 |
Previous Article | Next Article 
The Journal of Neuroscience, August 15, 1999, 19(16):6874-6886
Subfamily-Specific Posttranscriptional Mechanism Underlies
K+ Channel Expression in a Developing Neuronal
Blastomere
Fumihito
Ono1, 2,
You
Katsuyama1,
Kouichi
Nakajo3, and
Yasushi
Okamura1, 3, 4
1 Ion Channel Group, Biomolecular Engineering
Department, National Institute of Bioscience and Human Technology,
Tsukuba, Ibaraki 305-8566, Japan, 2 Department of Medical
Physiology, Meiji College of Pharmacy, Kiyose 204-8588, Tokyo, Japan,
3 Department of Life Sciences, Graduate School of Arts and
Sciences, University of Tokyo, Meguro-ku, Tokyo 153-0041, Japan, and
4 Intelligence and Synthesis, Precursory Research for
Embryonic Science and Technology, Japan Science and Technology
Corporation
 |
ABSTRACT |
Na+ and K+ channels are the
two key proteins that shape the action potentials in neurons. However,
little is known about how the expression of these two channels is
coordinated. To address this issue, we cloned a
Shab-related K+ channel gene from
ascidian Halocynthia roretzi (TuKv2). In this animal, a
blastomere of neuronal lineage isolated from the 8-cell embryo
expresses single Na+ channel and
K+ channel genes after neural induction. Expression
of a dominant negative form of TuKv2 eliminated the native delayed
rectifier K+ currents, indicating that the entire
delayed rectifier K+ current of the neuronal
blastomere is exclusively encoded by TuKv2. TuKv2 transcripts are
expressed more broadly than Na+ channel transcripts,
which are restricted to the neuronal lineages. There is also a temporal
mismatch in the expression of TuKv2 transcript and the
K+ current; TuKv2 transcripts are present throughout
development, whereas delayed rectifier K+ currents
only appear after the tailbud stage, suggesting that the functional
expression of the TuKv2 transcript is suppressed during the early
embryonic stages.
To test if this suppression occurs by a mechanism specific to the TuKv2
channel protein, an ascidian Shaker-related gene, TuKv1,
was misexpressed in neural blastomeres. A TuKv1-encoded current was
expressed earlier than the TuKv2 current. Furthermore, the introduction
of the TuKv2-expressing plasmid into noninduced cells did not lead to
the current expression. These results raise the possibility that the
expression of TuKv2 is post-transcriptionally controlled through a
mechanism that is dependent on neural induction.
Key words:
potassium channel; ascidian; gene expression; dominant negative; sodium channel; neuronal differentiation; post-transcriptional regulation
 |
INTRODUCTION |
From jellyfish to mammals,
voltage-gated K+ and
Na+ channels play principal roles in
determining the properties of neuronal action potentials (Hille, 1992 ).
As a neuron matures, the shape of the action potential becomes sharper
because of changes in the relative densities of the two channel types.
This suggests that the expression of K+
and Na+ channels is coregulated in
developing neurons. The mechanism of coordinated expression of the
Na+ and K+
channels, however, is difficult to address in higher vertebrates, because it requires isolation of ionic currents encoded by each channel
gene expressed in the particular neurons. Cloned genes for ion channels
are usually studied in heterologous systems, but currents expressed
heterologously often have functional properties different from those
observed in native environments (McManus et al., 1995 ). Furthermore,
both Na+ and
K+ channels form large multigene families,
and multiple splice variants are often generated from one gene (Pongs,
1992 ). Several molecular species of Na+
and K+ channels commonly exist in one
single neuron (Tsunoda and Salkoff, 1995b ; Gurantz et al., 1996 ;
Ribera, 1996 ). The difficulty in identifying the precursors of a
particular neuron also hinders the developmental studies of specific
channel species in native cells.
Ascidians (also called tunicates) are protochordates, close ancestors
to the vertebrates (Conklin, 1905 ). The ascidian embryos offer an
excellent system to study the regulation of voltage-gated ion channels
during embryogenesis, because of their simple composition of channel
species and stereotyped course of differentiation (Takahashi and
Okamura, 1998 ). Neuronal differentiation occurs in a short time in this
animal. Isolated ascidian blastomeres of specific cell fates are
amenable to electrophysiological studies (Okado and Takahashi, 1990 ).
Therefore, expressions of ion channels in individual cells can be
traced during neural differentiation (Okamura and Takahashi, 1993 ;
Takahashi and Okamura, 1998 ). We previously showed that a single
Na+ channel gene, TuNaI, accounts for the
entire Na+ current in the neuronal
blastomere, a4.2 (Okamura and Shidara, 1990 ; Okamura et al.,
1994 ). The transcription of TuNaI is dependent on a cell-specific
contact before the neural tube formation (Okamura et al., 1994 ). This
raises the possibility that Na+ and
K+ channels are regulated at the
transcriptional level by a mechanism dependent on the neural induction.
In the present study, we cloned an ascidian
K+ channel gene that encodes the major
delayed rectifier K+ current of anterior
neuronal blastomeres. Unexpectedly, we found that the gene expression
pattern of TuKv2 is significantly different from that of the TuNaI
gene. We show evidence for a subfamily-specific mechanism at the
post-transcriptional level that operates to determine the time course
of the K+ channel current expression
during the neuronal development.
 |
MATERIALS AND METHODS |
Animals. Ascidian Halocynthia roretzi was
used for all the experiments. Adult animals were purchased in winter
from fishermen in northern parts of Japan, Sanriku and Wakkanai.
Animals were maintained at 4°C in ultraviolet-sterilized circulating
seawater. The spawning of eggs and sperm was induced by keeping the
animal at a higher temperature, up to 12°C, under the daylight. The
methods of fertilization and of rearing the embryos were described
previously (Okamura and Shidara, 1990 ).
Nomenclature of blastomeres. Ascidian blastomeres were named
following the designation system first adopted by Conklin (1905) . Blastomeres of the animal hemisphere are designated by small letters, either a or b, and those in the vegital hemisphere by capital letters,
either A or B. At the eight-cell stage, one embryo is composed of four
pairs of different blastomeres, a4.2, b4.2,
A4.1, and B4.1. A4.2 and
a4.2 are the anterior cells, and b4.2 and
B4.1 are the posterior cells.
cDNA cloning. Amino acid sequences conserved among Kv2
clones of other animals were selected to perform RT-PCR: YLESCCQ
and KWKFFKG. Degenerate primers corresponding to these amino acids were
synthesized. Total RNA from ascidian young tadpole was
reverse-transcribed using Superscript (Life Technologies, Grand
Island, NY) with random hexamers. A partial cDNA clone of TuKv2 (~400
bps long) was isolated after a single round of PCR reaction (30 cycles). Using this partial clone as a probe, longer cDNA clones were
screened from a cDNA library that was constructed from tailbud embryos
of ascidian Halocynthia roretzi in lambda-Zap phage
(Stratagene, La Jolla, CA). Oligo-dT-primed cDNAs longer than ~4.5 kb
was size-selected on an agarose gel before ligation with phage arm
DNAs. The hybridization on nylon filter membranes was performed at
42°C overnight in the solution: 30% formamide, 5× SSPE, 5×
Denhardt's solution, 0.5% SDS, and 0.1% BSA. Membranes were washed
in 2× SSC, 0.1% SDS at room temperature twice and in 0.1× SSC, 0.1%
SDS at 50°C twice. After screening ~100,000 clones, four positive
clones were isolated and subcloned into Bluescript following the
in vivo excision protocol. Two of the four clones contained
the longest insert, 4.8 kb. Both clones contained the full coding
region of an ascidian Kv2 gene. Deletion clones in both directions were
constructed for one of the clones (named as Shb) and sequenced by the
deoxy-termination method using an automated sequencer, ABI prism 310 (Applied Biosystems, Foster City, CA). TuKv1 has been isolated by
RT-PCR and subsequent library screening as in TuKv2 cloning. Detailed
characterization of TuKv1 will be published elsewhere.
Expression in Xenopus oocytes. The original TuKv2
clone, Shb, with its natural 5'UTR and 3'UTR did not express robustly,
either in in vitro translation system or in
Xenopus oocytes. Therefore we changed 5'UTR and 3'UTR of the
native clone. 5'UTR and first three codons of Herpes Simplex virus
thymidine kinase derived from plasmid pSP6nuc Gal (provided by Dr.
Richard Harland, University of California, Berkeley, CA) was cloned
into the upstream of TuKv2 so that it is in frame. The distal part of
TuKv2 3'UTR was substituted at BamHI site with 3'UTR of
rabbit -globin (Dierks et al., 1981 ). The constructed clone, called
SbV, was in vitro transcribed and translated with TNT
T7-coupled reticulolysate system kit (Promega, Madison, WI) and run on
SDS-PAGE to confirm that a protein of the expected size is synthesized.
For injection into Xenopus oocytes, plasmid SbV was
linearized with XbaI and transcribed with T7 RNA polymerase.
