 |
 Previous Article | Next Article 
The Journal of Neuroscience, August 1, 1999, 19(15):6519-6527
Cloning and Characterization of Neuropilin-1-Interacting
Protein: A PSD-95/Dlg/ZO-1 Domain-Containing Protein That
Interacts with the Cytoplasmic Domain of Neuropilin-1
Huaibin
Cai1, 2 and
Randall R.
Reed1, 2, 3
1 Howard Hughes Medical Institutes and Departments of
2 Neuroscience and 3 Molecular Biology and
Genetics, The Johns Hopkins University School of Medicine, Baltimore,
Maryland 21205
 |
ABSTRACT |
Neuropilin-1 (Npn-1), a receptor for semaphorin III, mediates the
guidance of growth cones on extending neurites. The molecular mechanism
of Npn-1 signaling remains unclear. We have used a yeast two-hybrid
system to isolate a protein that interacts with the cytoplasmic domain
of Npn-1. This Npn-1-interacting protein (NIP) contains a central
PSD-95/Dlg/ZO-1 (PDZ) domain and a C-terminal acyl carrier
protein domain. The physiological interaction of Npn-1 and NIP is
supported by co-immunoprecipitation of these two proteins in extracts
from a heterologous expression system and from a native tissue. The
C-terminal three amino acids of Npn-1 (S-E-A-COOH), which is conserved
from Xenopus to human, is responsible for interaction
with the PDZ domain-containing C-terminal two-thirds of NIP. NIP as
well as Npn-1 are broadly expressed in mice as assayed by Northern and
Western analysis. Immunohistochemistry and in situ
hybridization experiments revealed that NIP expression overlaps with
that of Npn-1. NIP has been independently cloned as
RGS-GAIP-interacting protein (GIPC), where it was identified by
virtue of its interaction with the C terminus of RGS-GAIP and
suggested to participate in clathrin-coated vesicular trafficking. We
suggest that NIP and GIPC may participate in regulation of
Npn-1-mediated signaling as a molecular adapter that couples Npn-1 to
membrane trafficking machinery in the dynamic axon growth cone.
Key words:
neuropilin-1; PDZ domain; axon guidance; yeast
two-hybrid; neuron development; adapter protein; signal
transduction
| |
INTRODUCTION |
Neurons rely on particular
combinations of guidance molecules to project their axons to target
cells (Tessier-Lavigne and Goodman, 1996 ). The detection and
transduction of these cues are mediated by receptors residing on growth
cones. Guidance ligand-receptor pairs mediating attractive and
repulsive responses have been identified (Luo et al., 1993; Keino-Masu
et al., 1996; Kolodkin and Ginty, 1997; Leonardo et al., 1997).
However, mechanisms responsible for converting these guidance signals
into changes within the growth cone remain unclear. Because the
cytoplasmic domains of the guidance receptors bear no close homology to
known functional motifs, the identification of proteins associated with
the cytoplasmic domains of these receptors will be important in
elucidating the cellular mechanism underlying the response of neurons
to guidance molecules.
The semaphorin family proteins share a 500-amino acid loosely conserved
region called the "sema" domain (Kolodkin et al., 1993).
Collapsin-1, the chicken homolog of semaphorin III, can induce the
collapse of growth cones in cultured neurons, suggesting that this
family of proteins serve an inhibitory or repulsive role in axon
guidance (Luo et al., 1993). Neuropilin-1 (Npn-1), a semaphorin III
receptor identified through expression cloning, binds semaphorin III
with high affinity. Moreover, antibodies directed against the
extracellular segment of Npn-1 blocked ligand-specific growth cone
collapse (He and Tessier-Lavigne, 1997; Kolodkin et al., 1997). Npn-1
was originally characterized as a cell surface molecule with a
restricted expression pattern in the optic tectum of Xenopus
(Takagi et al., 1991). The transmembrane and cytoplasmic domains of
this receptor share >90% amino acid identity across species (Takagi
et al., 1995; Kawakami et al., 1996). Consistent with the role of Npn-1
in axon guidance, overexpression of Npn-1 results in axonal
defasciculation and sprouting in embryonic mice (Kitsukawa et al.,
1995). Furthermore, growth cones of dorsal root ganglion (DRG) neurons
derived from Npn-1 null mutant mice fail to collapse after application
of semaphorin III (Kitsukawa et al., 1997). These data demonstrate that
Npn-1 is a receptor for semaphorin III.
The semaphorins and neuropilins contribute to the projection of
olfactory primary axons (Pasterkamp et al., 1998). Npn-1 is expressed
in olfactory epithelium from early embryonic stages through adulthood
(Kawakami et al., 1996), reflecting the capacity of this tissue to
regenerate throughout the animal's lifetime. Moreover, collapsin-1 can
induce the collapse of the growth cones of olfactory neurons (Kobayashi
et al., 1997). Using a yeast two-hybrid screen, we have identified and
characterized a protein, Npn-1-interacting protein (NIP) from olfactory
epithelium that interacts with the cytoplasmic domain of Npn-1. The
interaction is also supported by co-immunoprecipitation of Npn-1 and
NIP in extracts from a heterologous expression system and from a native
tissue. NIP is expressed in a variety of mouse tissues. In
situ hybridization and immunohistochemistry studies revealed that
NIP and Npn-1 are co-localized in developing nervous system. The
physical interaction and co-localization of NIP and Npn-1 suggest that
NIP functionally interacts with Npn-1. The identification of NIP will
allow further study of the Npn-1-mediated signaling events. Recently,
NIP was independently cloned as RGS-GAIP-interacting protein
(GIPC), which interacts with the C terminus of RGS-GAIP (a
G  3-associated protein located to the membrane of
clathrin-coated vesicles) (De Vries et al., 1998). GIPC and RGS-GAIP
may be involved in the regulation of vesicular trafficking by
association with the G-protein-coupled signaling complex. This leads to
the hypothesis that NIP and GIPC, as molecular adapters, may couple
Npn-1 to the membrane trafficking machinery in the dynamic axon growth cones.
| |
MATERIALS AND METHODS |
Isolation of the Npn-1 cytoplasmic domain. The
cytoplasmic domain of Npn-1 was obtained by RT-PCR amplification of RNA
from adult mouse olfactory epithelium. Total RNA was purified using RNAzolB (Tel-Test, Friendswood, TX), reverse-transcribed into first-strand cDNA with random hexamers and Moloney murine leukemia virus reverse transcriptase (Life Technologies, Gaithersburg, MD). The
forward primer (HC89: ACGCGTCAGCGATCTCCAGGAAGCCAGGC) and
reverse primer (HC94:
ATAAGAATGCGGCCGCTCACGCCTCTGAGTAATTAC) were used to
amplify the cytoplasmic domain of Npn-1. PCR products were digested
with NotI and SalI, subcloned into pPC97, and
verified by DNA sequencing.
Yeast two-hybrid screen. A yeast two-hybrid screen was
performed as described (Fields and Song, 1989) by using an
oligo-dT-primed cDNA library from adult rat olfactory epithelium (Wang
and Reed, 1993), (3.6 × 106 independent
clones) fused to the GAL4 transactivator domain in the prey vector
pPC86 (Chevray and Nathans, 1992). The fragment encoding the
cytoplasmic domain of Npn-1 was subcloned into the SalI-NotI sites of the bait vector pPC97. The
plasmids were co-transformed into yeast strain HF7c (Feilotter et al.,
1994), and positive clones were selected on triple-minus plates
(Leu , Trp,
His) and assayed for  -galactosidase activity.
Plasmids rescued from His+/-gal+ yeast were isolated
and sequenced. For protein-protein interaction assays, NIP clones were
co-transformed with either the cytoplasmic domain of Npn-1 or pPC97
empty vector into yeast. Yeast cells were assayed for -galactosidase
activity by immobilization on nitrocellulose filters, lysing the cells
by immersion in liquid nitrogen for 10 sec, placing them onto 3MM
papers presoaked in Z buffer (Miller, 1972), and incubation at 37°C
for 30 min.
cDNA library screen and 5' rapid amplification of cDNA ends.
