 |
Previous Article | Next Article 
The Journal of Neuroscience, September 1, 1999, 19(17):7278-7288
Formation of Compact Myelin Is Required for Maturation of the
Axonal Cytoskeleton
Scott T.
Brady1,
Andrea S.
Witt1,
Laura L.
Kirkpatrick2,
Sylvie M.
de Waegh3,
Carol
Readhead4,
Pang-Hsien
Tu5, and
Virginia M.-Y.
Lee5
1 University of Texas Southwestern Medical Center,
Department of Cell Biology and Neuroscience, Dallas, Texas
75235-9039, 2 Baylor College of Medicine, Department of
Molecular and Human Genetics, Houston, Texas 77030, 3 University of Wisconsin, Madison, Wisconsin 53706, 4 California Institute of Technology, Biological Imaging
Center, Pasadena, California 91125, and 5 University of
Pennsylvania School of Medicine, Pathology, and Laboratory Medicine,
Philadelphia, Pennsylvania 19104-4283
 |
ABSTRACT |
Although traditional roles ascribed to myelinating glial cells are
structural and supportive, the importance of compact myelin for proper
functioning of the nervous system can be inferred from mutations in
myelin proteins and neuropathologies associated with loss of myelin.
Myelinating Schwann cells are known to affect local properties of
peripheral axons (de Waegh et al., 1992 ), but little is known about
effects of oligodendrocytes on CNS axons. The shiverer mutant
mouse has a deletion in the myelin basic protein gene that eliminates
compact myelin in the CNS. In shiverer mice, both local axonal features
like phosphorylation of cytoskeletal proteins and neuronal perikaryon
functions like cytoskeletal gene expression are altered. This leads to
changes in the organization and composition of the axonal cytoskeleton
in shiverer unmyelinated axons relative to age-matched wild-type
myelinated fibers, although connectivity and patterns of neuronal
activity are comparable. Remarkably, transgenic shiverer mice with thin
myelin sheaths display an intermediate phenotype indicating that CNS
neurons are sensitive to myelin sheath thickness. These results
indicate that formation of a normal compact myelin sheath is required
for normal maturation of the neuronal cytoskeleton in large CNS neurons.
Key words:
myelin; cytoskeleton; neurofilaments; oligodendrocytes; slow axonal transport; phosphorylation
 |
INTRODUCTION |
The first description of non-neuronal
cells in nervous tissue is generally attributed to Virchow (1846) , when
he described material that filled spaces between nerve elements. For
much of the last century and a half, the operational definition of glia for many neuroscientists was not much more detailed. Although a
substantial literature has accrued on glia (Kettenmann and Ransom, 1995 ), the roles of glia in the nervous system remain less well defined
than those of neurons. Contemporary neuroscience texts list glial
functions variously as providing structural support for neurons,
formation of myelin sheaths for insulating large axons, buffering of
ionic environment and clearance of neurotransmitters, and poorly
defined nutritive activities. However, recent evidence suggests a wider
range of glial activities affecting neuronal function. In particular,
cell-cell communication between neurons and glia may be more extensive
than previously thought. Given the intimate relationship between
myelinating glia and their associated axons, the potential of
myelin-forming glia to affect neuronal properties is considerable.
Analysis of axons in mice with mutations affecting myelination has
proven particularly instructive. For example, Trembler mice are
characterized by demyelination of large axons in the peripheral nervous
system (PNS) (Low and McLeod, 1975 ) with no significant effect on
myelination of CNS axons. Trembler is a dominant mutation with several
alleles, all associated with alterations in a peripheral myelin
protein, PMP22 (Suter et al., 1992a ,b ). PMP22 is also defective in
Charcot-Marie-Tooth type IA peripheral neuropathy (Lupski et al.,
1991 ), making Trembler a homolog of the human disease. Affected PNS
axons undergo continuing cycles of myelination and demyelination,
resulting in a high percentage of large axons with little or no compact
myelin (Low, 1976a ,b ).
Studies on Trembler mouse nerves revealed significant changes in large
peripheral axons associated with demyelination. Both organization and
dynamics of the axonal cytoskeleton in PNS nerves were altered by
demyelination. Remarkably, most changes were restricted to axon
segments without compact myelin (Aguayo et al., 1977 ; de Waegh et al.,
1992 ). Local alterations in axons included rates of slow axonal
transport (de Waegh and Brady, 1990 ; de Waegh et al., 1992 ),
phosphorylation of neurofilament and microtubule protein (de Waegh et
al., 1992 ; Kirkpatrick and Brady, 1994 ), and neurofilament density (de
Waegh and Brady, 1991 ; de Waegh et al., 1992 ). Subsequent studies on
normal myelinated fibers and other models of PNS hypomyelination confirmed that myelination locally influences neurofilament density and
phosphorylation (Mata et al., 1992 ; Cole et al., 1994 ; Hsieh et al.,
1994 ). Gaps in myelin as small as a PNS node of Ranvier produce
dramatic, highly localized changes in axon cytoskeletal organization
(de Waegh, 1990 ; Mata et al., 1992 ; Hsieh et al., 1994 ) and
neurofilament phosphorylation (Mata et al., 1992 ; Hsieh et al., 1994 ).
This led to the proposal that myelinating glia play a primary role in
regulation of axon cytoskeletal organization and targeting of axonal
proteins like sodium channels (de Waegh et al., 1992 ; Brady, 1993 ).
Demyelination-induced changes in PNS axons raised questions about
effects of myelination on CNS axons. CNS myelin is produced by
oligodendrocytes rather than Schwann cells, and some functions served
by Schwann cells in the PNS may be filled by astrocytes in the CNS. The
protein composition (Morell et al., 1994 ) and fine structure (Raine,
1984 ; Peters et al., 1991 ) of CNS myelin differ from PNS myelin.
Because central myelination is unperturbed in Trembler, we analyzed a
different mouse mutant. Shiverer is a recessive mutation with a more
severe phenotype than Trembler. Shiverer mutant mice not only develop a
severe tremor in early postnatal development, but they have a mean life
span of ~100 d (Chernoff, 1981 ). Shiverer mice lack compact CNS
myelin (Readhead and Hood, 1990 ) because of deletion of coding regions
in the myelin basic protein (MBP) gene (Roach et al., 1985 ), a major
structural protein of CNS myelin (Campagnoni and Macklin, 1988 ).
Although MBP is expressed in PNS myelin as well, two PNS-specific
proteins, P0 and P2, appear
to have functional overlap with MBP so PNS myelination is near normal
(Rosenbluth, 1980 ).
Unlike Trembler where PNS axons are subject to a constant cycle of
myelination and demyelination, the absence of a major structural protein for myelin means that shiverer CNS axons never see normal myelin. Studies with various mouse strains indicate that MBP expression can limit myelin sheath formation (Shine et al., 1992 ), and transgenic mice expressing intermediate levels of MBP in a shiverer background (Readhead et al., 1987 ) have been generated. Mice homozygous for the
MBP transgene express only 25% of wild-type MBP levels resulting in
thin compact myelin with few lamellae. However, this is sufficient to
suppress tremors and increase life spans to near wild-type, effecting a
"cure" of this neurogenetic disease (Readhead et al., 1987 ).
Availability of shiverer (shi) and transgenic mice homozygous for the
MBP transgene (MBP/MBP) permitted evaluation of compact myelin effects
on CNS neurons.
A wide range of neuronal parameters were altered in shiverer mouse CNS
tissues. These included differences in slow axonal transport,
cytoskeletal composition, posttranslational modification of
cytoskeletal proteins, axon caliber, and neuronal gene expression. In
each case, neurons in the shiverer mouse exhibited characteristics similar to early postnatal axons before myelination. Remarkably, analysis of these same parameters in the CNS of MBP/MBP mice with minimal tremor and normal life spans revealed a phenotype with features
of both wild-type and shiverer. Rates of slow axonal transport and
levels of NFM neurofilament protein in axons were comparable to
wild-type in MBP/MBP mice, whereas other aspects of the axonal
cytoskeleton and neuronal gene expression in MBP/MBP mice were more
like shiverer.
These results demonstrate that myelinating glia in the CNS profoundly
influence associated neurons and suggest an extensive dialogue between
oligodendrocytes and axons. Myelinating glia influence both local
axonal features like posttranslational modification of cytoskeletal
proteins as well as cytoskeletal gene expression in the neuronal
perikaryon. Incomplete recovery of normal phenotype in neurons of
MBP/MBP mice implies that multiple regulatory pathways exist,
which are somehow modulated by the amount of compact myelin. Taken
together, these results indicate that formation of compact myelin is
required for maturation of the neuronal cytoskeleton in large neurons
of the CNS.
 |
MATERIALS AND METHODS |
All chemicals used were American Chemical Society quality or
better and were obtained from Sigma (St. Louis, MO), Calbiochem (La
Jolla, CA), or Polysciences (Warrington, PA). Shiverer and MBP/MBP
Shiverer transgenic mice (Male and female, 4-6 weeks old, from the
colony maintained by Carol Readhead, Cedars Sinai Medical Center, Los
Angeles, CA) were used for all experiments. Age-matched wild-type mice
(B6C3/F1) were obtained from The Jackson Laboratory (Bar Harbor, ME).