The plasmid containing TuKv1 insert in Bluescript was linearized with
XhoI and transcribed with T3 RNA polymerase. RNA was
synthesized using Riboprobe system (Promega) in the presence of 0.5 mM ATP, CTP, and UTP, 50 nM
GTP, and 0.5 mM capping nucleotide m7G(5')ppp(5')
(Amersham Pharmacia Biotech, Piscataway, NJ). Xenopus oocytes were prepared according to a standard protocol (Vize et al.,
1991 ). Approximately 50 nl of TuKv2 RNA was injected into an oocyte at
the concentration of 1 ng/nl. Injected oocytes were cultured for 2-3 d
at 18°C in the medium composed of 50% Leibovitz's L-15 medium (Life
Technologies), 15 mM Na-HEPES, and 100 µg/ml gentamycin. Electrical recordings of Xenopus oocytes were
performed in the two-electrode voltage-clamp configuration with Oocyte
Clamp OC-725C (Warner Instruments, Grand Haven, MI). The signal was digitized with an analog-to-digital converter, ITC-16, sampled at 10 kHz, filtered at 3-5 kHz, and analyzed using Pulse and Pulsefit program (Heka, Germany). The bath for oocytes was kept at 16°C so
that the recording temperature was the same as in recording from
ascidian cells. The solution for recording (ND-96) contained (in
mM): NaCl 96, KCl 2, CaCl2
1.8, MgCl2 1, and Na-HEPES 5, pH 7.6. Leak and
capacitative currents were not corrected by the leak subtraction
method. Currents at the holding potential of 80 mV were <120 nA.
Electrical measurements of ascidian a4.2 cells.
Isolation, cleavage arrest, neural induction, and culture of
a4.2 cells were performed as previously described (Okamura
et al., 1994 ). Cells were neurally induced either by treatment with
0.2% subtilisin for 1 hr or by cell-contact with A4.1 cell
(Okado and Takahashi, 1993 ). Electrical recording was performed in the
two-electrode voltage-clamp configuration using AxoClamp2B (Axon
Instruments, Foster City, CA). The signal was filtered at 3.3 kHz,
digitized, sampled at 10 kHz with Clampex (version 6) program (Axon
Instruments). Analysis was performed with Clampfit (version 6) program
(Axon Instruments). The solution specific for
K+ current recording contained (in
mM): tetramethylammonium (TMA)Cl 439, KCl 1, MgCl2 75, MnCl2 5, and
Na-1,4-piperazinediethane sulfonic acid (PIPES) 5, pH 7.0. The solution
for recording Na+ and
K+ current (standard Ca-free) contained
(in mM): NaCl 430, KCl 10, MgCl2 75, MnCl2 5, and
Na-PIPES 5, pH 7.0. For recording K(Ca) currents,
MnCl2 was substituted with
CaCl2. The bath solution was kept at 16°C
during recording. Cells with large leak currents up to a few
nanoamperes caused by cell damages after the insertion of
microelectrodes were omitted from analysis. Leak and capacitative currents were not adjusted by the leak subtraction method. Because cell
capacitance does not change significantly after 30 hr from fertilization (Okamura and Takahashi, 1993 ), current densities were
estimated only by measuring current amplitudes.
Construction of dominant negative TuKv2. The mutant clone
was constructed using QuikChange site-directed mutagenesis kit
(Stratagene). Oligoprimers in both directions were synthesized
containing sequences that encode phenylalanine instead of wild-type
tryptophan. Full-length dominant negative clone, called W404F, was
synthesized from the wild-type TuKv2 clone, SbV, following the
instruction manual of the kit. The mutation was ascertained by sequencing.
Overexpression in ascidian a4.2 cells. A
3.7-kb-long sequence upstream of ascidian synaptotagmin (Y. Katsuyama
and Y. Okamura, unpublished data) was cloned into upstream of the
coding region of the wild-type TuKv2 clone (SbV), the dominant negative
clone (W404F), and TuKv1. Clones were prepared and purified with Qiagen (Chatsworth, CA) Plasmid Maxi kit and injected into a4.2
cells with air pressure just after isolation at the eight-cell stage (6-9 hr after fertilization; Okamura et al., 1994 ). Cells were neurally induced either by subtilisin or contact to A4.1.
Time course of current expression is not significantly different
between two procedures for neural induction (Okamura and Takahashi,
1993 ). The injected cells were neurally induced with 0.2% subtilisin and cultured in artificial seawater at 11°C up to the electrical recording at the larval stage (50-55 hr after fertilization). The
solution for injection contained 0.02 ng/nl plasmid in the circular
form and 1% rhodamine dextran (Sigma, St.Louis, MO). The injection
volume was controlled so that each cell emitted about the same
intensity of fluorescence.
Northern blot analysis. mRNA was extracted from whole
embryos of Halocynthia roretzi at sequential stages of
development. Five micrograms of RNA of each stage was run on an
agarose gel, and transferred onto a blotting membrane. RNA probe was
transcribed using Strip-EZ kit (Ambion, Austin, TX) from the linearized
plasmid DNA (Shb), which contains the full length sequence of TuKv2.
32P-UTP was included in the reaction
mixture and incorporated into the probe. The synthesized probe was
hybridized to the membrane overnight at 68°C. The hybridization
solution contained 5× SSPE, 50% formamide, 5× Denhardt's solution,
0.5% SDS, and 0.1% BSA. The membrane was washed in 2× SSC, 0.1%
SDS, and 0.2× SSC, 0.1% SDS at 68°C. The washed membrane was
exposed to a plate and analyzed using a phosphoimager Fuji Bas 2000 (Fuji film Co., Japan).
In situ hybridization. In situ hybridization
using a digoxigenin probe was performed following the method described
previously (Okada et al., 1997 ). The riboprobe for TuKv2 was
synthesized from the clone Shb, which contains the full-length sequence
of TuKv2 in pBluescriptII. The plasmid was linearized with
XhoI and was transcribed with T3 RNA polymerase. The probes
for TuNaI were synthesized from plasmids pYT1 and pYR1 (Okamura et al.,
1994 ).
RT-PCR. Cleavage-arrested a4.2 blastomeres were
prepared as previously described (Okado and Takahashi, 1990 , 1993 ;
Okamura et al., 1994 ). After cleavage arrest and isolation at the
eight-cell stage, a4.2 cells were separated into two groups:
cells in one group were neurally induced by contact with
A4.1 cells, and cells in the other group were cultured
without cell contact. a4.2 cells (24-28 cells) of each
group were harvested at particular stages of development. Total RNA was
extracted from harvested cells following the acid guanidium method.
cDNA was synthesized with random hexamers, and PCR was performed
following a similar basic protocol described previously (Okamura et
al., 1994 ). Sequence of the 5' primer for TuKv2 was
TCTAGCCGTAAAGGTACTGGC. Sequence of the 3' primer for TuKv2 was
TGAGCTAAATCCTCGTTGTCC. The PCR reaction was performed in a solution
containing 32P-dCTP. Primers for TuNaI
were the same as the ones used in previous experiments (Okamura et al.,
1994 ). The PCR cycle for TuKv2 was 94°C 1 min, 60°C 1 min, and
72°C 1 min, and the cycle was repeated 29 times. Other pilot
experiments were performed to show that the amplification occurs
linearly with this cycle number. Amount of template cDNA was normalized
by performing PCR (15 cycles) with primers specific to ascidian
ribosomal RNA (Wada et al., 1992 ). Primer sequences for rRNA were
TCAATCCTACCTGTGTCCGG and CGTTACCATGACGACCTTCC. Products were run on
polyacrylamide gel and analyzed using Fuji Bas 2000 (Fuji film
Co.).
GenBank accession numbers for TuKv2 and TuKv1 are AB018545 and
AB020853, respectively.
 |
RESULTS |
Isolation of full-length ascidian Kv2 cDNA clone
Kv2 genes in many species are known to encode typical delayed
rectifier K+ currents in neurons and
muscles (Tsunoda and Salkoff, 1995a ; Quattrocki et al., 1994 ; Burger
and Ribera, 1996 ; Murakoshi and Trimmer, 1999 ). Therefore we focused on
Kv2 subfamily as candidates of K+ channel
genes underlying the delayed rectifier K+
current in ascidian neural cells. A fragment of the Kv2 gene was
obtained from ascidian tadpole cDNA by performing PCR. We screened a
cDNA library from tailbud embryos using the PCR fragment as a probe. A
full-length cDNA clone that is homologous to genes of the Kv2 subfamily
was isolated, and the entire nucleic acid sequence was determined. We
named this clone ascidian (or tunicate) Kv2 (TuKv2). The amino acid
sequence (959 amino acids) deduced from 2877 bps open reading frame has
an ~40% identity with other members of the Kv2 subfamily (Fig.