DNA fragments from clone Y91 were 32P-labeled and used to
screen an oligo-dT-primed cDNA library from adult mouse olfactory
epithelium and an oligo-dT-primed  ZAP II mouse postnatal day 2-3
eye cDNA library. The 5' rapid amplification of cDNA ends (RACE)-PCR
was performed according to the manufacturer's instructions (Marathon
cDNA amplification kit; Clonetech, Palo Alto, CA).
Coimmunoprecipitation and expression construct. The Npn-1
( SEA) deletion construct was made by PCR amplification from
full-length Npn-1 cDNA in pCI-neo vector with an N-terminal Myc tag.
The full-length NIP cDNA was subcloned into pCIS with an N-terminal
10-amino acid hemagglutinin (HA) tag. HEK 293T cells were
co-transfected with NIP and Npn-1 constructs by using calcium
phosphate. After transfection (36-48 hr), cells were solubilized with
1% Triton X-100 in immunoprecipitation (IP) buffer (1× PBS, 5 mM EDTA, 5 mM EGTA, 0.1 mM PMSF,
and 10 U/ml Trasylol). The lysate was centrifuged at 14,000 rpm for 20 min at 4°C, precleared by incubating with CL-4B Sepharose beads (Pharmacia, Piscataway, NJ), and incubated with anti-NIP antibodies or
anti-myc antibodies at 4°C for 2 hr as indicated. The
immunoprecipitates were bound to protein A beads and washed twice with
IP buffer containing 1% Triton X-100, twice with IP buffer and 500 mM NaCl, and twice with IP buffer. Immunoprecipitated
proteins were eluted with SDS sample buffer, separated using SDS-PAGE,
transferred to polyvinylidene difluoride (PVDF), and subjected to
immunoblot analysis with antibodies to Myc tag and NIP protein.
Brain membrane preparation and coimmunoprecipitation.
Membrane preparations (P2) and solubilizations were performed according to published protocols (Luo et al., 1997), with modifications. Olfactory bulbs from postnatal day 2 CD-1 mice were homogenized twice
using a glass-Teflon homogenizer in the presence of protease inhibitors. After determining the protein concentration of the P2
fraction by Bradford assay (Bio-Rad, Hercules, CA; 500-0006), aliquots
of 300 µg of proteins were stored at  80°C until use. For
coimmunoprecipitation, an aliquot of P2 was solubilized by 1% NP-40
and centrifuged for 10 min at 100,000 × g. The
supernatant was then clarified by protein A-Sepharose beads.
Affinity-purified antibodies (~10 µg) were preincubated with 40 µl of 1:1 protein A-Sepharose slurry for 1 hr, and the protein
A-antibody complex was spun down at 2000 × g for 2 min and washed once with coimmunoprecipitation buffer (10 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% NP-40,
and protease inhibitors). The clarified P2 fractions were then added to
the antibody-conjugated Sepharose beads, and incubated for 2-3 hr at
4°C. After incubation, the mixture was washed once with
coimmunoprecipitation buffer, twice with Tris-buffered saline (TBS)
buffer containing 300 mM NaCl, and three times with TBS
buffer. The proteins were eluted by Laemmli sample buffer and subject
to Western analysis with an anti-Npn-1 antibody (Kolodkin et al.,
1997).
Antisera preparation. NIP anti-peptide and anti-fusion
protein antibodies against NIP were generated in rabbits (Covance
Research Products Inc., Denver, PA). A synthesized peptide
corresponding to the C-terminal 12 residues of mouse NIP protein was
coupled to bovine serum albumin using glutaraldehyde and used to make the anti-peptide antibody. The resulting antiserum was
affinity-purified on an immobilized peptide column. To generate the NIP
anti-fusion protein antiserum, a DNA fragment corresponding to the
residues from 210 to 311 of NIP was subcloned into pTrcHisA
(Invitrogen, San Diego, CA). The HIS6 fusion protein
purified by Ni-NTA (Qiagen, Hilden, Germany) chromatography was
used as antigen. The resulting antiserum was purified on a fusion
protein affinity column.
Western blot analysis of NIP protein. Whole tissue lysates
were prepared from postnatal day 2 mice by homogenization in PBS buffer
with 0.1 mM PMSF, 1% Triton X-100, and protease
inhibitors. The lysates were sonicated for 1 min and centrifuged at
14,000 rpm for 20 min at 4°C, and the supernatants were collected.
Protein concentrations were measured by Bradford assay (Bio-Rad
500-0006). Proteins (50 µg/lane) were separated using SDS-PAGE,
transferred to PVDF, and subjected to immunoblot analysis with anti-NIP antibodies.
Tissue preparation. CD-1 mouse embryos of embryonic days
12-16 (E12-E16) were immersion-fixed in freshly prepared 4%
paraformaldehyde in 1× PBS overnight at 4°C. Fixed embryos were
immersed in 30% sucrose in 1 ×PBS at 4°C overnight and embedded in
OCT (Tissue-Tek, Torrance, CA). Cryostat sections (10-14 µm) were
collected on Superfrost Plus (Fisher Scientific, Pittsburgh, PA) glass
slides. Adult mice or rats were anesthetized with pentobarbital and
perfused with ice-cold PBS, followed by Bouin's solution (Sigma, St.
Louis, MO). Tissues were harvested and post-fixed in the same fixative for 2 hr before immersion in 30% sucrose and 1× PBS at 4°C
overnight. Adult tissue sections were prepared as described above.
In situ hybridization. In situ hybridization was
performed on tissue sections with digoxigenin-labeled riboprobes as
previously described (Vassar et al., 1993).
Immunohistochemistry. Immunohistochemistry was performed on
embryonic mouse tissue sections as previously described (Davis and
Reed, 1996). Tissue sections were blocked by 10% normal goat serum in
TBST (100 mM Tris-HCl, pH 7.5, 150 mM NaCl, and
0.1% Tween 20), reacted with antisera specific for NIP or Npn-1
(Kolodkin et al., 1997), incubated with biotinylated anti-rabbit IgG
and avidin-biotin-horseradish peroxidase complex (Vectastain Elite ABC kit; Vector Laboratories, Burlingame, CA). Immunoreactivity was
visualized with diaminobenzidine.
| |
RESULTS |
Cloning and sequence analysis of a gene that interacts with the
cytoplasmic domain of Npn-1
The C-terminal 39 residues of Npn-1, predicted to comprise the
entire cytoplasmic domain, display >90% amino acid identity among
Xenopus, chick, mouse, rat, and human (Fig.
1). This suggests an important role for
this domain in Npn-1 function. A yeast two-hybrid screen was performed
to identify proteins interacting with the cytoplasmic domain of Npn-1.
The bait construct (pPC97-Nnp-1/C) contained a DNA fragment encoding
the 39 amino acid Npn-1 cytoplasmic domain (Npn-1/C) fused to a GAL4
DNA binding domain in the yeast expression vector pPC97. A cDNA
expression library from rat olfactory epithelium fused to the GAL4
transactivator domain in yeast expression vector pPC86 (Wang and Reed,
1993) was co-transformed with pPC97-Nnp-1/C into yeast strain HF7c.
From ~3 × 106 transformants, 28 clones
that were both HIS+ and
-galactosidase+ were identified, rescued from
yeast, and subjected to sequence analysis.
View larger version (34K):
[in this window]
[in a new window]
|
Figure 1.
Domain structure of Npn-1 and sequence alignment
of Npn-1 cytoplasmic domains. Npn-1s share ~70 and 90% amino acid
identities in the extracellular and cytoplasmic domains, respectively.