Because shiverer mice are not hardy, all mice were housed in a sterile
environment and were fed sterile food and water throughout the experiments.
Axonal transport labeling and analysis. Proteins in
axonal transport were labeled in mouse optic nerve by intravitreal
injection of 0.5 mCi [35S]methionine
(Trans35S Label; ICN Biochemicals, Costa
Mesa, CA) into the right eye as described previously (Brady, 1985 ).
Injections were made with a 30 gauge needle connected to a Hamilton
syringe by a length of PE20 tubing. Injection-sacrifice intervals
(ISIs) were chosen to catch the peak of the slow component a (SCa) or
slow component b (SCb) wave in the optic nerve and tract. ISIs
used were 4-7 d for SCb, and 18, 21, and 24 d for SCa. Two to
five mice were analyzed at each time point. Mice were euthanized under
anesthesia, then the optic nerve and tract were dissected.
The nerve and tract were cut into 1 mm long segments, and each segment
was homogenized individually in 200 µl BUST (2% -mercaptoethanol, 8 M urea, 1% SDS, 0.1 M Tris, and 0.02%
phenol red). A 5 µl aliquot of each homogenate was counted in a
liquid scintillation counter, and equal aliquots of each segment were
separated by SDS-PAGE on 4-16% (0-6 M urea) gradient
gels. The gels were stained with Coomassie blue and destained, then
processed for fluorography by dehydration in dimethylsulfoxide (DMSO;
2 × 30 min), impregnation with diphenyl oxazole (22% in DMSO, 3 hr) and rehydration (Laskey and Mills, 1975 ). The gels were then dried
and exposed to preflashed x-ray film (Eastman Kodak, Rochester, NY) for
the appropriate time. The amount of radioactivity incorporated into
specific proteins was quantitated by excising the appropriate bands
from the gel using the fluorograph as a template. The bands were
solubilized in 30% hydrogen peroxide for 2 d at 60°C and
counted in a liquid scintillation counter. In some cases, the
fluorograph was analyzed by laser densitometry (Molecular Dynamics,
Sunnyvale, CA).
To permit comparison of transport for individual proteins down the
optic nerve in different animals, the total radioactivity in segments
was summed, and then the segment containing the 50% point of
radioactivity was determined (Hoffman et al., 1983 ). The distance of
the 50% point from cell bodies was then divided by the ISI to
determine the rate of movement. Data for all SCa or SCb time points
were averaged, and statistical significance for differences between
rates was determined by a two-sample t test using DataDesk
software. Data are expressed as the mean ± SEM.
Quantitative immunoblots. Nerve segments were homogenized in
SUB buffer (0.5% SDS, 8 M urea, and 2%
-mercaptoethanol), then electrophoresed on 0.75-mm-thick 6%
polyacrylamide gels essentially as described previously (Cole et al.,
1994 ). Each lane was loaded with ~10 µg of nerve protein. Levels of
neurofilament subunits were analyzed by quantitative immunoblots.
After electrophoresis, proteins were transferred to nitrocellulose and
probed with a monoclonal antibody specific for a highly phosphorylated
neurofilament H (NFH) epitope, RM024, which has been previously
characterized (Lee et al., 1986 , 1987 ). To quantitate levels of
different NF epitopes, immunoblots were washed five times for 3 min
each in GB buffer (50 mM triethanolamine, 0.5% Triton
X-100, 0.1 M NaCl, 2 mM K-EDTA, and 0.1% SDS,
pH 7.5) and once in PTX buffer (10 mM
NaPO4, pH 7.5, 0.2% Triton X-100, 0.15 M NaCl, and 1 mM EGTA). Blots were then
incubated at room temperature in 125I-goat
anti-mouse IgG (2 × 106 dpm/ml) in
PTX buffer supplemented with 4% bovine serum albumin. After
incubation, immunoblots were washed again five times for 3 min in GB
buffer. Finally, blots were exposed to a PhosphorImager phosphor
screen, the screens were digitized on a PhosphorImager, and radioactive
bands were analyzed using the ImageQuant software (Molecular Dynamics,
Sunnyvale, CA). The amount of immunoreactivity was evaluated by
comparing shiverer, MBP/MBP transgenic, and wild-type samples on the
same blot.
Northern analyses. An NFH-specific probe was obtained using
PCR with forward (GCTGAAGCCAAATCTCCAGCTAC) and reverse
(AGGACTTTCACCTGCTCAGGG) primers directed against the C-terminal KSP
repeat region of NFH. A 15 kb genomic fragment (a gift of Dr.
Jean-Pierre Julien, McGill University, Montreal, Quebec, Canada) was
used as a starting template with primers. A 612 bp NFH probe was
generated using 30 cycles with 45 sec at 94°C, 1 min at 61°C, and 1 min 30 sec at 73°C. A neurofilament M (NFM) probe was made by
amplifying a 355 nucleotide product from a 0.66 kb NFM cDNA fragment
originally cloned by Dr. Jean-Pierre Julien subcloned into a pUC8
vector. Forward and reverse primers were, respectively:
CAGGATCTCCTTAACGTCAAGATGG and TTTCGGCTTCTGGTTCCTCCTC. The NFM probe was
generated using 30 cycles with 45 sec at 94°C, 1 min at 58°C, and 1 min 30 sec at 73°C with 3 mM MgCl2. A 486 bp
neurofilament L (NFL) probe was generated from a 1.2 kb NFL cDNA
originally cloned by Dr. Nicolas Cowan inserted in puC8. Conditions
used were similar to those used for the NFM probe, except that the
reaction mix used 7 mM MgCl2.
TCAGTTTCACCAGCGTGGGTAG was the forward primer, and TGATGAGGTTGACCTGATTGGG was the reverse primer. A GAPDH oligomer with
sequence CAGGGGGGCTAAGCAGTTGGTGGTGCAGGATGCATTGCTG was used to control
for load. PCR products were labeled to a specific activity of
2-2.5 × 109 dpm/µg using
-[32P]dCTP (3000 Ci/mmol; Amersham,
Arlington Heights, IL) and a random nonamer kit (Readiprime; Amersham).
Oligomers were labeled to a specific activity of 2.5-2.9 × 109 dpm/µg in a T4 kinase end labeling reaction.
Total RNA was isolated from mouse cortex using standard protocols for
guanidinium extraction as described previously (Chomczynski and Sacchi,
1987 ). Five micrograms of total RNA from each animal were run on a 1%
agarose-formaldehyde denaturing gel and transferred to a nylon membrane
(Nytran; Schleicher & Schuell, Keene, NH) in 20 × SSC. RNA was
UV-crosslinked to the membrane at 150 mJ. Membranes were fixed in 5%
acetic acid, stained in methylene blue, and rinsed in DEPC-treated
water to assess RNA transfer. To prevent probe cross reaction, blot
lanes were cut into two sections: one for the neurofilament-specific
probe and one for loading control. Each was prehybridized at 65°C for
a minimum of 2 hr in buffer containing 5× SSPE, 5× Denhardt's
solution, 0.5% SDS, and 20 µg/ml sheared herring sperm DNA. Blots
were incubated overnight at 65°C with 2 × 106 cpm/ml
32P-labeled probes, washed to a final
stringency of 2× SSC, 0.2% SDS at room temperature, and exposed on a
PhosphorImager (Molecular Dynamics) screen. Relative amounts of
neurofilaments were calculated by determining the ratio of the
intensity of the neurofilament and GAPDH signals after background subtraction.
Electron microscopy and morphometry of mouse optic nerve.
Optic nerves were processed for electron microscopy essentially as
described previously for sciatic nerves (de Waegh et al., 1992 ). Anesthetized mice were euthanized. Optic nerves were immediately removed, cut into 1-2 mm segments, and placed into freshly made fixative (2% paraformaldehyde, 2% glutaraldehyde in cacodylate buffer, pH 7.2, 37°C). After 2-3 hr of initial fixation, nerve segments were placed in fresh fixative overnight at 4°C. The nerves were post-fixed with 1% osmium tetroxide, dehydrated, and embedded in
Epon. Thin sections were cut, counterstained with uranyl acetate and
lead citrate, and viewed with a JEOL 1200SX electron microscope. Axons
cut in cross-section were photographed at 50,000×.
Neurofilament and microtubule densities were quantitatively evaluated
in Shiverer, MBP/MBP transgenic, and wild-type mouse optic nerve axons
as described previously (Price et al., 1988 ; de Waegh and Brady, 1991 ;
de Waegh et al., 1992 ). Briefly, a transparency with evenly spaced
hexagons was placed over electron micrographs printed at a final
magnification of 140,000×. At this magnification, each hexagon
represents 0.035 µm2 of axoplasm. All hexagons for
which >90% of their area was within axonal boundaries,
membrane-bounded organelles occupied <10% of the space, and the
neurofilaments and microtubules cut in true cross-section were
used. The number of neurofilaments or microtubules present in
each of the suitable hexagons was counted. At least 60 axons (370 hexagons) were counted for each mouse type. The average number of
neurofilaments or microtubules per hexagon was calculated by dividing
the total number counted by the total number of hexagons. Additionally,
the number of myelin wraps was noted for each axon counted. All values
are expressed ± SEM. Significant differences were determined by a
two-sample t test using Data Desk software.
 |
RESULTS |
Cytoskeletal proteins of the axon are moved with one of the slow
axonal transport rate components: tubulin and neurofilament proteins
move in SCa, whereas some tubulin and actin move in SCb (Brady, 1993 ).