1). It has N-terminal A and B box (NAB
region; Shen and Pfaffinger, 1995 ) and six transmembrane regions with a
high homology to other Kv channel genes. The P region that forms the
walls of the channel pore is highly conserved. Multiple alignments with
Kv2-related genes from other animals revealed that TuKv2 is more
closely related to vertebrate Kv2 channels than to invertebrate Kv2
channels. The amino acid that is most critical for external
tetraethylammonium (TEA) sensitivity, residue eight before the
beginning of segment S6, is tyrosine in TuKv2. Therefore, we would
predict that the channel encoded by this gene has a high affinity for
TEA (MacKinnon and Yellen, 1990 ; Heginbotham and MacKinnon, 1992 ).

View larger version (45K):
[in this window]
[in a new window]
|
Figure 1.
Isolation of a Kv2-related gene, TuKv2. Deduced
amino acid sequence of TuKv2 is shown along with that of rat Kv2.1.
Identical amino acids are boxed. NAB region, putative
transmembrane regions, and P region are indicated with
bars.
|
|
The delayed rectifier K+ current encoded by
TuKv2 in Xenopus oocytes resembles the native
ascidian current
To identify the electrical properties of TuKv2, cRNA was expressed
in Xenopus oocytes. Delayed rectifier
K+ currents started to appear 1-2 d after
injection (Fig. 2A).
The reversal potential of the currents in Xenopus oocytes,
determined by recording the tail current, shifted positive by ~35 mV
with the change in the external K+
concentration from 10 to 50 mM. This is close to
the theoretical Nernst value for K+
current, demonstrating that TuKv2 is indeed a
K+ current (Fig. 2B).
Properties of TuKv2-derived K+ currents in
Xenopus oocytes were compared with endogenous
delayed-rectifier K+ currents from
ascidian neuroblasts. Endogenous currents were recorded from isolated,
cleavage-arrested a4.2 cells. When a4.2 blastomere is isolated and cultured under cleavage arrest, it expresses
neuronal excitability after 48 hr (Takahashi and Okamura, 1998 ). These
neurally induced a4.2 cells are known to express the
TEA-sensitive delayed-rectifier K+ current
(Shidara and Okamura, 1991 ). Drug sensitivities were compared between
the currents in Xenopus oocyte and a4.2 cell. One
and 10 mM TEA significantly reduced the current
amplitude both in a4.2 cells and in Xenopus
oocytes (Fig. 2C, top panel). This
property was expected from the half-maximal inhibition dose of TEA (1.3 mM), which was previously
reported for endogenous delayed rectifier
K+ currents (Shidara and Okamura, 1991 ).
Both currents were resistant to 1 mM
4-aminopyridine (4-AP; Fig. 2C, bottom
panel). On the other hand, there are some differences in
gating properties. The normalized conductance
(G/Gmax) plotted versus
membrane potential (G-V curve) showed a 20 mV rightward
shift in Xenopus oocytes (Fig. 2D). A
similar shift was found in the time to half-maximal activation
(t1/2), and the TuKv2 current
activated more slowly than the endogenous current in ascidian
a4.2 cells when compared at the same voltages (Fig.
2E). This voltage shift was observed only for the
activation, but not for the deactivation. The time constant of
deactivation ( ) did not show a significant difference (Fig.
2F).

View larger version (31K):
[in this window]
[in a new window]
|
Figure 2.
K+ currents encoded by TuKv2 in
Xenopus oocytes resemble native delayed rectifier
K+ currents of ascidian a4.2 cells.
A, Top, Representative current traces of
Xenopus oocytes injected with TuKv2 cRNA.
Bottom, Representative current traces recorded from
ascidian neurally induced a4.2 cells. Currents were
elicited by membrane depolarization pulses ranging from 50 to +80 mV
in 10 mV increments after a 50 msec prepulse at 120 mV. Holding
potential was 80 mV. B, Tail currents of a
Xenopus oocyte injected with TuKv2 elicited by test
pulses after a prepulse at +30 mV for 200 msec in external solutions
containing 10 and 50 mM K+.
K+ was replaced by Na+ in the 10 mM K+ solution. The tail current was
fitted to a single exponential, and the amplitude of the
exponential extrapolated to the start of the test pulse was used to
describe the tail current. Inset is a representative
trace recorded in a 10 mM K+ solution.
Similar results were also obtained from another cell. C,
Drug sensitivities of TuKv2 currents in a Xenopus oocyte
(left) and of native delayed rectifier
K+ currents from a neuronal a4.2 cell
(right). Left, Top, TuKv2
currents in a Xenopus oocyte before TEA application, in
1 mM TEA, and in 10 mM TEA.
Left, Bottom, TuKv2 currents in a
Xenopus oocyte before 4-AP application and in 1 mM 4-AP. Right, Top, Native
currents from an ascidian neurally induced a4.2 cell
before TEA application, in 1 mM TEA, and in 10 mM TEA. Right, Bottom, Native
currents from a neurally induced a4.2 cell before 4-AP
application and in 1 mM 4-AP. Currents were elicited by
membrane depolarization pulses to +40 mV after a 50 msec prepulse to
120 mV. Two other cells were tested for each drug and cell type,
giving similar results. D, G-V curve of
currents in a TuKv2-injected Xenopus oocyte and in a
neurally induced ascidian a4.2 cell. Black
rectangles, In Xenopus oocytes. White
rectangles, In ascidian. Conductance values were calculated
using the formula G = I/(V Vr), where G is the
conductance, I is the current amplitude,
V is the depolarized membrane potential, and
Vr is the reversal potential measured by the
tail current recordings. E,
t1/2 of the current activation in a
TuKv2-injected Xenopus oocyte and in a neurally induced
ascidian a4.2 cell. Black rectangles, In
Xenopus oocytes. White rectangles, In
ascidian. F, Time constant of deactivation ( ) plotted
against the membrane potential. Tail currents were fitted to single
exponentials. Black rectangles, In
Xenopus oocytes. White rectangles, In
ascidian. For E and F, nine
Xenopus oocytes and six ascidian cells were tested in
addition to the cells shown in the figures, and similar results were
obtained.
|
|
TuKv2 exclusively encodes the delayed rectifier
K+ current in ascidian neurally induced
a4.2 cells
We suspected that the distinct voltage of activation observed in
Xenopus oocytes and native ascidian cells was caused by
different cellular environments, including ionic strength and
concentration of divalent cations. Consequently, the channel properties
of overexpressed TuKv2 were studied in ascidian neurally induced
a4.2 cells. A 3.7 kb promoter region of ascidian
synaptotagmin (Y. Katsuyama, unpublished data) was fused with a green
fluorescent protein (GFP). When this plasmid was injected into neurally
induced a4.2 cells, GFP fluorescence was detected after 1 or
2 d of culture in all the cells that were injected with the
plasmid (n = 10; Fig.
3A). This promoter was also
used to drive expression of TuKv2. When the plasmid
Syt:: TuKv2 was introduced into neurally induced
a4.2 cells, the K+ current was
increased 3- to 10-fold compared with noninjected neurally induced
cells (Fig. 3B). The delayed rectifier
K+ current from cells overexpressing TuKv2
showed G-V curve and t1/2
similar to those of endogenous currents from noninjected cells (Fig.
3C,D). These findings suggest that endogenous and overexpressed currents are functionally indistinguishable, suggesting that the endogenous delayed rectifier K+
current is encoded only by the TuKv2 gene.

View larger version (22K):
[in this window]
[in a new window]
|
Figure 3.
Overexpression of TuKv2 in ascidian neuronal cells
leads to an increase in the current amplitude without changing the
kinetics. A, A neurally induced a4.2 cell
injected with GFP gene fused to the ascidian synaptotagmin promoter. A
cell injected with Syt:: GFP emitted fluorescence (left
panel). A noninjected cell emitted no fluorescence
(right panel). B, Representative
traces of neurally induced a4.2 cells injected with
wild-type TuKv2 (top panel) and noninjected
a4.2 cell (bottom panel). Currents were elicited by
membrane depolarizations ranging from 50 to +80 mV in 10 mV
increments after a 50 msec prepulse to 120 mV. Holding potential was
80 mV. C, G-V curve of
K+ current in neurally induced a4.2
cells injected with wild-type TuKv2 (n = 3) and
those of noninjected a4.2 cells (n = 3). Curves of six cells are superimposed. Black
rectangles, TuKv2 overexpressed cells. White
rectangles, Noninjected cells. Conductance values were obtained
in the same way as in Figure 2D.
D, t1/2 of
K+ current in neurally induced a4.2
cells injected with wild-type TuKv2 (n = 3) and
those of noninjected a4.2 cells (n = 3). Curves of six cells are superimposed. Black
rectangles, TuKv2 overexpressed cells. White
rectangles, Noninjected cells. These gating properties were
compatible with the previous results (Shidara and Okamura, 1991 ).
|
|
It is known that other subfamilies of Kv channel gene such as Kv3 or
HERG-related channel also encode delayed rectifier
K+ currents in neuronal cells (Wang et
al., 1997 ). To confirm further that the endogenous delayed rectifier
K+ current in a4.2 cells is
exclusively encoded by TuKv2, a dominant negative form of TuKv2 was
also constructed. Four -subunits are known to assemble to form one
K+ channel (MacKinnon, 1991 ). Ionic
currents, but not gating currents, of Drosophila
Shaker K+ channels in
Xenopus oocytes disappear completely when a conserved tryptophan (W) in the P region is mutated to phenylalanine (F) (WF
mutant; Perozo et al., 1993 ). This WF mutation makes the channel more
readily enter C-type inactivation state (Yang et al., 1997 ), thereby
potentially working as a dominant negative protein (Ribera, 1996 ).
