 |
Previous Article | Next Article 
The Journal of Neuroscience, September 15, 1999, 19(18):7793-7803
The Drosophila -Amyloid Precursor Protein Homolog
Promotes Synapse Differentiation at the Neuromuscular Junction
Laura
Torroja1,
Mary
Packard2,
Michael
Gorczyca2,
Kalpana
White1, and
Vivian
Budnik2
1 Department of Biology, Brandeis University, Waltham,
Massachusetts 02454, and 2 Department of Biology,
University of Massachusetts, Amherst, Massachusetts 01003
 |
ABSTRACT |
Although abnormal processing of -amyloid precursor protein (APP)
has been implicated in the pathogenic cascade leading to Alzheimer's
disease, the normal function of this protein is poorly understood. To
gain insight into APP function, we used a molecular-genetic approach to
manipulate the structure and levels of the Drosophila APP homolog APPL. Wild-type and mutant forms of APPL were
expressed in motoneurons to determine the effect of APPL at the
neuromuscular junction (NMJ). We show that APPL was transported to
motor axons and that its overexpression caused a dramatic increase in
synaptic bouton number and changes in synapse structure. In an
Appl null mutant, a decrease in the number of boutons
was found. Examination of NMJs in larvae overexpressing APPL revealed
that the extra boutons had normal synaptic components and thus were
likely to form functional synaptic contacts. Deletion analysis
demonstrated that APPL sequences responsible for synaptic alteration
reside in the cytoplasmic domain, at the internalization sequence
GYENPTY and a putative Go-protein binding site. To
determine the likely mechanisms underlying APPL-dependent synapse
formation, hyperexcitable mutants, which also alter synaptic growth at
the NMJ, were examined. These mutants with elevated neuronal activity
changed the distribution of APPL at synapses and partially suppressed
APPL-dependent synapse formation. We propose a model by which APPL, in
conjunction with activity-dependent mechanisms, regulates synaptic
structure and number.
Key words:
APPL; APP; Alzheimer's disease; Go-protein; internalization; activity-dependent synapse
formation; UAS/Gal4
 |
INTRODUCTION |
The Drosophila
-amyloid precursor protein (APP) homolog APPL (Rosen et al.,
1989 ) is a pan-neural protein belonging to the conserved APP family.
This family includes APP and APLP1/2 in mammals (Kang et al., 1987 ;
Wasco et al., 1992 , 1993 ), apl-1 in nematodes (Daigle and Li, 1993 ),
and APP747 in Xenopus (Okado and
Okamoto, 1992 ). APP is synthesized as a transmembrane glycoprotein composed of extracellular, transmembrane, and cytoplasmic domains (Kang
et al., 1987 ; Luo et al., 1990 ; Wasco et al., 1993 ). APPs undergo
proteolytic cleavage, releasing the ectodomain (Weidemann et al., 1989 ;
Luo et al., 1990 ; Sisodia, 1994 ; Slunt et al., 1994 ). Homology among
APP members is paralleled by their ability to functionally substitute
for each other: transgenes encoding Drosophila APPL or a
human neural APP both rescue behavioral defects of Appl null flies (Luo et al., 1992 ).
Expression studies reveal a relationship between stages of APP
synthesis and neurite outgrowth and synaptogenesis. In mammals, transmembrane APP is associated with elongating axons, whereas secreted
APP is correlated with synaptogenesis (Loffler and Huber, 1992 ; Moya et
al., 1994 ). In Drosophila, APPL is enriched in growing axons
and areas of synapse formation (Torroja et al., 1996 ).
The effects of APP on neuronal development and function have been
extensively studied because of their implication in Alzheimer's disease (for review, see Mattson, 1997 ; Small, 1998 ). APP exhibits neurite outgrowth-promoting activities in vitro through
interactions with the extracellular matrix (Koo et al., 1993 ; Small et
al., 1994 ) and changes in intracellular calcium (Mattson, 1994 ).
Experiments with neuronal cultures suggest that secreted APP modulates
excitability via Ca2+-dependent
K+ channels (Furukawa et al., 1996 ) and
NMDA receptor activity (Furukawa and Mattson, 1998 ).
In vivo evidence supports a role for APP in synapse
formation, maintenance, and plasticity. APP administration increases
synaptic density and memory retention (Roch et al., 1994 ), and exposure of hippocampal slices to secreted APP enhances long-term potentiation and modifies the induction of long-term depression (Ishida et al., 1997 ). APP knock-out mice show impaired learning and memory (Müller et al., 1994 ; Zheng et al., 1995 ). However, experiments with APP overexpression are contradictory, demonstrating enhancement of
synaptic density (Mucke et al., 1994 ) or Alzheimer's-like pathology and lack of synaptotrophic effects (Higgins et al., 1993 ; Masliah et
al., 1995 ). Much of this controversial evidence may arise from the
inability, in these systems, to analyze APP function at the level of
single synapses.
To investigate the role of APP at single, identified synapses, we used
the Drosophila neuromuscular junction (NMJ). We show that
APPL overexpression in motoneurons results in a dramatic increase in
the number of synaptic boutons. Conversely, NMJs of Appl
null larvae exhibit a significant decrease in synaptic bouton number.
The synapse-promoting function required a conserved internalization sequence and a putative Go binding site at the
cytoplasmic domain. This function was partially suppressed by mutations
with increased excitability, which by themselves regulate synapse
growth (Budnik et al., 1990 ) and APPL expression at the NMJ.
 |
MATERIALS AND METHODS |
Fly strains. Flies were reared in standard
cornmeal-molasses medium and maintained at room temperature, unless
otherwise specified. To drive expression of Appl transgenes
in motoneurons, the Gal4 enhancer traps c155 (Lin and Goodman, 1994 )
and P[Gal4w+]C164 (J. Sharpe, M. Packard, and V. Budnik, unpublished observations) and the
transgene Appl-Gal4 (Torroja et al., 1999 ) were used. We also used a
fly strain carrying the UAS-LacZ reporter gene (Brand and
Perrimon, 1993 ). The following mutant stocks were used: Appld, a null mutation of the
Appl gene, eag4PM
Sh5, and eag1
ShKS133 (Budnik et al., 1990 ).
DNA constructs for germ line transformation. The pUAST
vector (Brand and Perrimon, 1993 ) was used as the germ line
transformation vector. Generation of cDNAs
Appl+, Appls,
and Applsd has been described previously
(Luo et al., 1992 ; Torroja et al., 1996 ). To generate
APPLsd cytoplasmic deletions C and
Cg, oligo-directed mutagenesis was performed using cDNA
Applsd in Bluescript
SK+ as the template, and oligos
tggccaaatggcgataagcttacatcgcgctcg for
UAS-Applsd C and
cgctcgccgcacgcccagacacaccatcccattgtg for
Applsd Cg. For
Applsd CI, the internal
SalI fragment of
Appl CI (Luo, 1992 ) was replaced
by the SalI fragment of
Applsd.
Applsd E1 and
Applsd E2 are internal
deletions of the StuI and the StyI restriction
fragments, respectively. All Appl cDNAs were cloned into the
EcoRI site of pUAST, and orientation was confirmed by
restriction analysis. To generate
UAS-APP695,
SK+-APP695
(Kang et al., 1987 ) was digested with SalI and
XbaI, and the insert containing the entire
APP695 coding region was cloned into pUAST
digested with XhoI and XbaI.
P element-mediated germ line transformation was performed according to
described methods (Spradling and Rubin, 1982 ). Df(1)w flies
were the parental strain for all germ line transformations. Flies
bearing autosomal transgenes were used for the analysis.
Protein extraction, electrophoresis, and immunoblot. Frozen
heads were extracted in homogenization buffer (50 mM Tris-HCl, pH 8.0, 150 mM
NaCl, 1 mM EGTA, 1.5 mM
MgCl2, and 1% Triton X-100) with proteinase
inhibitors. The amount of protein was measured using Bio-Rad (Hercules,
CA) Protein Assay reagent, and the same amount of total protein,
corresponding to ~1.5 heads, was loaded for each genotype.
Electrophoresis and electrotransfer were performed as described
previously (Torroja et al., 1996 ). Immunoreaction with antibody was
visualized using LumiGLO Chemoluminescent Substrate kit (Kirkegaard & Perry Laboratories, Gaithersburg, MD) according to the manufacturer's
specifications. After exposure, the autoradiograph was scanned using
the Bio-Rad Gel Doc 1000, and the intensity of the bands was quantified
using ImageQuant software (Molecular Dynamics, Sunnyvale, CA).
Rabbit polyclonal anti-APPL antibody Ab952 (Torroja et al., 1996 ) was
used at 1:500 dilution to detect all APPL protein forms containing the
entire extracellular domain; this antibody detects both the
transmembrane and soluble forms of APPL. A polyclonal rabbit antibody
against the cytodomain of APP (#332) (Buxbaum et al., 1990 ) was used to
detect APPL transmembrane forms containing the entire cytoplasmic
domain; this antibody cross-reacts with the APPL cytodomain and does
not recognize any other proteins in flies lacking APPL
(Appld).
Immunocytochemistry and quantification of synapse number.
Immunocytochemistry procedures and confocal image acquisition and analysis were performed as reported by Budnik et al. (1996) . To determine the number of synapses, body wall muscle preparations were
labeled with a presynaptic marker (anti-HRP), and boutons were counted
at muscles 6 and 7 of abdominal segment 3. Three different parameters
were measured: the total number of synaptic boutons, the percentage of
satellites (satellites × 100/total boutons), and the number of
"parent" boutons (total boutons satellites) (see
description of satellites in Results). For the expression of APPL
variants using the UAS/Gal4 system, crosses and rearing of larvae were
performed at 30°C to maximize expression of Gal4-driven transgenic
APPL. Controls at this temperature were also performed for wild type,
the homozygous Gal4 strain, the homozygous strain carrying the
Appl transgene, and the Gal4/UAS-LacZ heterozygote. The following antibodies were also used to label synaptic
terminals: anti-APPL Ab952 (Torroja et al., 1996 ) was used at a 1:500
dilution; anti-Discs-large (DLG) at a 1:250 dilution (Woods and
Bryant, 1991 ; Lahey et al., 1994 ); anti-synapsin (gift from E. Buchner,
Universitaet Wuerzburg) (Klagges et al., 1996 ); anti- -galactosidase
at a 1:1000 dilution (Cappel, West Chester, PA); anti-synaptotagmin at
a 1:500 dilution (gift from H. Bellen, Baylor College of Medicine)
(Littleton et al., 1993 ); and anti-cysteine string protein (CSP)
at a 1:250 dilution (gift from K. E. Zinsmaier, University of
Pennsylvania School of Medicine) (Zinsmaier et al., 1990 ). Secondary
antibodies were used at 1:200 dilution.
Transmission electron microscopy. Transmission electron
microscopy analysis was essentially performed as described by Jia et
al. (1993) , except that 1 mM
Mg2+ was added to the Trump's fixative,
which appeared to improve the fixation of internal bouton structures.
Transverse ultrathin serial sections (70-90 nm) were cut from ventral
longitudinal muscles 6 and 7 at abdominal segments A2 and A3. Three
wild-type (21 boutons), three APPLsd (17 boutons), and three APPL+ (13 boutons)
samples were used for this study. In all cases, boutons were analyzed
from photographs taken at 15,000-30,000× magnification, corresponding
to the bouton midline (Budnik et al., 1996 ). Morphometric analysis
(number of active zones) was performed as described by Budnik et al.
(1996) using larvae expressing APPLsd.
 |
RESULTS |
APPL is transported to synaptic boutons at the NMJ but it is not
required for NMJ formation
We have shown previously that APPL is found at developing central
synapses, such as the synaptic layers of the pupal optic lobes (Torroja
et al., 1996 ). However, not all neuropil regions display APPL
immunoreactivity, indicating that APPL is present differentially at
synapses. To determine whether APPL is transported to motoneuron
synapses, we used antibodies directed against the APPL ectodomain
(Torroja et al., 1996 ) to label larval body wall muscle preparations.
We found that APPL was consistently distributed in a punctate pattern
within the abdominal nerves, down to the point of contact with body
wall muscles, consistent with axonal transport of APPL (Fig.
1A1,A2).
NMJs showed very weak APPL signal (Fig. 1A2). No
signal was detected in nerves or NMJs of the Appl null
mutant (Appld) larvae, demonstrating that
APPL immunoreactivity at nerves and NMJs was specific (Fig.
1B1,B2).

View larger version (43K):
[in this window]
[in a new window]
|
Figure 1.
Transport of APPL to motor axons and nerve
terminals, and synapse morphology at NMJs with altered APPL levels.
A1-D1, Anti-HRP staining of larval NMJs in wild-type
muscles 12 and 13 (A1),
Appld mutant muscles 12 and 13 (B1), a larva overexpressing APPL+
(muscles 6/7) (C1), and a larva overexpressing
APPLsd (muscles 6/7) (D1).
A2-D2, Anti-APPL immunoreactivity in the same samples.
Note the presence of bright immunoreactivity at the nerve of the wild
type and the weak immunoreactivity at synaptic boutons. This anti-APPL
signal is eliminated in the Appld mutant.
NMJs from larvae overexpressing either APPL+
or APPLsd show strong anti-APPL immunoreactivity. In
Applsd, immunoreactivity is more restricted to
boutons, whereas in APPL+ immunoreactivity is not
restricted to boutons but is also found well outside boutons (not
colocalized with anti-HRP). Arrow points to a satellite
budding off from an NMJ process. Scale bar: A,
B, 25 µm; C, D, 12 µm.
|
|
APPL signal at synaptic terminals was enhanced when APPL was
overexpressed in the nervous system. Neural APPL overexpression was
achieved using the UAS/Gal4 system for targeted gene expression (Brand
and Perrimon, 1993 ). The UAS-Appl+
transgene was driven by pan-neural Gal4 drivers c155 (Lin and Goodman, 1994 ) or Appl-Gal4 (Torroja et al., 1999 ), or the
motoneuron-specific Gal4 driver
P[Gal4w+]C164. Expression of APPL and
its influence on synapse structure was examined at muscles 6 and 7. These muscles are innervated by two glutamatergic motoneurons that give
rise to morphologically and physiologically distinct synaptic boutons
[type Ib (big) and type Is (small)] (Atwood et al., 1993 ; Jia
et al., 1993 ; Kurdyak et al., 1994 ). At the NMJs of larvae
overexpressing APPL+, APPL
immunoreactivity was readily evident (Fig.
1C1,C2). APPL signal appeared in a nonhomogenous
punctate pattern, primarily inside synaptic boutons (colocalized with
anti-HRP as a presynaptic marker) but also outside in the immediate
vicinity of synaptic boutons (Fig. 1C1,C2). The
APPL immunoreactivity outside the boutons may represent secreted APPL,
as overexpressing a secretion-deficient APPL form
(APPLsd) resulted in APPL immunoreactivity
that was more restricted to synaptic boutons (see below). However, the
nature of the outside signal was not further investigated.
The presence of APPL in motor axons and their synaptic terminals
suggested that it might be involved in synapse development and/or
function. We therefore examined NMJs from
Appld larvae to ascertain the effects of
the lack of APPL on synapse structure. NMJs from mutant larvae,
examined in anti-HRP stained preparations, had a generally normal
appearance but contained fewer boutons (Fig. 1B1). We
counted the number of synaptic boutons at muscles 6 and 7 of abdominal
segment 3 at the light microscopic level (see Materials and Methods)
and found that Appld showed a significant
decrease in the number of synaptic boutons (34%; p < 0.001) compared with wild type (see below).
Overexpression of APPL perturbs NMJ appearance
When APPL was overexpressed in motoneurons, the increase in APPL
signal was accompanied by a change in overall morphology of the NMJ. We
were intrigued by these profound structural changes (Fig.
1C1,D1), which included a dramatic
increase in the number of synaptic boutons (see below) that resulted
largely from numerous small synaptic boutons of abnormal appearance
(Figs. 2B,
3). In wild-type NMJs, type I
synaptic boutons within a branch resemble a string of beads, with
boutons connected to one another by a short neuritic process (Fig.
2A). In contrast, in larvae overexpressing APPL, many
small "satellite" boutons appeared to bud off from a central bouton
of normal appearance (Fig. 2B, arrowhead).
This phenotype was associated with both type Ib and type Is endings. A
fraction of satellite boutons (~24%) were also observed budding off
from neuronal processes connecting two boutons (Fig. 1C1, arrow).

View larger version (29K):
[in this window]
[in a new window]
|
Figure 2.
Light microscopic analysis of satellite boutons.
A, B, Anti-HRP immunoreactivity in a string of synaptic
boutons at muscles 6/7 of wild type (A) and a
larva overexpressing APPL+
(B). Arrowheads point to a
satellite bouton. C, D, Anti-synapsin immunoreactivity
in wild type (C) (same preparation shown in
A) and a larva overexpressing APPL+
(D) (same preparation shown in B).
Note that each satellite bouton contains synapsin immunoreactivity.
E, F, Anti-HRP (red) and anti-DLG
(green) double labeling of NMJs in wild type
(E) and a larva overexpressing
APPL+(F). Note that virtually
all satellite boutons are surrounded by DLG immunoreactivity. Scale
bar, 13 µm.
|
|

View larger version (23K):
[in this window]
[in a new window]
|
Figure 3.
Quantitative analysis of NMJs at muscles 6 and 7 (abdominal segment 3) of wild type and APPL variants expressing normal
and altered forms of APPL. A, Total number of boutons.
B, Percentage of satellite boutons relative to total
number of boutons (see Results for a definition of satellites).
C, Number of parent (nonsatellite) boutons. The number
of preparations quantified are the same as shown above the
bars in B.
|
|
To determine whether the satellite boutons had normal features of
synaptic boutons, we used presynaptic and postsynaptic markers. Analysis of the presynaptic markers synapsin (Fig.
2C,D; Klagges et al., 1996 ),
synaptotagmin (data not shown) (Littleton et al., 1993 ), and CSP
(data not shown) (Zinsmaier et al., 1990 ) revealed that each satellite
bouton was immunopositive for these markers. Furthermore, analysis of
DLG immunoreactivity, a marker for postsynaptic subsynaptic reticulum
(SSR), clearly demonstrated that virtually all satellite boutons were
surrounded by SSR (Fig.
2E,F) as is the case with
normal boutons (Lahey et al., 1994 ). Thus, at least some elements of
the presynaptic apparatus and postsynaptic SSR are likely to be normal
at the satellite synapses.
The fine structure of the satellite boutons was analyzed at the EM
level (Fig. 4). As expected from the
light microscopic appearance of these NMJs, clusters of boutons were
common in APPL+ overexpressors, and larger
boutons were often surrounded by many small satellite boutons (Fig.
4B, asterisks). These satellite boutons
appeared to share a common SSR with the central boutons and were
frequently observed budding off from a parent bouton (Fig.
4B, arrow). At the presynaptic site, the
satellite boutons contained 40 nm clear synaptic vesicles and
mitochondria and displayed one or more T-shaped presynaptic densities
(active zones) of normal appearance (Fig. 4B,
arrowheads). Quantification of the number of active zones
per bouton midline (see Materials and Methods) revealed that boutons
from APPL overexpressors and from wild type had a similar number of
active zones, 0.62 ± 0.15 (n = 21 boutons, 3 preparations) in APPL overexpressing larvae versus 1.0 ± 0.24 (n = 17 boutons, 3 preparations) in wild type.
These observations suggest that, although small, satellite boutons have
at least several normal type I bouton presynaptic and postsynaptic
elements and therefore may form functional synaptic connections.

View larger version (108K):
[in this window]
[in a new window]
|
Figure 4.
Ultrastructural organization of type I synaptic
boutons in a larva overexpressing APPL+.
A, Cross-section through a type I synaptic bouton in
wild type. B, Cross-section through type I boutons and
satellite boutons in a larva overexpressing APPL+.
Note that, in wild type, a single bouton is completely surrounded by
the elaborate SSR. In larvae overexpressing APPL+,
parent boutons (b) and their satellite boutons
(asterisks) appear surrounded by a common SSR. Note a
satellite bouton budding off from a parent bouton
(arrow). Inset shows a view of a
satellite bouton containing a presynaptic density.
Arrowheads indicate presynaptic densities. Scale bar,
1.2 µm.
|
|
To quantify the increase of synaptic boutons observed in
APPL+ overexpressing NMJs, we counted the
total number of synaptic boutons (Fig. 3A), the percentage
of satellite boutons (Fig. 3B), and the number of normal
boutons (parent boutons) (Fig. 3C) at muscles 6 and 7 of
abdominal segment 3 at the light microscopic level. For this
quantification, boutons were considered to be satellites if they were
substantially smaller than normal type I boutons and were connected to
a central (parent) bouton (Fig. 1C1,D1). Boutons
that had a size and morphology similar to typical satellites but
emerged directly from an NMJ process were also considered to be
satellites. We found that, in larvae overexpressing APPL+ (using C164 as the Gal4 neuronal
driver), there was an ~2.5-fold increase in the total number of
boutons (p < 0.001), and an approximate threefold increase in the percentage of satellite boutons
(p < 0.001) compared with wild type. No
significant change in the number of synaptic boutons compared with wild
type (total number of boutons, 109.6 ± 2.6; n = 95) was observed in the control progeny (C164 crossed to
UAS-LacZ; total number of boutons, 115.7 ± 7.3;
n = 19). Thus, whereas the lack of APPL in
Appld mutants leads to a relatively small
decrease in the number of synaptic boutons, increasing APPL levels
results in a dramatic rise in bouton number. This increase in bouton
number resulting from both an increase in satellite boutons and
an elevated number of nonsatellite boutons of normal appearance (parent
boutons) (Fig. 3). Interestingly, expression of a human APP isoform,
APP695, also resulted in a significant but
comparatively smaller increase in the total number of synaptic boutons
(~1.4 fold; p < 0.001) and, particularly, an
increase in the percentage of satellite boutons (approximately twofold;
p < 0.001) (Fig.
3A,B).
Expression of a transmembrane APPL form mimics
APPL+-induced NMJ phenotype
All APP family members are proteolytically processed and can be
found as transmembrane and soluble protein forms. Studies demonstrating
extensive regulation of the cleavage and release of soluble APP (Gandy
and Greengard, 1994 ; Nitsch et al., 1994 ) suggest that the two protein
forms may play specific roles. To determine whether the transmembrane
or soluble APPL isoform can promote satellite formation, we used
transgenes that express mutant APPL proteins (Fig.
5A) upon Gal4 activation.
UAS-Applsd transgene encodes a
secretion-defective transmembrane form in which APPL lacks the
proteolytic cleavage site and consequently is expressed only as a
membrane-bound protein. UAS-Appls
transgene encodes a constitutively secreted form because it lacks the
transmembrane and cytoplasmic domains. Analysis of NMJs in larvae
expressing APPLsd or
APPLs demonstrated that
APPLsd expression resulted in a phenotype
similar to the phenotype observed in larvae overexpressing
APPL+ (Figs. 3,
6B), increasing the
percentage of satellite boutons (approximately fourfold;
p < 0.001) and, to a lesser extent, the number of
parent boutons (~1.7-fold; p < 0.001). In contrast, APPLs did not significantly differ from
wild type with regard to the total number of synaptic boutons or
satellites (Fig. 3A).

View larger version (38K):
[in this window]
[in a new window]
|
Figure 5.
Mutant APPL proteins. A,
Schematic representation of the mutant APPL proteins used in this
study. E1 and E2 are the two most
conserved regions in the extracellular domain. C is the
cleavage site that is deleted in all APPLsd forms.
TM represents the transmembrane domain. In the
cytoplasmic domain, g refers to the putative
Go-binding domain, and I is the
internalization signal (see Results). B,
Expression of mutant APPL proteins detected in Western blots of adult
head total protein extracts. Blots were probed with a polyclonal
antibody against the extracellular region of APPL that detects both
transmembrane and secreted forms (lanes 1-9), or with a
polyclonal antibody against the cytoplasmic internalization signal that
detects only the transmembrane form (lanes
10-16). In either case, no protein is observed in
Appld heads (lanes 1,
10), and the expected bands are present in wild-type Canton
special heads (lanes 2, 11). In
lane 2, the intense top band contains
transmembrane APPL forms with different post-translational
modifications. Directly below, a broad weak band
includes soluble APPL proteins with different post-translational
modifications. As expected, this soluble form is not recognized by the
antibody against the cytoplasmic domain (lane 11).
Lanes 3-9 and 12-16 are extracts from
heads of the genotype Appld
Appl-Gal4; UAS-Appl*/+
(asterisk indicates any of the deletion constructs)
raised at 30°C (lanes 3, 12) or at
20°C (lanes 4-9, 13-16) in
which APPL protein is derived exclusively from the transgene
encoding wild-type (APPL+) or mutant
(APPLs and APPLsd *) APPL
forms. Appl+ generates both transmembrane
and soluble forms (lanes 3, 4, 12,
13), whereas Appls
produces only the soluble forms detected as a weak broad band
(lane 5). All Applsd
-derived transgenes generate only transmembrane forms that
contain the cytoplasmic domain (compare lane 6
with 14); the bottom band at
~100 kDa most likely corresponds to unglycosylated forms. Molecular
weights are expressed in kilodaltons.
|
|

View larger version (126K):
[in this window]
[in a new window]
|
Figure 6.
APPL domains required for satellite bouton
formation and effect of elevated neuronal activity in APPL expression
and satellite bouton formation. A-D, Anti-HRP
immunoreactivity in wild type (A), an
APPLsd larva (B), an
APPLsd C larva (C), and an
APPLsd CI larva (D). Note
that normal boutons are present in larvae overexpressing the APPL
variant lacking the cytoplasmic domain or the conserved internalization
sequence. E, Expression of APPL in eag Sh
mutants. Note that, unlike wild type (Fig. 1A2), APPL
immunoreactivity at the NMJ of eag Sh mutants is
enhanced, and it is associated with the borders of the most distal
boutons. F1, NMJs in eag Sh mutants
expressing APPLsd, showing a decrease in satellite
boutons (but see histogram in Fig. 2B).
F2, Anti-APPL immunoreactivity in the same preparation as
F1. Scale bar: A-D, F, 12 µm; E, 18 µm.
|
|
The lack of effect seen in APPLs may be
because of differences in the amount of protein expressed. Therefore,
we assessed the levels of expression of the different transgenic APPL
forms in immunoblots probed with anti-APPL antibodies (Fig.
5B). Immunoblots of adult head extracts of wild type,
Appld, and transgenic flies expressing
different APPL constructs in an Appld
background revealed that Gal4-driven expression of both
APPL+ and
APPLsd resulted in high levels of protein
relative to the endogenous level of APPL (at 30°C, the amount of
APPL+ protein expressed with Appl-Gal4
driver was approximately three times higher than that of endogenous
APPL). In contrast, the amount of APPLs
generated from the transgene was only comparable with the amount of
endogenous soluble APPL. We suspect that this is attributable to
lability of the expressed soluble protein because other Appl mutant constructs expressed with this system all resulted in robust expression. We also attempted to increase the amount of
APPLs by using two doses of the transgene.
This manipulation did not alter the total number of boutons but
significantly reduced the number of satellites compared with wild type
(Fig. 3). In conclusion, both overexpression of
APPL+ holoprotein or transmembrane
APPLsd can strongly promote satellite
bouton formation, but APPLs does not
affect the number of total boutons, even after doubling the number of
copies of the transgene. However, two doses of
APPLs decreased the number of satellite
boutons (Fig. 3A).
The results described above suggest that the synaptic bouton-promoting
activity associated with APPL overexpression is sensitive to APPL
concentration. To test this possibility, we examined the phenotype of
NMJs in Appld larvae that overexpressed
APPLsd to eliminate wild-type
contribution. We found that the increase in the number of synaptic
boutons, percentage of satellites, and number of parent boutons was
intermediate but significantly different (p < 0.01) from wild-type and APPLsd
overexpressing larvae (Fig. 3), supporting a concentration effect of
APPL on this activity.
The APPL cytoplasmic domain is required to promote
synapse formation
We were interested in finding the domains of APPL that were
important for satellite and parent bouton-forming activity. APP family
proteins have several conserved domains that were initially recognized
from APP and APPL comparison (Rosen et al., 1989 ) (Fig. 5). Among these
are a perfectly conserved internalization sequence in the cytoplasmic
domain (GYENPTY) and extracellular regions of high homology E1 and E2.
Additionally, in the cytoplasmic domain a
Go-protein binding site, which is conserved in
APPL, has been demonstrated (Nishimoto et al., 1993 ; Okamoto et al.,
1995 ). We used these defined domains as a guide to construct a series
of deletion mutants: E1, lacking the distal half of E1 and those amino acids (aa) c-terminal to it (85-321 aa); E2, lacking 75% of
the distal E2 and amino acids c-terminal to it (449-740 aa); C100,
lacking the entire ectodomain (21-787 aa); C, lacking the entire
cytoplasmic domain (836-886 aa); CI, lacking the internalization sequence (872-883 aa); and Cg, lacking the putative
Go-protein binding site (845-855 aa).
Applsd was chosen rather than
Appl+ as a parent construct to avoid
complications in interpretation that may arise if generated
APPLs has independent activity. A
schematic representation of these constructs is shown in Figure
5A. Because several transformants were obtained with each
construct, we selected those lines that showed strong and similar
levels of protein expression in immunoblot analysis (Fig.
5B).
NMJs from larvae expressing the different constructs were double
stained with anti-HRP and anti-APPL, and the total number of boutons,
the percentage of satellite boutons, and the number of parent boutons
were determined. Labeling with anti-APPL antibodies allowed us to
determine that, with the exception of C100, all APPL mutant proteins
were transported to the NMJs in which they were present at similar
levels (data not shown). Because C100 was not transported to the NMJ,
quantification of the number of boutons (which was similar to wild
type) is not included in the histogram of Figure 5.
The salient observations from quantification of synaptic bouton number
in larvae expressing APPLsd -deletion
proteins, E1, E2, and C, are as follows. (1)
APPLsd, further deleted for either of the
two extracellular domains ( E1 or E2), prevented an increase in
the number of parent boutons, yet it still retained satellite
bouton-forming activity (p < 0.001). (2) In
contrast, deletion of the entire cytoplasmic domain of APPLsd ( C) completely abolished both
the satellite bouton-promoting activity and the increase in the number
of parent boutons (Figs. 3B,C,
6C). Thus, the cytoplasmic domain is essential for both the
satellite bouton-promoting activity and the formation of extra parent boutons.
To further dissect the likely cytoplasmic domain regions responsible
for promoting synapse formation, we also overexpressed smaller
deletions in the cytoplasmic domain. Deletion of the putative Go-protein binding site ( Cg) retained the
satellite bouton-promoting capacity (p < 0.001), but the formation of extra parent boutons was suppressed (Fig.
3B,C). Conversely, larvae
expressing APPL variants that lack the conserved internalization signal
( CI) had NMJs with a wild-type appearance with regard to the number of satellite boutons (Figs. 3B, 6D).
Interestingly, however, these larvae still showed a dramatic increase
in the number of parent boutons, which translated into an increase in
the total number of boutons (Fig. 3C)
(p < 0.001). Thus, the satellite
bouton-promoting activity depends on the presence of the
internalization signal, whereas the formation of extra parent boutons
depends on the presence of the Go-protein binding
site and the presence of an intact extracellular domain.
The development of satellite boutons and the expression of APPL may
involve activity-dependent mechanisms
A role for neuronal activity in the development and maintenance of
synapses has been documented in many systems (Cline, 1991 ). Neuronal
activity has also been shown to regulate APP metabolism (Allinquant at
al., 1994 ; Nitsch et al., 1994 ). We wondered whether APPL-mediated
regulation of the NMJ growth was induced through neuronal activity. To
explore this question, we analyzed the effects of APPL overexpression
in the hyperexcitable double mutant eag Sh (Fig. 6). Our
goals were to analyze the distribution of endogenous APPL in eag
Sh mutants and to analyze the NMJ of eag Sh
mutants overexpressing APPL.
Intriguingly, APPL immunoreactivity in eag Sh differed from
wild type. In wild type, APPL signal at synaptic boutons is very low
but is observed throughout the NMJ (Fig. 1A2). In
contrast, in eag Sh mutants, APPL signal was consistently
brighter and more concentrated at the most distal bouton(s) of a given
NMJ branch (Fig. 6E). In addition, APPL signal
appeared more concentrated at the bouton border, suggesting that there
might be an increase in plasma membrane-associated APPL. This phenotype
was observed in two allelic combinations of eag Sh
(eag1 ShKS133 and
eag4PM Sh5).
Western analysis of adult heads revealed no significant difference in
the amount of total APPL between wild type and eag Sh (data not shown).
Previous studies have revealed that, in eag Sh mutants, both
the number of boutons and NMJ branches are increased (Budnik et al.,
1990 ; Jia et al., 1993 ; Schuster et al., 1996 ). However, the increase
in synaptic boutons in eag Sh double mutants differs from
that observed in NMJs with APPL overexpression. In NMJs with enhanced
APPL levels, the increase in the number of synaptic boutons derives
primarily from satellite boutons, whereas in eag Sh mutants the increase in the number of synaptic boutons results from an increased elongation of the presynaptic terminals and the formation of
new secondary branches (Budnik et al., 1990 ). In eag Sh
larvae overexpressing APPLsd, a reduction
in the percentage of satellite boutons was observed when compared with
APPLsd overexpressed in a wild-type
background (p < 0.001). However, the formation
of extra parent boutons was still observed (Fig. 3B,C) (p < 0.001). Thus, eag Sh changes the pattern of endogenous APPL
expression and partially attenuates the satellite bouton-promoting activity elicited by overexpression of APPL.
 |
DISCUSSION |
We used an overexpression approach to determine whether APPL plays
a role in the regulation of synapse formation. Overexpression of APPL
in motoneurons resulted in morphologically distinct NMJs, characterized
by an increase in both parent and satellite boutons. To define the APPL
domains essential for these effects, we performed an analysis with
Appl deletion proteins that were expressed in motoneurons.
This demonstrated that a cytoplasmic internalization sequence is
essential for satellite bouton formation, whereas a cytoplasmic
Go-protein binding sequence and extracellular
domains are essential in promoting excess parent bouton formation.
Furthermore, we observed that, in eag Sh mutants (elevated
neuronal activity), APPL overexpression-associated effects are
partially suppressed, and the endogenous pattern of APPL expression at
the NMJ is altered. These results indicate that APPL localization and
trafficking at the synaptic bouton membrane can be regulated in an
activity-dependent manner and may influence synaptic growth.
Regulation of satellite and parent bouton formation by APPL
The normal appearance of NMJs in larvae lacking APPL in the
loss-of-function mutation demonstrates that APPL is not required for
synaptogenesis and/or synapse maintenance. However, bouton numbers are
reduced, indicating a possible regulatory role. This notion is
bolstered by the striking increase in the number of parent and
satellite boutons observed when APPL is elevated. Similar to APPL,
human neuronal APP also elicited an increase in satellite and parent
bouton number. This provides further support for the notion that
APP695 and APPL are structurally and functionally conserved.
An increase in bouton number has been observed in several
Drosophila mutants that affect synaptic activity, such as
eag Sh and dunce (Hannan and Zhong, 1999 ). In
eag Sh, the increase in bouton number appears to derive from
longer and more branched neuronal processes containing normal synaptic
boutons (Budnik et al., 1990 ). In contrast, APPL overexpression results
in satellite boutons that protrude from a larger parent bouton,
although parent bouton number is also increased.
During the postembryonic stage, there is tremendous growth of the NMJ,
including elongation and formation of branches, as well as increases in
bouton number, number of active zones, and bouton area (Gorczyca et
al., 1993 ; Guan et al., 1996 ; Schuster et al., 1996 ). These studies
suggest that NMJ expansion involves sprouting and elongation of a
process, followed by the differentiation of new terminal boutons.
Satellite boutons resulting from APPL overexpression may be caused by
increased sprouting and abnormal bouton differentiation.
Functional domains of APPL
The distribution of different APPL forms in larval brains suggests
that the transmembrane and soluble forms play specific roles in
Drosophila neurons (Torroja et al., 1996 ). Indeed, we found
that the secretion-deficient APPL form is as effective as wild-type
APPL in promoting satellite bouton formation, whereas constitutively
secreted APPL has no effect when expressed in one dose and has an
effect similar to the Appl null mutant with two doses of the
transgene. The observation that two doses of
APPLs result in a reduction in the
percentage of satellites may indicate an inhibitory role on the
satellite bouton-promoting activities.
Deletion of the APPL cytoplasmic domain abolished both the satellite
bouton and parent bouton-promoting activity of APPL. However, these
activities can be dissected by smaller deletions of the cytoplasmic and
extracellular domains. Deletion of the internalization sequence
prevented the formation of satellites but did not prevent the increase
in parent boutons. In contrast, deletion of the putative
Go-protein binding site prevented the increase in
the number of parents, but the satellite bouton-promoting activity
remained intact. Similar results were found when portions of the
extracellular domain (E1 and E2), which may serve to bind a ligand to
regulate Go function (Okamoto et al., 1995 ;
Brouillet et al., 1999 ), were deleted.
In vertebrates, the internalization signal is crucial for regulating
APP processing and trafficking (Lai et al., 1995 ; Borg et al., 1998a ).
It interacts with several proteins, including X11 and Fe65 (Ermekova et
al., 1997 ; Trommsdorff et al., 1998 ), which may participate in the
regulation of APP metabolism (Borg et al., 1998a ,b ; Sastre et al.,
1998 ). Thus, APPL-dependent satellite bouton formation is likely to
involve APPL internalization. Alternatively, or in addition, APPL may
signal by interacting with cytoplasmic proteins, leading to the
formation of satellite boutons. The low levels of APPL detected in
wild-type NMJs suggests that APPL turnover may be high at the plasma
membrane, similar to APP turnover in vertebrates (Allinquant et al.,
1994 ; Koo et al., 1996 ).
Internalization of synaptic proteins plays an important role in the
regulation of synaptic growth. For example, the Aplysia cell
adhesion molecule ApCaM (Bailey and Kandel, 1993 ) and its Drosophila homolog Fasciclin II (Schuster et al., 1996 ) are
internalized at synapses in an activity-dependent manner. This promotes
synapse growth, presumably by decreasing adhesion between presynaptic and postsynaptic membranes.
Studies in vertebrates show that APP695 behaves
as a Go-linked receptor; its cytoplasmic region
binds to Go-protein (Nishimoto et al., 1993 ;
Okamoto et al., 1995 ). However, whether APP stimulates or downregulates
Go is unclear (Brouillet et al., 1999 ). The
observation that deletion of the putative APPL
Go-binding site abolishes the ability of APPL to
increase parent bouton number indicates that Go
activity may be involved (Fig. 7). This
is consistent with observations implicating Go in
growth cone motility and synapse plasticity (Goh and Pennefather, 1989 ;
Strittmatter et al., 1994 ) and with high levels of
Go-protein in developing insect neurites (de
Sousa et al., 1989 ; Wolfgang et al., 1991 ; Copenhaver et al., 1995 ).

View larger version (19K):
[in this window]
[in a new window]
|
Figure 7.
Role of APPL on NMJ expansion.
A, Stages of NMJ expansion during larval development.
According to our model, new boutons at expanding NMJs are formed by
sprouting, followed by the consolidation of some of the sprouts into
undifferentiated boutons, which subsequently differentiate to form a
new mature bouton (shaded boutons). B,
Model of APPL function as a Go-coupled receptor. According
to this model, the binding of a ligand to APPL activates a transduction
cascade that involves Go-protein. Ligand-bound or unbound
APPL is internalized and subsequently recycled to the cell membrane. We
propose that surface APPL is involved in sprouting, whereas activation
of the transduction cascade is involved in the regulation of bouton
differentiation. Deletion of the Go-protein binding site
( Cg) or the conserved extracellular domains
( E1, E2) results in oversprouting
with diminished bouton differentiation, leading to satellite boutons.
Deletion of the internalization signal ( CI) or
elevated levels of electrical activity (eag Sh mutants)
lead to an increase in surface APPL, resulting in the differentiation
of a larger than normal number of sprouts and therefore an increase in
the number of parent boutons.
|
|
Is the APPL synaptic bouton-promoting function regulated by
neuronal activity?
Processing and trafficking of APP are known to be affected by
neuronal activity (Allinquant et al., 1994 ; Nitsch et al., 1994 ). For
example, in cortical neurons, the axonal pool of APP holoprotein at the
surface was found to be increased after
Ca2+ entry (Allinquant et al., 1994 ). In
eag Sh larvae, endogenous APPL signal was consistently
increased, especially at the distal-most boutons. Furthermore, when
APPL was overexpressed in the hyperexcitable mutant, there was a
reduction in satellite bouton number and an increase in parent boutons.
This phenotype is similar to the phenotype associated with
overexpression of APPL lacking the internalization signal. Thus,
deletion of the internalization signal, or high activity, are both
likely to increase surface APPL (presumably through a decrease in
internalization) and have similar effects on synaptic growth.
APPL-associated function
We suggest that APPL is involved in synaptic plasticity, because
APPL is nonessential for formation and maintenance of synapses but can
promote synapse formation and appears to be affected by neuronal
activity. NMJ phenotypes resulting from the expression of APPL proteins
lacking specific domains suggest that APPL trafficking and
APPL-dependent signal transduction are two processes that regulate
APPL-induced synaptic growth. The evidence indicates that (1) APP can
be rapidly internalized (Koo et al., 1996 ); (2) processing and
trafficking of APPL and APP is affected by activity (Allinquant et al.,
1994 ; this study); and (3) plasma membrane APP, and possibly APPL,
behave as Go-protein linked receptors (Nishimoto
et al., 1993 ).
We propose that NMJ expansion occurs by two consecutive steps: the
formation of sprouts and the consolidation of some of these sprouts
into differentiated boutons (see also Zito et al., 1999 ). Bouton
differentiation entails the proper arrangement of presynaptic and
postsynaptic components, as well as the enlargement of the sprout to
accommodate all the elements required for synaptic transmission. Both
sprouting and differentiation are modulated by APPL. We suggest that
plasma membrane APPL induces sprouting and that this response is
independent of APPL signal transduction. In contrast, bouton differentiation is regulated by APPL signal transduction, which may
involve Go (Fig. 7). Internalization of APPL
stops both activities. We propose that a satellite bouton is formed
when APPL-induced sprouting is initiated, followed by rapid
internalization of APPL, thus reducing APPL-dependent signal
transduction and, therefore, bouton differentiation. As a result, some
degree of differentiation, such as the formation of active zones and
transport of vesicles, does occur, but other aspects, such as bouton
enlargement, do not.
Several predictions from this model are in line with our findings. For
instance, decreasing APPL internalization ( CI) would reduce
formation of satellites. A persistent increase in APPL activation, as a
result of decreased internalization, is predicted to promote the
differentiation of sprouts, thus effectively increasing the number of
parent boutons. In contrast, overexpression of APPL variants that are
unable to undergo ligand-dependent receptor activation ( E1, E2,
Cg) would reduce bouton differentiation, preventing the increase of
parents but not of satellites. Full-length APPL
(APPL+,
APPLsd) would stimulate both
sprouting and differentiation and could be rapidly internalized as in
wild type, thus promoting both parent and satellite bouton formation.
Rapid APPL internalization appears to be key to the normally low level
of plasma membrane APPL. Increases in plasma membrane-associated APPL
result from increased neuronal activity, a factor shown to increase
bouton number (Budnik et al., 1990 ). Strikingly, overexpression of
APPLsd in eag Sh results in
reduction of satellites, with a concomitant increase in the number of
parent boutons. This further supports the idea that neuronal activity
can drive APPL-mediated bouton differentiation.
Based on our observations, we conclude that APPL has functional
significance for the regulation of synapse formation. Moreover, we have
shown that this process involves the APPL domains that are likely to
affect APPL signal transduction, suggesting a novel mechanism for the
regulation of the size of synaptic arbors.
 |
FOOTNOTES |
Received April 16, 1999; revised June 14, 1999; accepted June 28, 1999.
This work was supported by National Institutes of Health Grants RO1
NS30072 and KO4 NS01786 to V.B. and GM33205 to K.W. L.T. was
supported on a postdoctoral fellowship from the Ministry of Education
of Spain and a grant from G. Bursak. We thank Drs. E. Buchner, H. Bellen, and K. E. Zinsmaier for their generous gifts of antibodies
and Dr. U. Thomas for critical reading of this manuscript and helpful
discussions. We also thank the reviewers for their thorough review and
helpful comments. We thank Mutuhi Mugo for her assistance with the
dissections and the Electron Microscopy Facility and Biology Computer
Resource Center at the University of Massachusetts.
L.T. and M.P. contributed equally to this work.
Correspondence should be addressed to Vivian Budnik, Department of
Biology, Morrill Science Center, University of Massachusetts, Amherst,
MA 01003.
 |
REFERENCES |
-
Allinquant B,
Moya K,
Bouillot C,
Prochiantz A
(1994)
Amyloid precursor protein in cortical neurons: coexistence of two pools differentially distributed in axons and dendrites and association with cytoskeleton.
J Neurosci
14:6842-6854[Abstract].
-
Atwood HL,
Govind CK,
Wu C-F
(1993)
Differential ultrastructure of synaptic terminals on ventral longitudinal abdominal muscles in Drosophila larvae.
J Neurobiol
24:1008-1024[Web of Science][Medline].
-
Bailey CH,
Kandel ER
(1993)
Structural changes accompanying memory storage.
Annu Rev Physiol
55:397-426[Web of Science][Medline].
-
Borg JP,
Yang Y,
De Taddeo-Borg M,
Margolis B,
Turner RS
(1998a)
The X11alpha protein slows cellular amyloid precursor protein processing and reduces A
40 and A 42 secretion.
J Biol Chem
273:14761-14766[Abstract/Free Full Text]. -
Borg JP,
Straight SW,
Kaech SM,
de Taddeo-Borg M,
Kroon DE,
Karnak D,
Turner RS,
Kim SK,
Margolis B
(1998b)
Identification of an evolutionarily conserved heterotrimeric protein complex involved in protein targeting.
J Biol Chem
273:31633-31636[Abstract/Free Full Text].
-
Brand AH,
Perrimon N
(1993)
Targeted gene expression as a means of altering cell fates and generating dominant phenotypes.
Development
118:401-415[Abstract].
-
Brouillet E,
Trembleau A,
Galanaud D,
Volovitch M,
Bouillot C,
Valenza C,
Prochiantz A,
Allinquant B
(1999)
The amyloid precursor protein interacts with Go heterotrimeric protein within a cell compartment specialized in signal transduction.
J Neurosci
19:1717-1727[Abstract/Free Full Text].
-
Budnik V,
Zhong Y,
Wu C-F
(1990)
Morphological plasticity of motor axon terminals in Drosophila mutants with altered excitability.
J Neurosci
10:3754-3768[Abstract].
-
Budnik V,
Koh Y-H,
Guan B,
Hartmann B,
Haugh C,
Woods D,
Gorczyca M
(1996)
Regulation of synapse structure and function by the Drosophila tumor suppressor gene, dlg.
Neuron
17:627-640[Web of Science][Medline].
-
Buxbaum JD,
Gandy SE,
Cicchetti P,
Ehrlich ME,
Czernik AJ,
Fracasso RP,
Ramabhadran TV,
Unterbeck AJ,
Greengard P
(1990)
Processing of Alzheimer
A4 amyloid precursor protein: modulation by agents that regulates protein phosphorylation.
Proc Natl Acad Sci USA
87:6003-6006[Abstract/Free Full Text]. -
Cline HT
(1991)
Activity-dependent plasticity in the visual systems of frogs and fish.
Trends Neurosci
14:104-111[Web of Science][Medline].
-
Copenhaver PF,
Horgan AM,
Nichols DC,
Rasmussen MA
(1995)
Developmental expression of heterotrimeric G proteins in the nervous system of Manduca sexta.
J Neurobiol
26:461-484[Medline].
-
Daigle I,
Li C
(1993)
apl-1, a Caenorhabditis elegans gene encoding a protein related to the human
-amyloid protein precursor.
Proc Natl Acad Sci USA
90:12045-12049[Abstract/Free Full Text]. -
de Sousa SM,
Hoveland LL,
Yarfitz S,
Hurley JB
(1989)
The Drosophila Go
-like protein gene produces multiple transcripts and is expressed in the nervous system and ovaries.
J Biol Chem
264:18544-18551[Abstract/Free Full Text]. -
Ermekova KS,
Zambrano N,
Linn H,
Minopoli G,
Gertler F,
Russo T,
Sudol M
(1997)
The WW domain of neural protein FE65 interacts with proline-rich motifs in Mena, the mammalian homolog of Drosophila enabled.
J Biol Chem
272:32869-32877[Abstract/Free Full Text].
-
Furukawa K,
Mattson MP
(1998)
Secreted amyloid precursor protein alpha selectively suppresses N-methyl-D-aspartate currents in hippocampal neurons: involvement of cyclic GMP.
Neuroscience
83:429-438[Web of Science][Medline].
-
Furukawa K,
Barger SW,
Blalock EM,
Mattson MP
(1996)
Activation of K+ channels and suppression of neuronal activity by secreted
-amyloid precursor protein.
Nature
379:74-78[Medline]. -
Gandy S,
Greengard P
(1994)
Regulated cleavage of the Alzheimer amyloid precursor protein: molecular and cellular basis.
Biochimie
76:300-303[Medline].
-
Goh JW,
Pennefather PS
(1989)
A pertussis toxin-sensitive G protein in hippocampus long-term potentiation.
Science
244:980-983[Abstract/Free Full Text].
-
Gorczyca MG,
Augart C,
Budnik V
(1993)
Insulin-like receptor and insulin-like peptide are localized at neuromuscular junctions in Drosophila.
J Neurosci
13:3692-3704[Abstract].
-
Guan B,
Hartmann B,
Koh Y-H,
Gorczyca M,
Budnik V
(1996)
The Drosophila tumor suppressor gene, dlg, is involved in structural plasticity at a glutamatergic synapse.
Curr Biol
6:695-706[Web of Science][Medline].
-
Hannan F,
Zhong Y
(1999)
Second messenger systems underlying plasticity at the neuromuscular junction.
In: Neuromuscular junctions in Drosophila: international review of neurobiology, Vol 43 (Budnik V,
Gramates LS,
eds), pp 119-138. San Diego: Academic.
-
Higgins LS,
Catalano R,
Quon D,
Cordell B
(1993)
Transgenic mice expressing human
-APP751, but not mice expressing -APP695, display early Alzheimer's disease-like histopathology.
Ann NY Acad Sci
695:224-227[Medline]. -
Ishida A,
Furukawa K,
Keller JN,
Mattson MP
(1997)
Secreted form of
-amyloid precursor protein shifts the frequency dependency for induction of LTD, and enhances LTP in hippocampal slices.
NeuroReport
8:2133-2137[Web of Science][Medline]. -
Jia X,
Gorczyca M,
Budnik V
(1993)
Ultrastructure of neuromuscular junctions in Drosophila: comparison of wild type and mutants with increased excitability.
J Neurobiol
24:1025-1044[Web of Science][Medline].
-
Kang J,
Lemaire HG,
Unterbeck A,
Salbaum JM,
Masters CL,
Greschik KH,
Multhaun G,
Beyreuther K,
Muller-Hill B
(1987)
The precursor of Alzheimer's disease amyloid A4 protein resembles a cell-surface receptor.
Nature
325:733-736[Medline].
-
Klagges BR,
Heimbeck G,
Godenschwege TA,
Hofbauer A,
Pflugfelder GO,
Reifegerste R,
Reisch D,
Schaupp M,
Buchner S,
Buchner E
(1996)
Invertebrate synapsins: a single gene codes for several isoforms in Drosophila.
J Neurosci
16:3154-3165[Abstract/Free Full Text].
-
Koo EH,
Park L,
Selkoe DJ
(1993)
Amyloid
-protein as a substrate interacts with extracellular matrix to promote neurite outgrowth.
Proc Natl Acad Sci
90:4748-4752[Abstract/Free Full Text]. -
Koo EH,
Squazzo SL,
Selkoe DJ,
Koo CH
(1996)
Trafficking of cell-surface amyloid
-protein precursor. I. Secretion, endocytosis and recycling as detected by labeled monoclonal antibody.
J Cell Sci
109:991-998[Abstract]. -
Kurdyak P,
Atwood HL,
Stewart BA,
Wu CF
(1994)
Differential physiology and morphology of motor axons to ventral longitudinal muscles in larval Drosophila.
J Comp Neurol
350:463-472[Web of Science][Medline].
-
Lahey T,
Gorczyca M,
Jia X,
Budnik V
(1994)
The Drosophila tumor suppressor gene dlg is required for normal synaptic bouton structure.
Neuron
13:823-835[Web of Science][Medline].
-
Lai A,
Sisodia SS,
Trowbridge IS
(1995)
Characterization of sorting signals in the
-amyloid precursor protein cytoplasmic domain.
J Biol Chem
270:3565-3573[Abstract/Free Full Text]. -
Lin DM,
Goodman CS
(1994)
Ectopic and increased expression of Fasciclin II alters motoneuron growth cone guidance.
Neuron
13:507-523[Web of Science][Medline].
-
Littleton JT,
Bellen HJ,
Perin MS
(1993)
Expression of synaptotagmin in Drosophila reveals transport and localization of synaptic vesicles to the synapse.
Development
118:1077-1088[Abstract].
-
Loffler J,
Huber G
(1992)
-amyloid precursor protein isoforms in various rat brain regions and during brain development.
J Neurochem
59:1316-1324[Web of Science][Medline]. -
Luo L
(1992)
Functional analysis of APPL, the Drosophila homologue of human amyloid precursor protein associated with Alzheimer's disease.
In: PhD thesis Brandeis University.
-
Luo L,
Martin-Morris LE,
White K
(1990)
Identification, secretion, and neural expression of APPL, a Drosophila protein similar to human amyloid protein precursor.
J Neurosci
10:3849-3861[Abstract].
-
Luo L,
Tully T,
White K
(1992)
Human amyloid precursor protein ameliorates behavioral deficit of flies deleted for Appl gene.
Neuron
9:595-605[Web of Science][Medline].
-
Masliah E,
Mallory M,
Alford N,
Mucke L
(1995)
Abnormal synaptic regeneration in hAPP695 transgenic and ApoE knockout mice.
In: Research advances in Alzheimer's disease and related disorders (Iqbal K,
Mortimer J,
Winblad B,
Wisniewsky H,
eds), pp 405-414. New York: Wiley.
-
Mattson MP
(1994)
Secreted forms of
-amyloid precursor protein modulate dendrite outgrowth and calcium responses to glutamate in cultured embryonic hippocampal neurons.
J Neurobiol
25:439-450[Web of Science][Medline]. -
Mattson MP
(1997)
Cellular actions of
-amyloid precursor protein and its soluble and fibrillogenic derivatives.
Physiol Rev
77:1081-1132[Abstract/Free Full Text]. -
Moya KL,
Benowitz LI,
Schneider E,
Allinquant B
(1994)
The amyloid precursor protein is developmentally regulated and correlated with synaptogenesis.
Dev Biol
161:597-603[Web of Science][Medline].
-
Mucke L,
Maslaih E,
Johnson WB,
Ruppe MD,
Alford M,
Rockenstein EM,
Forss-Petter S,
Pietropaolo M,
Mallory M,
Abraham CR
(1994)
Synaptotrophic effects of human amyloid
protein precursors in the cortex of transgenic mice.
Brain Res
666:151-167[Web of Science][Medline]. -
Müller U,
Cristina N,
Li ZW,
Wolfer DP,
Lipp HP,
Rulicke T,
Brandner S,
Aguzzi A,
Weissmann C
(1994)
Behavioral and anatomical deficits in mice homozygous for a modified
-amyloid precursor protein gene.
Cell
79:755-765[Web of Science][Medline]. -
Nishimoto I,
Okamoto T,
Maysuura S,
Okamoto T,
Murayama Y,
Ogata E
(1993)
Alzheimer amyloid protein precursor complexes with brain GTP-binding protein Go.
Nature
362:75-79[Medline].
-
Nitsch RM,
Slack BE,
Farber SA,
Schulz JG,
Deng M,
Kim C,
Borghesani PR,
Korver W,
Wurtman RJ,
Growdon JH
(1994)
Regulation of proteolytic processing of the amyloid
-protein precursor of Alzheimer's disease in transfected cell lines and in brain slices.
J Neural Transm Suppl
44:21-27[Medline]. -
Okado H,
Okamoto H
(1992)
A Xenopus homologue of the human beta-amyloid precursor protein: developmental regulation of its gene expression.
Biochem Biophys Res Commun
189:1561-1568[Web of Science][Medline].
-
Okamoto T,
Takeda S,
Murayama Y,
Ogata E,
Nishimoto I
(1995)
Ligand-dependent G protein coupling function of amyloid transmembrane precursor.
J Biol Chem
270:4205-4208[Abstract/Free Full Text].
-
Roch JM,
Masliah E,
Roch-Levecq AC,
Sundsmo MP,
Otero DA,
Veinbergs I,
Saitoh T
(1994)
Increase of synaptic density and memory retention by a peptide representing the trophic domain of the amyloid
/A4 protein precursor.
Proc Natl Acad Sci USA
91:7450-7454[Abstract/Free Full Text]. -
Rosen DR,
Martin-Morris L,
Luo L,
White K
(1989)
A Drosophila gene encoding a protein resembling the human
-amyloid protein precursor.
Proc Natl Acad Sci USA
86:2478-2482[Abstract/Free Full Text]. -
Sastre M,
Turner RS,
Levy E
(1998)
X11 interaction with
-amyloid precursor protein modulates its cellular stabilization and reduces amyloid -protein secretion.
J Biol Chem
273:22351-22357[Abstract/Free Full Text]. -
Schuster CM,
Davis GW,
Fetter RD,
Goodman CS
(1996)
Genetic dissection of structural and functional components of synaptic plasticity. I. Fasciclin II controls synaptic stabilization and growth.
Neuron
17:641-654[Web of Science][Medline].
-
Sisodia SS
(1994)
Cellular and molecular genetic approaches in Alzheimer's disease.
Neurobiol Aging [Suppl]
2:S135-S137.
-
Slunt HH,
Thinakaran G,
Koch CV,
Lo AC,
Tanzi RE,
Sisodia SS
(1994)
Expression of a ubiquitous, cross-reactive homologue of the mouse
-amyloid precursor protein (APP).
J Biol Chem
269:2637-2644[Abstract/Free Full Text]. -
Small DH
(1998)
The role of the amyloid protein precursor (APP) in Alzheimer's disease: does the normal function of APP explain the topography of neurodegeneration?
Neurochem Res
23:795-806[Medline].
-
Small DH,
Nurcombe V,
Reed G,
Clarris H,
Beyreuther K,
Masters CL
(1994)
The role of the extracellular matrix in regulating the function of the amyloid protein precursor of Alzheimer's disease.
In: Amyloid protein precursor in development, aging and Alzheimer's disease (Masters CL,
Beyreuther K,
Trillet M,
Christen Y,
eds), pp 65-75. Berlin: Springer.
-
Spradling AC,
Rubin GM
(1982)
Transposition of cloned P elements into Drosophila germ line chromosomes.
Science
218:341-347[Abstract/Free Full Text].
-
Strittmatter SM,
Fishman MC,
Zhu XP
(1994)
Activated mutants of the
subunit of G(o) promote an increased number of neurites per cell.
J Neurosci
14:2327-2338[Abstract]. -
Torroja L,
Luo L,
White K
(1996)
APPL, the Drosophila member of the APP-family, exhibits differential trafficking and processing in CNS neurons.
J Neurosci
16:4638-4650[Abstract/Free Full Text].
-
Torroja L,
Chu H,
Kotovsky I,
White K
(1999)
Neuronal overexpression of APPL, the Drosophila homologue of the amyloid precursor protein (APP), disrupts axonal transport.
Curr Biol
9:489-492[Web of Science][Medline].
-
Trommsdorff M,
Borg JP,
Margolis B,
Herz J
(1998)
Interaction of cytosolic adaptor proteins with neuronal apolipoprotein E receptors and the amyloid precursor protein.
J Biol Chem
273:33556-33560[Abstract/Free Full Text].
-
Wasco W,
Bupp K,
Magendantz M,
Gusella JF,
Tanzi RE,
Solomon F
(1992)
Identification of a mouse brain cDNA that encodes a protein related to the Alzheimer's disease-associated amyloid
protein precursor.
Proc Natl Acad Sci USA
89:10758-10762[Abstract/Free Full Text]. -
Wasco W,
Gurubhagavatula S,
Paradis MD,
Romano DM,
Sisodia SS,
Hyman BT,
Neve RL,
Tanzi RE
(1993)
Isolation and characterization of APLP2 encoding a homologue of the Alzheimer's associated amyloid
protein precursor.
Nat Genet
5:95-100[Web of Science][Medline]. -
Weidemann A,
Konig G,
Bunke D,
Fischer P,
Salbaum JM,
Masters CL,
Beyreuther K
(1989)
Identification, biogenesis, and localization of precursors of Alzheimer's disease A4 amyloid protein.
Cell
57:115-126[Web of Science][Medline].
-
Wolfgang WJ,
Quan F,
Goldsmith P,
Unson C,
Spiegel A,
Forte M
(1991)
Restricted spatial and temporal expression of G protein
subunits during Drosophila embryogenesis.
Development
113:527-538[Abstract]. -
Woods DF,
Bryant PJ
(1991)
The discs-large tumor suppressor gene of Drosophila encodes a guanylate kinase homolog localized at septate junctions.
Cell
66:451-464[Web of Science][Medline].
-
Zheng H,
Jiang M,
Trumbauer ME,
Sirinathsinghji DJ,
Hopkins R,
Smith DW,
Heavens RP,
Dawson GR,
Boyce S,
Conner MW,
Stevens KA,
Slunt HH,
Sisodia SS,
Chen HY,
Van der Ploeg LHT
(1995)
-amyloid precursor protein-deficient mice show reactive gliosis and decreased locomotor activity.
Cell
81:525-531[Web of Science][Medline]. -
Zinsmaier KE,
Hofbauer A,
Heimbeck G,
Pflugfelder GO,
Buchner S,
Buchner E
(1990)
A cysteine-string protein is expressed in retina and brain of Drosophila.
J Neurogenet
7:15-29[Web of Science][Medline].
-
Zito K,
Parnas D,
Fetter RD,
Isacoff EY,
Goodman CS
(1999)
Watching a synapse grow: noninvasive confocal imaging of synaptic growth in Drosophila.
Neuron
22:719-729[Web of Science][Medline].
Copyright © 1999 Society for Neuroscience 0270-6474/99/19187793-11$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
A. Szodorai, Y.-H. Kuan, S. Hunzelmann, U. Engel, A. Sakane, T. Sasaki, Y. Takai, J. Kirsch, U. Muller, K. Beyreuther, et al.
APP Anterograde Transport Requires Rab3A GTPase Activity for Assembly of the Transport Vesicle
J. Neurosci.,
November 18, 2009;
29(46):
14534 - 14544.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-C. Chiang, K. Iijima, I. Hakker, and Y. Zhong
Distinctive roles of different {beta}-amyloid 42 aggregates in modulation of synaptic functions
FASEB J,
June 1, 2009;
23(6):
1969 - 1977.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Kasprowicz, S. Kuenen, K. Miskiewicz, R. L.P. Habets, L. Smitz, and P. Verstreken
Inactivation of clathrin heavy chain inhibits synaptic recycling but allows bulk membrane uptake
J. Cell Biol.,
September 8, 2008;
182(5):
1007 - 1016.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. L. Gatto and K. Broadie
Temporal requirements of the fragile X mental retardation protein in the regulation of synaptic structure
Development,
August 1, 2008;
135(15):
2637 - 2648.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Chai, J. Withers, Y. H. Koh, K. Parry, H. Bao, B. Zhang, V. Budnik, and G. Pennetta
hVAPB, the causative gene of a heterogeneous group of motor neuron diseases in humans, is functionally interchangeable with its Drosophila homologue DVAP-33A at the neuromuscular junction
Hum. Mol. Genet.,
January 15, 2008;
17(2):
266 - 280.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. R Seabrook, W. J. Ray, M. Shearman, and M. Hutton
BEYOND AMYLOID: The Next Generation of Alzheimer's Disease Therapeutics
Mol. Interv.,
October 1, 2007;
7(5):
261 - 270.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. A. Sofola, P. Jin, J. Botas, and D. L. Nelson
Argonaute-2-dependent rescue of a Drosophila model of FXTAS by FRAXE premutation repeat
Hum. Mol. Genet.,
October 1, 2007;
16(19):
2326 - 2332.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Hornsten, J. Lieberthal, S. Fadia, R. Malins, L. Ha, X. Xu, I. Daigle, M. Markowitz, G. O'Connor, R. Plasterk, et al.
APL-1, a Caenorhabditis elegans protein related to the human beta-amyloid precursor protein, is essential for viability
PNAS,
February 6, 2007;
104(6):
1971 - 1976.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Ueda and C.-F. Wu
Distinct frequency-dependent regulation of nerve terminal excitability and synaptic transmission by IA and IK potassium channels revealed by Drosophila Shaker and Shab mutations.
J. Neurosci.,
June 7, 2006;
26(23):
6238 - 6248.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Ataman, J. Ashley, D. Gorczyca, M. Gorczyca, D. Mathew, C. Wichmann, S. J. Sigrist, and V. Budnik
Nuclear trafficking of Drosophila Frizzled-2 during synapse development requires the PDZ protein dGRIP
PNAS,
May 16, 2006;
103(20):
7841 - 7846.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Ashley, M. Packard, B. Ataman, and V. Budnik
Fasciclin II Signals New Synapse Formation through Amyloid Precursor Protein and the Scaffolding Protein dX11/Mint
J. Neurosci.,
June 22, 2005;
25(25):
5943 - 5955.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. T. Kimberly, J. B. Zheng, T. Town, R. A. Flavell, and D. J. Selkoe
Physiological Regulation of the {beta}-Amyloid Precursor Protein Signaling Domain by c-Jun N-Terminal Kinase JNK3 during Neuronal Differentiation
J. Neurosci.,
June 8, 2005;
25(23):
5533 - 5543.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Wang, G. Yang, D. R. Mosier, P. Chang, T. Zaidi, Y.-D. Gong, N.-M. Zhao, B. Dominguez, K.-F. Lee, W.-B. Gan, et al.
Defective Neuromuscular Synapses in Mice Lacking Amyloid Precursor Protein (APP) and APP-Like Protein 2
J. Neurosci.,
February 2, 2005;
25(5):
1219 - 1225.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Franco, L. Bogdanik, Y. Bobinnec, A. Debec, J. Bockaert, M.-L. Parmentier, and Y. Grau
Shaggy, the Homolog of Glycogen Synthase Kinase 3, Controls Neuromuscular Junction Growth in Drosophila
J. Neurosci.,
July 21, 2004;
24(29):
6573 - 6577.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Iijima, H.-P. Liu, A.-S. Chiang, S. A. Hearn, M. Konsolaki, and Y. Zhong
Dissecting the pathological effects of human A{beta}40 and A{beta}42 in Drosophila: A potential model for Alzheimer's disease
PNAS,
April 27, 2004;
101(17):
6623 - 6628.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Hashimoto, T. Niikura, T. Chiba, E. Tsukamoto, H. Kadowaki, H. Nishitoh, Y. Yamagishi, M. Ishizaka, M. Yamada, M. Nawa, et al.
The Cytoplasmic Domain of Alzheimer's Amyloid-{beta} Protein Precursor Causes Sustained Apoptosis Signal-Regulating Kinase 1/c-Jun NH2-Terminal Kinase-Mediated Neurotoxic Signal via Dimerization
J. Pharmacol. Exp. Ther.,
September 1, 2003;
306(3):
889 - 902.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. S. Estes, T. C. Jackson, D. T. Stimson, S. Sanyal, L. E. Kelly, and M. Ramaswami
Functional Dissection of a Eukaryotic Dicistronic Gene: Transgenic stonedB, but Not stonedA, Restores Normal Synaptic Properties to Drosophila stoned Mutants
Genetics,
September 1, 2003;
165(1):
185 - 196.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. L. Sabo, A. F. Ikin, J. D. Buxbaum, and P. Greengard
The Amyloid Precursor Protein and Its Regulatory Protein, FE65, in Growth Cones and Synapses In Vitro and In Vivo
J. Neurosci.,
July 2, 2003;
23(13):
5407 - 5415.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. H. Frederikse and X.-O. Ren
Lens Defects and Age-Related Fiber Cell Degeneration in a Mouse Model of Increased A{beta}PP Gene Dosage in Down Syndrome
Am. J. Pathol.,
December 1, 2002;
161(6):
1985 - 1990.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. P. Roche, M. C. Packard, S. Moeckel-Cole, and V. Budnik
Regulation of Synaptic Plasticity and Synaptic Vesicle Dynamics by the PDZ Protein Scribble
J. Neurosci.,
August 1, 2002;
22(15):
6471 - 6479.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Taru, K.-i. Iijima, M. Hase, Y. Kirino, Y. Yagi, and T. Suzuki
Interaction of Alzheimer's beta -Amyloid Precursor Family Proteins with Scaffold Proteins of the JNK Signaling Cascade
J. Biol. Chem.,
May 24, 2002;
277(22):
20070 - 20078.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-H. Koh, C. Ruiz-Canada, M. Gorczyca, and V. Budnik
The Ras1-Mitogen-Activated Protein Kinase Signal Transduction Pathway Regulates Synaptic Plasticity through Fasciclin II-Mediated Cell Adhesion
J. Neurosci.,
April 1, 2002;
22(7):
2496 - 2504.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. T. Mueller, J.-P. Borg, B. Margolis, and R. S. Turner
Modulation of Amyloid Precursor Protein Metabolism by X11alpha /Mint-1. A DELETION ANALYSIS OF PROTEIN-PROTEIN INTERACTION DOMAINS
J. Biol. Chem.,
December 8, 2000;
275(50):
39302 - 39306.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|