The amino acid sequences of cytoplasmic domains of Npn-1
(Xenopus, chick, mouse, rat, and human), and Npn-2a
(rat) are aligned, and the identical amino acids are shown in bold.
TM, Transmembrane domain, Cy, cytoplasmic
domain.
|
|
Sequence analysis revealed that the same gene was identified in 26 isolates representing eight independent overlapping cloning events. We
named this gene NIP as Npn-1-interacting protein. The longest of these
clones (Y16) encoded an open reading frame of 1645 bp fused in-frame to
the GAL4 transactivator domain. Further analysis demonstrated that a
protein motif resembling a PSD-95/Dlg/ZO-1 (PDZ) domain was
shared by all of these 26 clones. A 1675 bp cDNA clone (mNIP9) was
obtained by screening an oligo-dT-primed mouse olfactory epithelium
cDNA library by using Y16 as probe. The PCR products obtained from 5'
RACE failed to yield sequences further upstream of mNIP9. Northern blot
analysis of total RNA from adult mouse olfactory epithelium revealed a
1.7 kb band (data not shown). These results, together with Western blot
analysis of endogenous proteins and HEK 293T cells transiently
transfected with the isolated NIP cDNA (described below), suggest that
mNIP9 contains the entire coding region of NIP protein.
The conceptually translated 333-amino acid protein encoded by mNIP9
predicts a cytoplasmic protein containing a single PDZ domain between
amino acids 129 and 217. This domain includes residues that are
conserved among other PDZ domain family members and contribute to the
interaction with the C terminus of target proteins (Cabral et al.,
1996; Doyle et al., 1996). Previous yeast two-hybrid screens with
canonical PDZ binding sequences have resulted in the isolation of
multiple PDZ domain-containing clones. NIP was among the proteins identified in one such screen (Rousset et al., 1998). Recently, an
RGS-GAIP C terminus-interacting protein, GIPC, was identified by yeast
two-hybrid system that is identical to NIP (De Vries et al., 1998). The
NIP protein encodes an identified PDZ domain, several short consensus
sequences for protein phosporylation, and an acyl carrier protein
domain at the C terminus but no other extensive homologies to other proteins.
Defined regions of NIP and Npn-1 mediate the
NIP-Npn-1 interaction
The C-terminal three residues of Npn-1, S-E-A-COOH, resemble the
T/S-X-V-COOH motif that interacts with PDZ domains, with the exception
of a less hydrophobic terminal residue (Ala). To test whether Npn-1
interacts with NIP through the C terminus, a truncated form of Npn-1,
Npn-1/C (SEA), lacking the three terminal residues, was fused to the
GAL4 DNA binding domain in pPC97 for protein-protein interaction
assays in yeast. The pPC97-Npn-1/C and pPC97-Npn-1/C (SEA) plasmids
were co-transformed with full-length NIP/GAL4 transactivator domain,
and LEU+/TRP+ yeast colonies were
identified. The positive clones were subjected to a -galactosidase
activity assay and HIS+ selection. The deletion of
the C-terminal three amino acids of Npn-1 abolished the interaction
with NIP (Table 1).
View this table:
[in this window]
[in a new window]
|
Table 1.
Interaction of NIP with Npn-1 determined by filter assay of
-galactosidase activities and His+ selection
|
|
The presence of the PDZ domain in all of the NIP clones isolated from
the yeast two-hybrid screen implicated this domain in the interaction
with the C-terminal tail of Npn-1. To examine whether the NIP-PDZ
domain mediated the interaction with Npn-1, the PDZ domain [amino
acids 120-248, (NIP120-248)] was fused to the GAL4
transactivator domain. In parallel, other regions of the NIP protein
(NIP1-148, NIP221-333, and
NIP120-333) were also subcloned into pPC86. These
constructs were co-transformed with pPC97-Npn-1/C into yeast and
assayed for -galactosidase activity and HIS+
selection (Table 1). NIP120-248, the PDZ domain of NIP, displayed a weaker interaction with the Npn-1 C terminus than that of
full-length NIP. The C-terminal one-third of NIP,
NIP221-333, itself showed a very weak interaction with
Npn-1, whereas NIP120-333, which contains both the PDZ
domain and C terminus of NIP, displayed a binding affinity similar to
that of the full-length NIP construct. The N-terminal one-third of NIP
failed to interact with Npn-1. These observations suggest that the PDZ
domain and C-terminal one-third of NIP may function together in the
binding of the Npn-1 C-terminal tail.
Co-immunoprecipitation of Npn-1 and NIP from mammalian
cell lines
The interaction between NIP and Npn-1 was examined by
co-immunoprecipitation in a heterologous expression system. The
full-length NIP, full-length Npn-1, or both were transiently expressed
in HEK 293T cells. The HA-tagged NIP was specifically
immunoprecipitated in the presence of the N-terminal Myc-tagged Npn-1
and the anti-Myc antibody (Fig.
2A). Similarly, the
N-terminal Myc-tagged Npn-1 required the presence of NIP and the
anti-NIP peptide antibody (described below) for specific
immunoprecipitation (Fig. 2B). Deletion of the
C-terminal three residues of Npn-1 abolished its interaction with NIP,
although the expression level of truncated Npn-1 protein was comparable
with the full-length construct (Fig. 2B). These
co-immunoprecipitation assays further support the interaction between
NIP and Npn-1.
View larger version (27K):
[in this window]
[in a new window]
|
Figure 2.
Co-immunoprecipitation of NIP and Npn-1.
A, The full-length N-terminal Myc-tagged Npn-1 with or
without HA-tagged NIP were expressed in HEK 293T cells and
immunoprecipitated with an anti-Myc antibody. The anti-NIP antibody was
used to detect the NIP protein. In the bottom two
panels, aliquots of whole-cell extract were immunoblotted with
anti-Myc or anti-HA antibodies. Molecular size markers are indicated in
kilodaltons. B, HA-tagged NIP was co-expressed with
Myc-tagged full-length Npn-1 or mutated Npn-1 lacking the C-terminal
three residues in HEK 293T cells. Extracts were subjected to
immunoprecipitation with the anti-NIP peptide antibody or preimmune
serum. The resulting immunoprecipitates were probed with anti-Myc
antibody to detect Npn-1 and its mutant form. In the bottom two
panels, aliquots of total cell extracts were immunoblotted with
anti-Myc or anti-HA antibod ies to confirm the similar expression levels of the
constructs. C, NIP was immunoprecipitated from
solubilized olfactory bulb membrane extract (input) by using the NIP
peptide antibody and the resulting immunoprecipitates were probed with
a Npn-1 antibody. Npn-1 was co-immunoprecipitated with NIP. Preimmune
serum failed to immunoprecipitated Npn-1.
|
|
Interaction of Npn-1 and NIP in vivo
The interaction of Npn-1 with NIP was examined in vivo.
NIP was solubilized from postnatal day 2 mouse olfactory bulb membrane extract with 1% NP-40 and immunoprecipitated with the
affinity-purified NIP peptide antibody (described below). The resulting
complexes were then examined by Western blotting for the presence of
Npn-1. As shown in Figure 2C, Npn-1 co-immunoprecipitates
with NIP from solubilized olfactory bulb membrane extract. In control
experiments, preimmune serum did not precipitate Npn-1. These
experiments indicate that NIP interact with Npn-1 in vivo
and further suggest that NIP may mediate the regulation of Npn-1
signaling by directly interacting with the cytoplasmic domain of
Npn-1.
NIP expression in mouse tissues
To analyze the expression pattern of NIP, two antibodies were
generated against two nonoverlapping portions of NIP protein. An
anti-peptide antibody recognizing amino acids 321-333 of NIP and an
anti-fusion protein antibody against residues 171-320 of NIP were
generated, and each recognized a single 40 kDa protein in
NIP-transfected HEK 293T cells (data not shown) and in mouse olfactory
bulb cell lysate (Fig. 3A).