Because genes belonging to different subfamilies of Kv channels do not
form heteromultimers (Xu et al., 1995 ), such a WF mutant of
K+ channel provides a useful molecular
tool to suppress functions of a specific subfamily of
K+ channels. We were able to construct a
WF mutant of TuKv2 because tryptophan at the corresponding site in the
P region is also conserved in TuKv2 (Fig.
4A). Xenopus
oocytes injected with this clone, W404F, expressed no
K+ current. The current expressed by
coinjection of the W404F and wild-type TuKv2 at a 1:1 ratio was ~25%
of that from control oocytes injected with the same amount of only
wild-type TuKv2 (Fig. 4B). This is consistent with
the idea that the mutated channel works as a dominant negative (Ribera,
1996 ).

View larger version (24K):
[in this window]
[in a new window]
|
Figure 4.
Forced expression of dominant negative
TuKv2 in ascidian neuronal cells eliminated the native current.
A, The amino acid sequence of the P region of TuKv2. The
tryptophan was mutated to phenylalanine in the mutant W404F.
B, Peak amplitudes of K+ current in
Xenopus oocytes elicited with a voltage step from 80
to +30 mV. Oocytes were injected with wild-type TuKv2 mRNA alone
(WT; n = 14), a mixture of wild-type TuKv2 mRNA and
W404F mRNA at a ratio of 1:1 (WT+W404F; n = 14), and W404F
mRNA alone (W404F; n = 7). C,
Representative traces of a noninjected a4.2 cell
(top panel), an Syt:: W404F-injected
a4.2 cell (middle panel) in a
solution without Ca2+ (standard
Ca2+-free). Traces from the same cell shown in the
middle panel in a solution containing 5 mM
Ca2+ (bottom panel). Currents
were elicited by membrane depolarizations ranging from 50 to +60 mV
in 10 mV increments after a 50 msec prepulse to 120 mV. Holding
potential was 80 mV. D, Mean peak amplitudes of
K+ currents at a +10 mV test pulse in neurally
induced a4.2 cells injected with wild-type TuKv2
(TuKv2-injected), no DNA (noninjected),
and dominant negative TuKv2 (DN-injected). Vertical bars
are SD. The differences between TuKv2-injected and noninjected cells as
well as between noninjected and DN-injected cells are significant
statistically (Student's t test; p < 0.01).
|
|
We drove the expression of this W404F mutant in ascidian neuronal cells
under the synaptotagmin promoter. Most cells injected with
Syt:: W404F (26 of 31 cells) showed no delayed rectifier K+ current, although the
Na+ current remained (Fig. 4C,
top and middle panels). Some
Syt:: W404F-injected cells expressed the
K+ current, but the current amplitude was
much reduced compared with noninjected cells (Fig.
4D). In some neuronal a4.2 cells, Ca-activated K+ current (K(Ca)) is
observed. When the recording solution contained 5 mM Ca2+, some
Syt:: W404F-injected cells with a barely detectable delayed rectifier K+ current showed a remarkable
amount of K(Ca) current (Fig. 4C, bottom
panel). This indicates that the dominant negative effect of
W404F is highly specific to the delayed rectifier
K+ current. Elimination of the
K+ current with W404F therefore suggests
that no gene belonging to subfamilies other than Kv2 contributes to the
formation of the endogenous current in neuronal a4.2 cells,
highlighting the simple composition of K+
currents in these cells.
Transcription of TuKv2 starts much earlier than its
functional expression
We analyzed the gene expression of TuKv2 during development.
Northern blot analysis with an RNA probe transcribed from the full
length TuKv2 clone detected two discrete bands, at 4.8 and 4.3 kb. The
longer band, 4.8 kb, corresponds to the insert size of the clone we
obtained (Fig. 5). We consider the
shorter band a splice variant of TuKv2. Both transcripts were expressed
maternally and throughout development, from the gastrula to the larval
stage. Previous electrophysiological results (Simoncini et al., 1988 ; Shidara and Okamura, 1991 ) and our recent patch-clamp recordings from
early isolated blastomeres (Y. Okamura, unpublished data) showed that
the delayed rectifier K+ current is absent
in mature unfertilized eggs and in early embryos. Thus, TuKv2
transcripts are present at much earlier stages of development than the
functional expression of the delayed rectifier K+ current.

View larger version (35K):
[in this window]
[in a new window]
|
Figure 5.
Northern blot analysis of TuKv2. Five micrograms
of mRNA from unfertilized eggs (0 hr) or embryos of gastrula (17 hr),
neurula (22 hr), tailbud (35 hr), and tadpole larva (55 hr) was loaded.
Two bands were detected at 4.8 and 4.3 kb at all stages of development.
RNA was quantified by measuring the absorbance by the spectrophotometer
before loading. The integrity of RNA was checked by rehybridizing the
same blot with a probe specific to ascidian voltage-gated calcium
channel (TuCaI; data not shown).
|
|
TuKv2 is regulated spatially in a distinct manner from TuNaI
To examine the tissue specificity of TuKv2 expression, whole-mount
in situ hybridization analysis was performed. Over long staining periods, the whole embryo, especially of earlier stages, turned opaque, a phenomenon commonly observed among ascidian genes expressed maternally. This is compatible with the Northern blot analysis that revealed significant amounts of maternal transcripts. Such a strong background signal was not detected in the case of TuNaI.
In order to discriminate the zygotic expression from maternal transcripts, the exposure to the staining dye was limited to a shorter
duration. Signals detected in this manner were associated with nuclei,
suggesting that the signals were from the zygotic expression.
Discrete signals were detected in the CNS in the regions derived
from the a-lineage (Fig.
6C; Nishida, 1987 ). The signal
was also detected in motor neurons and in putative peripheral neurons in the papilla (Fig. 6B,C). However
significant expression was also detected in non-neural tissues; the
most robust expression was detected bilaterally in the mesenchyme,
which gives rise to blood cells and adult body wall muscles (Fig.
6A--C). In a parallel experiment with
TuNaI specific probe, signals were detected in neurons (Fig.
6D--F) in agreement with previous
experiments (Okamura et al., 1994 ). Some neurons derived from
a4.2 and motor neurons seem to coexpress TuKv2 and TuNaI
(Fig.
6B,C,E,F).
Other neurons including epidermal neurons, however, express TuNaI but
not TuKv2 (Fig. 6B,E).

View larger version (64K):
[in this window]
[in a new window]
|
Figure 6.
The expression pattern of TuKv2 transcript was
distinct from that of TuNaI. Whole-mount in situ
hybridization was performed on ascidian embryos with riboprobes
specific to TuKv2 (A-C) and TuNaI
(D-F). A and D are
dorsal and lateral views of the neurula stage embryos, respectively.
B and E are lateral views of the young
tadpole stage embryos. C and F are
lateral views of the trunk regions of swimming larvae. Only the embryo
shown in D was cleared using a
benzylbenzoate-benzylalcohol mixture. me; Mesenchyme.
mn; motor neuron. en; epidermal neuron.
Scale bar, 100 µm.
|
|
Temporally distinct pattern of expression between TuKv2 and
TuNaI in cleavage-arrested a4.2 cells
The in situ hybridization results above demonstrated
that TuKv2 mRNA is expressed in some populations of neurons derived
from the a4.2 cell. RT-PCR analysis was performed to examine
if the gene expression of TuKv2 occurs in isolated, cleavage-arrested a4.2 cells that consistently show neuronal membrane
excitability after neural induction (Okado and Takahashi, 1990 , 1993 ).
Ascidian a4.2 cells were cleavage-arrested at the eight-cell
stage with cytochalasin B and were cultured in contact with
A4.1 cells (Fig. 5A). A4.1 cells can
induce a4.2 cells into the neural cell fate by cell contact
during the critical period (Okado and Takahashi, 1993 ). The two cells
were separated after the critical time and cultured in isolation.
Isolated neurally induced a4.2 cells express Na+ currents and delayed rectifier
K+ currents when embryos fertilized at the
same time and reared in parallel with the blastomeres become larvae and
hatch (Okado and Takahashi, 1990 ; Okamura and Shidara, 1990 ; Shidara
and Okamura, 1991 ). When another group of sibling a4.2 cells
were cultured in isolation without neural induction, they follow the
epidermal cell fate (Okado and Takahashi, 1990 ). When the intact
control embryos developed into the 32-cell stage, gastrula, neurula,
tailbud, and larva, both neurally induced and noninduced
a4.2 cells were harvested and used for RNA extraction (Fig.
7A).

