 |
Previous Article | Next Article 
The Journal of Neuroscience, August 15, 1999, 19(16):6979-6993
Thyroid Hormone Regulates reelin and dab1
Expression During Brain Development
Manuel
Alvarez-Dolado1, 2,
Mónica
Ruiz2,
José A.
Del Río2,
Soledad
Alcántara2,
Ferran
Burgaya2,
Michael
Sheldon3,
Kazunori
Nakajima4,
Juan
Bernal1,
Brian W.
Howell5,
Tom
Curran3,
Eduardo
Soriano2, and
Alberto
Muñoz1
1 Instituto de Investigaciones Biomédicas
"Alberto Sols", Consejo Superior de Investigaciones
Científicas, Universidad Autónoma de Madrid, 28029 Madrid, Spain, 2 Department of Animal and Plant Cell
Biology, University of Barcelona, Barcelona 08028, Spain,
3 Department of Developmental Neurobiology, St. Jude
Research Children's Hospital, Memphis, Tennessee 38105, 4 Department of Molecular Neurobiology, Institute of DNA
Medicine, Jikei University School of Medicine, Minato-ku, Tokyo
105-8461, Japan, and 5 Fred Hutchinson Cancer Research
Center, Seattle, Washington 98109
 |
ABSTRACT |
The reelin and dab1 genes are
necessary for appropriate neuronal migration and lamination during
brain development. Since these processes are controlled by thyroid
hormone, we studied the effect of thyroid hormone deprivation and
administration on the expression of reelin and
dab1. As shown by Northern analysis, in
situ hybridization, and immunohistochemistry studies,
hypothyroid rats expressed decreased levels of reelin
RNA and protein during the perinatal period [embryonic day 18 (E18)
and postnatal day 0 (P0)]. The effect was evident in Cajal-Retzius
cells of cortex layer I, as well as in layers V/VI, hippocampus, and
granular neurons of the cerebellum. At later ages, however, Reelin was more abundant in the cortex, hippocampus, cerebellum, and olfactory bulb of hypothyroid rats (P5), and no differences were detected at P15.
Conversely, Dab1 levels were higher at P0, and lower at P5 in
hypothyroid animals.
In line with these results, reelin RNA and protein
levels were higher in cultured hippocampal slices from P0 control rats compared to those from hypothyroid animals. Significantly,
thyroid-dependent regulation of reelin and
dab1 was confirmed in vivo and in
vitro by hormone treatment of hypothyroid rats and organotypic
cultures, respectively. In both cases, thyroid hormone led to an
increase in reelin expression. Our data suggest that the
effects of thyroid hormone on neuronal migration may be in part
mediated through the control of reelin and
dab1 expression during brain ontogenesis.
Key words:
reelin, dab1, thyroid hormone, neuronal
migration, cortical lamination, brain development
 |
INTRODUCTION |
Neuronal migration is an essential
step in the genesis of the nervous system, particularly in laminated
brain regions (Marín-Padilla, 1971 , 1998 ; Rakic, 1988 , 1990 ;
Hatten, 1993 ). Abnormal migration of neurons has been linked to
cognitive deficits, mental retardation, and motor disorders (Eksloglu
et al., 1996 ; Sheldon et al., 1997 ; Howell et al., 1997b ; des Portes et
al., 1998 ; Gleeson et al., 1998 ).
The study of mouse mutants has led to identify some of the molecules
that regulate neuronal positioning. The reeler mutant has
severe abnormalities in the neocortex, hippocampus, and cerebellum (Caviness and Sidman, 1973 ; Mariani et al., 1977 ; Goffinet, 1980 , 1992 ;
Derer, 1985 ; Rakic and Caviness, 1995 ). Characterization of the
defective gene in these mice showed that it encoded a large extracellular protein, Reelin, that is expressed in discrete regions of
the developing brain (D'Arcangelo et al., 1995 , 1997 ; Hirotsune et
al., 1995 ; Ogawa et al., 1995 ). reelin is expressed by
different sets of neurons, including the pioneer Cajal-Retzius (CR)
cells in layer I of the cerebral cortex and the granule cells of the cerebellum (D'Arcangelo et al., 1995 ; Ogawa et al., 1995 ; Miyata et
al., 1996 ; Nakajima et al., 1997 ; Schiffman et al., 1997 ;
Alcántara et al., 1998 ). In addition to controlling neuronal
position, Reelin influences the growth and targeting of hippocampal
afferents (Del Río et al., 1997 ; Borrell et al., 1999 ). Reelin
probably acts directly on migrating neurons through an uncharacterized
receptor or receptors. In support of this, Reelin is found in
association with neurons that do not express reelin RNA
(Ogawa et al., 1995 ; Miyata et al., 1996 ). Although the mediator of
Reelin function is unknown, it seems likely that mouse dab1
gene product acts on the same signaling cascade. Loss of function
alleles of dab1 produce a mutant phenotype that closely
resembles the reeler mutant (Sheldon et al., 1997 ; Howell et
al., 1997b ; Rice et al., 1998 ). Also, Dab1 is upregulated in
reeler mice (Rice et al., 1998 ). Since Reelin regulates Dab1
phosphorylation, Dab1 may act within migrating neurons in response to a
Reelin signal (Howell et al., 1999 ). Little is known about the
physiological factors that regulate Reelin expression. Only recently,
brain-derived neurotrophic factor (BDNF) has been described to
downregulate reelin expression (Ringstedt et al., 1998 ).
Thyroid hormone [3,5,3'-triiodothyronine (T3) and thyroxine (T4)]
deficiency during the perinatal period leads to cretinism, a syndrome
associated with mental retardation and neurological deficits (for
review, see DeLong, 1990 ; Porterfield and Hendrich, 1993 ). In
experimental animals, thyroid hormone deficiency causes an array of
abnormalities in the CNS of which alterations of cell migrations
are of special relevance. In rodents, there is a delayed migration of
cerebellar granule neurons, positional alterations of Purkinje cells,
and abnormalities in cerebral cortex lamination with ectopic location
of neurons (Patel et al., 1976 ; Legrand, 1984 ; Berbel et al., 1993 ;
Lucio et al., 1997 ).
A number of brain genes have been identified as regulated by thyroid
hormone. They include those coding for the major myelin proteins,
cytoskeletal proteins, neurotrophins and their receptors, transcription
factors, and intracellular signaling proteins (for review, see
Oppenheimer and Schwartz, 1997 ; Bernal and Guadaño-Ferraz, 1998 ).
None of these target genes are directly involved in neuronal migration.
Therefore, we investigated whether the expression of two genes critical
for neuronal migration, reelin and dab1, is regulated by thyroid hormone. We show that reelin expression
is severely decreased in hypothyroid rats at the perinatal stage, but
dab1 mRNA expression is not altered. Interestingly, Dab1
accumulates whereas the level of Reelin is reduced. Significantly,
hormone treatment restores the normal pattern of reelin
expression in vivo and in vitro, indicating that
the hormone is involved in the regulation of the reelin gene.
 |
MATERIALS AND METHODS |
Animals. Wistar rats maintained in the animal
facilities of our Instituto de Investigaciones Biomédicas were
used for the studies reported here. All efforts were made to minimize
animal suffering, to reduce the number of animals used, and to use
alternatives to in vivo techniques. The maintenance and
handling of the animals were as recommended by the European Communities
Council Directive of November 24th, 1986 (86/609/EEC). To induce fetal
and neonatal hypothyroidism (E18, P0, P5) 2-mercapto-1-methylimidazole
(MMI; 0.02%, Sigma, St. Louis, MO) was administered in the drinking water of the dams from the ninth day after conception and was continued
until the animals were killed. MMI blocks both maternal and fetal
thyroid hormone synthesis by inhibiting thyroglobulin iodination
(Yamada et al., 1974 ; Marchant et al., 1977 ). In addition, surgical
thyroidectomy was performed at P5, as previously described (Rodríguez-Peña et al., 1993 ; Alvarez-Dolado et al.,
1994 ). This protocol ensures that the animals are hypothyroid during the entire neonatal period (Muñoz et al., 1991 ; Alvarez-Dolado et
al., 1998 ). P0 animals were killed 8-12 hr after birth. T4 was used
for the in vivo hormonal treatments because it crosses the
blood-brain barrier more efficiently than T3, and is converted to T3
in the brain (Dickson et al., 1987 ). T4 was administered as single
daily intraperitoneal injections of 1.8 µg/100 gm body weight
starting 4 d before death. Rats were killed 24 hr after the last
T4 injection. At least three animals were studied per experimental
group to obtain representative values.
RNA extraction and Northern analysis. To prepare total
RNA we used the guanidinium isothiocyanate-phenol-chloroform procedure (Chomczynsky and Sacchi, 1987 ).
Poly(A)+ RNA was purified by affinity
chromatography using oligo-dT-cellulose (Vennström and Bishop,
1982 ). RNAs were fractionated in formaldehyde agarose gels and blotted
onto nylon membranes following standard techniques (Sambrook et al.,
1989 ). As controls for the amount and integrity of RNA present in the
filters, blots were stained in a 0.02% methylene blue solution made in
0.3 M sodium acetate and rehybridized with a cyclophilin
(Cy) cDNA probe (Muñoz et al., 1991 ). Radioactive probes were
prepared by the random priming procedure (Feinberg and Vogelstein,
1983 ). Ten micrograms of poly(A)+ RNA from
different brain regions was loaded per lane. The reelin probe was a 1540 bp fragment (positions 1532 to 3071) from the mouse
cDNA (D'Arcangelo et al., 1995 ). The Cy probe was from Dr. J. G. Sutcliffe (Scripps Research Institute, San Diego, CA).
In situ hybridization and immunocytochemistry. In
situ hybridization was performed on free-floating sections
essentially as described (de Lecea et al., 1994 , 1997 ; Alcántara
et al., 1998 ). Tissue preparation and hybridization of control and
hypothyroid rats were performed in bulk. Animals at embryonic day 18 (E18) and postnatal day 0 (P0), P5, and P15 were perfused with 4%
paraformaldehyde. After fixation and infiltration with sucrose, brains
were frozen in dry ice. Coronal and horizontal sections (thickness: 50 µm, E18; 30 µm, P0-P5; 25 µm, P15-adult) were collected in a
cryoprotectant solution (30% glycerol, 30% ethylenglycol, 40% 0.1 M PBS, and stored at 60°C until use.
Sections were permeabilized in 0.2-0.5% Triton X-100 (15 min),
treated with 2% H2O2 (15 min), deproteinized with 0.2 N HCl (10 min), fixed in 4%
paraformaldehyde (10 min), and blocked in 0.2% glycine (5 min).
Thereafter, sections were prehybridized at 60°C for 3 hr in a
solution containing 50% formamide, 10% dextran sulfate, 5×
Denhardt's solution, 0.62 M NaCl, 10 mM EDTA, 20 mM PIPES, pH
6.8, 50 mM DTT, 250 µg/ml yeast tRNA, and 250 µg/ml denatured salmon sperm DNA. Riboprobes were labeled with
digoxigenin-dUTP (Boehringer Mannheim, Indianapolis, IN) by in
vitro transcription of a cDNA fragment encoding mouse
reelin (D'Arcangelo et al., 1995 ) or mouse dab1
(Rice et al., 1998 ) using T3 polymerase. Labeled antisense cRNA was
added to the prehybridization solution (500 ng/ml) and hybridization
was carried out at 60°C overnight. Sections were then washed in 2×
SSC (30 min, room temperature), digested with 20 µg/ml RNase A
(37°C, 1 hr), washed in 0.5× SSC/50% formamide (4 hr, 55°C) and
in 0.1× SSC/0.1% sarkosyl (1 hr, 60°C). Sections were blocked in
10% normal goat serum (2 hr) and incubated overnight with an alkaline
phosphatase-conjugated antibody to digoxigenin (Boehringer Mannheim,
1:2000). After washing, sections were developed with nitroblue
tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (Life
Technologies, Gaithersburg, MD), mounted on gelatin-coated slides and
coverslipped with Mowiol.
For immunocytochemistry, embryos and postnatal rats were perfused with
2% paraformaldehyde and sectioned as above. Sections were incubated
with the CR50 monoclonal antibody (dilution 1:2000) that
recognizes the N-terminal region of Reelin (Ogawa et al., 1995 ;
D'Arcangelo et al., 1997 ). The primary antibody was visualized using a
biotinylated secondary antibody (1:200) and a streptavidin-peroxidase complex (1:400) (Vector Laboratories, Burlingame, CA). Peroxidase reactions were developed using diaminobenzidine and
H2O2. For detecting of Dab1
we used a rabbit polyclonal antibody (B3; dilution 1:2000) previously
described (Howell et al., 1997a ).
Organotypic slice cultures. Hippocampal slice cultures were
prepared from normal (n = 10) and hypothyroid rats
(n = 10) essentially as described (Del Río et
al., 1996 , 1997 ). P0 animals were anesthetized by hypothermia, and the
hippocampus and the prospective parietal cortex were dissected out.
Transverse slices (300- to 350-mm-thick) were obtained by cutting
tissue pieces in a McIlwain tissue chopper (Mickle Laboratory
Engineering, Gomshall, UK). Selected slices were maintained in
Minimum Essential Medium (MEM) supplemented with
L-glutamine (2 mM) for 45 min at 4°C. Thereafter, slices were cultured using the membrane
interphase technique (Stoppini et al., 1991 ). Incubation medium was
50% MEM, 25% horse serum, 25% HBSS, supplemented with
L-glutamine (2 mM).
Experimental groups comprised cultures established from hypothyroid
pups incubated in normal serum (n = 24) or in
T3/T4-depleted serum (n = 24) with or without daily
added T3 (150 nM, n = 24, or 500 nM, n = 24). Organotypic cultures
from newborn control rats were distributed in similar groups: normal
serum (n = 24), T3/T4-depleted serum alone
(n = 24), or supplemented daily with T3 (150 nM n = 24, or 500 nM, n = 24). After 6 days
in vitro (DIV) cultures were fixed with 4% paraformaldehyde
in 0.1 M phosphate buffer and stored. After
several rinses, 50-µm-thick sections were obtained using a vibratome,
and processed for the detection of reelin mRNA and protein
by in situ hybridization and immunocytochemistry as
described above.
For quantitative RT-PCR analysis, total RNA from six organotypic slices
was extracted by nondenaturing methods (Sambrook et al., 1989 ) and
resuspended in 20 µl of distilled water. Four microliter aliquots were retrotranscribed and amplified by using Retrotools cDNA/DNA polymerase kit (Biotools, Madrid, Spain) according to the
manufacturer's instructions (labeling was performed at Tm 3°C, and amplification was run up to 25 cycles, with
Taq polymerase). For reelin assays, the forward
primer was ATACGTGGATCCCTGTATCTACTTGCTGTGTTGC, and the reverse primer
was ATACGTCTAGACAAGTCACTTTGTTACCACAG, corresponding to the 342 bp
terminal sequence of the mouse reelin 3' untranslated region
(D'Arcangelo et al., 1995 ). For glyceraldehyde phosphate dehydrogenase
(GAPDH) assays, the forward primer was GGCCCCTCTGGAAAGCTGTGG, and the
reverse primer was CCTTGGAGGCCATGTAGGCCAT, covering a 435 bp coding
sequence between nucleotides 608 and 1043 of mouse GAPDH cDNA (Sabath
et al., 1990 ). PCR products were run in 1.2% agarose gels, transferred
to nylon membranes, and hybridized to 32P-labeled forward primer by standard
procedures (Sambrook et al., 1989 ). Results were analyzed in an Instant
Imager apparatus (Packard, Meridian, CT), and data were expressed as
counts per minute.
Brain extract preparation and immunoblot analysis. Protein
extracts from the cerebral cortex and cerebellum of P0 and P5 control and hypothyroid rats, and total brains from E17 or newborn wild-type and reeler mutant mice were prepared by dounce homogenizing
the tissue that was snap-frozen in liquid nitrogen in 500 µl of
ice-cold lysis buffer (0.1% NP-40, 250 mM NaCl,
50 mM Tris-HCl, pH 7.4, 1 mM EDTA, 2 mM PMSF, 20 µM leupeptin, and 50 mM
NaF) per 100 mg tissue. Extracts were cleared by centrifugation at
14,000 rpm for 30 min. One hundred micrograms of protein extract was
loaded per lane onto a 4-12% polyacrylamide gradient gel (Novagen,
Madison,WI), electrotransfered to nitrocellulose membranes, incubated
with a rabbit polyclonal antibody directed against the phosphotyrosine binding (PTB) domain of mDab1 (antibody PTB31) and visualized by
enhanced chemiluminescence (Boehringer Mannheim). Blots were stripped and reprobed with an anti-ref-1 antibody (Xanthoudakis et al.,
1992 ) as an internal control for equal amounts of protein loading.
Controls. Control hybridizations with sense
digoxigenin-labeled riboprobes, or RNase A digestion before
hybridization, prevented alkaline phosphatase staining above background
levels. In immunocytochemical controls, omission of the primary
antibody prevented diaminobenzidine staining. For RT-PCR assays, RNA
samples were digested with DNase I by standard procedures (Sambrook et
al., 1989 ) and then subjected to direct PCR analysis.
Data analysis. Sections were examined on a Reichert Polyvar
microscope. The delimitation of regional and laminar boundaries was
performed according to Sidman et al. (1971) , Zilles (1985) , and Paxinos
et al. (1994) . The number of labeled neurons present in neocortical
layer I (prospective parietal cortex) and in the stratum
lacunosum-moleculare of hippocampus was determined in horizontal strips
(400 µm length) covering the entire thickness of these layers (Del
Río et al., 1995 ). For the quantifications in layers V-VI, the
number of labeled cells present in 9 × 104 µm2 was
counted. For each group and age, counts were performed in four to six
sections per animal (two to five animals per group). Data (expressed as
means of cell counts ± SEM) were compared by ANOVA and post
hoc t tests.
 |
RESULTS |
reelin mRNA expression is downregulated in the cerebral
cortex of hypothyroid rats
To determine whether reelin expression was altered by
thyroid hormone depletion in the developing rat brain, we first
analyzed reelin mRNA levels by Northern blot hybridization.