Using the anti-peptide antibody, the tissue distribution of NIP protein
in postnatal day 2 mice was examined (Fig. 3B). In agreement
with the tissue distribution of Npn-1 (Soker et al., 1998), NIP was
present in multiple neuronal and non-neuronal tissues. The higher
molecular weight bands seen in liver and lung were also observed with
the anti-fusion protein antibody and may reflect a splice variant. The
intense, low molecular weight protein detected in the eye was only
detected with the anti-peptide antibody and likely reflects
cross-reaction with lens crystalin protein that contains an amino acid
sequence similar to the peptide sequence used to generate the anti-NIP
antibody. The broad tissue distribution of NIP and Npn-1 is consistent
with the observations suggesting that Npn-1 may play additional
physiological roles outside of the nervous system (Kitsukawa et al.,
1995; Soker et al., 1998).
View larger version (32K):
[in this window]
[in a new window]
|
Figure 3.
Distribution of NIP protein in postnatal day 2 mouse tissues. A, The NIP anti-fusion protein and the
anti-peptide antibodies recognize a 40 kDa protein in the olfactory
bulb whole-cell lysate. Detection of the NIP protein by the
anti-peptide antibody was blocked by preincubation with specific
peptide. Preimmune serum failed to detect the NIP protein.
B, Immunoblot of 11 tissues revealed a broad tissue
distribution of NIP protein. Equal amounts of whole tissue lysates (50 µg of proteins) were separated by gel electorphoresis and probed with
the anti-peptide antibody.
|
|
NIP expression in developing CNS and PNS
Npn-1 is a receptor for semaphorin III, which mediates a repulsive
effect on growth cones of neurons from DRG, sympathetic ganglion,
olfactory epithelium, and additional cranial ganglions (Kawakami et
al., 1996). If NIP functionally interacts with Npn-1, one might expect
NIP and Npn-1 to colocalize in the same neurons and within the same
subcellular compartments. To determine the expression pattern of NIP,
in situ hybridization with digoxigenin-labeled NIP RNA
antisense probes and immunohistochemistry with anti-NIP antibodies were
performed on neuronal tissue sections derived from E14 mouse embryos.
In situ hybridization experiments revealed NIP mRNA
enrichment in both DRG and spinal cord neurons (Fig. 4A). Within the spinal
cord, NIP-reactive neurons were more numerous in the dorsal horn than
in the ventral horn. No signal was detected from the adjacent section
with the NIP sense probe (Fig. 4B).
View larger version (123K):
[in this window]
[in a new window]
|
Figure 4.
Expression of NIP mRNA in neurons of the embryonic
mouse spinal cord and DRG. NIP mRNA is expressed in neurons of the
dorsal and ventral spinal cord as well as DRG revealed by in
situ hybridization on a transverse spinal cord section of an
E14 embryo using digoxigenin-labeled NIP riboprobe
(A). The sense probe failed to detect any signals
in the adjacent section (B). DH,
Dorsal horn of spinal cord; VH, ventral horn of spinal
cord.
|
|
NIP protein is also detected in multiple areas in the developing brain
and sympathetic system. From horizontal sections of E14 mouse embryo,
NIP immunoreactivity was observed in the optic nerve (Fig.
5E) and in the olfactory nerve
bundles that terminate on the surface of the olfactory bulb (Fig.
5H). Staining with antibody against Npn-1 in the
adjacent sections revealed a similar expression pattern (Fig.
5D,G). In sagittal sections of E14 mouse embryo, Npn-1 and
NIP immunoreactivity also co-localized in superior cervical ganglion
(Fig. 5A,B) and other brain regions, including clusters of
neurons in the brainstem, trigeminal ganglion, and Rathke's pouch
(data not shown). Sections incubated with preimmune serum failed to
stain (Fig. 5C,F,I). The co-localization of NIP and
Npn-1 protein in developing nervous system further supports their
functional interaction and suggests a role for NIP in axon guidance.
View larger version (111K):
[in this window]
[in a new window]
|
Figure 5.
Expression of Npn-1 and NIP protein in the
embryonic mouse CNS and PNS. Both Npn-1 and NIP proteins are expressed
in E14 superior cervical ganglion neurons (SCG) (A, B),
the optic nerve (ON) (D, E), the
olfactory axon (AX) underneath the olfactory
epithelium (OE), and the olfactory nerve layer
(ONL) terminating at the surface of olfactory bulb
(OB) (G, H). The sections were
stained with anti-Npn-1 (A, D, G) and anti-NIP
(B, E, H) antibodies. Preimmune serum failed to
detect signals (C, F, I).
|
|
NIP expression in primary olfactory axon bundles and their
terminals of adult animals
Olfactory neurons undergo constant replacement throughout
embryonic and adult life. Olfactory neuronal differentiation and axon
outgrowth in the adult mimic many aspects of the processes observed
during embryonic development. Npn-1 mRNA (Kawakami et al., 1996) and
protein (Fig. 6A,C)
persist into adulthood in the olfactory system in contrast to its
downregulation in most other adult neuronal tissues. Consistent with
its initial isolation from adult olfactory epithelium, NIP is expressed
in the mature olfactory epithelium. The NIP immunoreactivity was
observed almost exclusively in the axon bundles that underlie the
olfactory epithelium (Fig. 6B) and in their terminal
processes forming the glomeruli of the olfactory bulb (Fig.
6D). Furthermore, the immunostaining of primary
olfactory axon bundles and their terminals is not homogeneous with
anti-NIP antibody (Fig. 6B,D) and with anti-Npn-1
antibody (Fig. 6A,C). The co-localization of Npn-1
and NIP proteins in the same subset of glomeruli revealed by
immunostaining of two adjacent olfactory bulb sections suggests these
two proteins may play important roles in the specific projection of
primary olfactory axons to the olfactory bulb (Fig.
6C,D).
View larger version (129K):
[in this window]
[in a new window]
|
Figure 6.
Heterogeneous expression of NIP and Npn-1 proteins
in the adult rat olfactory nerve bundles and terminals. Transverse
sections of adult rat olfactory epithelium and bulb were immunostained
with the anti-NIP and anti-Npn-1 antibodies. Npn-1 staining was
detected predominantly in the olfactory axon bundles
(AX) underneath the olfactory epithelium
(A) and also in the olfactory neuron layers
(ORL) and glomeruli (GLO)
(C), but not in the sustentacular cell layer
(SCL) and basal cell layer (BCL). NIP
staining was detected exclusively in the olfactory axon bundles
underneath the olfactory epithelium (B) and at
the surface of the olfactory bulb covered by olfactory nerve layer and
glomeruli (D). Both Npn-1 and NIP
immunoreactivities were detected in olfactory nerve terminals within
the same subset of glomeruli on two adjacent olfactory bulb sections
(C, D). Arrowheads point to the glomeruli
that show weaker staining with both anti-Npn-1 and anti-NIP antibodies
(C, D).
|
|
Both NIP and Npn-1 immunoreactivities were also detected in the adult
vomeronasal organ, and their axons terminated at the accessory
olfactory bulb (data not shown). In all cases, no staining was observed
from the adjacent section incubated with preimmune serum.
| |
DISCUSSION |
The potential role of NIP in Npn-1-mediated cellular responses
Npn-1 has a short, but conserved cytoplasmic domain, which shares
no homology with known protein motifs. How does Npn-1 transduce an
extracellular signal into the changes within the cells? Npn-1 must be
coupled with intracellular signaling molecules directly or through an
adapter protein. The extraordinary conservation of the cytoplamic
domain of the Npn-1 protein across species may suggest an important
role for this domain in terms of the Npn-1 functions. One isoform of
Npn-2 (a0) also shares the last three amino acids
with Npn-1 (Fig. 1). Considering Npn-1 and Npn-2 both mediate the same
process of axon growth cone collapse, it is attractive to think that
the C-terminal tails of these two proteins are involved in the same
intracellular signal transduction events. Alternatively, Npn-1 may
couple to intracellular signaling events through a co-receptor, like
KDR/Kit-1 (Soker et al., 1998). For example, a recent study has
shown that the ectodomains of Npn-1 linked by GPI to the cell surface
retains a functional response to semaphorin III in chicken retinal
ganglion cells (Nakamura et al., 1998). One key to distinguishing between these two hypotheses is to identify and characterize the proteins interacting with the cytoplasmic domain of Npn-1.