View larger version (19K):
[in this window]
[in a new window]
|
Figure 7.
TuKv2 transcripts were detected in isolated
neurally induced a4.2 cells, and the temporal expression
pattern of TuKv2 transcript was distinct from that of TuNaI.
A, A scheme of experimental design for RT-PCR.
Cleavage-arrested a4.2 blastomeres were harvested at
sequential stages of development with or without neural induction. mRNA
was extracted, and RT-PCR was performed. B, RT-PCR in
neurally induced and noninduced a4.2 cells in stages of
the 32-cell (about 7 hr after fertilization), gastrula (17 hr), neurula
(23 hr), late tailbud (36 hr), and swimming larva (50 hr). Signals show
radiolabeled PCR products amplified with primers specific to TuKv2 and
TuNaI. PCR was also performed with primers specific to ascidian
ribosomal RNA (rRNA) as a control. Despite normalization of quantity of
loaded template cDNAs, the intensity of rRNA bands was not perfectly
equal among lanes, probably reflecting variability of the volume at
pipetting. Developmental changes of the TuNaI and TuKv2 signals were
more remarkable than variability of amplification of rRNAs.
|
|
RT-PCR with primers specific to TuKv2 revealed that in neurally induced
a4.2 cells, TuKv2 transcript was weakly detectable at the
32-cell stage, increased at the gastrula stage, decreased at the
neurula and the tailbud stage, and increased again at the larval stage.
Thus, its expression had two peaks during development. In contrast, in
noninduced a4.2 cells, the TuKv2 transcript was detected at
the 32-cell stage, decreased with time, and finally was not detectable
at the larval stage (Fig. 7B). When compared at the larval
stage, TuKv2 expression was specific to neurally induced cells.
PCR experiments were repeated twice for the larval stage, and the same
results were obtained. This temporal pattern of transcription is
significantly different from that of a Na+
channel gene, TuNaI (Okamura et al., 1994 ). TuNaI mRNA was detected in
the 32-cell stage regardless of neural induction. This early expression
was not found in previous RT-PCR studies using whole embryos (Okamura
et al., 1994 ), possibly because of different PCR protocols. This early
expression ceased before the gastrula stage. Transcription started
again at the neurula stage only in neurally induced a4.2,
and transcription increased up to the larval stage (Fig.
7B). These results also suggest that TuNaI and TuKv2 genes
are regulated by separate transcriptional mechanisms.
Misexpression of ascidian Kv1 in neurally induced
a4.2 leads to the functional expression of Kv1-derived
current earlier than Kv2-derived current
Northern blot analysis and RT-PCR from a4.2 cells
indicate that TuKv2 transcript is detected at developmental stages when the functional delayed rectifier K+
current is not detected. The delayed rectifier
K+ current is observed only when
a4.2 cell is neurally induced and only after 40 hr of
development (Shidara and Okamura, 1991 ). These temporal mismatches
between TuKv2 transcripts and the delayed rectifier
K+ current suggest that functional channel
expression from early TuKv2 mRNA is suppressed.
To test if TuKv2 channel expression is developmentally regulated by a
mechanism specific to the Kv2 family, we misexpressed ascidian
Kv1-related gene (TuKv1; Katsuyama et al., unpublished data) in
neurally induced a4.2 cells. TuKv1 encodes current with a
faster inactivation than TuKv2-derived current when expressed in
Xenopus oocytes (Fig.
8A). The magnitude of
TuKv1-derived current in Xenopus oocyte was as much as that
of TuKv2 current (our unpublished data). TuKv1-derived current
was insensitive to TEA in Xenopus oocyte (data not shown).
This pharmacological property makes it easy to discriminate between
TuKv1-derived current and TuKv2-derived current. TuKv1 is not expressed
endogenously in neurally induced a4.2 cells, as evidenced by
almost complete elimination of delayed rectifier
K+ currents by expressing a dominant
negative form of TuKv2 in this study or by application of TEA (Shidara
and Okamura, 1991 ).

View larger version (33K):
[in this window]
[in a new window]
|
Figure 8.
Misexpression of ascidian Kv1 in
neurally induced a4.2 cell led to the functional
expression of Kv1-derived current earlier than the TuKv2-derived
current. A, Representative current traces of a
Xenopus oocyte injected with cRNA of TuKv1. Currents
were elicited from a holding potential of 70 mV to steps ranging from
80 to +60 mV in 10 mV increments. B, Representative
current traces from a TuKv1-injected neuronal a4.2 cell
recorded at 46 and 54 hr after fertilization. Top panel
shows currents in TEA-free solution. Middle panel shows
currents in 50 mM TEA. Bottom panel shows
subtracted currents. Currents were elicited by membrane depolarizations
ranging from 50 to +60 mV by 10 mV increments after a 50 msec
prepulse to 120 mV. Holding potential was 80 mV. C,
%Kv2 plotted against the development time. %Kv2 is defined as the
maximum TuKv2 current amplitude at +60 mV divided by the sum of the
TuKv2 current amplitude and the TuKv1 current amplitude at +60 mV.
D, Peak amplitudes of K+ current
during a voltage step to +60 mV in a4.2 cells injected
with TuKv1, TuKv2, and no DNA (noninjected) plotted against the
development time. In TuKv1-injected cells, peak amplitudes before the
application of TEA are plotted.
|
|
When synaptotagmin promoter was fused to TuKv1 (Syt:: Kv1) and
was introduced into neurally induced a4.2, two currents with different sensitivity to TEA were observed: the endogeneous delayed rectifier K+ current that can be
eliminated by addition of 50 mM TEA and the current encoded by TuKv1 that is resistant to this concentration of
TEA. In the cell recorded at 46 hr after fertilization (Fig. 8B, left), currents recorded in solutions
with and without TEA were identical. In this cell, therefore,
K+ current is mainly based on TuKv1. The
low level of expression of TEA-sensitive delayed rectifier
K+ current at this developmental stage is
compatible with the data from noninjected cells (Fig.
8D) as well as the previous results (Shidara and
Okamura, 1991 ). The reason for the slower inactivation of TuKv1-derived
current in the ascidian cell than in Xenopus oocyte is not
known. We know that TuKv1 and TuKv2 do not coassemble, because
TEA-resistant current does not decrease by coinjection with the plasmid
of the dominant negative TuKv2 (data not shown). The inactivation of
TuKv1 current is variable among a4.2 cells, suggesting that
other cellular factors, such as the amount of auxiliary subunits
(Rettig et al., 1994 ) or degree of phosphorylation may determine
current decay kinetics of TuKv1 currents.
In contrast, currents from cells recorded at 54 hr after fertilization
(Fig. 8B, right) were sensitive to 50 mM TEA. Subtraction of the two traces between
with and without TEA reveals the current encoded by the endogenous
TuKv2 in this cell. Current amplitudes of TuKv1 and TuKv2 in each cell
were determined in this fashion. The ratio of TuKv2 current amplitude
to the sum of TuKv1 amplitude and TuKv2 amplitude (%Kv2) was plotted
against the developmental time (Fig. 8C). Before 50 hr, the
expressed current is almost purely TuKv1-derived. %Kv2 increased as
development progressed. This shows that exogenously introduced Kv1 was
expressed earlier than the current consisting of the endogenous TuKv2.
To rule out the possibility that exogenously introduced genes in
general are expressed earlier because of the transcriptional activity
of the synaptotagmin promoter or to a large copy number of introduced
genes, TuKv2 was exogenously overexpressed in cells from the same batch
for TuKv1 expression. The peak amplitude of K+ current was plotted against the
developmental time. In TuKv2-injected cells, in contrast to
TuKv1-injected cells, the current amplitude linearly increased with
time in the same fashion as the endogenous current of noninjected cells
(Fig. 8D). At earlier developmental stages, the
expression of the misexpressed Kv1 channel is more robust than the
overexpressed or endogenous TuKv2 channels. This suggests that the
failure of functional TuKv2 expression at earlier stages of development
in neurally induced cells is not caused by a general status of the
cell, such as immaturity of the transport system. We conclude that
there exists a specific mechanism that suppresses the functional
expression of only TuKv2 but cannot suppress TuKv1 expression.
Forced expression of TuKv2 in noninduced a4.2 cells
does not lead to the expression of the delayed rectifier
current
RT-PCR experiments of noninduced a4.2 cells revealed a
significant amount of TuKv2 transcripts at earlier stages of
development. Noninduced a4.2 cells, however, do not express
the delayed rectifier K+ current at any
developmental stage (Okamura and Takahashi, 1993 ). This mismatch of
mRNA and functional currents raises a possibility that the same
mechanism that suppresses the expression of the current in neurally
induced a4.2 cells works also in noninduced cells.