Measurement of slow axonal transport in demyelinated PNS fibers of
Trembler mice found a transport rate for cytoskeletal proteins
significantly slower than wild-type controls. To determine whether CNS
myelin affected transport of cytoskeletal proteins similarly, transport
rates were analyzed in optic nerves and tracts of shiverer, MBP/MBP
transgenic, and wild-type mice as described previously (Brady, 1985 ).
Briefly, 0.5 mCi [35S]methionine was
injected into the vitreous of the eye to pulse label proteins
synthesized in retinal ganglion cells. At various intervals after
labeling, the optic nerve and tract were dissected and cut into 1 mm
segments for gel electrophoresis. Radioactive polypeptides in each
nerve segment were visualized by fluorography (Fig.
1A) and fluorographs used
to estimate rates of transport for cytoskeletal proteins: measuring
neurofilament and microtubule protein distribution for SCa and
measuring actin distribution for SCb.

View larger version (55K):
[in this window]
[in a new window]
|
Figure 1.
SCa and SCb rates are increased in shiverer
relative to control and MBP/MBP shiverer transgenic rates.
A, Slow axonal transport rates were examined by
segmental analysis. [35S]methionine was injected
into the vitreous of the mouse eye, and 21 d after injection,
optic nerve and tracts were harvested and cut into 1 mm segments.
Radioactively labeled proteins in each segment were resolved on
SDS-PAGE gels, processed for fluorography, and exposed to film.
Fluorographs of control, MBP/MBP shiverer transgenic, and shiverer
animals show the wave of radioactively labeled SCa proteins traveling
down the optic nerve and tract. The positions for neurofilament
subunits (H, M, and L) and tubulin doublet (T) are distributed as a
wave in all three animals 21 d after injection. Note that the
peaks for NFH and NFM are in axon segments 3-4 mm for control and
MBP/MBP nerves, but are in segments 5-6 mm for shiverer. Similarly,
the peak of tubulin is 4 mm in control and MBP/MBP shiverer transgenic
animals but 5.5 mm in shiverer animals. Note that NFH is barely
detectable in shiverer and MBP/MBP animals when compared to control,
but NFL levels are comparable. B, Distance from retina
for labeled peaks of actin at 4, 5, and 7 (actin) and for NFM at 18, 21, and 24 d after labeling. Data are plotted for shiverer
(triangles), MBP/MBP transgenics
(circles), and wild-type control (filled
squares), where each symbol is data from a different animal,
and two to five animals were used for each time point. A best fit line
passing through zero is shown for shiverer (short dashed line,
triangle), MBP/MBP transgenic (long dashed line,
circle), and wild-type control (solid line, filled
square). The slope of this line represents the rate of slow
transport.
|
|
Although rates for neurofilament transport in SCa were slower in
Trembler sciatic nerve, labeled neurofilament subunits had moved
further along shiverer nerves than along control nerves at the same
time point (Fig. 1A), indicating a faster rate of transport. Similar changes were seen for distribution of tubulin in SCa
(Fig. 1A) and for actin and various other SCb
proteins (including spectrin and clathrin; data not shown). In contrast to the shiverer, distributions of labeled cytoskeletal proteins in
MBP/MBP transgenic nerves were the same as wild-type for all proteins
examined (Fig. 1A), indicating that the formation of compact myelin was sufficient to alter slow axonal transport rates even
when myelin thickness was only 25% of normal.
Rates of transport for actin and NFM may be estimated by plotting the
distance of their labeled peaks at 4, 5, and 7 (actin) or 18, 21, and
24 d (NFM) after labeling (Fig. 1B), where the slope of the line corresponds to the rate. For both actin and NFM, the
slope was greatest for the shiverer nerves, whereas wild-type and
MBP/MBP slopes were almost the same. Alternatively, rates of transport
may be calculated by measuring how far 50% of the labeled protein had
moved at each time point (Table 1). By
this measure, NFM moved at 0.20 ± 0.02 mm/d in shiverer, which
was significantly different (p 0.05 using a
two-sample t test) from the rate of 0.17 ± 0.03 mm/d
seen in both wild-type and MBP/MBP. Similarly, actin and spectrin moved
at ~0.95 mm/d in shiverer nerves, but only 0.75-0.85 mm/d in
wild-type and MBP/MBP nerves (Table 1). The fact that even reduced
levels of compact myelin were sufficient to restore axonal transport to
near wild-type is consistent with observations on suppression of tremor
and extension of life span in the transgenic (Readhead et al.,
1987 ).
View this table:
[in this window]
[in a new window]
|
Table 1.
Slow axonal transport rates for neurofilament and
microfilament subunits in shiverer, MBP/MBP shiverer transgenic, and
wild-type mouse optic nerve (rates in millimeters per day)
|
|
A different impression emerged from electron microscopic analysis of
nerves on these three types of mouse. Figure
2 shows axonal cross sections from the optic
nerve of wild-type (A, B), MBP/MBP transgenic
(C, D), and shiverer (E, F) mice. The
absence of compact myelin in shiverer is apparent, although
oligodendrocyte processes can be seen to wrap each axon. By comparison,
MBP/MBP nerves typically have only a few lamellae of compact myelin,
much reduced relative that seen in control nerves. However, even
qualitative examination of cytoskeletal elements in the axons indicate
that shiverer and MBP/MBP fibers resemble each other far more than either resembles wild-type fibers. Microtubules are much more abundant
than in wild-type and appear closer to each other, whereas the axoplasm
of both shiverer and MBP/MBP fibers has an increased electron density.

View larger version (121K):
[in this window]
[in a new window]
|
Figure 2.
Axonal neurofilament and microtubule organization
and numbers are altered in MBP/MBP shiverer transgenic and shiverer
optic axons relative to control. Typical axonal cytoskeletons are shown
in electron micrographs of optic nerve axonal cross sections from
wild-type (A, B), MBP/MBP transgenic (C,
D), and shiverer (E, F) mice. The number
and density of microtubules (arrow) are significantly
increased in MBP/MBP transgenic and shiverer axons relative to
wild-type control axons. Neurofilament organization
(arrowhead) appears altered to produce increased
density, although these changes are less dramatic than those seen with
microtubules. Neurofilament numbers may be depressed in the shiverer
and MBP/MBP transgenic axons. Compare the completely myelinated axons
in control to the partially myelinated axons of MBP/MBP shiverer
transgenic animals and unmyelinated axons of shiverer. Although the
density of extracellular material appears similar in micrographs from
each category of mouse, the electron density of axoplasm appears
greatest in MBP/MBP transgenics and is also increased in shiverer
axons. Scale bar, 0.19 µm.
|
|
Differences in axonal microtubules and neurofilaments were even more
striking in quantitative morphometric analyses. The similarities between shiverer and MBP/MBP mice are readily seen in the density distribution of microtubules in optic axons of shiverer, MBP/MBP, and
wild-type mice (Fig. 3A). The mean
number of microtubules per unit hexagon in shiverer was 4.4 and in
MBP/MBP was 4.5. Each of these was significantly different from the
mean of 1.9 microtubules per hexagon for wild-type axons with a
p 0.0001 using a two-sample t test. These
values indicate that axons in shiverer and MBP/MBP nerves averaged
~20-21 microtubules per axon, whereas wild-type axons averaged only
10-11 microtubules per axon.

View larger version (36K):
[in this window]
[in a new window]
|
Figure 3.
Morphometric analyses show changes for both
microtubule and neurofilament density in shiverer and MBP/MBP shiverer
transgenic axons. As a measure of cytoskeletal organization, the
density of microtubules and neurofilaments was examined as described
previously (de Waegh et al., 1992 ). The number of cytoskeletal elements
in random hexagons was evaluated. Both microtubules and neurofilament
densities are shifted to higher values in shiverer axons.
A, Microtubule distributions were similar in shiverer
and MBP/MBP transgenic nerves. The mean number of microtubules per
hexagon was increased in both MBP/MBP transgenic (4.38 ± 0.05; ± SEM) and shiverer (4.53 ± 0.05; ± SEM) axons. These differences
were significant at p 0.0001 (two-sample
t test) when compared to the wild-type control value of
1.9 ± 0.07 (± SEM) MT per hexagon. B, Unlike
microtubules, the neurofilament distribution in MBP/MBP transgenic
nerves was intermediate between shiverer and wild-type control nerves.
The mean number of neurofilaments per hexagon was also significantly
greater in shiverer (4.39 ± 0.06; ± SEM neurofilaments per
hexagon) and MBP/MBP shiverer transgenic (4.75 ± 0.05; ± SEM
neurofilaments per hexagon; in a paired t test relative
to wild-type control) than in control (4.11 ± 0.05 neurofilaments
per hexagon). Differences relative to wild-type control axons are
significant at p 0.0001 (shiverer) and
p = 0.002 (MBP/MBP transgenic) in a paired
t test. Morphometric analyses were conducted by
overlaying a hexagonal grid over electron micrographs of the optic
axonal cross sections printed at a final magnification of 140,000×.