The interaction of NIP with the cytoplasmic domain of Npn-1, identified
through a yeast two-hybrid screen and confirmed by biochemical
interaction assays, makes this protein an attractive candidate for
serving an adapter function. One of the important roles of PDZ
domain-containing proteins is to act as molecular adapters that target
proteins to proper subcellular compartments or assemble signal
transduction components into closely associated protein complexes. In
transfected HEK 293T cells, neither the C-terminal three residues of
Npn-1 nor exogenous NIP are required for plasma membrane localization
of Npn-1 (data not shown). However, other models for the participation
of NIP in the regulation of Npn-1 signaling can be envisioned. For
example, NIP may function to block the interaction of Npn-1 with other
signal molecules through the C-terminal tail. A detailed understanding
of the dynamics of NIP interaction with Npn-1 and other proteins should
provide further knowledge about the molecular mechanism of
Npn-1-mediated physiological responses.
Collapsin-1- and semaphorin III-induced growth cone collapse is also
mediated by the heterotrimeric G-protein-coupled signal transduction
pathway (Goshima et al., 1995). Pertussis toxin-mediated ADP
ribosylation of the subunit of Go or Gi
classes of G-protein blocks collapsin-1-induced growth cone collapse in
DRG neurons. The collapsin-1 response mediator protein CRMP-62 (Goshima
et al., 1995) is an intracellular component of this G-protein-coupled signaling cascade and shares homology with the UNC33 gene that is
required for directed axon extension in Caenorhabditis
elegans. Introduction of CRMP-62 antibody into DRG neurons can
block the collapsin-1-induced growth cone collapse, although a
collapsin-1-specific G-protein-coupled receptor has not been
identified. Rac1, a ras-related monomeric
GTP-binding protein, is also implicated in the collapsin-1-induced growth cone collapse (Jin and Strittmatter, 1997). Rac1
appears to participate in pathways that modulate membrane ruffling and lamellipodia (Ridley et al., 1992), in agreement with the essential rearrangement of actin fibers during growth cone collapse. Recently, NIP was independently cloned as GIPC through its interaction with RGS-GAIP (De Vries et al., 1998). This study suggested that GIPC functions as a carrier for palmitoyl moieties for the palmitoylation of
RGS-GAIP and G subunits and may be involved in the regulation of
G-protein-mediated vesicle trafficking. It is attractive to speculate
that NIP links Npn-1 to G and other components in the G-protein-coupled signal transduction pathway participating in vesicle
trafficking and mediates membrane reconstruction during the dynamic
rearrangement of axon growth cones encountering repulsive cues.
The PDZ domain containing C-terminal two-thirds of NIP is
responsible for the interaction with the cytoplasmic domain of
Npn-1
PDZ domains participate in many important signaling pathways
(Kornau et al., 1997). Typically, PDZ domains recognize a short, T/S-X-V-COOH, consensus sequence (Songyang et al., 1997). PDZ domain-containing molecules serve to anchor proteins at specific subcellular locations and organize intracelluar signal transduction components. PSD-95, a component of postsynaptic densities, clusters glutamate receptors and K+ channels at synapses
through the specific interaction between individual PDZ domains and the
C termini of these two proteins (Sheng and Wyszynski, 1997; Craven and
Bredt, 1998). InaD, a scaffolding protein with five PDZ domains,
assembles the Drosophila phototransduction machinery
(Chevesich et al., 1997; Tsunoda et al., 1997). Mutation in a single
PDZ domain of InaD prevents the recruitment of particular components
into the signaling transduction complex and results in a corresponding
physiological defect.
The PDZ domain of NIP interacts with the last three amino acids of
Npn-1. However, in the -galactosidase filter assay, the NIP-PDZ
domain alone displayed a weaker interaction with Npn-1 than that of the
C-terminal two-thirds of NIP, which contains both the PDZ domain and
the remaining C-terminal of NIP. This could result from instability or
improper folding of the NIP-PDZ domain fusion protein in the yeast or
from the less hydrophobic alanine at the C-terminal tip of Npn-1.
Mutation of the canonical PDZ recognition site by introduction of a
terminal alanine has been reported to result in disruption of the
interaction with PDZ domains (Songyang et al., 1997; Rousset et al.,
1998). The C-terminal one-third of NIP also displayed a very weak
binding to Npn-1, consistent with a second binding site in NIP that
recognized the cytoplasmic domain of Npn-1. Based on these
observations, the interaction of NIP with the cytoplasmic domain of
Npn-1 is mediated by the entire C-terminal two-thirds of the NIP protein.
The NIP-mediated interaction described here occurs with the isolated
cytoplasmic domain of the Npn-1 receptor and is therefore semaphorin
III-independent. NIP could function positively to link Npn-1 with
signaling molecules or the cytoskeleton. Alternatively, NIP could act
as an inhibitory protein to mask critical regions of Npn-1 for the
interacting with other signaling molecules in the absence of
semaphorins. The modulation of NIP and Npn-1 interaction by semaphorin
in vivo may provide clues regarding the physiological function of NIP in Npn-1-mediated responses.
The expression of NIP overlaps with that of Npn-1
During development, the expression of NIP in CNS and PNS neurons
coincides with their time of axonal outgrowth. In the CNS of E14 mice,
NIP is expressed in the olfactory and optic nerves, spinal cord,
several neuron clusters in the brain stem (data not shown), and the
intermediate zone of cortex (data not shown), a pattern nearly
identical to that of Npn-1 (Kawakami et al., 1996). Interestingly, in
E14 mouse spinal cord, Npn-1 is restricted to the dorsal horn, whereas
Npn-2 is expressed in the ventral half of spinal cord (Chen et al.,
1997). In light of the homology shared by the C-terminal tail of Npn-1
and Npn-2 (a0), particularly the identity of the
last three residues (S-E-A-COOH) critical for NIP/Npn-1 interaction, we
predict that NIP could also interact with cytoplasmic tail of Npn-2
(a0). The presence of NIP throughout the spinal cord
at this stage revealed by both in situ hybridization (Fig.
4A) and immunostaining (data not shown) may suggest
that this protein may interact with both of these receptor molecules.
Npn-1 displays a temporally restricted pattern of expression in the
optic nerve (Kawakami et al., 1996). Npn-1 and NIP are present in the
retina of E14 mouse embryos (Fig. 5D,E), but this expression
disappears in the adult optic nerve (data not shown). In contrast, NIP
and Npn-1 are localized to axon bundles in adult olfactory tissue.
Olfactory neurons undergo constant replacement throughout adult life
and project new axons to specific target glomeruli in the olfactory
bulb. The ability of semaphorin III and collapsin I to disrupt growth
cones of olfactory axons (Kobayashi et al., 1997) and especially the
colocalization of NIP and Npn-1 in subset of these axons strongly
suggests a functional role for this complex in olfactory axon guidance.
Similarly, in the PNS, both NIP and Npn-1 are expressed by neurons in
the developing DRG and superior cervical ganglion. These neurons are
also targets of semaphorin III- and collapsin-1-mediated axon growth
cone collapse.