Synaptotagmin promoter also drives gene expression in epidermal cells,
although at a weaker level than in neuronal cells (Y. Katsuyama, unpublished observation). Syt:: TuKv2 was introduced into
noninduced a4.2 cells. All the injected cells differentiated
into epidermal phenotype, as evidenced by a small
Ca2+ current observed in a solution
containing 5 mM
Ca2+. No Syt:: TuKv2-injected
noninduced cell show any expression of the
Na+ current typically observed in neuronal
cells (n = 3). A small Ca-activated
K+ current, which is also a typical
phenotype of epidermally differentiated cells (Hirano et al., 1984 ),
was also observed at higher voltages. This type of current shows a much
slower rate of activation than the delayed rectifier
K+ current observed in neurally induced
a4.2 cells (Fig.
9A); at +50 mV the delayed
rectifier current reaches the peak amplitude in <30 msec. Furthermore,
the amplitude of outward current is much smaller compared with the
delayed rectifier K+ current in neurally
induced a4.2 cells (Fig. 9B). From these results,
we conclude that the TuKv2 mRNA leads to the functional expression of
the delayed rectifier K+ current only in
neurally induced a4.2 cells, and some post-transcriptional mechanism suppresses expression of the delayed rectifier
K+ current in noninduced a4.2
cells.

View larger version (16K):
[in this window]
[in a new window]
|
Figure 9.
Forced expression of TuKv2 in noninduced
a4.2 cells did not lead to the current expression at the
epidermal differentiation. A, Representative traces of a
noninduced a4.2 cell injected with Syt:: TuKv2.
Noninduced a4.2 cell follows the epidermal cell fate
(Okado and Takahashi, 1990 ). Recording was made in a solution
containing 5 mM Ca2+. Current traces
were elicited by test pulses at +10 and +50 mV after a 50 msec prepulse
at 120 mV. The holding potential was 80 mV. B, A
comparison of current traces between a noninduced a4.2
cell injected with Syt:: TuKv2 (top, 1 of 3 cells) and a neurally induced a4.2 cell
(bottom, 1 of 3 cells) shown in the same gain scale.
Currents were elicited by membrane depolarizations ranging from 50 to
+60 mV by 10 mV increments after a 50 msec prepulse to 120 mV. The
holding potential was 80 mV.
|
|
Effect of K+ channel function on
Na+ channel expression
The electrical excitability of neurally induced a4.2
cells is based on a very limited number of genes, only TuKv2 for the delayed rectifier K+ current and TuNaI for
the Na+ current. Considering different
transcriptional regulations between TuKv2 and TuNaI, it is possible
that the coordinated expression of K+ and
Na+ channels is controlled at
post-transcriptional level. We determined whether changes in the
expression of TuKv2 affect the expression level of TuNaI.
The Na+ current amplitude was measured
with a 10 mV test pulse after hyperpolarizing to 120 mV, which is
known to completely remove slow inactivation of ascidian
Na+ channels (Okamura and Shidara, 1990 ).
The recording was made in a Ca2+-free
solution, so that the inward current can be assumed to be a pure
Na+ current. At 10 mV, the
G/Gmax for
K+ current is ~0.2. At 6-8 msec after
the start of the test pulse, where the Na+
current amplitude was measured, the K+
current amplitude is no more than 1% of the plateau current. Thus, in
a cell expressing 100 nA of the K+
current, its effect on the Na+ channel
amplitude is <0.2 nA. In order to ensure that the
K+ current does not mask the
Na+ current in cells expressing a large
amplitude of K+ current, 50 mM TEA was used to eliminate the
K+ current. The
Na+ current amplitude recorded in this
manner remained at the same level in neurally induced a4.2
cells overexpressing the dominant-negative TuKv2, compared with cells
overexpressing wild-type TuKv2 (Fig. 10A). As expected
from voltage-clamp data, overexpression of wild-type TuKv2 shortened
the width of the action potential, and expression of the dominant
negative TuKv2 widened it (Fig. 10B). These results indicate that the expression level of the delayed rectifier
K+ channel does not affect
Na+ channel expression.

View larger version (13K):
[in this window]
[in a new window]
|
Figure 10.
Neither overexpression nor abolition
of TuKv2 K+ channel affected Na+
channel expression. A, Mean peak amplitudes of
Na+ currents at a 10 mV test pulse in ascidian
neurally induced a4.2 cells injected with wild-type
TuKv2 (TuKv2-injected; n = 10), no
DNA (noninjected; n = 17), and
dominant negative TuKv2 (DN-injected;
n = 15). Vertical bars are SD. The holding
potential was 120 mV. The difference of mean peak amplitudes was not
statistically significant between TuKv2-injected cells and DN-injected
cells. B, Left panels, Representative
traces of ascidian neurally induced a4.2 cells injected
with wild-type TuKv2 (top), no DNA
(middle), and dominant negative TuKv2
(bottom). Currents were elicited by voltage steps from a
120 mV prepulse to 10 and +10 mV. Right panels,
Action potential of each cell to the left. The injected current (10 nA,
3 msec) is shown above each trace. Artifacts are observed at the end of
the injected current.
|
|
 |
DISCUSSION |
The present study demonstrates that an ascidian Kv2-related gene
is regulated by a transcriptional mechanism distinct from that of a
Na+ channel gene. Transcription of TuKv2
occurs much earlier than its functional expression and is not
restricted to neuronal lineages. Overexpression of TuKv2 and
misexpression of Shaker-related
K+ channel gene TuKv1 showed that some
post-transcriptional mechanism operates in a subfamily-specific manner
to control the expression timing of TuKv2.
Delayed rectifier K+ current in neurally induced
a4.2 is exclusively encoded by Kv2 subfamily
Whole-mount in situ hybridization revealed that TuKv2
was expressed in the neural region derived from the a4.2
blastomere. The expression studies in Xenopus oocytes and in
native ascidian a4.2 cells indicated that TuKv2 encodes the
entire macroscopic delayed rectifier K+
current in ascidian neurally induced a4.2 cells.
We introduced a point mutation in the pore region of TuKv2 to produce a
nonconductive mutant (Yang et al., 1997 ). Such a form of TuKv2
completely suppressed the delayed rectifier
K+ current in the neuronal a4.2
cells. Dominant negative K+ channels are
presumed to work in a subfamily-specific way because only -subunits
that belong to one subfamily can assemble to form a tetramer (Xu et
al., 1995 ). It is, therefore, deduced that the delayed rectifier
K+ current in the a4.2 neuronal
cells is exclusively encoded by -subunits of the Kv2 subfamily. The
WF mutation of the Xenopus Kv2 channel at the same site of
the P-region does not make the channel dominant negative (Blaine and
Ribera, 1998 ), although a similar mutant of Xenopus Kv1 does
work as a dominant negative (Ribera, 1996 ). This discrepancy may be
attributable to different high order molecular structures between
Xenopus and ascidian Kv2 channels.
We cannot neglect the possibility that other Kv2-related members are
also present in ascidian embryos. Two discrete bands in a Northern blot
suggest some TuKv2 molecular diversity. Hybridization of the Northern
blot under high or low stringency conditions did not make a significant
difference in the results (our unpublished observation),
suggesting that the two bands with different sizes represent splice
variants. In fact, we have recently isolated another splice variant
with the size corresponding to the lower band. This second type has a
shorter 5'UTR (our unpublished observation).
The expression of the delayed rectifier K+
current derived from TuKv2 is post-transcriptionally controlled
A mismatch was found between the TuKv2 transcripts and the
functional expression of the delayed rectifier
K+ current during ascidian embryogenesis.
First, TuKv2 transcripts are detected in neurally induced
a4.2 cells before the tailbud stage when the delayed
rectifier K+ current is not detected
(Shidara and Okamura, 1991 ). Second, TuKv2 transcripts are present in
noninduced a4.2 cells, which never express the delayed
rectifier K+ current at any developmental
stage (Okamura and Takahashi, 1993 ). These findings suggest that the
mRNA of -subunit alone is not sufficient for the functional current
expression. This is further indicated by the fact that the forced
expression of TuKv2 transcripts in noninduced cell does not lead to the
expression of the delayed rectifier K+ current.
Misexpression of ascidian Kv1-related gene in neurally induced cells
showed the earlier expression of the TuKv1 current than the endogenous
or overexpressed TuKv2 currents. This implies that the molecular
mechanism suppressing the functional expression from TuKv2 transcripts
is not through a mechanism common to diverse subfamilies of
K+ channels. There are two possible
mechanisms to account for the mismatch between the functional
expression of TuKv2 and its transcription. One possibility is that
other subunits or accessory proteins associated with TuKv2 control the
functional current expression in ascidian embryos. In other systems,
-subunits not only change electrical properties of voltage-gated
K+ channels but also determine the
efficiency of current expression (Shi et al., 1996 ). Although many of
the cloned -subunits specifically interact with Kv1 channels
(Nakahira et al., 1996 ), some -subunits can interact with a Kv2
channel (Fink et al., 1996 ). TuKv2 gives a robust current expression in
Xenopus oocytes without coinjections of other subunits. This
leads to a prediction that there is an endogenous factor in
Xenopus oocytes that can substitute native subunits
expressed in ascidian neuronal cells. This factor might also be related
to a recently identified protein, called KchAP, that binds to Kv
channels and facilitates the cell surface expression of the mammalian
Kv2 channels (Wible et al., 1998 ).
