 |
Previous Article | Next Article 
The Journal of Neuroscience, September 15, 1999, 19(18):7812-7822
Composition of the GABAA Receptors of Retinal
Dopaminergic Neurons
Stefano
Gustincich1,
Andreas
Feigenspan1,
Werner
Sieghart2, and
Elio
Raviola1
1 Department of Neurobiology, Harvard Medical School,
Boston, Massachusetts 02115, and 2 Department of Biochemical
Psychiatry, University Clinic for Psychiatry, Waehringer Guertel 18-20, A-1090, Vienna, Austria
 |
ABSTRACT |
Transgenic technology, single-cell RT-PCR, and
immunocytochemistry were combined to investigate the composition of the
GABAA receptors of dopaminergic (interplexiform) amacrine
(DA) cells. A mouse line was used in which these neurons were labeled
with human placental alkaline phosphatase and could therefore be
identified in vitro after dissociation of the retina. We
performed single-cell RT-PCR on the isolated cells and showed that (1)
DA cells contained the messages for 1, 3, 4, 1, 3, 1,
2S, and 2L subunits; (2) this
transcript repertory did not change on dissociation of the retina and
throughout the time required for cell harvesting; and (3) all DA cells
contained the entire transcript repertory. Immunocytochemistry with
subunit-specific antibodies showed that all subunits were expressed and
appeared homogeneously distributed throughout the cell membrane at a
low concentration. In addition, with the exception of 4, the
subunits formed clusters at the surface of the dendrites and on the
inner pole of the cell body. Because of their size, shape, and
topographic coincidence with GABAergic endings, the clusters were
interpreted as postsynaptic active zones containing GABAA
receptors. The composition of the synaptic receptors was not uniform:
clusters distributed throughout the dendritic tree contained 3,
3, and, less frequently, 1 subunits, whereas clusters containing
the 1 subunit were confined to large dendrites. Therefore, DA cells
possess at least two types of GABAA receptors localized in
different synapses. Furthermore, they exhibit multiple extrasynaptic
GABAA receptors.
Key words:
GABAA receptors; dopamine; retina; amacrine
cell; single-cell RT-PCR; immunocytochemistry
 |
INTRODUCTION |
The inhibitory
neurotransmitter GABA acts on a large repertory of
bicuculline-sensitive receptors that consist of various combinations of
at least 14 subunits (Sieghart, 1995 ; Barnard et al., 1998 ). In
situ hybridization and immunocytochemical studies demonstrated
that each subunit has a unique distribution in the CNS (Fritschy et
al., 1992 ; Laurie et al., 1992 ; Wisden et al., 1992 ); furthermore,
transfection experiments proved that the various combinations of
subunits found in specific regions of the brain have different
pharmacological properties (Rabow et al., 1995 ). With in
situ hybridization, however, it is often impossible to pinpoint
the types of neurons that contain the subunit transcripts. On the other
hand, pharmacological results on recombinant receptors may not always
apply to native assemblies because there is no certainty that some of
the transfected combinations of subunits exist in vivo on
the surface of specific cell types (McKernan and Whiting, 1996 ;
Sieghart et al., 1999 ). It is therefore crucial to identify the
composition of the subunit assemblies that are expressed at the surface
of individual neurons to understand their function in the computations
performed by specific neural networks. So far, comprehensive
information exists only for the cerebellar cortex (Santi et al., 1994 ;
Wisden, 1995 ; Nusser et al., 1996a , 1998 ) and hippocampus (Pearce,
1993 ; Nusser et al., 1995 , 1996b ) where the various neuronal types have
highly characteristic shape and distribution. The challenge is much
greater for rare cell types, which cannot be easily identified on the
basis of morphological criteria, either in tissue slices or after dissociation.
In this paper, we report the subunit composition of the
GABAA receptors in the dopaminergic
(interplexiform) amacrine (DA) cells of the mouse retina.
Dopamine is in large measure responsible for neural adaptation to light
(Witkovsky and Dearry, 1991 ; Djamgoz and Wagner, 1992 ). In turn, GABA
inhibits dopamine release when the light is turned off by acting
primarily on bicuculline-sensitive GABAA
receptors deployed at the surface of DA cells (Morgan and Kamp, 1980 ;
Kamp and Morgan, 1981 ; O'Connor et al., 1986 ; Ishita et al., 1988 ;
Kirsch and Wagner, 1989 ; Critz and Marc, 1992 ; Kolbinger and Weiler,
1993 ).
Because there are only 450 DA cells in each mouse retina and they
cannot be distinguished from neighboring cells on the basis of their
morphology, we labeled DA cells with human placental alkaline
phosphatase (PLAP) by introducing into the mouse genome PLAP cDNA under
the control of the promoter of the gene for tyrosine hydroxylase (TH),
the rate-limiting enzyme for dopamine biosynthesis (Gustincich et al.,
1997 ). Because PLAP is an enzyme that resides on the outer surface of
the cell membrane, we could identify DA cells after dissociation of the
retina by immunocytochemistry in the living state. Then, we analyzed
their repertory of GABAA receptor subunit mRNAs
by single-cell, RT-PCR. We finally confirmed by
immunocytochemistry that the messages were translated into proteins,
and we studied receptor composition and localization in the intact retina.
The pharmacological properties of the DA cell
GABAA receptors have been published previously
(Feigenspan et al., 1998 ).
 |
MATERIALS AND METHODS |
Harvesting of DA cells
Anesthetized, 1- to 6-month-old mice homozygous for the PLAP
transgene were used. Dissociation of the retina by enzymatic digestion
and mechanical trituration has been described elsewhere (Gustincich et
al., 1997 ). The cell suspension was allowed to sediment on a concavalin
A (1 mg/ml)-coated coverslip at the bottom of a recording chamber, and
DA cells were identified in epifluorescence after staining with a
monoclonal antibody to PLAP (E6) (De Waele et al., 1982 ) conjugated to
the fluorochrome Cy3 (E6-Cy3) (Gustincich et al., 1997 ). Labeled cells
were harvested after patch clamping. Patch pipettes were constructed
from borosilicate glass (1.65 mm outer diameter, 1.2 mm inner diameter;
A-M Systems, Everett, WA) using a horizontal two-stage electrode puller
(BB-CH, Mecanex, Geneva, Switzerland); the electrode resistance ranged
from 5 to 7 M . Electrodes were connected to the
amplifier via an Ag/AgCl wire. The electrode holder and the headstage
were mounted on a piezoelectric, remote-controlled device attached to a
tridimensional micromanipulator (Burleigh Instruments, Fishers, NY).
The intracellular solution contained 130 mM KCl and 0.5 mM EGTA in 10 mM HEPES, pH 7.4. When the patch
pipette was immersed into the bath, positive pressure was continuously
applied to the fluid within. After seal formation on the surface of DA
cells and disruption of the patch membrane, the cellular contents were
aspirated into the pipette by gently applying negative pressure until
the residual cell ghost became stuck to the pipette tip. The electrode
was then lifted from the bath under constant visual control and removed
from the holder. The tip of the pipette was finally broken into an
Eppendorf tube containing 20 U RNase inhibitor (RNasin ;
Boehringer Mannheim, Indianapolis, IN) and, after brief centrifugation,
the tube was frozen on dry ice and stored at 80°C. The harvesting
of DA cells lasted from 30 to 90 min from the time of plating.
 |
Single-cell RT-PCR |
After RT, each experiment comprised two successive rounds of
amplification. The first one used forward (F) and reverse (R) primers,
chosen according to the criteria specified below. To increase
specificity, the second round used either an F or an R primer in
combination with a primer internal to the first amplification product
[nested (N)] or two N primers (FN and RN).