The extensive overlapping of NIP and Npn-1 expression patterns, their
co-localization to primary olfactory axon terminals, and their
biochemical interaction both in the mammalian cell line and in
vivo provide evidence that NIP acts as an immediate downstream component in Npn-1-mediated functions.
| |
FOOTNOTES |
Received Feb. 24, 1999; revised May 13, 1999; accepted May 18, 1999.
This work was supported by the Howard Hughes Medical Institutes. We
thank Drs. Alex Kolodkin and David Ginty for helpful discussions of
this project and generously providing the anti-Npn-1 antibodies. We are
also in debt to Jun Xia and Jun Lai for technical support and Drs.
Haiqing Zhao, Song Wang, and Steve Munger for suggestions on this manuscript.
Correspondence should be addressed to Randall R. Reed, 818 PCTB, 725 North Wolfe Street, Baltimore, MD 21205.
| |
REFERENCES |
-
Cabral JH,
Petosa C,
Sutcliffe MJ,
Raza S,
Byron O,
Poy F,
Marfatia SM,
Chishti AH,
Liddington RC
(1996)
Crystal structure of a PDZ domain.
Nature
382:649-652[Medline].
-
Chen H,
Chedotal A,
He Z,
Goodman CS,
Tessier-Lavigne M
(1997)
Neuropilin-2, a novel member of the neuropilin family, is a high affinity receptor for the semaphorins Sema E and Sema IV but not Sema III.
Neuron
19:547-559[Web of Science][Medline].
-
Chevesich J,
Kreuz AJ,
Montell C
(1997)
Requirement for the PDZ domain protein, INAD, for localization of the TRP store-operated channel to a signaling complex.
Neuron
18:95-105[Web of Science][Medline].
-
Chevray PM,
Nathans D
(1992)
Protein interaction cloning in yeast: identification of mammalian proteins that react with the leucine zipper of Jun.
Proc Natl Acad Sci USA
89:5789-5793[Abstract/Free Full Text].
-
Craven SE,
Bredt DS
(1998)
PDZ proteins organize synaptic signaling pathways.
Cell
93:495-498[Web of Science][Medline].
-
Davis JA,
Reed RR
(1996)
Role of Olf-1 and Pax-6 transcription factors in neurodevelopment.
J Neurosci
16:5082-5094[Abstract/Free Full Text].
-
De Vries L,
Lou X,
Zhao G,
Zheng B,
Farquhar MG
(1998)
GIPC, a PDZ domain containing protein, interacts specifically with the C terminus of RGS-GAIP.
Proc Natl Acad Sci USA
95:12340-12345[Abstract/Free Full Text].
-
Doyle DA,
Lee A,
Lewis J,
Kim E,
Sheng M,
MacKinnon R
(1996)
Crystal structures of a complexed and peptide-free membrane protein-binding domain: molecular basis of peptide recognition by PDZ.
Cell
85:1067-1076[Web of Science][Medline].
-
Feilotter HE,
Hannon GJ,
Ruddell CJ,
Beach D
(1994)
Construction of an improved host strain for two hybrid screening.
Nucleic Acids Res
22:1502-1503[Free Full Text].
-
Fields S,
Song O
(1989)
A novel genetic system to detect protein-protein interactions.
Nature
340:245-246[Medline].
-
Goshima Y,
Nakamura F,
Strittmatter P,
Strittmatter SM
(1995)
Collapsin-induced growth cone collapse mediated by an intracellular protein related to UNC-33.
Nature
376:509-514[Medline].
-
He Z,
Tessier-Lavigne M
(1997)
Neuropilin is a receptor for the axonal chemorepellent Semaphorin III.
Cell
90:739-751[Web of Science][Medline].
-
Jin Z,
Strittmatter SM
(1997)
Rac1 mediates collapsin-1-induced growth cone collapse.
J Neurosci
17:6256-6263[Abstract/Free Full Text].
-
Kawakami A,
Kitsukawa T,
Takagi S,
Fujisawa H
(1996)
Developmentally regulated expression of a cell surface protein, neuropilin, in the mouse nervous system.
J Neurobiol
29:1-17[Web of Science][Medline].
-
Keino-Masu K,
Masu M,
Hinck L,
Leonardo ED,
Chan SS,
Culotti JG,
Tessier-Lavigne M
(1996)
Deleted in Colorectal Cancer (DCC) encodes a netrin receptor.
Cell
87:175-185[Web of Science][Medline].
-
Kennedy TE,
Serafini T,
de la Torre JR,
Tessier-Lavigne M
(1994)
Netrins are diffusible chemotropic factors for commissural axons in the embryonic spinal cord.
Cell
78:425-435[Web of Science][Medline].
-
Kitsukawa T,
Shimono A,
Kawakami A,
Kondoh H,
Fujisawa H
(1995)
Overexpression of a membrane protein, neuropilin, in chimeric mice causes anomalies in the cardiovascular system, nervous system and limbs.
Development
121:4309-4318[Abstract].
-
Kitsukawa T,
Shimizu M,
Sanbo M,
Hirata T,
Taniguchi M,
Bekku Y,
Yagi T,
Fujisawa H
(1997)
Neuropilin-semaphorin III/D-mediated chemorepulsive signals play a crucial role in peripheral nerve projection in mice.
Neuron
19:995-1005[Web of Science][Medline].
-
Kobayashi H,
Koppel AM,
Luo Y,
Raper JA
(1997)
A role for collapsin-1 in olfactory and cranial sensory axon guidance.
J Neurosci
17:8339-8352[Abstract/Free Full Text].
-
Kolodkin AL,
Ginty DD
(1997)
Steering clear of semaphorins: neuropilins sound the retreat.
Neuron
19:1159-1162[Web of Science][Medline].
-
Kolodkin AL,
Matthes DJ,
Goodman CS
(1993)
The semaphorin genes encode a family of transmembrane and secreted growth cone guidance molecules.
Cell
75:1389-1399[Web of Science][Medline].
-
Kolodkin AL,
Levengood DV,
Rowe EG,
Tai YT,
Giger RJ,
Ginty DD
(1997)
Neuropilin is a semaphorin III receptor.
Cell
90:753-762[Web of Science][Medline].
-
Kornau HC,
Seeburg PH,
Kennedy MB
(1997)
Interaction of ion channels and receptors with PDZ domain proteins.
Curr Opin Neurobiol
7:368-373[Web of Science][Medline].
-
Leonardo ED,
Hinck L,
Masu M,
Keino-Masu K,
Ackerman SL,
Tessier-Lavigne M
(1997)
Vertebrate homologues of C. elegans UNC-5 are candidate netrin receptors.
Nature
386:833-838[Medline].
-
Luo Y,
Raible D,
Raper JA
(1993)
Collapsin: a protein in brain that induces the collapse and paralysis of neuronal growth cones.
Cell
75:217-227[Web of Science][Medline].
-
Luo J,
Wang Y,
Yasuda RP,
Dunah AW,
Wolfe BB
(1997)
The majority of N-methyl-D-aspartate receptor complexes in adult rat cerebral cortex contain at least three different subunits (NR1/NR2A/NR2B).
Mol Pharmacol
51:79-86[Abstract/Free Full Text].
-
Miller JH
(1972)
In: Experiments in molecular genetics. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
-
Nakamura F,
Tanaka M,
Takahashi T,
Kalb RG,
Strittmatter SM
(1998)
Neuropilin-1 extracellular domains mediate semaphorin D/III-induced growth cone collapse.
Neuron
21:1093-1100[Web of Science][Medline].
-
Pasterkamp RJ,
De Winter F,
Holtmaat A,
Verhaagen J
(1998)
Evidence for a role of the chemorepellent semaphorin III and its receptor neuropilin-1 in the regeneration of primary olfactory axons.
J Neurosci
18:9962-9976[Abstract/Free Full Text].
-
Ridley AJ,
Paterson HF,
Johnston CL,
Diekmann D,
Hall A
(1992)
The small GTP-binding protein rac regulates growth factor-induced membrane ruffling.