As shown in Figure 1, reelin
RNA expression was markedly downregulated in the cerebral cortex of
hypothyroid rats at P0 (50-60% decrease). Recent studies have shown
that reelin is differentially expressed in several regions
of the developing brain (Schiffman et al., 1997 ; Alcántara et
al., 1998 ; Rice et al., 1998 ). To gain insight into the regional
differences in the regulation of reelin expression by
thyroid hormone, we performed in situ hybridization
analyses. We first focused on the pattern of developmental expression
in the neocortex and hippocampus, two regions that are targets of thyroid hormone action. At E18-P0 reelin transcripts were
very prominent in neurons present in the marginal zone of the
neocortical and hippocampal anlage [prospective layer I and stratum
lacunosum-moleculare (SLM), respectively] (Figs.
2A,G,
3) These neurons were intensely labeled and displayed large, horizontally-oriented perikarya, which are
typical for CR cells (Soriano et al., 1994 ; Del Río et al.,
1995 , 1997 ; Alcántara et al., 1998 ). In agreement with earlier
studies (Schiffman et al., 1997 ; Alcántara et al., 1998 ), reelin-positive CR cells were more numerous in the
hippocampus than in the neocortex (data not shown). The pattern of
reelin expression at E18 and P0 was similar in layer I/SLM.
A second population of reelin-positive neurons was detected
at P0 in layers V/VI of the neocortex (Fig. 2A) and
in the plexiform layers of the hippocampus (Schiffman et al., 1997 ;
Alcántara et al., 1998 ).

View larger version (35K):
[in this window]
[in a new window]
|
Figure 1.
Northern analysis of reelin RNA
expression in newborn hypothyroid rats. Ten micrograms of
poly(A)+ RNA from cerebral cortex of
control (C) and hypothyroid
(H) newborn (P0) rats (each sample
corresponded to three pooled animals) were analyzed in Northern blots
using a reelin cDNA probe as described in Materials and
Methods. Cyclophilin (Cy) was used as a control gene. The levels of
reelin RNA were quantitated using an Instant Imager apparatus
(Packard). Data from three independent experiments are shown as
mean ± SEM; ***p < 0.001.
|
|

View larger version (150K):
[in this window]
[in a new window]
|
Figure 2.
Effects of hypothyroidism on reelin
RNA expression in the cerebral cortex. A-F, Pattern of
reelin RNA expression in the neocortex of control
(A, C, E) and hypothyroid (B, D,
F) rats at P0 (A, B), P5 (C,
D), and P15 (E, F). Cortical layers are
indicated to the right. Note the decreased RNA levels in
hypothyroid rats at P0 and P5. Arrowheads in
A and B point to CR cells. G,
H, High magnification photomicrographs illustrating
reelin RNA-positive CR cells in layer I of the neocortex
in control (G) and hypothyroid rats
(H). I, J, Distribution of
reelin RNA-positive cells in the hippocampus of control
(I) and hypothyroid
(J) rats at P5, showing decreased RNA levels both
in the stratum lacunosum-moleculare and in the remaining hippocampal
layers. K, Distribution of reelin
RNA-positive cells in the hippocampus of a control rat at P15. No
differences were detected in hypothyroid rats at this age in this
region. C, Control; H, hypothyroid;
I VI, cortical layers; CP, cortical
plate; DG, dentate gyrus; GL, granule
cell layer; ML, molecular layer; CA3,
CA1, hippocampal subdivisions CA3 and CA1;
SLM, stratum lacunosum-moleculare. Scale bars:
A, 200 µm (applies to B-D, I, J);
E, 100 µm (applies to F, K); G, 40 µm (applies
to H).
|
|

View larger version (18K):
[in this window]
[in a new window]
|
Figure 3.
Number of reelin RNA-positive neurons in control
and hypothyroid rats in layer I and layers V/VI of the neocortex and in
the stratum lacunosum-moleculare of the hippocampus. Data were
quantitated as described in Materials and Methods (mean ± SEM;
*p < 0.05). For cortical layer I and stratum
lacunosum-moleculare, we analyzed four strips of three different
animals, and for layers V/VI, we measured five sections of three
different animals.
|
|
In hypothyroid rats, the regional and laminar patterns of
reelin expression at E18-P0 were similar to those in
control rats. However, the number of labeled neurons in layer I of the
neocortex and in the SLM of the hippocampus was significantly lower,
particularly at P0 (Figs. 2B, 3). Moreover,
reelin-positive CR neurons clearly displayed weaker
hybridization signals in hypothyroid rats than in controls (Fig.
2H). Both the number of positive neurons and their
intensity of labeling were lower in layers V/VI of the neocortex and in
the hippocampal plexiform layers at P0 (Figs. 2B,
3).
At P5 the levels of reelin RNA expression were slightly
lower in layer I/SLM than at previous stages, although a substantial number of positive neurons was still present, particularly in the
hippocampus (Fig. 2C,I). No significant differences
were found in these layers in the number of positive neurons between
control and hypothyroid rats (Fig. 3), although neurons displayed
weaker signals in hypothyroid rats (Fig. 2, compare
I,J). In contrast, the number of
reelin-positive neurons in layers II-VI was decreased in
hypothyroid rats (Fig. 3).
At P15, reelin transcripts were detected in a few neurons in
layer I of the neocortex and in neurons scattered within layers II-VI
(Fig. 2E), which are known to correspond to certain
GABAergic neurons (Alcántara et al., 1998 ). In the hippocampus,
reelin RNA expression was still detected in CR cells as well
as in some interneurons distributed within the plexiform layers (Fig.
2K). The pattern of expression in hypothyroid rats
was similar to that in controls (Figs. 2F, 3). These
data demonstrate that reelin RNA expression is downregulated
by hypothyroidism at late prenatal and early postnatal stages of corticogenesis.
Distribution of Reelin immunoreactivity in the cerebral cortex of
hypothyroid rats
To investigate whether Reelin distribution was also altered in
hypothyroid rats, brain sections were immunostained with the CR50 mAb
that recognizes the N-terminal region of Reelin (Ogawa et al., 1995 ;
D'Arcangelo et al., 1997 ). At E18-P0, CR50 immunoreactivity was very
prominent in layer I/SLM of control rats, labeling the perikarya and
dendrites of CR cells (Fig.
4A,E). In addition, there was diffuse staining in layer I/SLM, which is likely to correspond to the distribution of extracellular Reelin. In the cerebral
cortex of hypothyroid rats, CR50 immunostaining was much weaker in
layer I/SLM, particularly at P0 (Fig. 4B,F).
Immunoreactive neurons were difficult to identify in layer I/SLM of
newborn hypothyroid rats, and the diffuse staining observed in control
rats was drastically reduced (Fig. 4B,F).
Furthermore, a few Reelin-positive neurons were observed in layers V-VI
of the cortex and in the hippocampal plexiform layers in control rats,
which could not be detected in hypothyroid rats (data not shown).

View larger version (105K):
[in this window]
[in a new window]
|
Figure 4.
Reelin expression in the cerebral cortex of
control and hypothyroid rats. A-D, Photomicrographs
showing the distribution of CR50 immunostaining in layer I of control
(A, C) and hypothyroid rats (B, D) at P0
(A, B) and P5 (C, D). Some CR50-positive
CR cells are indicated by arrowheads. Note the decreased
staining at P0 in hypothyroid animals. E-H, Pattern of
CR50 immunostaining in the hippocampus of control (E, G)
and hypothyroid rats (F, H) at P0 (E,
F) and P5 (G, H), illustrating a
clear reduction in the staining in hypothyroid rats at P0. The
hippocampal fissure is indicated by arrowheads.
I-L, Pattern of CR50 staining in the neocortex
(I, J) and hippocampus (K, L) of
control (I, K) and hypothyroid (J,
L) rats at P15. No marked differences were found in both
cortical regions at this age. C, Control; H,
hypothyroid; EC, entorhinal cortex; other abbreviations are as in
legend to Figure 2. Scale bars: A, 40 µm (applies to
B-D); E, 200 µm (applies to
F); G, 200 µm (applies to
H); I, 100 µm (applies to
J-L).
|
|
At P5, the pattern of Reelin immunostaining in layer I/SLM of control
rats was similar to that seen at previous stages (Fig. 4C,G). In contrast to the perinatal stages, a large number
of CR50-positive neurons were also present in layer I/SLM of P5
hypothyroid rats, with the diffuse extracellular-like staining being
very prominent (Fig. 4D,H). In fact, the
intensity of immunolabeling at P5 was slightly higher in hypothyroid
rats than in control rats.
At P15 a few Reelin-positive neurons populated layer I/SLM and the
remaining neocortical and hippocampal layers in control rats. No clear
differences were apparent in the distribution of Reelin-positive
neurons in hypothyroid rats (Fig. 4I-L), although cells were more weakly stained in these experimental animals. Taken
together, the data show that Reelin levels are decreased at perinatal
stages in hypothyroid rats, whereas they appear to reach normal levels
at later postnatal stages.
reelin expression in the cerebellum and olfactory bulb of
hypothyroid rats
We next examined the developmental distribution of
reelin mRNA and protein in the cerebellum and olfactory
bulb, two regions of high reelin expression in which
migration deficits have been reported in hypothyroid rats (Patel et
al., 1976 ; Legrand, 1984 ). At E18-P0 reelin transcripts and
CR50 immunoreactivity in the cerebellum were detected in the external
granule cell layer (EGL) and in a population of neurons in the
prospective internal granule cell layer (IGL), which may correspond to
the first postmigratory granule cells (see Miyata et al., 1996 ). Both
the hybridization and the immunocytochemical signals were lower in the
cerebellum of hypothyroid rats (Fig.
5A,B). In contrast, no
remarkable changes in expression levels or immunohistochemical signals
were observed in the primordium of the olfactory bulb at these ages
(data not shown).

View larger version (121K):
[in this window]
[in a new window]
|
Figure 5.
Patterns of reelin RNA and protein
distributions in the cerebellum and olfactory bulb of hypothyroid rats.
A-F, Distribution of reelin RNA in the
cerebellum of control (A, C, E) and hypothyroid
(B, D, F) rats. Note the decreased RNA levels in
hypothyroid rats at P0, and the opposite increased levels at P5 and P15
in these animals. G-J, Pattern of CR50 immunostaining
in the cerebellum of control (G, I) and
hypothyroid (H, J) rats at P5 (G,
H) and P15 (I, J). Increased
Reelin levels are observed in hypothyroid rats.
Arrowheads point to the external granule cell layer.
K, L, CR50 immunostaining in the olfactory bulb of
control (K) and hypothyroid
(L) rats at P5, illustrating the decreased
immunolabeling in the mitral cells and glomerular neurons in
hypothyroid rats. EGL, External granule cell layer;
IGL, internal granule cell layer; ML,
molecular layer; WM, white matter; MCL,
mitral cell layer; GCL, granule cell layer;
GL, glomerular cell layer. Scale bars: A,
200 µm (applies to B-J); K, 40 µm (applies to L).
|
|
At P5-P15 reelin mRNA and CR50 immunolabeling were
prominent in both the EGL and the IGL of the cerebellum (Fig.
5C,E,G,I). Although the EGL is thicker in the
hypothyroid rat brain because of the delayed migration of granule
cells, the distribution of reelin RNA and protein was
similar in control and hypothyroid rats at P5-P15 (Fig.
5D,F,H,J). However, both mRNA and protein levels were
clearly elevated in the cerebellum of hypothyroid rats at these ages.
In the olfactory bulb, decreased levels of RNA and protein were noticed
at P5 in hypothyroid rats (Fig. 5K,L), whereas no changes
were detected at P15.
Developmental regulation of dab1 mRNA and protein in
hypothyroid rats
Recent studies have shown that mutations in the dab1
gene, which encodes an adaptor protein that appears to function in
signal transduction processes, leads to cytoarchitectonic alterations similar to those in reeler mutant mice (Sheldon et al.,
1997 ; Howell et al., 1997b ; Rice et al., 1998 ). This suggests that Dab1 acts in the same signaling pathway of Reelin that controls cell positioning in the developing brain. To determine whether
dab1 expression was altered in hypothyroid rats, we
performed in situ hybridization analyses. At E18 and P0
dab1 transcripts were widely distributed in the
proliferative ventricular zone as well as in postmitotic neurons of the
cerebral cortex. Both the cortical plate in the neocortex and the
pyramidal and granule cell layers of the hippocampus were intensely
labeled. In other brain regions such as the cerebellum, widespread
expression was also noticed (data not shown), which is consistent with
recent studies (Rice et al., 1998 ). No changes in the distribution of
transcripts or the intensity of the hybridization signal were observed
in hypothyroid rats at E18-P0 (Fig.
6A,B). At P5-P15
dab1 expression was also widespread in the neocortex and
hippocampus with many labeled neurons evident (Fig. 6C,D).
In the cerebellum dab1 was expressed in Purkinje cells, in
the IGL, and in the inner part of the EGL (data not shown). Again, no
major changes were detected in hypothyroid rats, except for a slightly
lower signal at P5. These data indicate that dab1 RNA
synthesis or stability is not substantially altered by the lack of
thyroid hormone.

View larger version (140K):
[in this window]
[in a new window]
|
Figure 6.
Distribution of dab1 RNA and
protein levels in the cerebral cortex and cerebellum of control
(C) and hypothyroid
(H) rats. A-D, Pattern of
dab1 RNA hybridization at P0 and P5 in control
(A, C) and hypothyroid (B, D) rats in the
hippocampus (A, B) and neocortex (C, D).
dab1 is widely expressed within the cerebral cortex, and
no major differences are observed between control and hypothyroid rats.
E-H, Distribution of Dab1 immunolabeling in the
neocortex of control (E, G) and hypothyroid (F,
H) rats at P0 and P5. Increased levels of Dab1
immunoreactivity are observed in hypothyroid rats at P0, whereas the
opposite occurs at P5. I, J, Photomicrographs
illustrating decreased Dab1 immunostaining in the cerebellum of
hypothyroid (J) compared to controls
(I) rats at P5. Abbreviations are as in
legends to Figures 2 and 5. Scale bars: A, 200 µm
(applies to B-H); I, 100 µm
(applies to J).
|
|
We next examined the distribution of Dab1 protein, which accumulates to
abnormally high level in the absence of Reelin in reeler
mice (Rice et al., 1998 ). At P0, Dab1 immunoreactivity was detected in
the perikarya and dendrites of many postmitotic neurons of the
neocortex and hippocampus, as well as in fiber tracts in control rats
(Fig. 6E; data not shown). At this age, hypothyroid
brains showed a similar distribution of Dab1 protein; however the
intensity of immunostaining was higher compared to that in control rats
(Fig. 6E,F). At P5, the distribution of Dab1 in the cerebral cortex remained widespread in both control and hypothyroid rats. However, at P5 the levels of immunostaining were
higher in control than in hypothyroid rats (Fig. 6, compare G,H). The same difference in Dab1 expression was
found in the cerebellum (Fig. 6I,J). At later
developmental stages (P15, P25) no differences were seen between
controls and hypothyroid rats (data not shown).
To further confirm these data, we analyzed the amount of Dab1 protein
in cortex and cerebella from control and hypothyroid animals by Western
blotting. As shown in Figure 7, at P5
Dab1 was more abundant in control rats. These results indicate that the
levels of Dab1 are inversely correlated with those of Reelin in
hypothyroid rats, as recently shown in the reeler mutant
mouse (Rice et al., 1998 ). This also implies that Dab1 fails to be
degraded in the absence of a Reelin-evoked signal. Brain samples from
wild-type and reeler mice were included as controls, showing
the upregulation of Dab1 expression in mutant animals lacking
Reelin.

View larger version (37K):
[in this window]
[in a new window]
|
Figure 7.
Western blot analysis of the expression of Dab1 in
the cortex (Cx) and cerebellum (Cb) of
control (C) and hypothyroid
(H) rats at P5. Total brain extracts from
wild-type (wt) and reeler (rl / )
mice at the indicated ages were used as controls, showing a high
increase in Dab1 content in reeler mutants. Numbers to
the right indicate Mr of marker proteins.
|
|
reelin expression is regulated by thyroid
hormone in vivo and in vitro
To test whether reelin expression is directly regulated
by thyroid hormone, organotypic hippocampal slices from control and hypothyroid P0 rats were incubated in culture medium containing either
normal serum or T3/T4-depleted serum supplemented or not with T3 (150 or 500 nM). After 6 d in culture,
reelin mRNA expression was analyzed by in situ
hybridization. Slices from control rats incubated in the T3/T4-depleted
or normal serum showed the typical pattern of reelin
mRNA-positive neurons. Thus, intensely labeled CR cells were present in
the SLM near the hippocampal fissure, and a few additional scattered
neurons were present in the remaining layers (Fig.
8A,D; data not shown).
Control slices incubated with T3 did not exhibit a statistically
significant increase in the number of reelin-positive
neurons (Fig. 9). These data suggest that
the effect of hormone-depleted serum in vitro may not be as
severe as long-term hypothyroidism in vivo.

View larger version (136K):
[in this window]
[in a new window]
|
Figure 8.
reelin RNA (A-F) and
protein (G-L) expression in hippocampal organotypic
slice cultures. Left panels,
(A-J), Slices from euthyroid rats incubated for
6 d in standard serum. Middle panels,
(B-K), Slices from hypothyroid rats incubated
for 6 d in thyroid-depleted serum. Right panels,
(C-L), Slices from hypothyroid rats incubated
for 6 d in T3/T4-depleted serum supplemented with 500 nM T3. Note that the reduced expression levels in
hypothyroid slices are rescued by T3 treatment. Higher magnification
photomicrographs illustrating reelin RNA
(D-F) and protein (J-L)
in the CR cells of the hippocampus are shown. Abbreviations are as in
legends to Figure 2; S, subiculum. Scale bars:
A, 300 µm (applies to B, C, and
G-I); D, 75 µm (applies to
E, F); J, 50 µm (applies to
K, L).
|
|

View larger version (22K):
[in this window]
[in a new window]
|
Figure 9.
Density of reelin RNA-positive
neurons in the stratum lacunosum-moleculare of hippocampal slice
cultures from control and hypothyroid newborn (P0) rats. Organotypic
slices were incubated in standard normal serum (NS) or
in T3/T4-depleted serum (DS) supplemented or not with T3
as indicated. For statistical analysis, T3-treated slices were compared
to untreated DS slices. Note the increase in
reelin-positive cells caused by T3 treatment. Data were
quantitated as described in Materials and Methods (mean ± SEM;
*p < 0.05). Each value corresponds to five strips
of two different slices.
|
|
Slices from hypothyroid newborn rats cultured with either normal or
hormone-depleted sera displayed a marked reduction in the number of
reelin-positive cells after 6 d (Figs.
8B,E, 9). This result was in contrast to the similar
number of reelin-expressing cells found in the hippocampus
of control and hypothyroid rats at P5 (Fig. 3), and indicates that
additional systemic factors regulating reelin expression may
exist that are not present in slice cultures. Furthermore, the labeled
neurons exhibited weak hybridization signals. In contrast, hypothyroid
hippocampal slices treated with T3 displayed a pattern of expression
indistinguishable from that of control cultures, indicating that
thyroid hormone restores reelin expression to normal levels
(Fig. 8C,F). This result was confirmed by counting
positive cells (Fig. 9). Additionally, the effect of T3 on
reelin RNA expression in the organotypic cultures was
estimated by using a semiquantitative RT-PCR analysis. In line with the
above data, T3 treatment restored reelin RNA expression in
hypothyroid rats to normal levels, and led to a threefold increase in
control animals (Fig. 10).

View larger version (42K):
[in this window]
[in a new window]
|
Figure 10.
RT-PCR analysis of reelin RNA
expression in organotypic cultures. A, Total RNAs were
prepared from the same four types of slices as in legend to Figure 9
and then were retrotranscribed and analyzed as described in Materials
and Methods to estimate the expression of reelin RNA.
GAPDH gene was used as internal control. B, Quantitation
of the reelin/GAPDH ratio of RNA expression.
|
|
To examine whether the regulation of reelin RNA expression
correlated with protein levels, hippocampal slices were immunostained with the CR50 antibody. As seen in Figure 8 (compare panels
G and J with H and
K) the robust CR50 immunostaining seen in control slices was dramatically reduced in hippocampal slices from hypothyroid rats. Again, the pattern of CR50 immunostaining returned to normal when
these cultures were treated with T3 for 6 d (Fig.
8I,L).
To determine if reduced hormone levels in hypothyroid rats was the
cause of the observed decreased reelin expression, we
administered T4 to these animals. In agreement with the above results,
the pattern of reelin mRNA distribution did not differ
greatly at P15 between control and hypothyroid rats, but the intensity
of labeling was however reduced in the latter animals (Fig.
11A). Hypothyroid
rats treated with T4 showed an increase in the number of
reelin-positive neurons present in layer I/SLM and in layers V/VI (Fig. 11B). In addition, T4 treatment resulted
in a stronger hybridization signal in labeled neurons. Together, these
results indicate that reelin RNA and protein expression are
regulated by thyroid hormone in vivo.

View larger version (70K):
[in this window]
[in a new window]
|
Figure 11.
Effect of thyroid hormone treatment
in vivo on the number of reelin-positive
cells present in P15 rats. A, Photomicrographs
illustrating the level of reelin RNA expression in the
parietal cortex of control (C), hypothyroid
(H), and hypothyroid rats treated with T4
(H+T4), as described in Materials
and Methods. B, Number of reelin
RNA-positive neurons in the neocortex (layers I and V/VI) and
hippocampus (SLM) of the three groups of animals. Data were quantitated
as described in Materials and Methods (mean ± SEM;
*p < 0.05). For cortical layer I and SLM each
value corresponds to three strips of four different animals, and for
layers V/VI to four sections of three animals. Abbreviations are as in
legend to Figure 2. Scale bar, 100 µm.
|
|
 |
DISCUSSION |
Reelin and Dab1 are critical for neuronal migration, which in turn
is responsible for lamination and precise cellular localization during
CNS development. We show here that thyroid hormone, an agent known to
exert broad regulatory actions on brain maturation (Legrand, 1984 ;
Dussault and Ruel, 1987 ; Porterfield and Hendrich, 1993 ), increases
reelin RNA and protein levels. The exact mechanism of T3
action on reelin expression, whether transcriptional or post-transcriptional, remains to be determined. The lack of a strict
correlation between the changes in RNA and protein levels might
indicate that reelin expression is regulated at multiple levels, perhaps by thyroid hormone. Furthermore, the differences observed in the effect of the hormone in distinct brain regions suggests that T3 may cooperate with locally acting factors, or that
hormone action is modulated by region- or cell-specific proteins. Recently, BDNF has been found to negatively regulate the expression of
reelin in CR cells of the cerebral cortex (Ringstedt et al., 1998 ). At present we do not know if the thyroid hormone effect on
reelin is direct or, alternatively, is mediated by the
control of BDNF expression. Previous studies indicated that BDNF
expression, as measured by RNA protection assays, is diminished at P15
and later ages in the cerebellum of hypothyroid rats (Neveu and Arenas, 1996 ), although the levels in the cortex and hippocampus remain unchanged (Alvarez-Dolado et al., 1994 ). Therefore, the increased expression of reelin in the cerebellum at P5-P15 may be
secondary to the modulation of BDNF levels in this region.
We show that both the number of Reelin-positive cells and the intensity
of signal per cell is reduced in hypothyroid rats. However, we cannot
ascertain whether the number of CR cells is affected because there are
not known cell markers for the entire population of CR cells in the rat
cortex. Although calretinin appears to label all the CR cell population
in mice, antibodies to different calcium-binding proteins, including
calretinin and calbindin, only result in the labeling of subpopulations
of CR cells (Meyer et al., 1998 ). Suggesting that hypothyroidism does not affect the number of CR cells, when hippocampal slice cultures from
newborn hypothyroid rats (showing a decrease number of Reelin-positive cells) were treated with T3 in vitro, the number of
Reelin-positive CR cells increased dramatically. This indicates that
the cells were present at P0, but had no detectable expression levels.
Thus, although we cannot discard the possibility that the lack of
thyroid hormone may affect CR cell number or viability, the present
data appear to favor that CR cell number is not altered in the
hypothyroid state.
It is interesting to note that in contrast to reelin, dab1
RNA levels are not affected by hypothyroidism. However, Dab1 protein levels are modulated in thyroid-deficient rats. This effect may be
caused by a direct effect of T3 on dab1 mRNA translation or on Dab1 protein stability. Alternatively, changes in Dab1 protein content may be an indirect consequence of the reduction in
reelin expression by the lack of hormone. In fact,
reeler mutant mice show normal dab1 mRNA levels
but increased Dab1 protein content (Rice et al., 1998 ).
The possibility that thyroid hormone primarily controls Dab1 levels and
as a consequence affects secondarily the expression of
reelin RNA and protein cannot be ruled out, but it does not appear very likely since the expression of Reelin is unaltered in
scrambler and yotari mice carrying mutations in
the dab1 gene (Yoneshima et al., 1997 ; Rice et al., 1998 ),
and dab1 RNA expression is not changed in hypothyroid rats.
Given the important role of these proteins in migration, it is
conceivable that the profound alteration in Reelin/Dab1 levels may
affect this process in the hypothyroid brain.
Thyroid hormone exerts its wide regulatory actions by controlling gene
expression. In the last years, a number of genes have been described by
us and others to be under thyroid control in the CNS (for review, see
Bernal and Guadaño-Ferraz, 1998 ). The classical mechanism of
action of T3 is the regulation of gene transcription through the
binding to specific nuclear receptors (TR 1, TR 1, and TR 2
isoforms) that interact with specific nucleotide sequences (T3REs:
thyroid response elements) present in target genes, usually in the form
of heterodimers with the RXR 9-cis retinoic acid receptor
(Lazar, 1993 ; Muñoz and Bernal, 1997 ). T3 can regulate gene
transcription through the activation of positive T3REs or repression of
negative T3REs, or by interference with other transcription factors
(Muñoz and Bernal, 1997 ). In addition, several studies have
indicated post-transcriptional regulatory effects of T3 on mRNA
stabilization, processing, and translation, or on post-translational
mechanisms (Aniello et al., 1991 ). Besides the above discussed data on
BDNF expression, we and others have previously reported a positive
regulation of nerve growth factor (NGF), the trkA gene
encoding its high-affinity receptor, and neurotrophin (NT)-3 genes by
thyroid hormone during rat brain development (Walker et al., 1982 ;
Lindholm et al., 1993 ; Alvarez-Dolado et al., 1994 ). In contrast,
abnormally higher levels of the p75LNGFR
low-affinity receptor for neurotrophins are expressed in the hypothyroid brain (Figueiredo et al., 1993 ; Alvarez-Dolado et al.,
1994 ). These data are in line with the functional interplay described
between thyroid hormone and NGF in the developing rodent brain and
in vitro in pheochromocytoma PC12 cells (Patel et al., 1988 ;
Clos and Legrand, 1990 ; Muñoz et al., 1993 ).
Cell migration is known to be altered by hypothyroidism in the neonatal
cerebellum (for review, see Legrand, 1984 ). The migration of cerebellar
granule cells from the external to the internal layer is delayed as a
consequence of a reduction in their rate of movement through
the molecular layer and Bergmann glia (Lauder, 1979 ). In addition,
ectopic localization of Purkinje cells is a typical abnormality found
in the hypothyroid cerebellum, which remarkably also occurs to much
higher extent in reeler mice (Mariani et al., 1977 ; Legrand,
1984 ; Miyata et al., 1997 and references therein). In contrast,
cerebral neuronal migration has been traditionally considered to be
unaltered by hypothyroidism, possibly because of the fact that this
process is mostly completed before birth, and also by the presumption
that the fetal brain is insensitive to thyroid hormone (Schwartz et
al., 1997 ). However, recent data have led to a reconsideration of this
notion. An abnormal laminar distribution has been reported in the
auditory cortex of hypothyroid rats, including an increased number of
neurons in layers V/VI, a concomitant decrease in layers II to IV, and
the abnormal presence of neurons in the subcortical white matter
(Berbel et al., 1993 ; Lucio et al., 1997 ). These cytoarchitectonic
abnormalities most probably reflect migration defects in the cortex.
Also, it has recently been shown that iodine deficiency causes an
impaired maturation of hippocampal radial glial cells, which are
involved in neuronal migration (Martínez-Galán et al.,
1997 ). Additionally, hypothyroidism affects the migration of cells from
germinative zones toward the olfactory bulb and caudate putamen region
(Patel et al., 1976 ; Lu and Brown, 1977 ). These observations can be
linked to the reduction in Reelin content in the hypothyroid brain
during the perinatal period reported here. The abnormal expression of reelin at around birth argues against the proposed thyroid
resistance of the fetal brain and clearly indicates that
reelin is an early target of thyroid action during late
fetal development.
This work provides the first demonstration that thyroid hormone
regulates the expression of reelin, a gene implicated in the control of neuronal migration. Recently, other mutant mice such as
those lacking the cdk5 or p35 genes have been
shown to display also migration deficits that disrupt normal cortical
lamination (Ohshima et al., 1996 ; Chae et al., 1997 ; Kwon and Tsai,
1998 ). Although the patterns of alterations throughout the brains of these mice are distinct, suggesting that p35/cdk5 and
reelin probably signal through different pathways, our
results suggest that it may be interesting to analyze whether
cdk5/p35 are under thyroid control.
Our results show that the migration deficits observed in the
hypothyroid brain may in part be caused by alterations in
reelin expression. Previously, we reported changes in the
expression of other genes such as tenascin-C and neural cell adhesion
molecule, which could also contribute to alterations in cell migration
(Iglesias et al., 1996 ; Alvarez-Dolado et al., 1998 ). The complexity of the processes underlying cell migration (dynamic changes in
cytoskeleton and in cell to cell and cell to matrix adhesion, active
movement, degradation of extracellular matrix) suggests the existence
of multiple sites of possible regulation. Among them, and according to
the drastic phenotype caused by its lack of expression,
reelin seems to be clearly relevant. The finding that
thyroid hormone influences reelin expression suggests a
molecular mechanism that may be of fundamental importance in
understanding the alterations that occur in the hypothyroid brain
during development.
 |
FOOTNOTES |
Received March 15, 1999; revised May 11, 1999; accepted May 21, 1999.
This work was supported by grants from Comisión Interministerial
de Ciencia y Tecnología, Plan Nacional de Salud (SAF98-0060 to
A.M. and SAF98-0106 to E.S.), by Marató de TV3 Foundation to
E.S., by the National Cancer Institute (Grant CA41702) to Jonathan Cooper and B.H., and by the Japanese Ministry of Education, Science, and Culture to K.N. T.C. was supported in part by National
Institutes of Health Cancer Center Support CORE Grant P30 CA21765 and
by the American Lebanese Syrian Associated Charities. E.S., K.N., and
T.C. were supported also by the Human Frontier Science Program Organization. We thank Fernando Núñez and Pablo Señor
for the care of animals, and Margarita González for technical help.
Correspondence should be addressed to Dr. Alberto Muñoz,
Instituto de Investigaciones Biomédicas, Arturo Duperier, 4, 28029 Madrid, Spain.
 |
REFERENCES |
-
Alcántara S,
Ruiz M,
D'Arcangelo G,
Ezan F,
de Lecea L,
Curran T,
Sotelo C,
Soriano E
(1998)
Regional and cellular patterns of reelin mRNA expression in the forebrain of the developing and adult mouse.
J Neurosci
18:7779-7799[Abstract/Free Full Text].
-
Alvarez-Dolado M,
Iglesias T,
Rodríguez-Peña A,
Bernal J,
Muñoz A
(1994)
Expression of neurotrophins and the trk family of neurotrophin receptors in normal and hypothyroid rat brain.
Mol Brain Res
27:249-257[Medline].
-
Alvarez-Dolado M,
González-Sancho J,
Bernal J,
Muñoz A
(1998)
Developmental expression of tenascin-C is altered by hypothyroidism in the rat brain.
Neuroscience
84:309-322[Web of Science][Medline].
-
Aniello F,
Couchie D,
Bridoux AM,
Gripois D,
Nunez J
(1991)
Splicing of juvenile and adult tau m-RNA variants is regulated by thyroid hormone.
Proc Natl Acad Sci USA
88:4035-4039[Abstract/Free Full Text].
-
Berbel P,
Guadaño-Ferraz A,
Martínez M,
Quiles J,
Balboa R,
Innocenti G
(1993)
Organization of auditory callosal connections in hypothyroid rats.
Eur J Neurosci
5:1465-1478[Web of Science][Medline].
-
Bernal J,
Guadaño-Ferraz A
(1998)
Thyroid hormone and the development of the brain.
Curr Opin Endocrinol Diabetes
5:296-302.
-
Borrell V,
Del Río JA,
Alcántara S,
Derer M,
D'Arcangelo G,
Nakajima K,
Mikoshiba K,
Derer P,
Curran T,
Soriano E
(1999)
Reelin regulates the development and synaptogenesis of layer-specific hippocampal connections.
J Neurosci
19:1345-1358[Abstract/Free Full Text].
-
Caviness Jr VS,
Sidman RL
(1973)
Time of origin of corresponding cell classes in the cerebral cortex of normal and mutant reeler mice: an autoradiographic analysis.
J Comp Neurol
148:141-152[Web of Science][Medline].
-
Chae T,
Kwon YT,
Bronson R,
Dikkes P,
Li E,
Tsai LH
(1997)
Mice lacking p35, a neuronal specific activator of Cdk5, display cortical lamination defects, seizures, and adult lethality.
Neuron
18:29-42[Web of Science][Medline].
-
Chomczynski P,
Sacchi N
(1987)
Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:156-159[Web of Science][Medline].
-
Clos J,
Legrand CH
(1990)
An interaction between thyroid hormone and nerve growth factor promotes the development of hippocampus, olfactory bulbs and cerebellum: a comparative biochemical study of normal and hypothyroid rats.
Growth Factor
3:205-220.
-
D'Arcangelo G,
Miao GG,
Chen S-C,
Soares HD,
Morgan JI,
Curran T
(1995)
A protein related to extracellular matrix proteins deleted in the mouse mutant reeler.
Nature
374:719-723[Medline].
-
D'Arcangelo G,
Nakajima K,
Miyata T,
Ogawa M,
Mikoshiba K,
Curran T
(1997)
Reelin is a secreted glycoprotein recognized by the CR-50 monoclonal antibody.
J Neurosci
17:23-31[Abstract/Free Full Text].
-
de Lecea L,
Soriano E,
Criado JR,
Steffensen SL,
Henriksen SJ,
Sutcliffe JG
(1994)
Transcripts encoding a neural membrane CD26 peptidase-like protein are stimulated by synaptic activity.
Mol Brain Res
25:286-296[Medline].
-
de Lecea L,
Del Río JA,
Criado JR,
Alcántara S,
Morales M,
Henriksen SJ,
Soriano E,
Sutcliffe JG
(1997)
Cortistatin is expressed in a distinct subset of cortical interneurons.
J Neurosci
17:5868-5880[Abstract/Free Full Text].
-
DeLong GR
(1990)
The effect of iodine deficiency on neuromuscular development.
IDD Newsletter
6:1-12.
-
Del Río JA,
Martínez A,
Fonseca M,
Auladell C,
Soriano E
(1995)
Glutamate-like immunoreactivity and fate of Cajal-Retzius cells in the murine cortex as identified with calretinin antibody.
Cereb Cortex
5:13-21[Abstract/Free Full Text].
-
Del Río JA,
Heimrich B,
Supèr H,
Borrell V,
Frotscher M,
Soriano E
(1996)
Differential survival of Cajal-Retzius cells in organotypic slice cultures of neocortex and hippocampus.
J Neurosci
16:6896-6907[Abstract/Free Full Text].
-
Del Río JA,
Heimrich B,
Borrell V,
Forster E,
Drakew A,
Alcántara S,
Nakajima K,
Miyata T,
Ogawa M,
Mikoshiba M,
Derer P,
Frotscher M,
Soriano E
(1997)
A role for Cajal-Retzius cells and Reelin in the development of hippocampal connections.
Nature
385:70-75[Medline].
-
Derer P
(1985)
Comparative localization of Cajal-Retzius cells in the neocortex of normal and reeler mutant mice fetuses.
Neurosci Lett
54:1-6[Web of Science][Medline].
-
des Portes V,
Pinard JM,
Billuart P,
Vinet MC,
Koulakoff A,
Carrié A,
Gelot A,
Dupuis E,
Motte J,
Berwald-Netter Y,
Catala M,
Kahn A,
Beldjord C,
Chelly J
(1998)
A novel CNS gene required for neuronal migration and involved in X-linked subcortical laminar heterotopia and lissencephaly syndrome.
Cell
92:51-61[Web of Science][Medline].
-
Dickson PW,
Aldred AR,
Menting JGT,
Marley PD,
Sawyer WH,
Schreiber G
(1987)
Thyroxine transport in choroid plexus.
J Biol Chem
262:13907-13915[Abstract/Free Full Text].
-
Dussault JH,
Ruel J
(1987)
Thyroid hormones and brain development.
Annu Rev Physiol
49:321-334[Web of Science][Medline].
-
Eksloglu YZ,
Scheffer IE,
Cardenas P,
Knoll J,
DiMario F,
Ramsby G,
Berg M,
Kamuro K,
Berkovic SF,
Duyk GM,
Parisi J,
Huttenlocker PR,
Walsh CA
(1996)
Periventricular heterotopia: An X-linked dominant epilepsy locus causing aberrant cerebral cortical development.
Neuron
16:77-87[Web of Science][Medline].
-
Feinberg PA,
Vogelstein B
(1983)
A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity.
Anal Biochem
137:266-267.
-
Figueiredo BC,
Almazán G,
Ma Y,
Teztlaff W,
Miller FD,
Cuello AC
(1993)
Gene expression in the developing cerebellum during perinatal hypo- and hyperthyroidism.
Mol Brain Res
17:258-268[Medline].
-
Gleeson JG,
Allen KM,
Fox JW,
Lamperti ED,
Berkovic S,
Scheffer I,
Cooper EC,
Dobyns WB,
Minnrath SR,
Ross ME,
Walsh CA
(1998)
doublecortin, a brain-specific gene mutated in human X-linked lissencephaly and double cortex syndrome, encodes a putative signaling protein.
Cell
92:63-72[Web of Science][Medline].
-
Goffinet AM
(1980)
The cerebral cortex of the reeler embryo (an electron microscopic analysis).
Anat Embryol
159:199-210[Medline].
-
Goffinet AM
(1992)
The reeler gene: a clue to brain development and evolution.
Int J Dev Biol
36:101-107[Web of Science][Medline].
-
Hatten ME
(1993)
The role of migration in central nervous system neuronal development.
Curr Opin Neurobiol
3:38-44[Medline].
-
Hirotsune S,
Takahara T,
Sasaki N,
Hirose K,
Yoshiki A,
Ohashi T,
Kusakabe M,
Murakami Y,
Muramatsu M,
Watanabe S,
Nakao K,
Katsuki M,
Hayashizaki Y
(1995)
The reeler gene encodes a protein with an EGF-like motif expressed by pioneer neurons.
Nat Genet
10:77-83[Web of Science][Medline].
-
Howell BW,
Gertler FB,
Cooper JA
(1997a)
Mouse disabled (mdab1): a Src-binding protein implicated in neuronal development.
EMBO J
16:121-132[Web of Science][Medline].
-
Howell BW,
Hawkes R,
Soriano P,
Cooper JA
(1997b)
Neuronal position in the developing brain is regulated by mouse disabled-1.
Nature
389:733-737[Medline].
-
Howell BW,
Herrick TM,
Cooper JA
(1999)
Reelin-induced tyrosine phosphorylation of disabled 1 during neuronal positioning.
Genes Dev
13:643-648[Abstract/Free Full Text].
-
Iglesias T,
Caubín J,
Stunnenberg HG,
Zaballos A,
Bernal J,
Muñoz A
(1996)
Thyroid hormone-dependent transcriptional repression of neuronal cell adhesion molecule during brain maturation.
EMBO J
15:4307-4316[Web of Science][Medline].
-
Kwon YT,
Tsai LH
(1998)
A novel disruption of cortical development in p35
/ mice distinct from reeler.
J Comp Neurol
395:510-522[Web of Science][Medline]. -
Lauder JM
(1979)
Granule cell migration in the developing rat cerebellum. Influence of neonatal hypo- and hyper-thyroidism.
Dev Biol
70:105[Web of Science][Medline].
-
Lazar MA
(1993)
Thyroid hormone receptors: multiple forms, multiple possibilities.
Endocr Rev
14:184-193[Abstract/Free Full Text].
-
Legrand J
(1984)
Effects of thyroid hormones on central nervous system.
In: Neurobehavioural teratology (Yanai J,
ed), pp 331-363. Amsterdam: Elsevier/North Holland.
-
Lindholm D,
Castrén E,
Tsoulfas P,
Kolbel R,
Berzaghi MP,
Leingärtner A,
Heisenberg CP,
Tesarollo L,
Parada LP,
Thoenen H
(1993)
Neurotrophin-3 induced by triiodothyronine in cerebellar granule cells promotes Purkinje cell differentiation.
J Cell Biol
122:443-450[Abstract/Free Full Text].
-
Lu E,
Brown W
(1977)
The developing caudate nucleus in the euthyroid and hypothyroid rat.
J Comp Neurol
171:261-284[Web of Science][Medline].
-
Lucio RA,
García JV,
Cerezo JR,
Pacheco P,
Innocenti GM,
Berbel P
(1997)
The development of auditory callosal connections in normal and hypothyroid rats.
Cereb Cortex
7:303-316[Abstract/Free Full Text].
-
Marchant B,
Brownlie BEW,
Hart DM,
Horton PW,
Alexander WD
(1977)
The placental transfer of propylthiouracil, methimazole and carbamidazole.
J Clin Endocrinol Metab
45:1187-1193[Abstract/Free Full Text].
-
Mariani J,
Crepel F,
Mikoshiba K,
Changeux JP,
Sotelo C
(1977)
Anatomical, physiological and biochemical studies of the cerebellum from reeler mutant mouse.
Philos Trans R Soc Lond B Biol Sci
281:1-28[Abstract/Free Full Text].
-
Marín-Padilla M
(1971)
Early prenatal ontogenesis of the cerebral cortex (neocortex) of the Felix domestica. A Golgi study. I. The primordial neocortical organization.
Z Anat Entwicklungsgesch
134:117-145[Web of Science][Medline].
-
Marín-Padilla M
(1998)
Cajal-Retzius cells and the development of the neocortex.
Trends Neurosci
21:64-71[Medline].
-
Martínez-Galán J,
Pedraza P,
Santacana M,
Escobar del Rey F,
Morreale de Escobar G,
Ruiz-Marcos A
(1997)
Early effects of iodine deficiency on radial glial cells of the hippocampus of the rat fetus. A model of neurological cretinism.
J Clin Invest
99:2701-2709[Web of Science][Medline].
-
Meyer G,
Soria JM,
Martínez-Galán JR,
Martín-Clemente B,
Fairén A
(1998)
Different origins and developmental histories of transient neurons in the marginal zone of the fetal and neonatal rat cortex.
J Comp Neurol
397:493-518[Web of Science][Medline].
-
Miyata T,
Nakajima K,
Aruga J,
Takahashi S,
Ikenaka K,
Mikoshiba K,
Ogawa M
(1996)
Distribution of reelin-gene related antigen in the developing cerebellum: an immunohistochemical study with an allogenic antibody CR-50 on normal and reeler mice.
J Comp Neurol
372:899-912.
-
Miyata T,
Nakajima K,
Aruga J,
Mikoshiba K,
Ogawa M
(1997)
Regulation of Purkinje cell alignment by reelin as reveled with CR-50 antibody.
J Neurosci
15:3599-3609.
-
Muñoz A,
Bernal J
(1997)
Biological activities of thyroid hormone receptors.
Eur J Endocrinol
137:433-445[Web of Science][Medline].
-
Muñoz A,
Rodríguez-Peña A,
Pérez-Castillo A,
Ferreiro B,
Sutcliffe JG,
Bernal J
(1991)
Effects of neonatal hypothyroidism on rat brain gene expression.
Mol Endocrinol
5:273-280[Abstract/Free Full Text].
-
Muñoz A,
Wrighton C,
Seliger B,
Bernal J,
Beug H
(1993)
Thyroid hormone receptor/c-erbA: control of commitment and differentiation in the neuronal/chromaffin progenitor line PC12.
J Cell Biol
121:423-438[Abstract/Free Full Text].
-
Nakajima N,
Mikoshiba K,
Miyata T,
Kudo C,
Ogawa M
(1997)
Disruption of hippocampal development in vivo by CR-50 mAb against Reelin.
Proc Natl Acad Sci USA
94:8196-8201[Abstract/Free Full Text].
-
Neveu I,
Arenas E
(1996)
Neurotrophins promote the survival and development of neurons in the cerebellum of hypothyroid rats in vivo.
J Cell Biol
133:631-646[Abstract/Free Full Text].
-
Ogawa M,
Miyata T,
Nakajima K,
Yagyu K,
Seike M,
Ikenaka K,
Yamamoto H,
Mikoshiba K
(1995)
The reeler gene-associated antigen on Cajal-Retzius neurons is a crucial molecule for laminar organization of cortical neurons.
Neuron
14:899-912[Web of Science][Medline].
-
Ohshima T,
Ward JM,
Huh CG,
Longenecker G,
Veeranna,
Pant HC,
Brady RO,
Martin LJ,
Kulkarni AB
(1996)
Targeted disruption of the cyclin-dependent kinase 5 gene results in abnormal corticogenesis, neuronal pathology and perinatal death.
Proc Natl Acad Sci USA
93:11173-11178[Abstract/Free Full Text].
-
Oppenheimer JH,
Schwartz HL
(1997)
Molecular basis of thyroid hormone-dependent brain development.
Endocr Rev
18:462-475[Abstract/Free Full Text].