TH transcript
For amplification of TH cDNA, first-round F primer was
CTGGCCTTCCGTGTGTTTCAGTG, which hybridizes with TH cDNA at nucleotide (nt) 915 (GenBank M69200), and the corresponding R primer was CCGGCTGGTAGGTTTGATCTTGG, which hybridizes with TH cDNA at nt 1296. The
conditions of the amplification reactions are specified below. The
first-round RT-PCR product was 382 bp long. The second-round FN primer
was AGTGCACACAGTACATCCGTCAT, which hybridizes with TH cDNA at nt 934, and the corresponding RN primer was GCTGGTAGGTTTGATCTTGGTA, which
hybridizes with TH cDNA at nt 1293. The final nested RT-PCR product was
360 bp long and contained a unique SacI site. The product
was successfully amplified only from DA cells labeled by E6-Cy3.
Unstained cells and control reactions without cells or with culture
medium were negative. An aliquot of the reaction products from labeled
cells was purified and cut with SacI to show the specificity
of the amplification. As expected, the digestion with this restriction
enzyme produced fragments of 271 and 89 bp.
GABAA receptor transcripts
Primers. Primer sequences are shown in Table 1.
Primer pairs were chosen that annealed at 55 or 60°C so that all
subunit cDNAs could be amplified simultaneously in a single multiplex experiment. Primers were designed in regions of the cDNA that are
characterized by lack of homology among the various subunits, and their
sequences were located in different exons to avoid amplification of
genomic DNA.
RT and cDNA amplification. Tubes containing single cells
were incubated for 1.5 min at 65°C (Ghia et al., 1996 ). After cooling in ice, reverse transcriptase was added to each tube [75
mM KCl, 3 mM
MgCl2, 10 mM DTT, 40 U
RNasin (Boehringer Mannheim), 4 ng Pd(N)6
(Pharmacia, Piscataway, NJ), 1 mM each dNTPs (Pharmacia), 200 U RT Superscript II H (Life Technologies,
Gaithersburg, MD) in 19 µl 50 mM Tris-HCl, pH 8.3], and
first-strand cDNA was synthesized at 37°C for 1 hr. At the end of
this reaction, first-round PCR mixture [35 mM
KCl, 0.9 mM MgCl2, 40 pM each F and R primers, 1 U Taq polymerase
(Boehringer Mannheim) in 80 µl 10 mM Tris-HCl,
pH 8.3] was added to the tubes. First-round amplification comprised
2.5 min at 94°C; 10 cycles, each consisting of 30 sec at 94°C, 30 sec at 55°C, and 1 min at 72°C; 18 cycles, each consisting of 30 sec at 94°C, 30 sec at 55°C, and 1 min at 72°C, with a 5 sec
extension time added to the final step of each cycle beginning from the
second cycle; 10 min at 72°C. Aliquots (1 µl) of the first-round
PCR mixtures were used as a template for second-round PCR reactions. To
each tube, a solution was added containing 50 mM KCl, 1.5 mM MgCl2, 200 mM dNTPs, 20 pM each N and F or R primers, 1 U Taq polymerase in 49 µl 10 mM Tris-HCl, pH 8.3. The amplification was
performed as follows: 2.5 min at 94°C; 10 cycles, each consisting of
30 sec at 94°C, 30 sec at 60°C, and 1 min at 72°C; 20 cycles,
each consisting of 30 sec at 94°C, 30 sec at 60°C, and 1 min at
72°C, with a 5 sec extension time added to the final step of each
cycle beginning from the second cycle. Aliquots (10 µl) of the
second-round PCR mixtures were analyzed by electrophoresis in 1%
Seakem and 1% Nusieve GTG agarose (FMC, Rockland, ME) containing 0.5 µg/ml ethidium bromide.
To confirm that each DA cell contained the entire repertory of subunit
mRNAs, a multiplex semi-nested single-cell RT-PCR was performed. In
this experiment, first-strand cDNA was synthesized as described above.
The first-round PCR solution contained 40 pM F and R
primers for all seven subunit cDNAs ( 1, 3, 4, 1, 3,
1, and 2). The 30-cycle amplification was the same as described above. Aliquots (1 µl) of the first-round PCR reaction product were
distributed to seven tubes, each containing N and F or R primers for a
single subunit. Seven separate second-round PCR reactions were
performed according to the protocol described above. The products were
finally analyzed by agarose gel electrophoresis.
Precautions and controls. Our main concern was the
preservation of the integrity of the RNA and the elimination of
contamination. Recording chambers were washed with hydrogen peroxide;
cotton-plug pipette tips, tubes, and glass for electrodes were
autoclaved; reagents were stored at 20°C in single-use aliquots.
Cells were harvested and solutions were prepared in rooms that were
different from the laboratory in which PCR reactions and agarose gel
electrophoresis were performed. DA cells, unlabeled neurons, and
controls were examined simultaneously in each experiment, and six was
the highest number of cells analyzed at any given time. Samples of the
supernatant in the recording chamber were examined by PCR to rule out
amplification of mRNA from floating or dead cells. Each couple of
primers was tested first in an RT-PCR experiment from 0.5 µg of total
brain RNA. These amplifications were performed for 40 cycles at the specific annealing temperatures. The RT-PCR products were digested with
the appropriate restriction enzymes to confirm specificity. RNA
dependency of the amplification was established by omitting RT during
first-strand cDNA synthesis. First-round PCR products from total brain
RNA, obtained using F and R primers for each subunit, were used as
templates for second-round reactions with primers specific for other
members of the same subunit family (e.g., the first-round RT-PCR
product for the 1 subunit was amplified in second-round reactions
driven by the primers for 2 and 3 subunits). No difference in the
repertory of PCR products from single cells was observed when the
number of cycles was increased from 28+30 to 40+35 cycles. However, the
number of cycles was kept as low as possible to avoid contamination and
increase in nonspecific signals. When the experiments summarized in
Table 2 were completed, a single-cell RT-PCR product for each subunit was cloned into the pCR-II vector by using the Original TA cloning Kit
(Invitrogen, Carlsbad, CA). Both strands were sequenced using the
dideoxy-chain termination method. DNA similarities were examined, and
identity scores were generated by matching the query sequence to
database entries using the BLAST and BESTFIT algorithms. All of the
fragments were identified correctly.
cDNA cloning of mouse GABAA receptor subunits.
Because sequences for the mouse subunits 4, 5, 1, and
were not available, we cloned and sequenced a small cDNA fragment
of each subunit to design new primers for single-cell RT-PCR
experiments from mouse cells. Total RNA from mouse retina, cerebrum,
cerebellum, and amygdala was purified according to the acid guanidinium
thiocyanate-phenol-chloroform method (Chomczynski and Sacchi, 1987 ) and
used as a template in an RT-PCR reaction. Total RNA (0.5 µg)
was incubated in the presence of 4 ng P(dN)6 for
5 min at 65°C. After cooling in ice for 2 min, the following mixture
was added to the denatured RNA to a final volume of 19 µl: 75 mM KCl, 3 mM MgCl2, 10 mM DTT, 10 U RNasin, 1 mM each
dNTPs in 50 mM Tris-HCl, pH 8.3. After 5 min at 37°C, 200 U RT Superscript II H (Life Technologies) was
added to the samples and incubated at the same temperature for 1 hr.
For amplification, we used a high-fidelity Pwo polymerase (Boehringer
Mannheim) with proofreading activity. The PCR reaction took place in a
100 µl volume containing 40 mM KCl, 0.6 mM
MgCl2, 1.4 mM MgSO4, 5 mM
(NH4)2SO4, 2 mM DTT,
200 µM each dNTPs, 40 pM F and R primers, 1 U
Pwo polymerase, 20 mM Tris-HCl, pH 8.8. The amplification
protocol was the following: 2.5 min at 95°C; 10 cycles, each
consisting of 30 sec at 95°C, annealing for 30 sec, and 1 min at
72°C; 30 cycles, each consisting of 30 sec at 95°C, and 1 min at
72°C, with a 5 sec extension time added to the final step of each
cycle starting from the second cycle; 10 min at 72°C (annealing
temperatures are specified below). We choose primers specific for
sequences identical in the rat and human genes. From rat 4 (L08493),
rat 4F CCTGGATTTGGGGGTCCTGTTAC (nt 284) and rat 4R
CATGGGACACTCCGCACTTATGG (nt 613) amplified a fragment 330 bp long.
Annealing took place at 55°C. From rat 5 (L08494), rat 5F
CTTATCCAGTCACTTTGGCTTTT (nt 350) and rat 5R TTTCATCTTTCCAGCTTTGTCGG
(nt 603) amplified a fragment 254 bp long. Annealing took place at
45°C. From rat 1 (X57514), rat 1F AGCCCTCAGTGGAAGTGGCTGAT (nt
764) and rat 1R CCCAGGGATGTTCTAGCAGGTAC (nt 1016) amplified a
fragment 253 bp long. Annealing took place at 60°C. From rat (U92284), rat F TTTCCAATGGATTCTCACTCTTG (nt 241) and rat R
GGGAAATTCTTACGAGAAAAGGT (nt 632) amplified a fragment 392 bp long.
Annealing took place at 45°C. For each of the mouse subunits, two
fragments from two different RT-PCR reactions were gel-purified,
incubated with Taq polymerase for 10 min at 72°C, cloned,
and sequenced as described above. The sequences of the mouse cDNA
fragments are available at EMBL databank with the following accession
numbers: 4 AF090373, 5 AF090374, 1 AF090375, and AF090376.
Immunocytochemistry
Fixation
GABAA receptor subunits are very sensitive
to chemical fixation; thus, satisfactory preservation of antibody
binding sites was obtained by fast chemical fixation under microwave
irradiation. Eyecups were immersed in Ames medium (Sigma, St. Louis,
MO) containing 40 mM glucose, and the retinas were
separated from choroid and sclera. Immediately after immersion in 2%
formaldehyde in PBS at 25°C (5 ml in 35 mm Falcon Petri dishes),
specimens were irradiated for 10 sec in a microwave oven (Pelco; Ted
Pella, Redding, CA) and rapidly returned to Ames medium. At the end of
irradiation, the temperature of the fixative solution had increased by
~20°C. After cryoprotection in 20% sucrose, retinas were frozen in
partially solidified dichlorodifluoromethane; 5-8 µm horizontal
sections through the retina were obtained in a cryostat and mounted on gelatinized slides.
Antibodies
Rabbit polyclonal antibodies to the 1, 3, 4, 1,
3, and 1 subunits were described elsewhere (Sperk et al., 1997 );
they were used at the following protein concentrations (in µg/ml): 1 1.8, 3 5, 4L 2.6, 4N 6, 1 2, 3 3.4, 1 4. Antibody to 2 (Ebert et al., 1999 ) was diluted 1:100. Guinea pig
antibody to the 3 subunit (Gao et al., 1993 ), a generous gift from
J.-M. Fritschy (Institute of Pharmacology, University of Zürich,
Switzerland), was diluted 1:3000. Rabbit polyclonal antibodies to the
vescicular GABA transporter (VGAT) (Chaudhry et al., 1998 ), a generous
gift from R. H. Edwards (Department of Neurology, University of
California, San Francisco), was diluted 1:2000. DA cells were
identified by staining with a monoclonal antibody to TH (Incstar,
Stillwater, MN; 1:100).
Double- and triple-labeling studies
Slides were rinsed in PBS for 20 min, blocked in 10% normal
goat serum (NGS) (Vector Laboratories, Burlingame, CA), 0.2% bovine serum albumin (BSA) (Sigma) in PBS for 1 hr, followed by 2% fish gelatin (Goldmark Biologicals, Phillipsburg, NJ) in PBS for 30 min.
They were incubated overnight in a mixture of the primary antibodies
diluted with 0.2% BSA in PBS, rinsed with PBS for 20 min, and
incubated for 3 hr in a mixture of the secondary antibodies diluted
with PBS containing 0.1% NGS, 0.2% fish gelatin, and 0.2% BSA.
Slides were finally rinsed in PBS and coverslipped with Vectashield. For double-labeling experiments, the mixture of primary antibodies contained a rabbit polyclonal to a GABAA subunit
and the monoclonal to TH. Secondary antibodies were goat
FITC-conjugated anti-rabbit (Boehringer Mannheim; 1:500) and donkey
Texas Red-conjugated anti-mouse (Jackson ImmunoResearch, West Grove,
PA; 1:100). For triple-labeling experiments, the mixture of primary
antibodies contained the guinea pig polyclonal to the 3 subunit, a
rabbit polyclonal to one of the other subunits, and the monoclonal to
TH. Secondary antibodies were the same as above with the addition of
donkey Cy5-conjugated anti-guinea pig (Jackson; 1:100). Double- and
triple-label immunocytochemistry did not change the pattern of staining
when compared with labeling with a single antibody. Staining was
absent when the antibodies to the GABAA subunits
were omitted. In another experiment, the mixture of primary antibodies
contained the guinea pig polyclonal to the 3 subunit, the rabbit
polyclonal to VGAT, and the monoclonal to TH. Secondary antibodies were
the same as above. Fluorescence was detected using a Bio-Rad (Bio-Rad
Laboratories, Hercules, CA) MRC-1024 confocal imaging system equipped
with an argon-krypton laser and a Zeiss Axiophot microscope.
Sections were viewed with a 100× 1.4 NA plan apochromat, and the
minimal thickness of the confocal image was adopted that was compatible
with adequate emission. Images (1024 × 1024 pixels) were obtained
sequentially from two or three channels by averaging seven scans; they
were stored as TIFF files and processed by Adobe Photoshop (Adobe
Systems, Mountain View, CA). Colocalization of 3 with other subunits
in TH-positive cells was evaluated by overlaying the three stainings in
three different color channels and labeling with text symbols the site of putative synapses. For double staining, data from one channel (TH)
are represented in red and those from the other channel
(GABAA receptor subunits) are represented in
green; yellow indicates the postsynaptic active zones on DA cells that
contain a GABAA receptor subunit. For triple
staining, TH is red, the 3 subunit is blue, and the
GABAA receptor subunits or VGAT is green; white indicates synapses overlaying DA cells that contain both 3 and another GABAA receptor subunit or aggregates of
3 subunits in register with a presynaptic cluster of GABA-containing
vesicles. Retinal slices were obtained with a tissue chopper and
incubated in the living state with antibody to 2, followed by
FITC-conjugated anti-rabbit antibody, both diluted 1:100 in Ames
medium. Slices were subsequently fixed with 2% formaldehyde in PBS,
blocked as above with the addition of 0.5% Triton X-100, and
immunostained for TH as above.
 |
RESULTS |
Single-cell RT-PCR
After enzymatic digestion and mechanical trituration of the
retina, DA cells were identified by labeling of their membrane with the
fluorescent monoclonal antibody to PLAP E6-Cy3. DA and large unlabeled
cells, possibly ganglion cells, were patch-clamped in the whole-cell
configuration and individually harvested between 30 and 90 min from the
moment when the retina was dissociated. This time interval was chosen
to minimize changes in gene expression induced by cell damage during
trituration, absence of synaptic inputs, or exposure to culture medium
(see below).
Because we know from immunocytochemistry that in the intact retina all
PLAP-expressing neurons contain TH (Gustincich et al., 1997 ), we used
single-cell nested RT-PCR to detect the presence of TH mRNA in the
fluorescent cells and thus prove beyond doubt that the neurons stained
by E6-Cy3 were DA cells. In 23 of 28 labeled cells (82%) we amplified
a 360 bp product specific for TH transcript (data not shown), whereas
unlabeled neurons were consistently negative. With a technique based on
processing individual cells and in the absence of false positive
results, we have adopted a rate of success higher than 70% as a
satisfactory test of the reproducibility and specificity of our
experimental protocol. Negative outcomes are easily explained by loss
of the cell, deterioration of the message, or inefficient amplification.
Single-cell RT-PCR technique was then applied to detect mRNAs for 13 subunits of the GABAA receptor: 6 was not
studied because of its limited distribution in the CNS (Varecka et al.,
1994 ; Jones et al., 1997 ). Table 1
illustrates the sequences of the three primers (F, R, N) for each
reaction, databank accession number of the mouse cDNA sequences,
lengths of the PCR products, and restriction enzymes used to establish
specificity of the 13 reactions. The primers for the 2 subunit were
selected in a region of the gene that is identical for its large (L)
and short (S) variants. These differ for a 24-bp-long exon that codes
for a PKC phosphorylation site (Whiting et al., 1990 ). Because mouse sequences were not available for 4, 5, 1, and , we cloned and sequenced partial cDNAs from mouse brain to design sets of primers
specific for this species.
In a two-rounds RT-PCR, one can analyze more than one transcript at a
time from the same cell, provided that the messages are present in
equivalent amounts. Because TH mRNA is abundantly expressed, we
consistently failed in our efforts to demonstrate in the same cell the
presence of the messages for both TH and one of the subunits of the
GABAA receptor. Probably, amplification of the
receptor transcript was competitively suppressed by the reaction for TH
mRNA. Thus, because the relative amounts of the various receptor
transcripts were not known, we studied first the expression of one
subunit mRNA at a time in a total of 161 DA cells.
As shown in Figure 1 and summarized
in Table 2, DA cells contained mRNAs for
the 1, 3, 4, 1, 3, 1, and 2 subunits. Both the S
and L spliced forms of the 2 subunit transcript were present.
We analyzed at least 10 DA cells for each of the subunits, and the rate
of success was from 70 to 88% of the cells tested. The specificity of
the amplification was established by restriction enzyme digestion of
the PCR products. Furthermore, their identity was confirmed beyond
doubt by cloning and sequencing; this control was performed after
completion of all the experiments to avoid contamination. Several
large, unlabeled neurons, probably ganglion cells, expressed some of
the subunit transcripts that were also present in DA cells, whereas
specific bands were consistently absent when the reaction was performed
either on the supernatant or in absence of a cell. It is significant
that anomalous reaction products were rarely seen when the specific
message was present in the reaction mixture. Transcripts for the 2,
5, 2, 3, , and subunits were absent in DA cells; to
prove that this failure was not caused by insufficient sensitivity of
our technique, we repeated single-cell RT-PCR reactions on unlabeled
neurons until we observed expression of all the above transcripts (data
not shown).

View larger version (94K):
[in this window]
[in a new window]
|
Figure 1.
Agarose gel electrophoresis of the products of
semi-nested single-cell RT-PCR for the transcripts of the subunits of
the GABAA receptor in DA cells. In lane 1 is
the product from a DA cell; in lane 2 is the product
from a large cell that does not express PLAP; in lane 3
is a control reaction in which the cell was omitted; and in lane
4 is the result of restriction enzyme digestion of the product
of lane 1 to establish specificity. Bands in
lanes 1 are the products of the reactions for the 1,
3, 4, 1, 3, 1, 2S, and 2L subunits. Messages for
2 and subunits are absent in DA cells. The specific reaction
products can be identified by comparison with Table 1, which lists
their lengths and the restriction enzymes used to establish
specificity. The molecular weights of the restriction products are
those expected for each subunit cDNA. A nonspecific band of lower
molecular weight is present in the reaction for 3. On the other
hand, the reaction for 1 consistently yielded a nonspecific band at
higher molecular weights.
|
|
Next, we examined whether all DA cells contained seven
GABAA receptor subunit transcripts or could be
assigned to subpopulations each expressing a different repertory of
GABAA receptor mRNAs. To this purpose, we
resorted to multiplex semi-nested RT-PCR: in this method, first-strand
cDNA was synthesized from single cells and amplified in the presence of
primers for all subunit transcripts detected previously. Then, the
product of the first-round amplification was distributed among seven
different second-round reactions, each specific for a single subunit
cDNA. Seven DA cells were examined, and four of them contained the
transcripts of all seven subunits (Fig.
2). In three cells the reaction failed,
and we did not obtain any PCR product. Large, unlabeled neurons,
possibly ganglion cells, expressed different repertories of subunit
mRNAs.

View larger version (42K):
[in this window]
[in a new window]
|
Figure 2.
A, Agarose gel electrophoresis of
the products of a multiplex semi-nested single-cell RT-PCR for the
mRNAs of the 1, 3, 4, 1, 3, 1, and 2 subunits of
the GABAA receptor in a DA cell. All seven subunits
subtypes are expressed in the same cell. B, Pattern of
expression of the seven subunits in a large bystander neuron, possibly
a ganglion cell. Messages for 1, 3, 3, and 2 are present.
C, Control reaction in absence of the cell.
|
|
Because DA cells were isolated from the retina by enzymatic digestion
and mechanical trituration and were exposed to abnormal culture stimuli
before harvesting, we were concerned that their repertory of
GABAA receptor subunit mRNAs did not reflect the true situation in the intact retina. Especially worrisome in this respect was the suppression of synaptic inputs that could alter the
expression of postsynaptic receptor genes. Our approach to this problem
was twofold. First, we investigated whether the repertory of
transcripts varied over time: we began to observe loss of some of the
messengers at 4.5 hr. As a result, cell harvesting was limited to the
first 90 min after dissociation. To test whether experimental
conditions induced a new pattern of gene expression, we shut off
de novo transcription immediately after trituration by
blocking the activity of RNA Polymerase II with -amanitin (2 µg/ml) (Montarolo et al., 1986 ). Multiplex semi-nested RT-PCR analysis proved that the pattern of GABAA
receptor subunit mRNAs remained the same after inhibition of mRNA
synthesis (data not shown). These finding confirmed that we were
detecting transcripts that were present in the intact retina before dissociation.
Evidence was now sought to confirm that the subunit mRNAs were
translated into proteins that were expressed at the surface of DA cells
in the intact retina.
Immunocytochemistry
Vertical and horizontal sections of the retina were
double-immunolabeled for TH and one of the seven subunits of the
GABAA receptor whose mRNA had been identified in
DA cells by single-cell RT-PCR. A 10 sec formaldehyde fixation under
microwave irradiation was used to limit denaturation of the subunits.
DA cells were readily recognized because they were the only retinal
neurons stained by anti-TH antibody (Versaux-Botteri et al., 1984 );
furthermore, the entire neuron was immunoreactive, and this facilitated
the analysis of the distribution of the subunits at the cell surface. As reported previously (Gustincich et al., 1997 ), mouse DA cells had a
perikaryon 15 µm in diameter situated in the most vitreal tier of the
inner nuclear layer. Large dendrites originated from the inner surface
of the cell body and immediately spread horizontally in the inner
plexiform layer (IPL). Here they branched repeatedly, giving rise to a
dense plexus of varicose processes, rigorously confined to the most
scleral stratum of the IPL. From this plexus, thinner, beaded processes
occasionally descended into the center of the IPL and, after a long
horizontal course, returned to the overlying dendritic plexus. DA cells
also gave rise to vertically ascending processes. Most of them ended
with a swelling in the outer plexiform layer (OPL); a few bent at a
right angle and ran a long course in the OPL, where they formed a
sparse horizontal plexus. Thus, some or all of DA cells belong to the
interplexiform variety. DA cells conform to the general rule that most
of the surface of the perikaryon of amacrine cells is devoid of
synapses, except for the pole directed toward the IPL (data not shown).
Immunoreactivity for the GABAA receptor subunits
was noted in three distinct locations: (1) as a diffuse staining of the
entire cell surface; (2) in a small number of cytoplasmic organelles on
the vitreal aspect of the nucleus, possibly endoplasmic reticulum and/or Golgi elements; and (3) as discrete clusters throughout the
dendritic tree and vitreal pole of the perikaryon. The staining of the
cell surface was distinct but weak. It was observed with the antibodies
to all seven subunits (Fig.
3A-H). To confirm that this staining resided in the cell membrane rather than in the underlying endoplasmic reticulum (Connolly et al., 1996 ) or Golgi complex, we resorted to an in vivo experiment of
antibody-induced endocytosis. We treated slices of living retina with
the polyclonal antibody to the 2 subunit. This is the only
subunit-specific antibody that recognizes the extracellular domain of
the receptor (Ebert et al., 1999 ). After a rinse with Ames medium and
incubation in fluorescein-conjugated anti-rabbit antibody, the entire
surface of numerous cell bodies in the inner nuclear layer became
fluorescent, showing that the 2 subunit resided in the cell
membrane. Within a matter of minutes, however, the label formed patches
and was internalized. After fixation and permeabilization, DA cells
were stained with the monoclonal anti-TH, followed by Texas
Red-conjugated anti-mouse antibody. Newly formed, large endosomes
containing the internalized subunit were present in the cytoplasm of DA
cells (Fig. 3I). This experiment confirmed that DA
cells express extrasynaptic GABAA receptors at the cell
surface.

View larger version (78K):
[in this window]
[in a new window]
|
Figure 3.
A-H, Vertical sections of the
retina double-immunolabeled for TH (red) and one of the
seven subunits of the GABAA receptor
(green) whose mRNA had been identified in DA
cells by single-cell RT-PCR. The cytoplasm of DA cells is stained by
the TH antibody. The entire cell surface is weakly positive for all
seven GABAA receptor subunits whose mRNA was identified by
single-cell RT-PCR; this is confirmed by the insets that
illustrate the staining with the subunit antibodies alone. In addition,
cytoplasmic organelles are stained. Control experiments
(Con) in which only the primary antibody to the subunits
was omitted confirm the specificity of the reaction. I,
In a DA cell, fluorescent endosomes contain the 2 subunits that were
swept from the cell surface by antibody-mediated endocytosis (for
details see Results). Magnification 750×.
|
|
With the exception of 4, the six remaining subunits formed intensely
fluorescent, compact clusters on the surface of the dendrites of DA
cells and at the vitreal pole of their perikaryon (Figs.
4, 5). At
high magnification, the clusters appeared as round or elliptical
plaques 0.2-0.5 µm in diameter when seen en face, and as
short, thin lines when seen in profile along the edge of the dendrites
(Fig. 4). Because of their size and shape, they were identified as
postsynaptic specializations; this identification was supported by the
fact that different subunits were localized in the same cluster (see
below). Furthermore, after triple immunolabeling for TH, 3 subunit
of the GABAA receptor, and VGAT, clusters of 3
subunits were seen in register with presynaptic GABAergic endings (Fig.
4, insets). In places, the synaptic clusters were more
irregular or appeared as loose aggregates of fluorescent puncta; these
images were probably the result of inadequate stabilization of the
synaptic membrane, because fixation was so brief.

View larger version (52K):
[in this window]
[in a new window]
|
Figure 4.
In a vertical section of the retina stained for
the 1 subunit, clusters of receptors appear as short, thin lines
when seen in profile along the edge of dendrites
(arrow). Because of their size and shape, these clusters
correspond to postsynaptic active zones containing GABAA
receptors. This interpretation is confirmed by the
insets, in which triple-labeling for TH
(a), VGAT (b), and
3 (c) shows that a cluster of 3
subunits is in register with a presynaptic GABAergic ending.
Magnification 2500×.
|
|

View larger version (80K):
[in this window]
[in a new window]
|
Figure 5.
Horizontal sections of the retina
double-immunolabeled for TH (red) and six of the
subunits of the GABAA receptor
(green) whose mRNA had been identified in DA
cells by single-cell RT-PCR. Results with 4 are absent, because no
synaptic localization was observed for this subunit. Clusters intensely
positive for the GABAA receptor subunits indicated in the
bottom right corner of each micrograph are present at
the surface of DA cells (arrowheads). The micrographs
illustrating the results with the antibodies to 1, 3, and 2
are horizontal sections through the vitreal pole of the perikaryon.
Magnification 1000×.
|
|
To establish whether the distribution of the subunits varied in
different synapses, we resorted to triple-labeling with mouse antibody
to TH, guinea pig antibody to 3 (Gao et al., 1993 ), and rabbit
antibody to one of the remaining subunits (with the exception of 4),
followed by secondary antibodies conjugated to different fluorophores
(Fig. 6). The three high-magnification confocal images were finally stored sequentially in different color
channels of a computer. A total of 1000 receptor clusters were examined
by comparing their images in the different channels. We could therefore
establish their position at the cell surface and their subunit
composition. This examination also confirmed the total absence of
cross-reactivity between secondary antibodies and of bleeding between
different channels, because in absence of colocalization the stained
clusters were consistently seen in a single channel. The histogram in
Figure 7 illustrates our results in
comparing the synaptic clusters stained by the guinea pig antibody to
3 with those stained by the rabbit antibodies to the remaining five
synaptic subunits. We found that (1) 3 and 1 subunits were
localized in different synapses (synapses with 3 alone = 73%,
with 1 alone = 28%, with both subunits = 2%; 243 synapses examined). Furthermore, synapses containing 3 were
distributed throughout the dendritic arborization, whereas those
containing 1 had a preference for larger dendrites. (2) 3 was
associated most commonly with 3 (synapses with 3 alone = 21%, with 3 alone = 11%, with both = 68%; 256 synapses
examined) and more rarely with 1 (synapses with 3 alone = 58%, with 1 alone = 26%, with both = 15%; 261 synapses
examined). (3) 3 did not colocalize to an appreciable extent with
either 1 (synapses with 3 alone = 66%, with 1 alone = 32%, with both = 1.8%; 110 synapses examined) or 2
(synapses with 3 alone = 91%, with 2 alone = 8%, with
both = 2%; 130 synapses examined). It should be noted that fewer
synapses were stained by the antibodies to 1 or 2.

View larger version (89K):
[in this window]
[in a new window]
|
Figure 6.
Horizontal sections of the retina
triple-immunolabeled for TH (red), 3
(blue), and 1 (green). Subunit clusters on
the dendrites of DA cells were labeled at high magnification by
comparing images in different channels: circles indicate
synapses that contain 1, and crosses indicate synapses
that contain 3. The results of the counts are illustrated in Figure
7. Magnification 1500×.
|
|

View larger version (17K):
[in this window]
[in a new window]
|
Figure 7.
Synaptic colocalization of 3 with the other
subunits present in DA cells. For details, see Results.
|
|
 |
DISCUSSION |
Combination of transgenic technology with single-cell RT-PCR and
immunocytochemistry proved to be a powerful tool to identify the
composition of the GABAA receptors in DA cells.
First and foremost, we could obtain precise data on a very small
neuronal population. This approach could be very useful for studying
receptor gene expression in other neurons that are sparsely represented in the nervous system and do not possess a distinctive shape. Secondly,
when cells are harvested individually after patch clamping and care is
taken to avoid contamination, highly reproducible results were obtained
with medium abundance transcripts, such as those for the subunits of
this neurotransmitter receptor. Negative results, on the other hand,
should be considered with caution, because the sensitivity of the
technique remains to be determined.
Because little is known of the turnover of mRNAs in intact organs or
after dissociation, we were concerned that our findings in the isolated
cells did not reflect the true situation in the intact retina. Messages
for the GABAA receptor, however, were stable for
a long enough interval after dissociation that harvesting of a rare
cell type could take place within a comfortable period of time. Our
confidence that we had obtained a reliable representation of the
in vivo transcript repertory was confirmed when mRNA
synthesis was blocked and was reinforced by the finding that this
repertory was remarkably consistent among different DA cells. In the
past, only one report examined this important point: apparently, 1 and 6 subunit transcripts were not uniformly distributed among cerebellar granule cells (Santi et al., 1994 ). Our result that the
subunit repertory is the same for all DA cells indicates that rules
about an entire cell population can be extrapolated from findings
obtained in individual cells. Furthermore, this observation could only
be obtained by single-cell RT-PCR, because a quantitative evaluation of
the electrophysiological properties of an entire neuronal population is
prevented by variations in cell viability. Immunocytochemistry, on the
other hand, is too much dependent on the quality of the antibody used
and severely limited by the vagaries of the interaction between antigen
epitopes and fixation. For instance, our results do not support
previous observations in the rat retina that DA cells do not express
1 and 1 subunits (Greferath et al., 1995 ).
DA cells contain transcripts for seven subunits of the
GABAA receptor, namely 1, 3, 4, 1,
3, 1, 2S, and
2L; furthermore, all these messages are
translated and their products are transported to the cell surface. Such
a complexity in GABAA receptor composition is not
new, for three other types of neurons, hippocampal pyramidal cells
(Nusser et al., 1996b ), and granule cells of both cerebellum and
dentate gyrus (Laurie et al., 1992 ; Nusser et al., 1995 , 1998 ), exhibit
a similar richness in subunit subtypes.
Previous experiments showed that DA cells express bicuculline-sensitive
GABAA receptors at their surface (Gustincich et
al., 1997 ). More recently, we have demonstrated that most of the
subunits are assembled into functional receptors. In fact,
pharmacological dissection of the benzodiazepine sensitivity of DA
cells' responses to GABA suggested the presence of assemblies
containing 1, one , and 2 subunits (Feigenspan et al., 1998 ).
Furthermore, the GABA response was potentiated by loreclezole, which
confirms the existence of the 3 subunit (Wafford et al., 1994 ;
Wingrove et al., 1994 ). Further evidence that multiple
GABAA receptors exist at the surface of DA cells
emerges from previous electrophysiological observations after
transfection of different subunit combinations: 4-containing
receptors are insensitive to benzodiazepines (Benke et al., 1997 ), and
the 1 subunit does not co-assemble with 2 (Mossier et al., 1994 ;
Quirk et al., 1994 ).
With the exception of 4, six of the subunits formed clusters on the
surface of DA cells. Because of their size, shape, and location
opposite GABAergic endings, these clusters were interpreted as
postsynaptic active zones containing GABAA
receptors. The postsynaptic clusters did not exhibit homogeneous
composition. Clusters distributed throughout the dendritic tree
contained the 3 subunit associated with 3 and, less frequently,
1, whereas clusters containing the 1 subunit were confined to
large dendrites. Both types of clusters were found on the vitreal pole
of the perikaryon. By exclusion, the 1 subunit had to be prevalently
associated with 1. We were surprised that subunits were not
colocalized with the 3 subunit, but the antibodies to 1 and 2
stained fewer synapses. It is possible that the antibodies to the subunits are less sensitive or recognize epitopes more easily denatured by the fixative fluid.
It is therefore tempting to speculate that a receptor consisting of
1, 1, and 2 subunits is localized at postsynaptic active zones
on large dendrites, whereas a second type of receptor containing 3
and 3 subunits is postsynaptic at contacts distributed throughout the dendritic tree. Both types of synapses would be present on the
vitreal aspect of the perikaryon. Most likely, two or more varieties of
GABAergic amacrines synapse with DA cells and inhibit dopamine release
with different physiological actions at the postsynaptic membrane. This
is not surprising if one considers that GABA is the major transmitter
that controls dopamine release (Morgan and Kamp, 1980 ; Kirsch and
Wagner, 1989 ; Gustincich et al., 1997 ). In fact, GABA suppresses
light-evoked release in the intact retina, and GABA receptor
antagonists induce dopamine release in the dark (Kamp and Morgan, 1981 ;
O'Connor et al., 1986 ; Ishita et al., 1988 ; Critz and Marc, 1992 ;
Kolbinger and Weiler, 1993 ; Gustincich et al., 1997 ). Multiple types of
GABAergic amacrines would therefore be responsible for subtle
regulations of DA cell activity, perhaps in different conditions of illumination.
In agreement with findings reported elsewhere in the nervous system
(Fritschy et al., 1992 ; Nusser et al., 1995 , 1996a ), a large repertory
of subunits is also present throughout the neuronal surface, suggesting
the existence of multiple types of extrasynaptic receptors. It is
interesting that only the 4 subunit is exclusively extrasynaptic.
The function of 4 is poorly understood. It is commonly colocalized
with the subunit (Benke et al., 1997 ), which in turn is exclusively
extrasynaptic in cerebellar granule cells (Nusser et al., 1998 ).
The presence of extrasynaptic GABAA receptors
suggests that the activity of a neuron responsible for neural
adaptation to light must constantly integrate excitation and inhibition
over its entire surface and accordingly regulate dopamine release. After all, the composition of the chemical soup in the intercellular spaces of the inner plexiform layer mirrors the diversity of the visual
scene presented to the retina.
 |
FOOTNOTES |
Received April 29, 1999; revised June 23, 1999; accepted June 28, 1999.
This research was supported by National Institutes of Health Grant
EY-01344. We thank J.-M. Fritschy for providing the anti- 3 subunit
antibody and R. H. Edwards for the anti-vesicular GABA transporter
(VGAT) antibody. We are grateful to Heather Regan and Jennifer J. Wilson for assistance.
Correspondence should be addressed to Elio Raviola, Department of
Neurobiology, Harvard Medical School, 220 Longwood Avenue, Boston, MA 02115.
 |
REFERENCES |
-
Barnard EA,
Skolnick P,
Olsen RW,
Mohler H,
Sieghart W,
Biggio G,
Braestrup C,
Bateson AN,
Langer SZ
(1998)
International Union of Pharmacology. XV. Subtypes of
-aminobutyric acidA receptors: classification on the basis of subunit structure and receptor function.
Pharmacol Rev
50:291-313[Abstract/Free Full Text]. -
Benke D,
Michel C,
Mohler H
(1997)
GABAA receptors containing the
4-subunit: prevalence, distribution, pharmacology, and subunit architecture in situ.
J Neurochem
69:806-814[Web of Science][Medline]. -
Chaudhry FA,
Reimer RJ,
Bellocchio EE,
Danbolt NC,
Osen KK,
Edwards RH,
Storm-Mathisen J
(1998)
The vesicular GABA transporter, VGAT, localizes to synaptic vesicles in sets of glycinergic as well as GABAergic neurons.
J Neurosci
18:9733-9750[Abstract/Free Full Text].
-
Chomczynski P,
Sacchi N
(1987)
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:156-159[Web of Science][Medline].
-
Connolly CN,
Krishek BJ,
McDonald BJ,
Smart TG,
Moss SJ
(1996)
Assembly and cell surface expression of heteromeric and homomeric
-aminobutyric acid type A receptors.
J Biol Chem
271:89-96[Abstract/Free Full Text]. -
Critz SD,
Marc RE
(1992)
Glutamate antagonists that block hyperpolarizing bipolar cells increase the release of dopamine from turtle retina.
Vis Neurosci
9:271-278[Web of Science][Medline].
-
De Waele P,
De Groote G,
Van De Voorde A,
Fiers W,
Franssen J-D,
Herion P,
Urbain J
(1982)
Isolation and identification of monoclonal antibodies directed against human placental alkaline phosphatase.
Arch Int Physiol Biochim Biophys
90:B21[Web of Science].
-
Djamgoz MB,
Wagner HJ
(1992)
Localization and function of dopamine in the adult vertebrate retina.
Neurochem Int
20:139-191[Web of Science][Medline].
-
Ebert V,
Scholze P,
Fuchs K,
Sieghart W
(1999)
Identification of subunits mediating clustering of GABAA receptors by rapsyn.
Neurochem Int
34:453-463[Web of Science][Medline].
-
Feigenspan A,
Gustincich S,
Raviola E
(1998)
Electrophysiology of dopaminergic amacrine cells GABAA receptors.
Exp Eye Res [Suppl]
67:178.
-
Fritschy J-M,
Benke D,
Mertens S,
Oertel WH,
Bachi T,
Möhler H
(1992)
Five subtypes of type A
-aminobutyric acid receptors identified in neurons by double and triple immunofluorescence staining with subunit-specific antibodies.
Proc Natl Acad Sci USA
89:6726-6730[Abstract/Free Full Text]. -
Gao B,
Fritschy JM,
Benke D,
Mohler H
(1993)
Neuron-specific expression of GABAA-receptor subtypes: differential association of the
1- and 3-subunits with serotonergic and GABAergic neurons.
Neuroscience
54:881-892[Web of Science][Medline]. -
Ghia P,
ten Boekel E,
Sanz E,
de la Hera A,
Rolink A,
Melchers F
(1996)
Ordering of human bone marrow B lymphocyte precursors by single-cell polymerase chain reaction analyses of the rearrangement status of the immunoglobulin H and L chain gene loci.
J Exp Med
184:2217-2229[Abstract/Free Full Text].
-
Greferath U,
Grünert U,
Fritschy JM,
Stephenson A,
Möhler H,
Wässle H
(1995)
GABAA receptor subunits have differential distributions in the rat retina: in situ hybridization and immunohistochemistry.
J Comp Neurol
353:553-571[Web of Science][Medline].
-
Gustincich S,
Feigenspan A,
Wu DK,
Koopman LJ,
Raviola E
(1997)
Control of dopamine release in the retina: a transgenic approach to neural networks.
Neuron
18:723-736[Web of Science][Medline].
-
Ishita S,
Negishi K,
Teranishi T,
Shimada Y,
Kato S
(1988)
GABAergic inhibition on dopamine cells of the fish retina: a [3H]dopamine release study with isolated fractions.
J Neurochem
50:1-6[Web of Science][Medline].
-
Jones A,
Korpi ER,
McKernan RM,
Pelz R,
Nusser Z,
Mäkelä R,
Mellor JR,
Pollard S,
Bahn S,
Stephenson FA,
Randall AD,
Sieghart W,
Somogyi P,
Smith AJH,
Wisden W
(1997)
Ligand-gated ion channel subunit partnerships: GABAA receptor
6 subunit gene inactivation inhibits subunit expression.
J Neurosci
17:1350-1362[Abstract/Free Full Text]. -
Kamp CW,
Morgan WW
(1981)
GABA antagonists enhance dopamine turnover in the rat retina in vivo.
Eur J Pharmacol
69:273-279[Web of Science][Medline].
-
Kirsch M,
Wagner HJ
(1989)
Release pattern of endogenous dopamine in teleost retinae during light adaptation and pharmacological stimulation.
Vision Res
29:147-154[Web of Science][Medline].
-
Kolbinger W,
Weiler R
(1993)
Modulation of endogenous dopamine release in the turtle retina: effects of light, calcium, and neurotransmitters.
Vis Neurosci
10:1035-1041[Web of Science][Medline].
-
Laurie DJ,
Seeburg PH,
Wisden W
(1992)
The distribution of 13 GABAA receptor subunit mRNAs in the rat brain. II. Olfactory bulb and cerebellum.
J Neurosci
12:1063-1076[Abstract].
-
McKernan RM,
Whiting PJ
(1996)
Which GABAA-receptor subtypes really occur in the brain?
Trends Neurosci
19:139-143[Web of Science][Medline].
-
Montarolo PG,
Goelet P,
Castellucci VF,
Morgan J,
Kandel ER,
Schacher S
(1986)
A critical period for macromolecular synthesis in long-term heterosynaptic facilitation in Aplysia.
Science
234:1249-1254[Abstract/Free Full Text].
-
Morgan WW,
Kamp CW
(1980)
A GABAergic influence on the light-induced increase in dopamine turnover in the dark-adapted rat retina in vivo.
J Neurochem
34:1082-1086[Web of Science][Medline].
-
Mossier B,
Tögel M,
Fuchs K,
Sieghart W
(1994)
Immunoaffinity purification of
-aminobutyric acidA (GABAA) receptors containing 1-subunits: evidence for the presence of a single type of -subunit in GABAA receptors.
J Biol Chem
269:25777-25782[Abstract/Free Full Text]. -
Nusser Z,
Roberts JDB,
Baude A,
Richards JG,
Sieghart W,
Somogyi P
(1995)
Immunocytochemical localization of the
1 and 2/3 subunits of the GABAA receptor in relation to specific GABAergic synapses in the dentate gyrus.
Eur J Neurosci
7:630-646[Web of Science][Medline]. -
Nusser Z,
Sieghart W,
Stephenson FA,
Somogyi P
(1996a)
The
6 subunit of the GABAA receptor is concentrated in both inhibitory and excitatory synapses on cerebellar granule cells.
J Neurosci
16:103-114[Abstract/Free Full Text]. -
Nusser Z,
Sieghart W,
Benke D,
Fritschy J-M,
Somogyi P
(1996b)
Differential synaptic localization of two major
-aminobutyric acid type A receptor subunits on hippocampal pyramidal cells.
Proc Natl Acad Sci USA
93:11939-11944[Abstract/Free Full Text]. -
Nusser Z,
Sieghart W,
Somogyi P
(1998)
Segregation of different GABAA receptors to synaptic and extrasynaptic membranes of cerebellar granule cells.
J Neurosci
18:1693-1703[Abstract/Free Full Text].
-
O'Connor P,
Dorison SJ,
Watling KJ,
Dowling JE
(1986)
Factors affecting release of 3H-dopamine from perfused carp retina.
J Neurosci
6:1857-1865[Abstract].
-
Pearce RA
(1993)
Physiological evidence for two distinct GABAA responses in rat hippocampus.
Neuron
10:189-200[Web of Science][Medline].
-
Quirk K,
Gillard NP,
Ragan CI,
Whiting PJ,
McKernan RM
(1994)
-aminobutyric acid type A receptors in the rat brain can contain both 2 and 3 subunits, but 1 does not exist in combination with another subunit.
Mol Pharmacol
45:1061-1070[Abstract]. -
Rabow LE,
Russek SJ,
Farb DH
(1995)
From ion currents to genomic analysis: recent advances in GABAA receptor research.
Synapse
21:189-274[Web of Science][Medline].
-
Santi MR,
Vicini S,
Eldadah B,
Neale JH
(1994)
Analysis by polymerase chain reaction of
1 and 6 GABAA receptor subunit mRNAs in individual cerebellar neurons after whole-cell recordings.
J Neurochem
63:2357-2360[Web of Science][Medline]. -
Sieghart W
(1995)
Structure and pharmacology of
-aminobutyric acidA receptor subtypes.
Pharmacol Rev
47:181-234[Web of Science][Medline]. -
Sieghart W,
Fuchs K,
Tretter V,
Ebert V,
Jechlinger M,
Höger H,
Adamiker D
(1999)
Structure and subunit composition of GABAA receptors.
Neurochem Int
34:379-385[Web of Science][Medline].
-
Sperk G,
Schwarzer C,
Tsunashima K,
Fuchs K,
Sieghart W
(1997)
GABAA receptor subunits in the rat hippocampus I: immunocytochemical distribution of 13 subunits.
Neuroscience
80:987-1000[Web of Science][Medline].
-
Varecka L,
Wu C-H,
Rotter A,
Frostholm A
(1994)
GABAA/Benzodiazepine receptor
6 subunit mRNA in granule cells of the cerebellar cortex and cochlear nuclei: expression in developing and mutant mice.
J Comp Neurol
339:341-352[Web of Science][Medline]. -
Versaux-Botteri C,
Nguyen-Legros J,
Vigny A,
Raoux N
(1984)
Morphology, density and distribution of tyrosine hydroxylase-like immunoreactive cells in the retina of mice.
Brain Res
301:192-197[Web of Science][Medline].
-
Wafford KA,
Bain CJ,
Quirk K,
McKernan RM,
Wingrove PB,
Whiting PJ,
Kemp JA
(1994)
A novel allosteric modulatory site on the GABAA receptor
subunit.
Neuron
12:775-782[Web of Science][Medline]. -
Whiting P,
McKernan RM,
Iversen LL
(1990)
Another mechanism for creating diversity in
-aminobutyrate type A receptors: RNA splicing directs expression of two forms of 2 subunit, one of which contains a protein kinase C phosphorylation site.
Proc Natl Acad Sci USA
87:9966-9970[Abstract/Free Full Text]. -
Wingrove PB,
Wafford KA,
Bain C,
Whiting PJ
(1994)
The modulatory action of loreclezole at the
-aminobutyric acid type A receptor is determined by a single amino acid in the 2 and 3 subunit.
Proc Natl Acad Sci USA
91:4569-4573[Abstract/Free Full Text]. -
Wisden W
(1995)
Structure and distribution of multiple GABAA receptor subunits with special reference to the cerebellum.
Ann NY Acad Sci
757:506-515[Web of Science][Medline].
-
Wisden W,
Laurie DJ,
Monyer H,
Seeburg PH
(1992)
The distribution of 13 GABAA receptor subunit mRNAs in the rat brain. I. Telencephalon, diencephalon, mesencephalon.
J Neurosci
12:1040-1062[Abstract].
-
Witkovsky P,
Dearry A
(1991)
Functional roles of dopamine in the vertebrate retina.
Prog Retinal Res
11:247-292.
Copyright © 1999 Society for Neuroscience 0270-6474/99/19187812-11$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
H. Hirasawa, M. Puopolo, and E. Raviola
Extrasynaptic Release of GABA by Retinal Dopaminergic Neurons
J Neurophysiol,
July 1, 2009;
102(1):
146 - 158.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. K. Archibald, M. P. Clarke, U. P. Mosimann, and D. J. Burn
The retina in Parkinson's disease
Brain,
May 1, 2009;
132(5):
1128 - 1145.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. J. Bailey, M. A. Ravier, and G. A. Rutter
Glucose-Dependent Regulation of {gamma}-Aminobutyric Acid (GABAA) Receptor Expression in Mouse Pancreatic Islet {alpha}-Cells
Diabetes,
February 1, 2007;
56(2):
320 - 327.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D.-Q. Zhang, T.-R. Zhou, and D. G. McMahon
Functional Heterogeneity of Retinal Dopaminergic Neurons Underlying Their Multiple Roles in Vision
J. Neurosci.,
January 17, 2007;
27(3):
692 - 699.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G.-X. Ruan, D.-Q. Zhang, T. Zhou, S. Yamazaki, and D. G. McMahon
Circadian organization of the mammalian retina
PNAS,
June 20, 2006;
103(25):
9703 - 9708.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. O. Wadiche, D. A. Bromberg, A. L. Bensen, and G. L. Westbrook
GABAergic Signaling to Newborn Neurons in Dentate Gyrus
J Neurophysiol,
December 1, 2005;
94(6):
4528 - 4532.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Gustincich, M. Contini, M. Gariboldi, M. Puopolo, K. Kadota, H. Bono, J. LeMieux, P. Walsh, P. Carninci, Y. Hayashizaki, et al.
Gene discovery in genetically labeled single dopaminergic neurons of the retina
PNAS,
April 6, 2004;
101(14):
5069 - 5074.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Contini and E. Raviola
GABAergic synapses made by a retinal dopaminergic neuron
PNAS,
February 4, 2003;
100(3):
1358 - 1363.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Frech, J. Perez-Leon, H. Wassle, and K. H. Backus
Characterization of the Spontaneous Synaptic Activity of Amacrine Cells in the Mouse Retina
J Neurophysiol,
October 1, 2001;
86(4):
1632 - 1643.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Feigenspan, S. Gustincich, and E. Raviola
Pharmacology of GABAA Receptors of Retinal Dopaminergic Neurons
J Neurophysiol,
October 1, 2000;
84(4):
1697 - 1707.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|