Another possible mechanism for the post-transcriptional suppression is
that the translation is inhibited. In this case again, the masking of
mRNA from translation must be subfamily-specific, because
overexpression of a Shaker-related
K+ channel, TuKv1, led to an earlier
functional expression than that of TuKv2. Several proteins are known
that bind to mRNA in neuronal cells (Sakakibara and Okano, 1997 ). TuKv2
mRNA might be inhibited from being translated by factors that bind to
mRNA. If a translational control occurs as the critical step for
determining the expression timing of TuKv2, this mechanism must be
inherent to the ascidian embryos, because the translational
efficiencies of TuKv1 and TuKv2 were not significantly different either
during in vitro translation or during Xenopus
oocyte expression (our unpublished data). Generating antibodies
against TuKv2 in the future can test this idea.
Coordinated expression of K+ and
Na+ channels
Both the Na+ and
K+ channels are critical for determining
the shapes of the action potentials. There are several lines of
evidence that the Na+ and
K+ channels are coregulated during
ascidian neuronal differentiation. When the gap-junctional
communication between the a4.2 cell and a neighboring cell
is forced to persist longer than usual, expression of both the
Na+ and K+
channels are delayed to a similar extent (Saitoe et al., 1996 ). Furthermore, this timing of expression of the two channels are constant
among a4.2 cells that are neurally induced by three
different methods, bFGF treatment, subtilisin treatment, and cell
contact (Inazawa et al., 1998 ).
One possible mechanism for this co-regulation is control of
transcription through one common transcriptional factor, such as the
protein, called REST, which represses a set of neuron-specific genes in
mammals (Chong et al., 1995 ). However, in ascidian a4.2 cells, neither the temporal nor spatial transcriptional pattern of the
Na+ and K+
channels can be explained by the same transcription factor. The temporal pattern of the TuKv2 transcription is different from that of
TuNaI, the gene that encodes the Na+
current in neuronal a4.2 cells. In a RT-PCR experiment,
the TuNaI transcript was not detected at the gastrula stage, when
TuKv2 transcript showed a transient increase. Expression of the
TuKv2 and TuNaI transcript is also different in terms of tissue
specificity. TuKv2 was also expressed in non-neural tissues such as
mesenchymal cells, whereas the expression of TuNaI was restricted to
neural tissues (Okamura et al., 1994 ). Within the neural tissues, TuNaI was more widely distributed than TuKv2, whereas TuKv2 is not expressed in some neurons, including epidermal sensory neurons. Thus, TuKv2 and
TuNaI are under different transcriptional controls.
The functional expression of the Na+ and
K+ channels may be coordinated at the
functional level. It is reported that disturbances of ion channel
expression lead to changes in status of later cell maturation.
Overexpression of the K+ channels in
Xenopus neural tissue does not affect the
Na+ channel expression but leads to a
decrease in the number of neurons in vitro (Jones and
Ribera, 1994 ). In Drosophila, one allele of the HERG mutant
ts1 is associated with changes in the levels of the functional
Na+ channels, suggesting that the
Na+ channel density is regulated by
electrical activity of the cell through the
K+ channel function (Jackson et al., 1984 ;
O'Dowd and Aldrich, 1988 ; Wang et al., 1997 ). In ascidian
myocytes, it was shown that the electrical activity of the
Ca2+ channels regulates the expression of
the Ca-activated K+ channels (Dallman et
al., 1998 ). In our previous study (Okamura et al., 1994 ), however, the
decrease in the Na+ current by injection
of antisense oligonucleotides did not affect the level of the
K+ current expression in the ascidian
a4.2 cells. Furthermore, overexpression of the wild-type and
dominant negative K+ channels did not
change the Na+ channel expression in the
present study. Thus a post-translational control between the
Na+ and K+
channels through electrical activity does not seem relevant in isolated
a4.2 cells.
However, the coordination of the Na+ and
K+ channels through electrical activity
might be too weak to be detected. The ratio of the
K+ and Na+
current is variable even in noninjected neuronal a4.2 cells
from cell to cell (data not shown). The shapes of the action potentials may not be rigorously regulated as long as they can fulfill normal neuronal functions. We also cannot deny the possibility that the lack
of an activity-dependent regulation is caused by the isolated conditions of the cell. It has not been addressed whether isolated blastomeres show spontaneous activities during development. It is
possible that neurons in developing embryos can tune the ion channel
expression in an activity-dependent manner by interacting with each
other. This possibility needs to be tested in the future by
overexpressing the wild-type and dominant-negative TuKv2 in intact embryos.
 |
FOOTNOTES |
Received Dec. 22, 1998; revised May 25, 1999; accepted May 26, 1999.
We thank Dr. Hitoshi Nagahora for his technical help in cDNA cloning.
We thank Dr. Richard Harland for providing a plasmid pSP6nuc Gal for
Xenopus. We also thank Drs. Kunitaro Takahashi, David
Naranjo, Paul Brehm, and Julia Dallman for their critical reading of
the manuscript and helpful suggestions. We acknowledge Dr. Harumasa
Okamoto for valuable support throughout this study.
Correspondence should be addressed to Yasushi Okamura, Ion Channel
Group, BIOMOL">Biomolecular Engineering Department, National Institute of
Bioscience and Human Technology, Tsukuba, Ibaraki 305-8566, Japan.
 |
REFERENCES |
-
Blaine JT,
Ribera AB
(1998)
Heteromultimeric potassium channels formed by members of the Kv2 subfamily.
J Neurosci
18:9585-9593[Abstract/Free Full Text].
-
Burger C,
Ribera AB
(1996)
Xenopus spinal neurons express Kv2 potassium channel transcripts during embryonic development.
J Neurosci
16:1412-1421[Abstract/Free Full Text].
-
Chong JA,
Tapia-Ramirez J,
Kim S,
Toledo-Aral JJ,
Zheng Y,
Boutros MC,
Altshuller YM,
Frohman MA,
Kraner SD,
Mandel G
(1995)
REST: a mammalian silencer protein that restricts sodium channel gene expression to neurons.
Cell
80:949-957[Web of Science][Medline].
-
Conklin EG
(1905)
The organization and cell-lineage of the ascidian egg.
J Acad Nat Sci Phil
13:1-119.
-
Dallman JE,
Davis AK,
Moody WJ
(1998)
Spontaneous activity regulates calcium-dependent K+ current expression in developing ascidian muscle.
J Physiol (Lond)
511:683-693[Abstract/Free Full Text].
-
Dierks PA,
van Ooyen A,
Mantei N,
Weissmann C
(1981)
DNA sequences preceding the rabbit
globin gene are required for formation in mouse L cells of globin RNA with the correct 5' terminus.
Proc Natl Acad Sci USA
78:1411-1415[Abstract/Free Full Text]. -
Fink M,
Duprat F,
Lesage F,
Heurteaux C,
Romey G,
Barhanin J,
Lazdunski M
(1996)
A new K+ channel
subunit to specifically enhance Kv2.2 (CDRK) expression.
J Biol Chem
18:26341-26348. -
Gurantz D,
Ribera AB,
Spitzer NC
(1996)
Temporal regulation of Shaker- and Shab-like potassium channel gene expression in single embryonic spinal neurons during K+ channel development.
J Neurosci
16:3287-3295[Abstract/Free Full Text].
-
Heginbotham L,
MacKinnon R
(1992)
The aromatic binding site for tetraethylammonium ion on potassium channels.
Neuron
8:483-91[Web of Science][Medline].
-
Hille B
(1992)
In: Ionic channels of excitable membranes. Sunderland, MA: Sinauer.
-
Hirano T,
Takahashi K,
Yamashita N
(1984)
Determination of excitability types in blastomeres of the cleavage-arrested but differentiated embryos of an ascidian.
J Physiol (Lond)
347:301-325[Abstract/Free Full Text].
-
Inazawa T,
Okamura Y,
Takahashi K
(1998)
Basic fibroblast growth factor induction of neuronal ion channel expression in ascidian ectodermal blastomeres.
J Physiol (Lond)
511:347-359[Abstract/Free Full Text].
-
Jackson FR,
Wilson SD,
Strichartz GR,
Hall LM
(1984)
Two types of mutants affecting voltage-sensitive sodium channels in Drosophila melanogaster.
Nature
308:189-191[Medline].
-
Jones SM,
Ribera AB
(1994)
Overexpression of a potassium channel gene perturbs neural differentiation.
J Neurosci
14:2789-2799[Abstract].
-
Linsdell P,
Moody WJ
(1994)
Na+ channel mis-expression accelerates K+ channel development in embryonic Xenopus laevis skeletal muscle.
J Physiol (Lond)
480:405-410[Abstract/Free Full Text].
-
MacKinnon R
(1991)
Determination of the subunit stoichiometry of a voltage-activated potassium channel.
Nature
350:232-235[Medline].
-
MacKinnon R,
Yellen G
(1990)
Mutations affecting TEA blockade and ion permeation in voltage-activated K+ channels.