Cell
70:401-410[Web of Science][Medline].
-
Rousset R,
Fabre S,
Desbois C,
Bantignies F,
Jalinot P
(1998)
The C-terminus of the HTLV-1 Tax oncoprotein mediates interaction with the PDZ domain of cellular proteins.
Oncogene
16:643-654[Medline].
-
Sheng M,
Wyszynski M
(1997)
Ion channel targeting in neurons.
Bioessays
19:847-853[Web of Science][Medline].
-
Soker S,
Takashima S,
Miao HQ,
Neufeld G,
Klagsbrun M
(1998)
Neuropilin-1 is expressed by endothelial and tumor cells as an isoform-specific receptor for vascular endothelial growth factor.
Cell
92:735-745[Web of Science][Medline].
-
Songyang Z,
Fanning AS,
Fu C,
Xu J,
Marfatia SM,
Chishti AH,
Crompton A,
Chan AC,
Anderson JM,
Cantley LC
(1997)
Recognition of unique carboxyl-terminal motifs by distinct PDZ domains.
Science
275:73-77[Abstract/Free Full Text].
-
Takagi S,
Hirata T,
Agata K,
Mochii M,
Eguchi G,
Fujisawa H
(1991)
The A5 antigen, a candidate for the neuronal recognition molecule, has homologies to complement components and coagulation factors.
Neuron
7:295-307[Web of Science][Medline].
-
Takagi S,
Kasuya Y,
Shimizu M,
Matsuura T,
Tsuboi M,
Kawakami A,
Fujisawa H
(1995)
Expression of a cell adhesion molecule, neuropilin, in the developing chick nervous system.
Dev Biol
170:207-222[Web of Science][Medline].
-
Tessier-Lavigne M,
Goodman CS
(1996)
The molecular biology of axon guidance.
Science
274:1123-1133[Abstract/Free Full Text].
-
Tsunoda S,
Sierralta J,
Sun Y,
Bodner R,
Suzuki E,
Becker A,
Socolich M,
Zuker CS
(1997)
A multivalent PDZ-domain protein assembles signalling complexes in a G-protein-coupled cascade.
Nature
388:243-249[Medline].
-
Vassar R,
Ngai J,
Axel R
(1993)
Spatial segregation of odorant receptor expression in the mammalian olfactory epithelium.
Cell
74:309-318[Web of Science][Medline].
-
Wang MM,
Reed RR
(1993)
Molecular cloning of the olfactory neuronal transcription factor Olf-1 by genetic selection in yeast.
Nature
364:121-126[Medline].
Copyright © 1999 Society for Neuroscience 0270-6474/99/19156519-09$05.00/0
This article has been cited by other articles:
|
|
|
|
 
P. Gaur, D. R. Bielenberg, S. Samuel, D. Bose, Y. Zhou, M. J. Gray, N. A. Dallas, F. Fan, L. Xia, J. Lu, et al.
Role of Class 3 Semaphorins and Their Receptors in Tumor Growth and Angiogenesis
Clin. Cancer Res.,
November 15, 2009;
15(22):
6763 - 6770.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Ruiz de Almodovar, D. Lambrechts, M. Mazzone, and P. Carmeliet
Role and Therapeutic Potential of VEGF in the Nervous System
Physiol Rev,
April 1, 2009;
89(2):
607 - 648.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Larrivee, C. Freitas, S. Suchting, I. Brunet, and A. Eichmann
Guidance of Vascular Development: Lessons From the Nervous System
Circ. Res.,
February 27, 2009;
104(4):
428 - 441.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. A. Dallas, M. J. Gray, L. Xia, F. Fan, G. van Buren II, P. Gaur, S. Samuel, S. J. Lim, T. Arumugam, V. Ramachandran, et al.
Neuropilin-2-Mediated Tumor Growth and Angiogenesis in Pancreatic Adenocarcinoma
Clin. Cancer Res.,
December 15, 2008;
14(24):
8052 - 8060.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Kawamura, X. Li, K. Goishi, L. A. van Meeteren, L. Jakobsson, S. Cebe-Suarez, A. Shimizu, D. Edholm, K. Ballmer-Hofer, L. Kjellen, et al.
Neuropilin-1 in regulation of VEGF-induced activation of p38MAPK and endothelial cell organization
Blood,
November 1, 2008;
112(9):
3638 - 3649.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Prahst, M. Heroult, A. A. Lanahan, N. Uziel, O. Kessler, N. Shraga-Heled, M. Simons, G. Neufeld, and H. G. Augustin
Neuropilin-1-VEGFR-2 Complexing Requires the PDZ-binding Domain of Neuropilin-1
J. Biol. Chem.,
September 12, 2008;
283(37):
25110 - 25114.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Salikhova, L. Wang, A. A. Lanahan, M. Liu, M. Simons, W. P. J. Leenders, D. Mukhopadhyay, and A. Horowitz
Vascular Endothelial Growth Factor and Semaphorin Induce Neuropilin-1 Endocytosis via Separate Pathways
Circ. Res.,
September 12, 2008;
103(6):
e71 - e79.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Walz, P. Feinstein, M. Khan, and P. Mombaerts
Axonal wiring of guanylate cyclase-D-expressing olfactory neurons is dependent on neuropilin 2 and semaphorin 3F
Development,
November 15, 2007;
134(22):
4063 - 4072.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Z. Yi, R. S. Petralia, Z. Fu, C. C. Swanwick, Y.-X. Wang, K. Prybylowski, N. Sans, S. Vicini, and R. J. Wenthold
The Role of the PDZ Protein GIPC in Regulating NMDA Receptor Trafficking
J. Neurosci.,
October 24, 2007;
27(43):
11663 - 11675.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. W. Vander Kooi, M. A. Jusino, B. Perman, D. B. Neau, H. D. Bellamy, and D. J. Leahy
Structural basis for ligand and heparin binding to neuropilin B domains
PNAS,
April 10, 2007;
104(15):
6152 - 6157.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. A. Lanahan, T. W. Chittenden, E. Mulvihill, K. Smith, S. Schwartz, and M. Simons
Synectin-dependent gene expression in endothelial cells
Physiol Genomics,
November 21, 2006;
27(3):
380 - 390.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Lai, C. Xie, S. G. McCormack, H.-C. Chiang, M. K. Michalak, X. Lin, J. Chandran, H. Shim, M. Shimoji, M. R. Cookson, et al.
Amyotrophic Lateral Sclerosis 2-Deficiency Leads to Neuronal Degeneration in Amyotrophic Lateral Sclerosis through Altered AMPA Receptor Trafficking.
J. Neurosci.,
November 8, 2006;
26(45):
11798 - 11806.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Wu, M. O'Donnell, A. D. Gitler, and P. S. Klein
Kermit 2/XGIPC, an IGF1 receptor interacting protein, is required for IGF signaling in Xenopus eye development
Development,
September 15, 2006;
133(18):
3651 - 3660.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. N. Naccache, T. Hasson, and A. Horowitz
Binding of internalized receptors to the PDZ domain of GIPC/synectin recruits myosin VI to endocytic vesicles
PNAS,
August 22, 2006;
103(34):
12735 - 12740.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Ghez, Y. Lepelletier, S. Lambert, J.-M. Fourneau, V. Blot, S. Janvier, B. Arnulf, P. M. van Endert, N. Heveker, C. Pique, et al.