Each hexagon represented an area of 0.035 µm2. The
number of microtubules and neurofilaments per hexagon was scored,
binned, and plotted. The number of microtubules per hexagon ranged
between 0 and 12, whereas the number of neurofilaments per hexagon
ranged from 0 to 23.
|
|
Differences in neurofilament density could also be seen (Fig.
3B), but in this case MBP/MBP neurofilament densities were
intermediate between those of shiverer and wild-type. The mean number
of neurofilaments per unit hexagon in shiverer (± SEM) was 4.85 ± 0.06 and in MBP/MBP was 4.63 ± 0.05, as opposed to a mean of
4.11 ± 0.05 neurofilaments per hexagon in wild-type axons. The
mean of shiverer neurofilaments per hexagon was significantly different
from both wild-type and transgenic with a p 0.0001 in a paired t test, whereas the difference between wild-type
and MBP/MBP was significant at p 0.002. As previously seen in the PNS with Trembler, neurofilament density increases in the absence of compact myelin. In contrast to the large
increase in numbers of microtubules per axon, numbers of neurofilaments
per axon were slightly depressed in shiverer axons with an average of
34-35 neurofilaments per axon in shiverer, 39-40 neurofilaments per
axon in MBP/MBP, and 43-44 neurofilaments per axon in wild-type axons.
The axonal transport experiments (Fig. 1A) not only
showed an increased rate of transport for neurofilaments in shiverer, but also suggested that neurofilament subunit composition was altered.
When the amount of radiolabel associated with each subunit was
expressed as a fraction of total radiolabeled SCa proteins in optic
nerve (Fig. 4A), the
relative amount of NFH was reduced in shiverer and transgenics. The
mean level of NFH was essentially the same in shiverer and MBP/MBP
transgenics. However, the difference between transgenics and wild-type
was significant at p = 0.037 using a two-sample
t test, whereas the difference between shiverer and
wild-type was significant only at p = 0.051 because of
the greater scatter in data from shiverer. In contrast, relative
amounts of NFM were reduced in shiverer nerves relative to both
wild-type and MBP/MBP transgenics (differences were significant at
p = 0.035 and p 0.0001, respectively
in a two-sample t test). NFM protein levels in MBP/MBP
nerves were actually elevated over wild-type levels (difference
significant at p = 0.04 in a two-sample t
test). Although higher molecular weight subunits were decreased in
shiverer, NFL levels were slightly but significantly elevated in
shiverer nerves over both wild-type (p = 0.026)
and MBP/MBP (p 0.013, both using a two-sample
t test). Based on a similar analysis, amounts of tubulin
protein present in shiverer and MBP/MBP nerves were also significantly
increased over wild-type (L. L. Kirkpatrick, A. S. Witt, C. Readhead,
and S. T. Brady, in preparation).

View larger version (29K):
[in this window]
[in a new window]
|
Figure 4.
Neurofilament protein levels and neurofilament
composition are changed in MBP/MBP shiverer transgenic and shiverer
animals relative to control. The amount of NFH, NFM, and NFL protein in
nerves expressed as a fraction of the total protein moving with SCa was
determined by densitometry of fluorographs from axonal transport
studies in wild-type control, MBP/MBP transgenic, and shiverer mice.
A, NFH protein levels are decreased relative to
wild-type control in both MBP/MBP transgenic and shiverer
(n = 17; n = 24; and
n = 17, respectively). The differences in NFH for
shiverer was different from wild-type at p = 0.051, whereas MBP/MBP transgenics were different at p = 0.037. Shiverer and transgenics had a similar mean value for NFH, but
the shiverer data had greater scatter. NFM levels were decreased in
shiverer mice relative to both wild-type (p = 0.035) and transgenics (p 0.0001), but
NFM in MBP/MBP transgenic animals was increased over wild-type
(p = 0.04). NFL levels were not
distinguishable between wild-type control and MBP/MBP transgenics, but
were increased slightly in shiverer relative to both wild-type control
(p = 0.026) and MBP/MBP transgenics
(difference significant at p 0.0001). All
comparisons were made using a two-sample t test.
B, Changes in the relative contributions of NFH, NFM,
and NFL proteins to neurofilament mass illustrate changes in
composition. A larger proportion of shiverer neurofilament consists of
NFL subunits, whereas in control animals the contribution of NFH to the
neurofilament mass is greater than either MBP/MBP transgenic or
shiverer neurofilaments. Similarly, in MBP/MBP shiverer transgenic the
contribution of NFH to neurofilament mass is comparable to that in
shiverer, but the NFM content is greater than in either control or
shiverer animals.
|
|
These values may be used to calculate the relative contribution of each
subunit to total neurofilament mass in the three mouse strains (Fig.
4B). NFH represented only 8% of the mass for
shiverer and MBP/MBP neurofilaments, but comprised 12% of wild-type
neurofilaments. Increased NFM levels in MBP/MBP nerves mean that NFM
constituted a greater fraction of the neurofilaments in transgenic
nerves (33%) than of those in either shiverer (20%) or wild-type
(27%). Similarly, shiverer neurofilaments included a greater
proportion of NFL (73%), whereas the contribution of NFL to MBP/MBP
and wild-type was comparable (59 and 61%, respectively).
Differences in cytoskeletal protein levels seen in shiverer and MBP/MBP
nerves could have been caused by changes in either cytoskeletal gene
expression or protein degradation. When levels of NFH and NFM mRNA were
analyzed by Northern blot analyses of total RNA fractions from
shiverer, MBP/MBP, and wild-type CNS tissue (Fig.
5), striking differences were seen. A probe
specific for NFH recognized a 4.0 kb message, and the same blots were
analyzed with a GAPDH probe to allow normalization for RNA load (Fig.
5A). When expressed as a ratio to wild-type levels, shiverer
NFH mRNA levels were significantly reduced (p = 0.029 using a paired t test) (Fig. 5B). The mean
level of NFH message in MBP/MBP tissue was also reduced (Fig.
5B), but the observed differences were not statistically
significant at the p 0.05 level (n = 5). These results indicate that either transcription or stability of
NFH mRNA is sensitive to the level of myelination.

View larger version (33K):
[in this window]
[in a new window]
|
Figure 5.
Expression levels of NFH are significantly reduced
in shiverer as opposed to wild-type control. The reduced levels of NFH
polypeptide in shiverer and MBP/MBP transgenic is reflected in reduced
levels of NFH mRNA. In contrast, NFM mRNA is not significantly
different from wild-type control in either shiverer or MBP/MBP
transgenic animals. A, Northern blot of NFH and the
GAPDH loading control. The expression of the 4.0 kb NFH transcript
appeared to be reduced in shiverer when compared to control or MBP/MBP
transgenic animals. The NFH mRNA levels in MBP/MBP transgenic appeared
to be slightly reduced. Each lane contains 5 µg of total RNA isolated
from the cortices of age-matched animals. B,
Quantitation of the NFH expression levels (n = 5).
After normalizing with GAPDH, a ratio of NFH expression was calculated,
and the expression level of shiverer and MBP/MBP shiverer transgenic
was normalized to control expression levels. The levels of NFH
expression were significantly reduced in shiverer relative to control
(p = 0.029 in a paired t
test). Although levels of NFH expression in MBP/MBP shiverer transgenic
animals were consistently reduced as opposed to wild-type control and
consistently higher than shiverer NFH expression levels, the
differences were not significant at p 0.05. C, Northern blot of NFM and GAPDH loading control. No
consistent differences in mRNA expression levels were apparent.
D, Quantitation of relative NFM levels in the three
animals (n = 11). NFM levels were not significantly
different in the three animal types.
|
|
Although NFM protein levels were depressed in shiverer and slightly
elevated in MBP/MBP, parallel analyses of the 3.5 kb NFM message showed
a different pattern for NFM mRNA expression quite different from that
seen for NFH (Fig. 5C). After normalizing for RNA load by
comparison with GAPDH, levels of NFM message in the CNS (Fig.
5D) were essentially the same as wild-type for both MBP/MBP
(1.09 ± 0.05) and shiverer (1.15 ± 0.07). The slight
increases were not statistically significant at p 0.05 using a paired t test (n = 11). These
results suggest that either translation of NFM mRNA or the stability of
NFM protein is sensitive to the level of myelination.
Because phosphorylation of neurofilaments in Trembler peripheral nerves
is significantly reduced in demyelinated regions, we used antibodies
sensitive to phosphorylation state of NFH in quantitative immunoblots.
After compensating for differences in NFH protein levels by normalizing
signals to wild-type levels, the level of relative phosphorylation for
NFH could be examined in the corpus callosum and sciatic nerve of
MBP/MBP and shiverer mice based on immunoreactivity with the RMO24
monoclonal antibody, which recognizes only highly phosphorylated NFH
(Lee et al., 1986 ). NFH phosphorylation was reduced in CNS axons of the
corpus callosum, but was unaffected in PNS axons of the sciatic nerve
(Fig. 6). The differences from wild-type
control values in CNS tissue were significant using a paired
t test for both shiverer (p = 0.016) and MBP/MBP transgenics (p = 0.0014). These
results indicate that deficient myelination locally reduces
neurofilament phosphorylation in both CNS (shiverer and MBP/MBP) and
PNS (Trembler; de Waegh et al., 1992 ) fibers. Notably, the suboptimal
CNS myelination seen in MBP/MBP transgenics was not sufficient to
restore neurofilament phosphorylation to normal levels. In the Trembler
mouse, graft studies demonstrated that differences in phosphorylation
of neurofilaments was caused by differences in local activity (de Waegh
and Brady, 1991 ). Although a similar mechanism may well be operational
in shiverer axons, the observed effects of myelination on neuronal gene
expression raise the possibility that altered neurofilament phosphorylation shiverer axons could be caused by changes in the expression of kinases or phosphatases. Because similar graft studies are not currently feasible in the CNS, resolution of this issue will
require alternative approaches.

View larger version (16K):
[in this window]
[in a new window]
|
Figure 6.
Quantitative immunoblot analysis of highly
phosphorylated NFH antibody immunoreactivity in corpus callosum and
sciatic nerve homogenates from MBP/MBP shiverer transgenic and shiverer
relative to wild-type control. The relative phosphorylation of NFH was
significantly reduced in CNS, but not in PNS axons. Whereas NFH levels
were reduced in the CNS of MBP/MBP transgenic and shiverer mice, the
phosphorylation of the NFH present was roughly half that of wild-type
controls. The differences from wild-type control values were
significant at p = 016 for shiverer and at
p = 0.0014 for MBP/MBP transgenics. Phosphorylation
of NFH was not significantly different between MBP/MBP transgenic and
shiverer nerves. Approximately 10 µg of corpus callosum or sciatic
nerve homogenates was run on SDS-PAGE gels and transferred to
nitrocellulose blots, then blotted with the RMO24 antibody, which is
specific to highly phosphorylated NFH. This was followed by a
radioactively labeled secondary antibody before being exposed to a
PhosphorImager screen. The relative intensity of highly phosphorylated
NFH immunoreactivity on the ensuing scans was determined. Highly
phosphorylated NFH signals were normalized to NFL-immunoreactive
signals that had been corrected for varying levels among the three
animal types using the data in Figure 4. Each was plotted as the ratio
of NFH-immunoreactive signal from MBP/MBP or shiverer to control. All
values were corrected for the varying amounts of NFH protein levels
among the three animal types using the data in Figure 4 before
calculation of phosphorylation ratios. For corpus callosum samples,
n = 32 for shiverer animals, n = 21 for MBP/MBP animals, and n = 17 for control
animals. For sciatic nerve samples, n = 32 for
shiverer, n = 20 for MBP/MBP, and
n = 18 for control animals.
|
|
In summary, a wide range of axonal and neuronal parameters were altered
in the CNS of myelin-deficient shiverer mice, including rates of axonal
transport, organization, and composition of the axonal cytoskeleton,
posttranslational modification of cytoskeletal proteins, and
cytoskeletal gene expression in the neuronal cell body. The reduced
level of myelination found in the MBP/MBP transgenic mouse was
sufficient to restore some parameters to wild-type levels (slow axonal
transport rates and NFM protein levels), but not sufficient to restore
others (such as microtubule numbers and NFH protein levels). Despite
these alterations in the composition and architecture of CNS axons in
the MBP/MBP transgenic mouse, the reduced level of myelination in
transgenics was sufficient to restore normal life span and minimize tremors.
 |
DISCUSSION |
The effects of demyelination on the PNS axonal cytoskeleton in
Trembler mutant mice (de Waegh and Brady, 1990 ; de Waegh, 1990 ; de
Waegh and Brady, 1991 ) led to examination of similar parameters in
optic axons of CNS myelin-deficient shiverer mutant mice. Shiverer mice
lack myelin basic protein, an essential structural component of CNS
myelin (Campagnoni and Macklin, 1988 ) and do not form CNS compact
myelin. Many of the same parameters were altered in both shiverer and
Trembler axons without myelin, but these changes were not always in the
same direction, and additional characteristics were affected in
shiverer myelin-deficient neurons. Because transgenic mice homozygous
for an MBP transgene in a shiverer background have myelin sheaths
significantly thinner than wild-type, the requirement for a myelin
sheath of normal thickness was assessed in parallel studies.
Surprisingly, some neuronal parameters were restored to wild-type
values by a thin myelin sheath, whereas others were more like shiverer
or intermediate between the two. Characteristics of neurons in both
shiverer and MBP/MBP transgenic mice are reminiscent of immature or
unmyelinated axons, suggesting that myelinating glia play a role in
differentiation of neurons with large axons.
Shiverer is a CNS myelin deficiency mouse mutant (Chernoff, 1981 )
resulting from a recombination within the MBP gene (Roach et al., 1985 ;
Molineaux et al., 1986 ) that eliminates MBP expression (Roach et al.,
1983 ; Kimura et al., 1985 ). Although MBP is normally present in PNS
myelin, PNS myelination is near normal in MBP null mice (Rosenbluth,
1980 ), because PNS-specific proteins with overlapping function exist.
However, differences do exist in shiverer PNS myelin fine structure,
including mild hypomyelination and a significant increase in
Schmidt-Lantermann cleft number (Gould et al., 1995 ). In contrast, MBP
null mice have no compact myelin in their CNS (Shine et al., 1992 ).
Absence of CNS myelination in shiverer leads to severe intention tremor
and early death, typically within 100 d (Readhead and Hood, 1990 ).
Although shiverer is the best characterized animal model with deficits
in MBP expression, less severe alleles like
shimld/shimld
(myelin deficient) mouse exist (Readhead and Hood, 1990 ), and transgenic mice have been generated that express varying levels of MBP
(Popko et al., 1987 ; Readhead et al., 1987 ; Kimura et al., 1989 ).
Availability of mouse models with different levels of MBP expression
permits detailed analyses of myelination effects on CNS function (Popko
et al., 1987 ; Shine et al., 1992 ).
Introduction of MBP transgenes into shiverer was the first genetic
"cure" of a neurological mutant (Readhead et al., 1987 ). Shiverer
mice homozygous for an MBP transgene have MBP mRNA and protein levels
~25% of normal (Popko et al., 1987 ; Readhead et al., 1987 ). MBP/MBP
transgenics produce compact myelin with morphologically normal major
dense lines, but substantially reduced myelin sheath thickness. Optic
axons typically have only two to four lamellae as opposed to 8-11 or
more lamellae in wild-type. Even this modest investiture of compact
myelin was sufficient to restore life spans of MBP/MBP mice to
wild-type values and largely suppress intention tremor (Readhead et
al., 1987 ). This showed that essential aspects of neuronal function can
be reestablished by minimal myelination and was consistent with
observations that even a thin myelin sheath allows saltatory conduction
of action potentials (Shrager and Rubinstein, 1990 ). Initial
observations on slow axonal transport rates reinforced this conclusion,
because rates of transport in MBP/MBP optic nerves were
indistinguishable from wild-type (Fig. 1).
Although normal axonal transport rates, minimal tremor, and normal life
span of MBP/MBP mice all implied that any amount of compact myelin
would restore axonal functionality, electron micrographs of optic
nerves from shiverer, MBP/MBP, and wild-type mice (Fig. 2) led to a
very different conclusion about axonal morphology. Differences between
wild-type and MBP/MBP axons in ultrastructure, cytoskeletal
organization, and cytoskeletal composition are as apparent as
similarities between shiverer and MBP/MBP axons. Differences in
organization were confirmed by morphometric studies and prompted quantitative analysis of cytoskeletal composition. Neurofilament protein and mRNA levels were altered in shiverer and MBP/MBP transgenic mouse CNS tissue. In contrast to Trembler PNS axons where levels of
axonal neurofilament protein did not differ from controls (de Waegh et
al., 1992 ), interactions between oligodendrocytes and axons during
compact myelin formation significantly altered axon cytoskeletal
composition as well as organization.
The shiverer axonal cytoskeleton is similar in many respects to the
cytoskeleton of wild-type axons before myelination. NFH appears later
in development than NFM and NFL (Shaw and Weber, 1982 ; Willard and
Simon, 1983 ; Pachter and Liem, 1984 ), and rates for SCa and SCb are
faster in immature fibers gradually slowing with maturation and aging
(Hoffman et al., 1985 ). A significant upregulation of NFH mRNA (Hoffman
et al., 1988 ) occurs postnatally, and immature neurofilaments have
lower content of the NFH subunit than neurofilaments from adult nerves
(Shaw and Weber, 1982 ; Pachter and Liem, 1984 ; Carden et al., 1987 ).
Upregulation of NFH protein and slowing of slow axonal transport occur
at P10-P20 in rodent optic
nerve (Willard and Simon, 1983 ; Pachter and Liem, 1984 ; Carden et al.,
1987 ), concurrent with myelination of these axons. The failure of
shiverer to produce a mature CNS axonal cytoskeleton in combination
with temporal correlation of maturation in wild-type development
strongly suggests that formation of compact myelin is necessary for
normal differentiation of neurons with large axons. This conclusion is
strengthened by the intermediate phenotype seen with MBP/MBP axons
(slower transport and higher NFM expression, whereas NFH expression
continues to be altered; see Table 2 for summary of changes).
Altered cytoskeletal gene expression in shiverer and MBP/MBP indicated
that signaling pathway or pathways exist by which myelinating glia
influence CNS neuronal differentiation. Although some components of
these pathways modify local properties of CNS axons like neurofilament phosphorylation, others affect events in the neuronal cell body. Changes in the neuronal perikaryon include altered levels of NFH mRNA
presumably through effects on transcriptional regulation and changes in
net translation of NFM mRNA. A previous report (Sanchez et al., 1996 )
suggested that oligodendrocyte influence on axonal caliber required
contact, but not formation of compact myelin. However, this study
focused on retinal ganglion cell axon segments as they emerge from the
lamina cribosa. This is a transitional myelination region and is not
representative of mature myelinated fibers. Regardless, data presented
here demonstrate that simple contact between oligodendrocyte and axon
is not sufficient.
Signaling pathways by which oligodendrocytes influence neurons remain
to be determined. However, some characteristics of these pathways can
be defined (Fig. 7). A locally acting
component must affect specifically axonal kinase/phosphatase activities
to produce observed local changes in neurofilament phosphorylation. A
retrograde signaling component must also exist that is transported back
to neuronal perikarya to influence neuronal gene expression at the level of translation and/or transcription. This second component may be
generated either directly or indirectly (by modification of axonal
components for return). Finally, activation of signaling pathways for
communication between myelinating glia and axons must require intimate
contacts associated with formation of compact myelin. This last element
suggests a plausible model might be based on various receptor-linked
kinases that affect gene expression in non-neuronal cells through
phosphorylation cascades modifying transcription factors and other
cellular targets.

View larger version (48K):
[in this window]
[in a new window]
|
Figure 7.
Pathways for compact myelin to affect CNS neuronal
differentiation. Although the molecular identity of many components
involved in the modulation of neuronal architecture by myelinating
oligodendrocytes remains to be determined, essential characteristics of
these pathways can be defined. In this diagram, some of these key
elements are illustrated schematically. One or more signals is produced
by interaction between compact myelin and axon (small
arrows). These signals are not produced by simple interaction
between an oligodendrocyte process and the axon, such as is seen in
shiverer (arrows in circle with
bar), but require formation of compact myelin. Signals
produced in axon segments surrounded by compact myelin suggest multiple
actions. The first may be an action on local factor or factors
(eight-pointed star) that changes the net activity of
axonal kinases and/or phosphatases, thereby altering the net
phosphorylation state of neurofilaments in that segment, much as was
seen in Trembler PNS neurons. In this figure, the open
symbols represent factors in the absence of myelin, whereas the
filled symbols correspond to factors that have been
"activated" in the presence of compact myelin. A second action
might involve a retrograde acting factor (filled
star) that is committed to retrograde axonal transport and
returned to the cell body. At the level of the cell body, this
retrograde signal may activate other pathways, directly alter
transcription in the nucleus (stars in
nucleus), or act at the level of translation in the cell
body (stars near polysomes). In the
absence of appropriate myelination, axonal signals might fail to be
activated (unfilled stars in axon),
leading to an altered composition and organization of the axonal
cytoskeleton, or may not be returned to the cell body.
|
|
While the transgenic shiverer mouse was termed a genetic rescue based
on increased life span and suppression of tremor (Readhead et al.,
1987 ), detailed analyses of axonal composition and morphology reveal a
more complex situation (Table 2). Some features of transgenic axons
like slow axonal transport and NFM expression are comparable to
wild-type, but other parameters like expression of tubulin and NFH
subunits remain more like shiverer (Figs. 1, 4, 5). Other parameters
like neurofilament density are intermediate between shiverer and
wild-type. This suggests that multiple pathways exist by which
myelinating glia influence neuron and axons. Some characteristics are
restored by formation of a thin myelin sheath such as that found in
transgenic shiverers, but others are not activated until a thicker
myelin sheath such as that found in wild-type has formed. While the
genetic lesion is well characterized (Molineaux et al., 1986 ; Readhead
and Hood, 1990 ), disruption of normal relationships between axon and
oligodendrocyte may affect other aspects of glial differentiation,
including secretion of regulatory factors and expression of cell
surface proteins. These differences may be the direct cause of altered
neuronal phenotypes in shiverer and transgenic shiverer.
A number of differences exist between demyelinating (Trembler) and
dysmyelinating (shiverer) mutants. For example, local effects on the
axonal cytoskeleton are more apparent in Trembler, but changes in gene
expression are more pronounced in shiverer. This might reflect
differences in effects of CNS and PNS myelinating glia on axons.
Consistent with this possibility, previous studies showed that neurons
react differently to PNS and CNS glial environments (Vidal-Saenz et
al., 1987 ; Schwab and Caroni, 1988 ). Similarly, CNS- and PNS-myelinated
fibers differ in ultrastructure (Peters et al., 1991 ) and protein
composition (Morell et al., 1994 ). The extent to which Trembler and
shiverer reveal PNS/CNS differences in axon/glia interactions may help
characterize the molecular basis for different axonal responses to PNS
and CNS environments.
However, phenotypic differences between shiverer and Trembler mutants
might account for some differences. In Trembler, compact myelin forms
around PNS axons, but does not go to completion. Instead, myelin is
resorbed, and Schwann cells continue proliferating. In contrast,
shiverer CNS neurons never see compact myelin, whereas MBP/MBP
transgenic neurons see limiting amounts of compact myelin. Perhaps the
myelination level achieved before demyelination in Trembler is
sufficient to produce normal expression of neurofilament and tubulin
subunits (but not the microtubule-associated protein tau; see
Kirkpatrick and Brady, 1994 , their Fig. 4), whereas myelin levels in
MBP/MBP transgenics are subthreshold. Support for this idea comes from
evidence that mice expressing 50% or more of wild-type MBP levels have
normal myelin sheaths (Shine et al., 1992 ), suggesting a threshold
level of MBP for myelination exists. Analysis of axonal cytoskeletal
composition and ultrastructure in mice expressing higher levels of MBP
and in mice with a CNS demyelination phenotype should distinguish
between these two possibilities.
Differences between MBP/MBP and wild-type axons also indicate that
feedback mechanisms must inform neurons about the extent of
myelination. Such pathways would be likely to represent mechanisms by
which myelin sheath thickness is adjusted to axon caliber (Friede and
Miyagishi, 1972 ). Whereas correlations between axon caliber and myelin
sheath thickness is robust and adjustments to sheath thickness
associated with changes in axon diameter are well documented, no
plausible mechanisms for counting myelin lamellae have been identified.
Analysis of mice with different MBP levels may illuminate ways by which
myelin sheath thickness is specified.
Functional consequences of altered cytoskeletal composition and
organization in MBP/MBP and shiverer nerves are not well understood. Partial myelination in MBP/MBP mice produces normal life spans and
grossly normal behavior under laboratory conditions, but no studies
have specifically addressed physiological effects of an altered
cytoskeleton. Similarities in fine structure between developing or
unmyelinated axons in wild-type mice and mature shiverer axons suggest
that aspects of neuronal physiology that change during development
might be affected. For example, timing of CNS myelination correlates
with the end of critical periods in neuronal development, suggesting
that myelination may influence developmental stabilization of synaptic
connectivity and neuronal plasticity. One intriguing possibility is
that critical periods could be extended in myelin deficiency mutants
yielding altered or unstable synaptic connectivity. Similarly,
inhibition of neurite outgrowth by mature oligodendrocytes that appears
during early stages of myelination (Caroni and Schwab, 1989 ) may be
delayed, thereby altering patterns of axonal growth and regeneration in
the CNS. Full delineation of changes in CNS neurons associated with
deficient compact myelin requires further study.
In summary, CNS myelin deficiencies lead both to local consequences on
the axon cytoskeleton (i.e., reduced neurofilament phosphorylation) and
to altered gene expression in the cell body (i.e., decreased
neurofilament protein). Reduced myelination in MBP/MBP nerves converts
some parameters to match wild-type completely (transport rates and NFM
levels), whereas other parameters match only partially (NFH message),
and others were indistinguishable from axons without any myelin
(microtubule numbers). Thus, myelination has a profound effect on
axonal cytoskeleton properties and composition, but a partial
complement of myelin is not sufficient to induce a full response from
neurons. Regardless, signals produced during myelination affect
differentiation of neurons with large axons and maturation of neuronal
function. These data demonstrate that the relationship between neurons
and myelinating glia is more complex than previously thought.
Understanding the molecular bases of this relationship is critical to
understanding how nervous systems can be assembled and maintained.
 |
FOOTNOTES |
Received Oct. 2, 1998; revised June 11, 1999; accepted June 11, 1999.
This work was supported in part by National Institute of Neurological
Disease and Stroke Grants NS23868 and NS23320 to S.T.B., a joint grant
from NASA and the National Institute of Aging (NAG2-962/AG12646), the
Welch Foundation (#1237), and the Muscular Dystrophy Association. We
thank Milena Gould, Enid Romanelli, and Martha Stokely for technical
support. C.R. acknowledges Cedars-Sinai Medical Center for its support.
Correspondence should be addressed to Dr. Scott T. Brady, University of
Texas Southwestern Medical Center, Department of Cell Biology And
Neuroscience, 5323 Harry Hines Boulevard, Dallas, TX 75235-9039.
 |
REFERENCES |
-
Aguayo A,
Attiwell M,
Trecarten J,
Perkins S,
Bray G
(1977)
Abnormal myelination in transplanted Trembler mouse Schwann cells.
Nature
265:73-74[Medline].
-
Brady S
(1985)
Axonal transport methods and applications.
In: Neuromethods, general neurochemical techniques (Boulton A,
Baker G,
eds), pp 419-476. Clifton, NJ: Humana.
-
Brady ST
(1993)
Axonal dynamics and regeneration.
In: Neuroregeneration (Gorio A,
ed), pp 7-36. New York: Raven.
-
Campagnoni AT,
Macklin WB
(1988)
Cellular and molecular aspects of myelin protein gene expression.
Mol Neurobiol
2:41-89[Web of Science][Medline].
-
Carden MJ,
Trojanowski JQ,
Schlaepfer WW,
Lee VM-Y
(1987)
Two stage expression of neurofilament polypeptides during rat neurogenesis with early establishment of adult phosphorylation patterns.
J Neurosci
7:3489-3504[Abstract].
-
Caroni P,
Schwab M
(1989)
Codistribution of neurite growth inhibitors and oligodendrocytes in rat CNS: appearance follows nerve fiber growth and precedes myelination.
Dev Biol
136:287-295[Web of Science][Medline].
-
Chernoff GF
(1981)
Shiverer: an autosomal recessive mutant mouse with myelin deficiency.
J Hered
72:128[Abstract/Free Full Text].
-
Chomczynski P,
Sacchi N
(1987)
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:156-159[Web of Science][Medline].
-
Cole JS,
Messing A,
Trojanowski JQ,
Lee VM-Y
(1994)
Modulation of axon diameter and neurofilaments by hypomyelinating Schwann cells in transgenic mice.
J Neurosci
14:6956-6966[Abstract].
-
de Waegh SM
(1990)
The importance of Schwann cell/axon interactions in the local control of neuronal shape and function: the Trembler mouse as an in vivo model.
In: PhD thesis in Cell Biology Program, Cell biology, p 202 Dallas: University of Texas Southwestern Medical Center.
-
de Waegh S,
Brady ST
(1990)
Altered slow axonal transport and regeneration in a myelin deficient mutant mouse: the Trembler mouse as an in vivo model for Schwann cell-axon interactions.
J Neurosci
10:1855-1865[Abstract].
-
de Waegh SM,
Brady ST
(1991)
Local control of axonal properties: neurofilaments and axonal transport in homologous and heterologous nerve grafts.
J Neurosci Res
30:201-212[Web of Science][Medline].
-
de Waegh SM,
Lee VM-Y,
Brady ST
(1992)
Local modulation of neurofilament phosphorylation, axonal caliber, and slow axonal transport by myelinating Schwann cells.
Cell
68:451-463[Web of Science][Medline].
-
Friede RL,
Miyagishi T
(1972)
Adjustment of the myelin sheath to changes in axonal caliber.
Anat Rec
17:1-14.
-
Gould RM,
Byrd AL,
Barbarese E
(1995)
The number of Schmidt-Lanterman incisures is more than doubled in shiverer PNS myelin sheaths.
J Neurocytol
24:85-98[Web of Science][Medline].
-
Hoffman P,
Griffin J,
Gold B,
Price D
(1985)
Slowing of neurofilament transport and the radial growth of developing nerve fibers.
J Neurosci
5:2920-2929[Abstract].
-
Hoffman P,
Koo E,
Muma N,
Griffin J,
Price D
(1988)
Role of neurofilaments in the control of axonal caliber in myelinated nerve fibers.
In: Intrinsic determinants of neuronal forms and functions (Lasek RJ,
Black MM,
eds), pp 389-402. New York: Alan R. Liss.
-
Hoffman PM,
Lasek RJ,
Griffin JW,
Price DL
(1983)
Slowing of the axonal transport of neurofilament protein during development.
J Neurosci
3:1694-1700[Abstract].
-
Hsieh S-T,
Kidd GJ,
Crawford TO,
Xu Z,
Lin W-M,
Trapp BD,
Clevelan DW,
Griffin JW
(1994)
Regional modulation of neurofilament organization by myelination in normal axons.
J Neurosci
14:6392-6401[Abstract].
-
Kettenmann H,
Ransom BR
(1995)
In: Neuroglia, p 1079. New York: Oxford UP.
-
Kimura M,
Inoko H,
Katsuki M,
Ando A,
Sato T,
Hirose T,
Takashima H,
Inayama S,
Okano H,
Takamatsu K,
Mikoshiba K,
Tsukuda Y,
Watanabe I
(1985)
Molecular genetic analysis of myelin-deficient mice: shiverer mutant mice show deletion in gene(s) coding for myelin basic protein.
J Neurochem
44:692-696[Web of Science][Medline].
-
Kimura M,
Sato M,
Akatsuka A,
Nozawa-Kimura S,
Takahashi R,
Yokoyama M,
Nomura T,
Katsuki M
(1989)
Restoration of myelin formation by a single type of myelin basic protein in transgenic shiverer mice.
Proc Natl Acad Sci USA
86:5661-5665[Abstract/Free Full Text].
-
Kirkpatrick LL,
Brady ST
(1994)
Modulation of the axonal microtubule cytoskeleton by myelinating Schwann cells.
J Neurosci
14:7440-7450[Abstract].
-
Laskey RA,
Mills AD
(1975)
Quantitative film detection of 3H and 14C in polyacrylamide gels by fluorography.
Eur J Biochem
563:335-341.
-
Lee V,
Carden M,
Schlaepfer W,
Trojanski J
(1987)
Monoclonal antibodies distinguish several differentially phosphorylated states of the two largest rat neurofilament subunits (NFH and NFM) and demonstrate their existence in the normal nervous system of adult rats.
J Neurosci
7:3474-3488[Abstract].
-
Lee VM-Y,
Carden MJ,
Trojanowski JQ
(1986)
Novel monoclonal antibodies provide evidence for the in situ existence of a nonphosphorylated form of the largest neurofilament subunit.
J Neurosci
6:850-858[Abstract].
-
Low PA
(1976a)
Hereditary hypertrophic neuropathy in the Trembler mouse. Part 1. Histological studies: light microscopy.
J Neurol Sci
30:327-341[Web of Science][Medline].
-
Low PA
(1976b)
Hereditary hypertrophic neuropathy in the Trembler mouse. Part 2. Histological studies: electron microscopy.
J Neurol Sci
30:343-368[Web of Science][Medline].
-
Low PA,
McLeod JG
(1975)
Hereditary demyelination neuropathy in the Trembler mouse.
J Neurol Sci
26:565-574[Web of Science][Medline].
-
Lupski JR,
de Oca-Luna RM,
Slaugenhaupt S,
Pentao L,
Guzzetta V,
Trask BJ,
Saucedo-Cardenas O,
Barker DF,
Killian JM,
Garcia CA,
Chakravarti CA,
Patel PI
(1991)
DNA duplication associated with Charcot-Marie-Tooth disease type 1A.
Cell
66:219-232[Web of Science][Medline].
-
Mata M,
Kupina N,
Fink DJ
(1992)
Phosphorylation-dependent neurofilament epitopes are reduced at the node of Ranvier.
J Neurocytol
21:199-210[Web of Science][Medline].
-
Molineaux SM,
Engh H,
de Ferra F,
Hudson L,
Lazzarini RA
(1986)
Recombination within the myelin basic protein gene created the dysmyelinating shiverer mouse mutation.
Proc Natl Acad Sci USA
83:7542-7546[Abstract/Free Full Text].
-
Morell P,
Quarles RH,
Norton WT
(1994)
Myelin formation, structure and biochemistry.
In: Basic neurochemistry: molecular, cellular, and medical aspects (Siegel GJ,
Agranoff BW,
Albers RW,
Molinoff PB,
eds), pp 117-143. New York: Raven.
-
Pachter JS,
Liem RK
(1984)
The differential appearance of neurofilament triplet polypeptides in the developing rat optic nerve.
Dev Biol
103:200-210[Web of Science][Medline].
-
Peters A,
Palay SL,
Webster HD
(1991)
In: The fine structure of the nervous system: neurons and their supporting cells, Ed 3 New York: Oxford UP.
-
Popko B,
Puckett C,
Lai E,
Shine HD,
Readhead C,
Takahashi N,
Hunt III SW,
Sidman RL,
Hood L
(1987)
Myelin deficient mice: expression of myelin basic protein and generation of mice with varying levels of myelin.
Cell
48:713-721[Web of Science][Medline].
-
Price R,
Paggi P,
Lasek R,
Katz M
(1988)
Neurofilaments are spaced randomly in the radial dimension of axons.
J Neurcytol
17:55-62.
-
Raine CS
(1984)
The morphology of myelin and myelination.
In: Myelin (Morrell P,
ed), pp 1-41. New York: Plenum.
-
Readhead C,
Hood L
(1990)
The dysmyelinating mouse mutants shiverer (shi) and myelin deficient (shimld).
Behav Genet
20:213-234[Web of Science][Medline].
-
Readhead C,
Popko B,
Takahashi N,
Shine HD,
Saavedra RA,
Sidman RL,
Hood L
(1987)
Expression of a myelin basic protein gene in transgenic shiverer mice: correction of the dysmyelinating phenotype.
Cell
48:703-712[Web of Science][Medline].
-
Roach A,
Boylan K,
Horvath S,
Prusiner SB,
Hood L
(1983)
Characterization of cloned cDNA representing rat myelin basic protein: absence of expression in brain of shiverer mutant mice.
Cell
34:799-806[Web of Science][Medline].
-
Roach A,
Takahashi N,
Pravtcheva D,
Ruddle F,
Hood L
(1985)
Chromosomal mapping of mouse myelin basic protein gene and structure and transcription of the partially deleted gene in Shiverer mutant mice.
Cell
42:149-155[Web of Science][Medline].
-
Rosenbluth J
(1980)
Peripheral myelin in the mouse mutant Shiverer.
J Comp Neurol
193:729-739[Web of Science][Medline].
-
Sanchez I,
Hassinger L,
Paskevich PA,
Shine HD,
Nixon RA
(1996)
Oligodendroglia regulate the regional expansion of axon caliber and local accumulation of neurofilaments during development independently of myelin formation.
J Neurosci
16:5095-5105[Abstract/Free Full Text].
-
Schwab M,
Caroni P
(1988)
Oligodendrocytes and CNS myelin are nonpermissive substrates for neurite growth and fibroblast spreading in vitro.
J Neurosci
8:2381-2393[Abstract].
-
Shaw G,
Weber K
(1982)
Differential expression of neurofilament triplet proteins in brain development.
Nature
298:277-279[Medline].
-
Shine HD,
Readhead C,
Popko B,
Hood L,
Sidman RL
(1992)
Morphometric analysis of normal, mutant, and transgenic CNS: correlation of myelin basic protein expression to myelinogenesis.
J Neurochem
58:342-349[Web of Science][Medline].
-
Shrager P,
Rubinstein CT
(1990)
Optical measurement of conduction in single demyelinated axons.
J Gen Physiol
95:867-889[Abstract/Free Full Text].
-
Suter U,
Moskow JJ,
Welcher AA,
Snipes GJ,
Sidman RL,
Buchberg AM,
Shooter EM
(1992a)
A leucine-to-proline mutation in the putative first transmembrane domain of the 22-kDa peripheral myelin protein in the trembler-J mouse.
Proc Natl Acad Sci USA
89:4382-4386[Abstract/Free Full Text].
-
Suter U,
Welcher AA,
Ozcelik T,
Snipes GJ,
Kosaras B,
Francke U,
Billings-Gagliardi S,
Sidman RL,
Shooter EM
(1992b)
Trembler mouse carries a point mutation in a myelin gene.
Nature
356:241-243[Medline].
-
Vidal-Saenz M,
Bray GM,
Villegas-Perez MP,
Thanos S,
Aguayo AJ
(1987)
Axonal regeneration and synapse formation in the superior colliculus by retinal ganglion cells in the adult rat.
J Neurosci
7:2894-2909[Abstract].
-
Virchow R
(1846)
. Über das granulierte ansehen der Wandungen der Gerhirnventrikel.
Allg Z Psychiatr
3:242.
-
Willard M,
Simon C
(1983)
Modulations in neurofilament axonal transport during development of rabbit retinal ganglion cells.
Cell
35:551-559[Web of Science][Medline].
Copyright © 1999 Society for Neuroscience 0270-6474/99/19177278-11$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
A Wilkins and N Scolding
Protecting axons in multiple sclerosis
Multiple Sclerosis,
September 1, 2008;
14(8):
1013 - 1025.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Chatzopoulou, A. Miguez, M. Savvaki, G. Levasseur, A. Muzerelle, M.-P. Muriel, O. Goureau, K. Watanabe, L. Goutebroze, P. Gaspar, et al.
Structural Requirement of TAG-1 for Retinal Ganglion Cell Axons and Myelin in the Mouse Optic Nerve
J. Neurosci.,
July 23, 2008;
28(30):
7624 - 7636.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Lasiene, L. Shupe, S. Perlmutter, and P. Horner
No Evidence for Chronic Demyelination in Spared Axons after Spinal Cord Injury in a Mouse
J. Neurosci.,
April 9, 2008;
28(15):
3887 - 3896.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Provenzale, L. Liang, D. DeLong, and L. E. White
Diffusion Tensor Imaging Assessment of Brain White Matter Maturation During the First Postnatal Year
Am. J. Roentgenol.,
August 1, 2007;
189(2):
476 - 486.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Imitola, T. Chitnis, and S. J. Khoury
Insights Into the Molecular Pathogenesis of Progression in Multiple Sclerosis: Potential Implications for Future Therapies
Arch Neurol,
January 1, 2006;
63(1):
25 - 33.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Higuchi, B. Zhang, M. S. Forman, Y. Yoshiyama, J. Q. Trojanowski, and V. M.-Y. Lee
Axonal Degeneration Induced by Targeted Expression of Mutant Human Tau in Oligodendrocytes of Transgenic Mice That Model Glial Tauopathies
J. Neurosci.,
October 12, 2005;
25(41):
9434 - 9443.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. D. Schwartz, E. T. Cooper, C.-L. Chin, S. Wehrli, A. Tessler, and D. B. Hackney
Ex vivo Evaluation of ADC Values within Spinal Cord White Matter Tracts
AJNR Am. J. Neuroradiol.,
February 1, 2005;
26(2):
390 - 397.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Edgar, M. McLaughlin, D. Yool, S.-C. Zhang, J. H. Fowler, P. Montague, J. A. Barrie, M. C. McCulloch, I. D. Duncan, J. Garbern, et al.
Oligodendroglial modulation of fast axonal transport in a mouse model of hereditary spastic paraplegia
J. Cell Biol.,
July 5, 2004;
166(1):
121 - 131.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Yin, G. J. Kidd, E. P. Pioro, J. McDonough, R. Dutta, M. L. Feltri, L. Wrabetz, A. Messing, R. M. Wyatt, R. J. Balice-Gordon, et al.
Dysmyelinated Lower Motor Neurons Retract and Regenerate Dysfunctional Synaptic Terminals
J. Neurosci.,
April 14, 2004;
24(15):
3890 - 3898.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Mathis, L. Collin, and E. Borrelli
Oligodendrocyte ablation impairs cerebellum development
Development,
October 1, 2003;
130(19):
4709 - 4718.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A De Sandre-Giovannoli, M Chaouch, I Boccaccio, R Bernard, V Delague, D Grid, J M Vallat, N Levy, and A Megarbane
Phenotypic and genetic exploration of severe demyelinating and secondary axonal neuropathies resulting from GDAP1 nonsense and splicing mutations
J. Med. Genet.,
July 1, 2003;
40(7):
e87 - 87.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Wilkins, H. Majed, R. Layfield, A. Compston, and S. Chandran
Oligodendrocytes Promote Neuronal Survival and Axonal Length by Distinct Intracellular Mechanisms: A Novel Role for Oligodendrocyte-Derived Glial Cell Line-Derived Neurotrophic Factor
J. Neurosci.,
June 15, 2003;
23(12):
4967 - 4974.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Y. Garbern, D. A. Yool, G. J. Moore, I. B. Wilds, M. W. Faulk, M. Klugmann, K.-A. Nave, E. A. Sistermans, M. S. van der Knaap, T. D. Bird, et al.
Patients lacking the major CNS myelin protein, proteolipid protein 1, develop length-dependent axonal degeneration in the absence of demyelination and inflammation
Brain,
May 1, 2002;
125(3):
551 - 561.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. E. M. Boucher, M. A. Cypher, L. R. Carlock, and R. P. Skoff
Proteolipid Protein Gene Modulates Viability and Phenotype of Neurons
J. Neurosci.,
March 1, 2002;
22(5):
1772 - 1783.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Neusch, N. Rozengurt, R. E. Jacobs, H. A. Lester, and P. Kofuji
Kir4.1 Potassium Channel Subunit Is Crucial for Oligodendrocyte Development and In Vivo Myelination
J. Neurosci.,
August 1, 2001;
21(15):
5429 - 5438.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. L. Kirkpatrick, A. S. Witt, H. R. Payne, H. D. Shine, and S. T. Brady
Changes in Microtubule Stability and Density in Myelin-Deficient Shiverer Mouse CNS Axons
J. Neurosci.,
April 1, 2001;
21(7):
2288 - 2297.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. J. Barkovich
Concepts of Myelin and Myelination in Neuroradiology
AJNR Am. J. Neuroradiol.,
June 1, 2000;
21(6):
1099 - 1109.
[Full Text]
|
 |
|
|