Science
250:276-279[Abstract/Free Full Text].
-
McManus OB,
Helms LM,
Pallanck L,
Ganetzky B,
Swanson R,
Leonard RJ
(1995)
Functional role of the
subunit of high conductance calcium-activated potassium channels.
Neuron
14:645-650[Web of Science][Medline]. -
Murakoshi H,
Trimmer JS
(1999)
Identification of the Kv2.1 K+ channel as a major component of the delayed rectifier K+ current in rat hippocampal neurons.
J Neurosci
19:1728-1735[Abstract/Free Full Text].
-
Nakahira K,
Shi G,
Rhodes KJ,
Trimmer JS
(1996)
Selective interaction of voltage-gated K+ channel
-subunits with -subunits.
J Biol Chem
271:7084-7089[Abstract/Free Full Text]. -
Nishida H
(1987)
Cell lineage analysis in ascidian embryos by intracellular injection of a tracer enzyme. III. Up to the tissue restricted stage.
Dev Biol
121:526-541[Web of Science][Medline].
-
O'Dowd DK,
Aldrich RW
(1988)
Voltage-clamp analysis of sodium channels in wild-type and mutant Drosophila neurons.
J Neurosci
8:3633-3643[Abstract].
-
Okada T,
Hirano H,
Takahashi K,
Okamura Y
(1997)
Distinct neuronal lineages of the ascidian embryo revealed by expression of a sodium channel gene.
Dev Biol
190:257-272[Web of Science][Medline].
-
Okado H,
Takahashi K
(1990)
Induced neural-type differentiation in the cleavage-arrested blastomere isolated from early ascidian embryos.
J Physiol (Lond)
427:603-623[Abstract/Free Full Text].
-
Okado H,
Takahashi K
(1993)
Neural differentiation in cleavage-arrested ascidian blastomeres induced by a proteolytic enzyme.
J Physiol (Lond)
463:269-290[Abstract/Free Full Text].
-
Okamura Y,
Shidara M
(1990)
Changes in sodium channels during neural differentiation in the isolated blastomeres of the ascidian embryo.
J Physiol (Lond)
431:39-74[Abstract/Free Full Text].
-
Okamura Y,
Takahashi K
(1993)
Neural induction suppresses early expression of the inward-rectifier K+ channel in the ascidian blastomere.
J Physiol (Lond)
463:245-68[Abstract/Free Full Text].
-
Okamura Y,
Ono F,
Okagaki R,
Chong JA,
Mandel G
(1994)
Neural expression of a sodium channel gene requires cell-specific interactions.
Neuron
13:937-948[Web of Science][Medline].
-
Perozo E,
MacKinnnon R,
Bezanilla F,
Stefani E
(1993)
Gating currents from a nonconducting mutant reveal open-closed conformations in Shaker K+ channels.
Neuron
11:353-358[Web of Science][Medline].
-
Pongs O
(1992)
Molecular biology of voltage-dependent potassium channels.
Physiol Rev
72:S69-S88.
-
Quattrocki EA,
Marshall J,
Kaczmarek LK
(1994)
A Shab potassium channel contributes to action potential broadening in peptidergic neurons.
Neuron
12:73-86[Web of Science][Medline].
-
Rettig J,
Heinemann SH,
Wunder F,
Lorra C,
Parcej DN,
Dolly JO,
Pongs O
(1994)
Inactivation properties of voltage-gated K+ channels altered by presence of
-subunit.
Nature
369:289-294[Medline]. -
Ribera AB
(1996)
Homogeneous development of electrical excitability via heterogeneous ion channel expression.
J Neurosci
16:1123-1130[Abstract/Free Full Text].
-
Saitoe M,
Inazawa T,
Takahashi K
(1996)
Neuronal expression in cleavage-arrested ascidian blastomeres requires gap junctional uncoupling from neighboring cells.
J Physiol (Lond)
491:825-842[Abstract/Free Full Text].
-
Sakakibara S,
Okano H
(1997)
Expression of neural RNA-binding proteins in the postnatal CNS: implications of their roles in neuronal and glial cell development.
J Neurosci
17:8300-8312[Abstract/Free Full Text].
-
Shen NV,
Pfaffinger PJ
(1995)
Molecular recognition and assembly sequences involved in the subfamily-specific assembly of voltage-gated K+ channel subunit proteins.
Neuron
14:625-633[Web of Science][Medline].
-
Shi G,
Nakahira K,
Hammond S,
Rhodes KJ,
Schechter LE,
Trimmer JS
(1996)
subunits promote K channel surface expression through effects early in biosynthesis.
Neuron
16:843-852[Web of Science][Medline]. -
Shidara M,
Okamura Y
(1991)
Developmental changes in delayed rectifier K+ currents in the muscular and neural-type blastomere of ascidian embryos.
J Physiol (Lond)
443:277-305[Abstract/Free Full Text].
-
Simoncini L,
Block ML,
Moody WJ
(1988)
Lineage-specific development of calcium currents during embryogenesis.
Science
242:1572-1575[Abstract/Free Full Text].
-
Takahashi K,
Okamura Y
(1998)
Ion channels and early development of neural cells.
Physiol Rev
78:307-327[Abstract/Free Full Text].
-
Tsunoda S,
Salkoff L
(1995a)
The major delayed rectifier in both Drosophila neurons and muscles is encoded by Shab.
J Neurosci
15:5209-5221[Abstract].
-
Tsunoda S,
Salkoff L
(1995b)
Genetic analysis of Drosophila neurons; Shal, Shaw, and Shab encode most embryonic potassium currents.
J Neurosci
15:1741-1754[Abstract].
-
Vize PD,
Melton DA,
Hemmati-Brivanlou A,
Harland RM
(1991)
Assays for gene function in developing Xenopus embryos.
Methods Cell Biol
36:361-381.
-
Wada H,
Makabe KW,
Nakauchi M,
Satoh N
(1992)
Phylogenetic relationships between solitary and colonial ascidians, as inferred from the sequence of the central region of their respective 18S rRNA.
Biol Bull
183:448-455[Abstract].
-
Wang XJ,
Reynolds ER,
Deak P,
Hall LM
(1997)
The seizure locus encodes the Drosophila homolog of the HERG potassium channel.
J Neurosci
17:882-890[Abstract/Free Full Text].
-
Wible BA,
Yang Q,
Kuryshev YA,
Accili EA,
Brown AM
(1998)
Cloning and expression of a novel K+ channel regulatory protein, KChAP.
J Biol Chem
273:11745-11751[Abstract/Free Full Text].
-
Xu J,
Yu W,
Jan YN,
Jan LY,
Li M
(1995)
Assembly of voltage-gated potassium channels. Conserved hydrophilic motifs determine subfamily-specific interactions between
-subunits.
J Biol Chem
270:24761-24768[Abstract/Free Full Text]. -
Yang Y,
Yan Y,
Sigworth FJ
(1997)
How does the W434F mutation block current in Shaker potassium channels?
J Gen Physiol
109:779-789[Abstract/Free Full Text].
Copyright © 1999 Society for Neuroscience 0270-6474/99/19166874-13$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
A. Prince-Carter and P. J. Pfaffinger
Multiple intermediate states precede pore block during N-type inactivation of a voltage-gated potassium channel
J. Gen. Physiol.,
July 1, 2009;
134(1):
15 - 34.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Tanaka-Kunishima, K. Takahashi, and F. Watanabe
Cell contact induces multiple types of electrical excitability from ascidian two-cell embryos that are cleavage arrested and contain all cell fate determinants
Am J Physiol Regulatory Integrative Comp Physiol,
November 1, 2007;
293(5):
R1976 - R1996.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Gruhn, J. Guckenheimer, B. Land, and R. M. Harris-Warrick
Dopamine Modulation of Two Delayed Rectifier Potassium Currents in a Small Neural Network
J Neurophysiol,
October 1, 2005;
94(4):
2888 - 2900.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. T. Blaine, A. D. Taylor, and A. B. Ribera
Carboxyl Tail Region of the Kv2.2 Subunit Mediates Novel Developmental Regulation of Channel Density
J Neurophysiol,
December 1, 2004;
92(6):
3446 - 3454.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Tanaka-Kunishima and K. Takahashi
Cleavage-arrested cell triplets from ascidian embryo differentiate into three cell types depending on cell combination and contact timing
J. Physiol.,
April 1, 2002;
540(1):
153 - 176.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Murata, H. Okado, and Y. Kubo
Characterization of Heteromultimeric G Protein-coupled Inwardly Rectifying Potassium Channels of the Tunicate Tadpole with a Unique Pore Property
J. Biol. Chem.,
May 18, 2001;
276(21):
18529 - 18539.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Tanaka-Kunishima and K. Takahashi
Cleavage-arrested cell triplets from ascidian embryo differentiate into three cell types depending on cell combination and contact timing
J. Physiol.,
February 8, 2002;
(2002)
200101329.
[Abstract]
[PDF]
|
 |
|
|