-
Patel AJ,
Rabie A,
Lewis P,
Balazs R
(1976)
Effects of thyroid deficiency on postnatal cell formation in the rat brain. A biochemical investigation.
Brain Res
104:33-48[Web of Science][Medline].
-
Patel AJ,
Hayashi M,
Hunt A
(1988)
Role of thyroid hormone and nerve growth factor in the development of choline acetyltransferase and other cell-specific marker enzymes in the basal forebrain of the rat.
J Neurochem
50:803-811[Web of Science][Medline].
-
Paxinos G,
Törk I,
Tecott LH,
Valentino KL
(1994)
In: Atlas of the developing rat brain. London: Academic.
-
Porterfield SP,
Hendrich CE
(1993)
The role of thyroid hormones in prenatal and neonatal neurological development. Current perspectives.
Endocr Rev
14:94-106[Abstract/Free Full Text].
-
Rakic P
(1988)
Specification of cerebral cortical areas.
Science
241:170-176[Abstract/Free Full Text].
-
Rakic P
(1990)
Principles of neural cell migration.
Experientia
46:882-891[Web of Science][Medline].
-
Rakic P,
Caviness Jr VS
(1995)
Cortical development: view from neurological mutants two decades later.
Neuron
14:1101-1103[Web of Science][Medline].
-
Rice DS,
Sheldon M,
D'Arcangelo G,
Nakajima K,
Goldowitz D,
Curran T
(1998)
Disabled-1 acts downstream of Reelin in a signaling pathway that controls laminar organization in the mammalian brain.
Development
125:3719-3729[Abstract].
-
Ringstedt T,
Linnarsson S,
Wagner J,
Lendahl U,
Kokaia Z,
Arenas E,
Ernfors P,
Ibañez CF
(1998)
BDNF regulates reelin expression and cajal-retzius cell development in the cerebral cortex.
Neuron
21:305-315[Web of Science][Medline].
-
Rodríguez-Peña A,
Ibarrola N,
Iñiguez MA,
Muñoz A,
Bernal J
(1993)
Neonatal hypothyroidism affects the timely expression of myelin-associated glycoprotein in the rat brain.
J Clin Invest
91:812-818.
-
Sabath DE,
Broome HE,
Prytowsky MB
(1990)
Glyceraldehyde-3-phosphate dehydrogenase mRNA is a major interleukin 2-induced transcript in a cloned T-helper lymphocyte.
Gene
91:185-191[Web of Science][Medline].
-
Sambrook J,
Fritsch EF,
Maniatis T
(1989)
In: Molecular Cloning: a Laboratory Manual, Ed 2 Cold Spring Harbor, NY: Cold Spring Harbour Laboratory.
-
Schiffmann SN,
Bernier B,
Goffinet A
(1997)
reelin mRNA expression during mouse brain development.
Eur J Neurosci
9:1055-1071[Web of Science][Medline].
-
Schwartz HL,
Ross M,
Oppenheimer JH
(1997)
Lack of effects of thyroid hormone on late fetal rat brain development.
Endocrinology
138:3119-3124[Abstract/Free Full Text].
-
Sheldon M,
Rice DS,
D'Arcangelo G,
Yoneshima H,
Nakajima K,
Mikoshiba K,
Howell BW,
Cooper JA,
Goldowitz D,
Curran T
(1997)
scrambler and yotari disrupt the disabled gene and produce a reeler-like phenotype in mice.
Nature
389:730-733[Medline].
-
Sidman RL,
Angevine Jr JB,
Taber-Pierce E
(1971)
In: Atlas of the mouse brain and spinal cord. Cambridge, MA: Harvard UP.
-
Soriano E,
Del Río J A,
Martínez A,
Supèr H
(1994)
Organization of the embryonic and early postnatal murine hippocampus. I. Immunocytochemical characterization of neuronal populations in the subplate and marginal zone.
J Comp Neurol
342:571-595[Web of Science][Medline].
-
Stoppini L,
Buchs PA,
Muller D
(1991)
A simple method for organotypic cultures of nervous tissue.
J Neurosci Methods
37:173-182[Web of Science][Medline].
-
Vennström B,
Bishop JM
(1982)
Isolation and characterization of chicken DNA homologous to the two putative oncogenes of avian erythroblastosis virus.
Cell
28:135-143[Medline].
-
Walker P,
Weichsel ME,
Eveleth D,
Fisher DA
(1982)
Ontogenesis of nerve growth factor and epidermal growth factor in submaxillary glands and nerve growth factor in brains of immature male mice: correlation with ontogenesis of serum levels of thyroid hormones.
Pediatr Res
16:520-524[Web of Science][Medline].
-
Xanthoudakis S,
Miao G,
Wang F,
Pan YC,
Curran T
(1992)
Redox activation of Fos-Jun DNA binding activity is mediated by a DNA repair enzyme.
EMBO J
11:3323-3335[Web of Science][Medline].
-
Yamada T,
Kajihara A,
Takemura Y,
Onaya T
(1974)
Antithyroid compounds.
In: Handbook of Physiology (Greer MA,
Solomon DH,
eds)., section 7, Vol 3, pp. 345-357. Washington: American Physiology Society.
-
Yoneshima H,
Nagata E,
Matsumoto M,
Yamada M,
Makajima K,
Miyata T,
Ogawa M,
Mikoshiba K
(1997)
A novel neurological mutant mouse, yotari, which exhibits reeler- like phenotype but expresses CR-50 antigen/reelin.
Neurosci Res
29:217-223[Web of Science][Medline].
-
Zilles K
(1985)
In: The cortex of the rat. A stereotaxic atlas. Berlin: Springer.
Copyright © 1999 Society for Neuroscience 0270-6474/99/19166979-15$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
M. Zikova, A. Corlett, Z. Bendova, P. Pajer, and P. Bartunek
DISP3, a Sterol-Sensing Domain-Containing Protein that Links Thyroid Hormone Action and Cholesterol Metabolism
Mol. Endocrinol.,
April 1, 2009;
23(4):
520 - 528.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Saunier
How Low Can Maternal Thyroxin Go?
Endocrinology,
June 1, 2007;
148(6):
2591 - 2592.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. H. Goodman and M. E. Gilbert
Modest Thyroid Hormone Insufficiency during Development Induces a Cellular Malformation in the Corpus Callosum: A Model of Cortical Dysplasia
Endocrinology,
June 1, 2007;
148(6):
2593 - 2597.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. G. Trentin
Thyroid hormone and astrocyte morphogenesis.
J. Endocrinol.,
May 1, 2006;
189(2):
189 - 197.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Botella-Lopez, F. Burgaya, R. Gavin, M. S. Garcia-Ayllon, E. Gomez-Tortosa, J. Pena-Casanova, J. M. Urena, J. A. Del Rio, R. Blesa, E. Soriano, et al.
Reelin expression and glycosylation patterns are altered in Alzheimer's disease
PNAS,
April 4, 2006;
103(14):
5573 - 5578.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Gonzalez-Billault, J. A. Del Rio, J. M. Urena, E. M. Jimenez-Mateos, M. J. Barallobre, M. Pascual, L. Pujadas, S. Simo, A. L. Torre, R. Gavin, et al.
A role of MAP1B in Reelin-dependent Neuronal Migration
Cereb Cortex,
August 1, 2005;
15(8):
1134 - 1145.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. M. Rodier
Environmental Causes of Central Nervous System Maldevelopment
Pediatrics,
April 1, 2004;
113(4/S1):
1076 - 1083.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Manzano, B. Morte, T. S. Scanlan, and J. Bernal
Differential Effects of Triiodothyronine and the Thyroid Hormone Receptor {beta}-Specific Agonist GC-1 on Thyroid Hormone Target Genes in the Brain
Endocrinology,
December 1, 2003;
144(12):
5480 - 5487.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Martinez and F. C. A. Gomes
Neuritogenesis Induced by Thyroid Hormone-treated Astrocytes Is Mediated by Epidermal Growth Factor/Mitogen-activated Protein Kinase-Phosphatidylinositol 3-Kinase Pathways and Involves Modulation of Extracellular Matrix Proteins
J. Biol. Chem.,
December 13, 2002;
277(51):
49311 - 49318.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. R. Smith, C. D. Capo-chichi, J. He, J. L. Smedberg, D.-H. Yang, A. H. Prowse, A. K. Godwin, T. C. Hamilton, and X.-X. Xu
Disabled-2 Mediates c-Fos Suppression and the Cell Growth Regulatory Activity of Retinoic Acid in Embryonic Carcinoma Cells
J. Biol. Chem.,
December 7, 2001;
276(50):
47303 - 47310.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. M. Yen
Physiological and Molecular Basis of Thyroid Hormone Action
Physiol Rev,
July 1, 2001;
81(3):
1097 - 1142.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. R. S. Lima, A. Gervais, C. Colin, M. Izembart, V. M. Neto, and M. Mallat
Regulation of Microglial Development: A Novel Role for Thyroid Hormone
J. Neurosci.,
March 15, 2001;
21(6):
2028 - 2038.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Morreale de Escobar, M. Jesús Obregón, and F. Escobar del Rey
Is Neuropsychological Development Related to Maternal Hypothyroidism or to Maternal Hypothyroxinemia?
J. Clin. Endocrinol. Metab.,
November 1, 2000;
85(11):
3975 - 3987.
[Abstract]
[Full Text]
|
 |
|
|