Neuropilin-1 Is Involved in Human T-Cell Lymphotropic Virus Type 1 Entry
J. Virol.,
July 15, 2006;
80(14):
6844 - 6854.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Wang, D. Mukhopadhyay, and X. Xu
C terminus of RGS-GAIP-interacting protein conveys neuropilin-1-mediated signaling during angiogenesis
FASEB J,
July 1, 2006;
20(9):
1513 - 1515.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Fu, X. Huang, H. Zhong, R. M. Mortensen, L. G. D'Alecy, and R. R. Neubig
Endogenous RGS Proteins and G{alpha} Subtypes Differentially Control Muscarinic and Adenosine-Mediated Chronotropic Effects
Circ. Res.,
March 17, 2006;
98(5):
659 - 666.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. C. Reed, C. Cefalu, B. H. Bellaire, J. A. Cardelli, T. Louis, J. Salamon, M. A. Bloecher, and R. C. Bunn
GLUT1CBP(TIP2/GIPC1) Interactions with GLUT1 and Myosin VI: Evidence Supporting an Adapter Function for GLUT1CBP
Mol. Biol. Cell,
September 1, 2005;
16(9):
4183 - 4201.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Favre-Bonvin, C. Reynaud, C. Kretz-Remy, and P. Jalinot
Human Papillomavirus Type 18 E6 Protein Binds the Cellular PDZ Protein TIP-2/GIPC, Which Is Involved in Transforming Growth Factor {beta} Signaling and Triggers Its Degradation by the Proteasome
J. Virol.,
April 1, 2005;
79(7):
4229 - 4237.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Hoeben, B. Landuyt, M. S. Highley, H. Wildiers, A. T. Van Oosterom, and E. A. De Bruijn
Vascular Endothelial Growth Factor and Angiogenesis
Pharmacol. Rev.,
December 1, 2004;
56(4):
549 - 580.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Cheng, H. Jia, M. Lohr, A. Bagherzadeh, D. I. R. Holmes, D. Selwood, and I. Zachary
Anti-chemorepulsive Effects of Vascular Endothelial Growth Factor and Placental Growth Factor-2 in Dorsal Root Ganglion Neurons Are Mediated via Neuropilin-1 and Cyclooxygenase-derived Prostanoid Production
J. Biol. Chem.,
July 16, 2004;
279(29):
30654 - 30661.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Jeanneteau, J. Diaz, P. Sokoloff, and N. Griffon
Interactions of GIPC with Dopamine D2, D3 but not D4 Receptors Define a Novel Mode of Regulation of G Protein-coupled Receptors
Mol. Biol. Cell,
February 1, 2004;
15(2):
696 - 705.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Wang, H. Zeng, P. Wang, S. Soker, and D. Mukhopadhyay
Neuropilin-1-mediated Vascular Permeability Factor/Vascular Endothelial Growth Factor-dependent Endothelial Cell Migration
J. Biol. Chem.,
December 5, 2003;
278(49):
48848 - 48860.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Hirakawa, C. Galet, M. Kishi, and M. Ascoli
GIPC Binds to the Human Lutropin Receptor (hLHR) through an Unusual PDZ Domain Binding Motif, and It Regulates the Sorting of the Internalized Human Choriogonadotropin and the Density of Cell Surface hLHR
J. Biol. Chem.,
December 5, 2003;
278(49):
49348 - 49357.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Hasson
Myosin VI: two distinct roles in endocytosis
J. Cell Sci.,
September 1, 2003;
116(17):
3453 - 3461.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. K. Atwal, K. K. Singh, M. Tessier-Lavigne, F. D. Miller, and D. R. Kaplan
Semaphorin 3F Antagonizes Neurotrophin-Induced Phosphatidylinositol 3-Kinase and Mitogen-Activated Protein Kinase Kinase Signaling: A Mechanism for Growth Cone Collapse
J. Neurosci.,
August 20, 2003;
23(20):
7602 - 7609.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. A. Hu, W. Chen, N. P. Martin, E. J. Whalen, R. T. Premont, and R. J. Lefkowitz
GIPC Interacts with the {beta}1-Adrenergic Receptor and Regulates {beta}1-Adrenergic Receptor-mediated ERK Activation
J. Biol. Chem.,
July 3, 2003;
278(28):
26295 - 26301.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Hollinger and J. R. Hepler
Cellular Regulation of RGS Proteins: Modulators and Integrators of G Protein Signaling
Pharmacol. Rev.,
September 1, 2002;
54(3):
527 - 559.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
X. Lou, T. McQuistan, R. A. Orlando, and M. G. Farquhar
GAIP, GIPC and G{alpha}i3 are Concentrated in Endocytic Compartments of Proximal Tubule Cells: Putative Role in Regulating Megalin's Function
J. Am. Soc. Nephrol.,
April 1, 2002;
13(4):
918 - 927.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. C. Blobe, X. Liu, S. J. Fang, T. How, and H. F. Lodish
A Novel Mechanism for Regulating Transforming Growth Factor beta (TGF-beta ) Signaling. FUNCTIONAL MODULATION OF TYPE III TGF-beta RECEPTOR EXPRESSION THROUGH INTERACTION WITH THE PDZ DOMAIN PROTEIN, GIPC
J. Biol. Chem.,
October 19, 2001;
276(43):
39608 - 39617.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Tan, M. A. Deardorff, J.-P. Saint-Jeannet, J. Yang, A. Arzoumanian, and P. S. Klein
Kermit, a frizzled interacting protein, regulates frizzled 3 signaling in neural crest development
Development,
October 1, 2001;
128(19):
3665 - 3674.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
X. Lou, H. Yano, F. Lee, M. V. Chao, and M. G. Farquhar
GIPC and GAIP Form a Complex with TrkA: A Putative Link between G Protein and Receptor Tyrosine Kinase Pathways
Mol. Biol. Cell,
March 1, 2001;
12(3):
615 - 627.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
K. Pavelock, K. M. Braas, L'H. Ouafik, G. Osol, and V. May
Differential Expression and Regulation of the Vascular Endothelial Growth Factor Receptors Neuropilin-1 and Neuropilin-2 in Rat Uterus
Endocrinology,
February 1, 2001;
142(2):
613 - 622.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Robinson and S. Stringer
The splice variants of vascular endothelial growth factor (VEGF) and their receptors
J. Cell Sci.,
January 3, 2001;
114(5):
853 - 865.
[Abstract]
[PDF]
|
|
|
|
|
|
|
G. Fuh, K. C. Garcia, and A. M. de Vos
The Interaction of Neuropilin-1 with Vascular Endothelial Growth Factor and Its Receptor Flt-1
J. Biol. Chem.,
August 25, 2000;
275(35):
26690 - 26695.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Inagaki, Y. Ohoka, H. Sugimoto, S. Fujioka, M. Amazaki, H. Kurinami, N. Miyazaki, M. Tohyama, and T. Furuyama
Sema4C, a Transmembrane Semaphorin, Interacts with a Post-synaptic Density Protein, PSD-95
J. Biol. Chem.,
March 16, 2001;
276(12):
9174 - 9181.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. B. Whitaker, B. J. Limberg, and J. S. Rosenbaum
Vascular Endothelial Growth Factor Receptor-2 and Neuropilin-1 Form a Receptor Complex That Is Responsible for the Differential Signaling Potency of VEGF165 and VEGF121
J. Biol. Chem.,
June 29, 2001;
276(27):
25520 - 25531.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Ligensa, S. Krauss, D. Demuth, R. Schumacher, J. Camonis, G. Jaques, and K. M. Weidner
A PDZ Domain Protein Interacts with the C-terminal Tail of the Insulin-like Growth Factor-1 Receptor but Not with the Insulin Receptor
J. Biol. Chem.,
August 31, 2001;
276(36):
33419 - 33427.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Z. Gluzman-Poltorak, T. Cohen, Y. Herzog, and G. Neufeld
Neuropilin-2 and Neuropilin-1 Are Receptors for the 165-Amino Acid Form of Vascular Endothelial Growth Factor (VEGF) and of Placenta Growth Factor-2, but Only Neuropilin-2 Functions as a Receptor for the 145-Amino Acid Form of VEGF
J. Biol. Chem.,
June 9, 2000;
275(24):
18040 - 18045.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION
