 |
Previous Article | Next Article 
The Journal of Neuroscience, September 15, 1999, 19(18):7870-7880
A Dominant Negative Receptor for Specific Secreted Semaphorins Is
Generated by Deleting an Extracellular Domain from Neuropilin-1
Michael J.
Renzi,
Leonard
Feiner,
Adam M.
Koppel, and
Jonathan A.
Raper
Department of Neurosciences, University of Pennsylvania School of
Medicine, Philadelphia, Pennsylvania 19104-6074
 |
ABSTRACT |
Neuropilins have recently been characterized as receptors for
secreted semaphorins. Here, we report the generation of a dominant negative form of neuropilin-1 by the deletion of one of its
extracellular domains. Expression of this variant in cultured primary
sympathetic neurons blocks the paralysis of growth cone motility
normally induced by SEMA-3A (collapsin-1, semaphorin III, semaphorin D) and SEMA-3C (collapsin-3, semaphorin E) but not that induced by SEMA-3F
(semaphorin IV). A truncated form of neuropilin-1 that is missing its
cytoplasmic domain fails to act as a dominant negative receptor
component. These results suggest that neuropilin-1 is a necessary
component of receptor complexes for some, but not all, secreted
semaphorin family members. Overexpression of dominant negative
neuropilins should provide a powerful new method of blocking the
functions of secreted semaphorins.
Key words:
semaphorin; collapsin; neuropilin-1; sympathetic neuron; growth cone guidance; growth cone collapse; dominant negative
receptor
 |
INTRODUCTION |
The development of a functional
nervous system requires that axons navigate through a complex
environment, sometimes over long distances, to locate their correct
targets. At the growing tips of axons, motile growth cones detect and
respond to a multitude of attractive and repellent guidance cues in
their environment. Chick SEMA-3A (chick collapsin-1, human
semaphorin-III, mouse semaphorin-D) is a member of the semaphorin
family of signaling proteins and is thought to act as a repellent
guidance cue for a variety of specific axons. Recombinant SEMA-3A
inhibits the motility of growth cones from explanted dorsal root
ganglia (DRGs), sympathetic ganglia, several but not all cranial
sensory ganglia, olfactory sensory epithelial neurons, and spinal motor
neurons (Luo et al., 1993 ; Kobayashi et al., 1997 ; Shepherd et al.,
1997 ). In collagen-stabilized cultures, it has been shown to repel
sensory axons projecting from explanted DRGs (Messersmith et al., 1995 ) and motor axons from most motor nuclei in the brainstem
(Varela-Echavarria et al., 1997 ). Knocking out the homologous protein
(semaphorin-D) in embryonic mice results in defasciculation and
aberrant pathfinding of peripheral axon projections (Behar et al.,
1996 ; Taniguchi et al., 1997 ).
The semaphorin family now includes more than 20 members. Several of
these are secreted proteins structurally related to SEMA-3A. SEMA-3C
(chick collapsin-3, mouse semaphorin-E) and SEMA-3F (human sema-IV)
have overall domain structures identical to SEMA-3A and amino acid
sequences that are ~50% identical to SEMA-3A and to each other
(Adams et al., 1997 ; Chen et al., 1997 ; Koppel et al., 1997 ). All three
of these semaphorin family members induce the collapse of sympathetic
growth cones, but only SEMA-3A induces the collapse of DRG growth cones
(Chen et al., 1997 ; Koppel et al., 1997 ; Giger et al., 1998b )
All three are expressed in overlapping patterns in the developing
embryo (Adams et al., 1996 ; Shepherd et al., 1996 ; Giger et al.,
1998a ,b ) and are likely to act as repellents that help guide
peripheral axons, particularly sympathetic axons, along their
appropriate trajectories.
Significant progress has been made in identifying receptors for these
axonal guidance molecules. A SEMA-3A binding protein, neuropilin-1, has
been identified by expression cloning (He and Tessier-Lavigne,
1997 ; Kolodkin et al., 1997 ). Neuropilin-1 is expressed in
SEMA-3A-sensitive neurons as they extend their axons during development
(Takagi et al., 1995 ). Antibodies directed against neuropilin-1 inhibit
SEMA-3A-induced collapse of growth cones from DRGs (He and
Tessier-Lavigne, 1997 ; Kolodkin et al., 1997 ), and DRGs from
neuropilin-1 knock-out mice are unresponsive to SEMA-3A when tested in
the growth cone collapse assay (Kitsukawa et al., 1997 ). Neuropilin-1
knock-out mice have a phenotype that is similar to the SEMA-3A
knock-out mouse until they die between 10.5 and 13.5 d postcoitus
(dpc). These results demonstrate that neuropilin-1 is required
in neurons for SEMA-3A responsiveness.
Although neuropilin-1 is necessary for SEMA-3A function, several lines
of evidence suggest that, by itself, it is unlikely to comprise the
complete SEMA-3A receptor (Feiner et al., 1997 ). First, it has an
extremely short cytoplasmic tail lacking any known signaling motifs.
Second, a wide variety of secreted semaphorin family members bind to
neuropilin-1 with approximately equal affinities, although, as
described above, they do not all have the same biological specificities. Third, alkaline phosphatase (AP)-tagged versions of
these semaphorins bind in overlapping but distinct patterns on
sectioned embryonic tissues, suggesting that binding specificities are
determined by more than the distribution of neuropilin-1. These
considerations suggest that neuropilin-1 could be a common component
for receptors responsive to secreted semaphorins, although additional
receptor components help determine binding specificities and biological
responsiveness. As addressed later in Discussion, some or all of the
required specificity could be determined by the presence or absence of
the neuropilin-1-related protein neuropilin-2 (Chen et al., 1998 ; Giger
et al., 1998b ; Takahashi et al., 1998 ).
The objective of this study was to engineer a dominant negative
form of neuropilin-1 that could be used to explore its functional role in semaphorin receptors. If neuropilin-1 is a common component of
receptor complexes that are specific for different secreted semaphorins, then it should follow that a dominant negative
neuropilin-1 would block responsiveness to multiple secreted
semaphorins. We have generated neuropilin-1 constructs missing specific
structural domains, expressed them in cultured primary sympathetic
cells responsive to several secreted semaphorins, and tested whether the constructs interfere with semaphorin activities. We have determined that deleting a portion of the extracellular domain of neuropilin-1 generates a dominant negative construct that blocks the activities of
both SEMA-3A and SEMA-3C but not SEMA-3F. This finding is consistent with the hypothesis that neuropilin-1 is a component of receptors for
some but not all secreted semaphorins. In future studies, the
overexpression of this construct could be used to simultaneously block
the activities of SEMA-3A and SEMA-3C during embryogenesis in
vivo.
 |
MATERIALS AND METHODS |
Generation of neuropilin-1 deletion constructs. PCR
was used to generate constructs of neuropilin-1 with specific domains deleted. PCR products were cloned into the modified mammalian expression vector pAG-NT as described previously, containing an N-terminal tag consisting of a signal sequence (from the first 25 amino acids of chick SEMA-3A), two myc epitope tags, and a 6xHis tag
(Koppel et al., 1997 ). The oligonucleotide primers for the
neuropilin deletion constructs were made containing the appropriate restriction enzyme sites so that the amplified products could be cloned
directly into the BamHI and Not1 restriction
sites of pAG-NT. Standard PCR amplification between oligonucleotide
primers, all of which placed a BglII restriction site 5' and
a Not1 site 3', was used to make the following constructs:
full-length neuropilin-1 between cgaagcgataaatgcggcgac (F1) and
tcatgcttccgagtaagaattctg (R1); a1/a2 domain deletion
neuropilin-1 between atggaaccactaggtatggag (F2) and R1; and cytoplasmic
domain deletion neuropilin-1 between F1 and gcaggcacagtacaggcaaac (R2).
Constructs that required the deletion of internal domains were made
using a two-step PCR protocol described by Koppel et al. (1997) .
Briefly, the sequence on either side of the deleted region is amplified
in the first step. The 5' end of the internal reverse primer is
complimentary to the internal forward primer. The second step involves
annealing the two primers at the complimentary sequence and
amplifying the final product using the outermost primers. The following
constructs were made: b1/b2 domain deletion neuropilin-1 [step
1, between F1 and ttcggaaacagtagggacgacagcgcactgga-aatcttctgatac (R3)
and between gctgtccctactgtttccgaa (F3) and R1] and (step 2, between F1
and R1); C-domain deletion neuropilin-1 [step1, between F1 and
tgcactcatggctatgatggtcgtgggagcttcaagttcaca (R4) and between
aacatcatagccatgagtgca (F4) and R1] and (step 2, between F1 and R1).
Protein expression in cultured cells. Human embryonic kidney
(HEK) 293T or Cos-7 cells were grown to ~70% confluency in a 10 cm dish in DMEM (Life Technologies, Gaithersburg, MD) with 1%
penicillin-streptomycin (P-S) (Life Technologies) and 10% fetal bovine serum (FBS) (Hyclone Laboratories, Logan, UT) and transfected using calcium phosphate in the presence of 25 µM of chloroquine (Sigma, St. Louis, MO).
Approximately 50 µg of DNA was added per 10 cm dish. Cells were
incubated in the transfection mix for at least 4 hr and then changed
into fresh media. HEK293T cells expressing AP-SEMA-3A or AP-SEMA-3C
were allowed to grow for 2 d. Conditioned media were then
collected, spun down to remove cell debris, and stored in frozen
aliquots before their use in the growth cone collapse assay. Cos-7
cells were transfected with the neuropilin-1 deletion constructs, grown
overnight, and assayed for AP-SEMA-3A binding the next day.
Culture of sympathetic neurons. Sympathetic chain ganglia
were dissected from E7-E8 chick embryos and placed in ice cold
HBSS (Life Technologies). The ganglia were carefully cleaned of
connective tissue and placed in DMEM containing 1% P-S and 10% FBS
and preincubated at 37°C with 5% CO2. The
ganglia were spun down, resuspended in 0.05% trypsin, and incubated at
37°C for 15 min. The ganglia were again spun down and then
dissociated by trituration in 100 µl of fresh medium. The dissociated
cells were plated on 10 mm round coverslips coated with laminin (Life
Technologies) at an approximate density of
104 cells per coverslip and cultured in
500 µl of media. Cells were incubated at 37°C with 5%
CO2 for at least 1 hr to allow them to adhere to
the coverslip before transfection (see below).
Protein expression in sympathetic cells. Cultured
sympathetic cells were transfected using calcium phosphate.
Approximately 1 µg of plasmid DNA was added to 500 µl of medium
with 25 µM chloroquin in the well of a 48-well
cluster plate. The cells were incubated for no longer than 5 hr at
37°C in 5% CO2. To stop the transfection, the
media was removed and replaced with F-12 (Life Technologies) supplemented with glutamine, glucose, bovine pituitary extract, nerve
growth factor, insulin, transferrin, selenium, 1% P-S, and 10% FBS (Baird and Raper, 1995 ). Cells were grown overnight in supplemented F-12. The next day, the dissociated sympathetic cells were
washed with warm HBSS and then treated in 0.25% trypsin for 1-2 min.
After the cells had dislodged from the coverslip, supplemented F-12 was
added, and the cells were either replated as dissociated cells on fresh
laminin coated coverslips or suspended in drop culture for
reaggregation. Dissociated cells were grown for 5-6 hr and then
assayed for collapse and/or protein expression. Sympathetic cells in
drop cultures were allowed to reaggregate for 4-5 hr and then plated
onto fresh laminin coated coverslips. Reaggregates were grown overnight
(18 hr) in supplemented F-12 at 37°C with 5%
CO2 and assayed the next day for growth cone
collapse and/or protein expression.
Collapse assay. The collapse assay was performed as
described by Luo et al. (1993) with slight alterations. In brief, an
amount of recombinant secreted semaphorin, 10 times greater than that required to induce 50% of DRG or sympathetic growth cones to collapse [10 collapsing units (c.u.)], or as a control an equal volume of media, was added to each well in a volume not exceeding 250 µl.
The cells were incubated at 37°C in 5% CO2 for
35 min and then fixed in 4% paraformaldehyde in PBS containing 10%
sucrose. Cells were then stained for the myc epitope tag (see below) to identify transfected cells. Neurites from transfected cells that had a
length of greater than two times the width of the cell body were
analyzed. The tips of neurites without lamellipodia or filopodia were
scored as being collapsed.
Immunohistochemistry. Cells were fixed as described above
and incubated with PBS containing a mix of polyvinyl-pyrolidone (Sigma) with molecular weights of 10,000, 40,000, and 360,000 and 3% BSA. Cells were incubated with a mouse anti-myc ascites (9E10
from American Type Culture Collection, Manassas, VA) diluted 1:500 in
blocker for 3 hr at room temperature or overnight at 4°C.
Cells were then washed with PBS and incubated with a Cy3-conjugated donkey anti-mouse IgG/IgM secondary antibody (Jackson ImmunoResearch, West Grove, PA) for 2 hr at room temperature or overnight at 4°C.
AP fusion protein binding assay. AP-SEMA-3A, AP-Sema,
and AP-Ig-basic were tested for their ability to bind to neuropilin-1 deletion constructs expressed in Cos-7. In brief, cells expressing truncated neuropilins were washed gently with PBS and incubated with
AP-SEMA-3A, AP-Sema, or AP-Ig-basic diluted in PBS with 10% FBS. The
AP fusion proteins were produced by HEK293T cells transiently transfected with the appropriate expression vector. The concentration of AP-SEMA-3A was determined by measuring the amount of conditioned media required to cause 50% collapse in the growth cone collapse assay. The concentrations of AP-Sema and AP-Ig-basic were estimated by
comparing their AP activities with that of AP-collapsin. Cells were
incubated with probe for 1 hr. After three 10 min washes with PBS, the
cells were fixed in 4% paraformaldehyde in PBS with 10% sucrose.
Inactivation of endogenous alkaline phosphatases was accomplished by
heating the samples to 65°C for 3 hr. Binding of the AP-tagged
ligands was visualized by reacting with nitro blue
tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (Sigma).
Membrane preparations and Western blots. Neuropilin-1
deletion constructs were expressed in HEK293T cells as described above and grown overnight (18 hr). Cells were harvested in lysis buffer (Hallak et al., 1994 ) containing 20 mM HEPES, 2 mM MgCl2, 1 mM EDTA, leupeptin (2ug/ul), and PMSF (0.1 mM). Cells were incubated on ice for 5 min and
then lysed by passing them through a 20 gauge needle. The lysed cells
were spun down at 1000 × g for 5 min to pellet
unbroken cells and nuclei. The supernatant was transferred to an
ultracentrifuge tube and spun at 100,000 × g for 60 min to pellet the membranes. The pellet was resuspended in 100 µl of
lysis buffer. Ten microliters of this sample were extracted with
SDS-sample buffer and analyzed by Western blot using an anti-myc antibody.
 |
RESULTS |
Generation of neuropilin-1 deletion constructs
Neuropilin-1 is a cell surface protein recently identified as a
receptor or receptor component for SEMA-3A. It has a large extracellular domain containing five distinct sub-domains, a single transmembrane domain, and a short cytoplasmic domain (Fig.
1A). The five
extracellular domains, a1, a2, b1, b2, and C, have been defined by
their homology to other proteins (Takagi et al., 1991 ). Domains a1 and
a2 are related to each other and to the noncatalytic region of the
complement components C1r and C1s. The b1 and b2 domains are related to
each other and to the C1 and C2 domains of coagulation factors VIII and
V. A portion of the C domain shares homology to meprin, A5, µ (MAM) domains found in a variety of proteins that are thought to
mediate homophilic protein-protein interactions (Beckmann and Bork,
1993 ; Zondag et al., 1995 ).

View larger version (23K):
[in this window]
[in a new window]
|
Figure 1.
Neuropilin-1 deletion constructs and their
expression. A, The domain structure of full-length
neuropilin-1 is shown on the left, and the deletion
constructs used in this study are arrayed to the right.
The domains are described in the boxed key, and the
boundaries between domains are defined in Results.
B, HEK293-T cells were transfected with the neuropilin-1
constructs in A. Blotted membrane preparations were
probed for the myc epitope. All of the constructs generate
membrane-associated recombinant proteins that are close to their
expected sizes.
|
|
We used PCR to delete specific portions of chick neuropilin-1 sequences
corresponding to these domains. The boundaries of the domains were
defined approximately as described by Takagi et al. (1991) .
Specifically, for this study, we defined the boundaries as follows: in
the A-deletion construct, the a1 and a2 domains from
Arg21 to Glu254 are
missing; in the B-deletion construct, the b1 and b2 domains from
Gly255 to Thr587 are
missing; in the C-deletion construct, the C domain from
Ala588 to Ile851 is
missing; and in the Cyt-deletion construct, the cytoplasmic domain from Trp875 to the C terminus is deleted. Membranes
from HEK293T cells transfected with these deletion constructs were
purified and extracted, and the myc-tagged recombinant deletion
products were analyzed by Western blots of reducing gels. All the
constructs copurified with the cell membrane and, with the exception of
the C-deletion product, are close to their predicted size (Fig.
1B). C-deletion neuropilin-1 is reduced in weight to
a larger degree than predicted by the loss of the deleted amino acids
alone. This is most likely explained by the loss of three predicted
glycosylation sites within the C domain. In addition, a band with the
approximate molecular weight of a dimer is present in all of the
constructs except C-deletion neuropilin-1. This band is more prominent
in nonreducing SDS-PAGE gels (data not shown). This finding is
consistent with the suggestion of Giger et al. (1998b) and
Nakamura et al. (1998) that the C domain mediates dimer formation,
which occurs in the absence of ligand.
Neuropilin-1 contains more than one binding site for SEMA-3A
In an effort to determine which domains within neuropilin-1 are
responsible for binding SEMA-3A, we expressed neuropilin-1 deletion
constructs in Cos-7 cells and probed them with alkaline phosphatase-tagged versions of full-length SEMA-3A (AP-SEMA-3A), the
semaphorin domain of SEMA-3A (AP-Sema), or the Ig-basic tail of SEMA-3A
(AP-Ig-basic). Previous studies have shown AP-Sema has an ~30-fold
reduced activity compared with full-length SEMA-3A and that AP-Ig-basic
has no detectable biological activity (Koppel and Raper, 1998 ).
AP-SEMA-3A and AP-Ig-basic bind to cells transfected with full-length,
A-deletion, C-deletion, and Cyt-deletion neuropilin-1 equally well
(Fig. 2A). Reaction
conditions that detect strong binding of AP-SEMA-3A and AP-Ig-basic to
these neuropilin-1 constructs detect no binding to the B-deletion
construct. The b1 and b2 domains therefore contribute very
strongly to the binding of SEMA-3A to neuropilin-1, and the
Ig-basic regions of SEMA-3A appear to mediate this binding.

View larger version (105K):
[in this window]
[in a new window]
|
Figure 2.
Mapping SEMA-3A binding sites to neuropilin-1
domains. A, HEK293T cells were transiently transfected
with A-, B-, or C- deletion neuropilin-1 and probed with ~1.5
nM AP-SEMA-3A (top) or an anti-myc antibody
(bottom). After 1 hr development in NBT/BCIP, AP-SEMA-3A
was visualized bound to cells expressing A-deletion and C-deletion
neuropilin-1 but not to those expressing B-deletion neuropilin-1.
Staining live cells with anti-myc demonstrates that all constructs are
expressed on the cell surface. B, The same neuropilin-1
deletion constructs were probed with ~3 nM AP-Sema
(top two rows) or 1.5 nM AP-Ig-basic
(bottom). After 2 d development, AP-Sema was
visualized bound to A- and B-deletion neuropilin-1 but not to
C-deletion neuropilin-1. After 1 hr development, AP-Ig-basic was
visualized bound to A- and C-deletion neuropilin-1 but not B-deletion
neuropilin-1. Scale bars: A, 62.5 µm;
B, 100 µm.
|
|
Commensurate with its much lower biological potency, AP-Sema binds
full-length neuropilin-1 more weakly than does AP-SEMA-3A (Fig.
2B). Surprisingly, it binds to B-deletion
neuropilin-1, indicating that it binds outside the b1 and b2 domains
recognized by the Ig-basic portion of full-length SEMA-3A. It is also
possible to detect weak binding of AP-Sema to A-deletion neuropilin-1. No binding of AP-Sema to C-deletion neuropilin-1 was detected in our
experiments. Experiments using the Sema domain fused to a fragment that
crystalizes (Fc) as a probe produced an identical binding
pattern (data not shown). These results argue that the C domain is the
primary locus of semaphorin domain binding on neuropilin-1.
Overexpression of neuropilin-1 without the C domain in sympathetic
neurons blocks their responsiveness to SEMA-3A
Each of the neuropilin-1 deletion constructs was transfected into
cultured primary sympathetic cells in an effort to identify a dominant
negative neuropilin-1 variant that blocks SEMA-3A function. Dissociated
sympathetic neurons from E7 to E8 chicks were grown on laminin-coated
coverslips. Eighteen hours after transfection, the cells were treated
with trypsin and replated to ensure that all neurites were newly formed
and would therefore incorporate proteins generated from the transfected
plasmids. Neurites were allowed to extend for an additional 5-6 hr
before adding control medium or medium containing ~300 pM
recombinant AP-SEMA-3A. This is ~10 c.u. of SEMA-3A. A collapsing
unit is defined as the amount of SEMA-3A required to induce 50% of
growth cones to collapse in our standard explant assay. Neurons that
stained positive for the myc epitope tag incorporated into every
neuropilin-1 construct were assayed for their ability to respond to
SEMA-3A.
The engineered recombinant proteins can be visualized with anti-myc
antibodies and are seen to be expressed on the growth cone, as well as
on the neurites and cell bodies of all transfected cells (Fig.
3). Expression levels are generally high
and uniform between cells as judged by the intensity of myc
staining. The anti-myc antibody did not label untransfected cells.

View larger version (19K):
[in this window]
[in a new window]
|
Figure 3.
Expression of neuropilin-1 deletion constructs in
cultured sympathetic growth cones. Myc-tagged recombinant proteins were
visualized using an anti-myc ascites and a Cy3-conjugated secondary
antibody. Recombinant protein is expressed throughout the cell,
including the lamellipodia and filopodia of the growth cone. The
addition of SEMA-3A induces the collapse of growth cones expressing
either a control truncated Trk-B protein or full-length
neuropilin-1. Sympathetic neurons expressing C-deletion neuropilin-1
are resistant to collapse when exposed to SEMA-3A. Scale bar, 20 µm.
|
|
As expected, sympathetic neurons transfected with a control plasmid
producing an inactive, myc-tagged Trk-B missing its kinase domain
respond normally to SEMA-3A. SEMA-3A induces a loss of motile growth
cones (Fig. 4A). A
similar dramatic collapsing effect is induced by SEMA-3A in sympathetic
cells expressing full-length neuropilin-1. SEMA-3A induces normal
collapse of sympathetic neurons expressing A-deletion neuropilin-1 as
well. In contrast, sympathetic neurons expressing B-deletion
neuropilin-1 are partially resistant to SEMA-3A-induced collapse. More
dramatically, sympathetic neurons expressing C-deletion neuropilin-1 do
not collapse to any significant degree when exposed to SEMA-3A.

View larger version (25K):
[in this window]
[in a new window]
|
Figure 4.
C-deletion neuropilin-1 is a dominant negative
receptor component for SEMA-3A. Sympathetic neurons were transfected
with the indicated constructs and then exposed to either control media
or media containing AP-SEMA-3A. After 35 min, the cultures were fixed,
and the percentage of myc-labeled neurites with growth cones were
counted. A, The addition of 10 c.u. of AP-SEMA-3A
induces collapse in growth cones expressing truncated Trk-B, full
length neuropilin-1, and cytoplasmic-deletion neuropilin-1. Growth
cones expressing C-deletion neuropilin-1 do not respond to SEMA-3A.
Expression of B-deletion neuropilin-1 caused a partial block of
SEMA-3A-induced collapse. B, Sympathetic neurons were
transfected with test constructs and then reaggregated. Growth cones
expressing truncated Trk-B, full-length neuropilin-1, and B-deletion
neuropilin-1 all collapse in response to AP-SEMA-3A. Growth cones
expressing C-deletion neuropilin-1 do not respond to SEMA-3A. The SEM
of three to eight experiments is shown for each condition.
*p 0.01; **p 0.001 by
Student's two-tailed t test. C,
Sympathetic neurons were transfected with either full-length or
C-deletion neuropilin-1 and then reaggregated. Ten, 30, or 100 c.u. of SEMA-3A induced growth cone collapse in
neuropilin-1-transfected neurons. Neurons transfected with C-deletion
neuropilin-1 did not respond to 10 or 30 c.u. of AP-SEMA-3A and
were partially responsive at 100 c.u. The concentration of SEMA-3A
required to induce 50% collapse of sympathetic neurons was shifted to
~100-fold higher concentrations by C-deletion neuropilin-1.
|
|
The percentage of neurites with recognizable growth cones in
dissociated sympathetic cultures is only ~50%. One possible
explanation for this relative paucity of growth cones is that they may
collapse on contact with other neuronal processes and with non-neuronal cells in these cultures (Ivins and Pittman, 1989 ). To decrease these
contacts, sympathetic cells were reaggregated after transfection and
plated as large clumps of cells. Neurites extend from these reaggregates in a manner similar to that observed from explanted sympathetic ganglia, whereas most non-neuronal cells remain associated with the reaggregates.
The effects of SEMA-3A on sympathetic neurons transfected with
full-length neuropilin-1, B-deletion, and C-deletion neuropilin-1, as
well as truncated Trk-B, were reexamined in this assay. As expected,
neither the Trk-B control nor the full-length neuropilin-1 constructs
affected SEMA-3A responsiveness (Fig. 4B). The
B-deletion neuropilin-1 construct that partially blocks SEMA-3A
activity in the dissociated assay has no detectable blocking effect in the reaggregate assay. This result suggests that any dominant negative
effect induced by the overexpression of this construct is weak and of
doubtful utility. The C-deletion neuropilin-1 construct strongly
suppresses SEMA-3A activity in the reaggregate assay. The ability of
C-deletion neuropilin-1 to suppress SEMA-3A activity in sympathetics
persists, even when very high concentrations of SEMA-3A are used. Fifty
percent responsiveness is shifted to 100-fold higher concentrations of
SEMA-3A when C-deletion neuropilin-1 is expressed in sympathetic
neurons with our expression vector (Fig. 4C). Thus,
C-deletion neuropilin-1 acts as a powerful dominant negative SEMA-3A receptor.
C-deletion neuropilin-1 blocks collapse of sympathetic growth cones
induced by SEMA-3C
SEMA-3C, like SEMA-3A, induces a dose-dependent collapse of
cultured sympathetic growth cones. Sympathetic neurons transfected with
the C-deletion or appropriate control constructs were tested for their
ability to respond to SEMA-3C. Sympathetic neurons transfected with
truncated Trk-B or full-length neuropilin-1 collapse normally when
exposed to 10 c.u. of SEMA-3C (Fig.
5A). Sympathetic neurons expressing C-deletion neuropilin-1 do not respond to SEMA-3C. These
results indicate that the C-deletion neuropilin-1 construct acts as a
dominant negative receptor component for both SEMA-3A and SEMA-3C and
suggests that neuropilin-1 may participate in signaling mediated by
each of these two ligands.

View larger version (24K):
[in this window]
[in a new window]
|
Figure 5.
C-deletion neuropilin-1 is a dominant negative
receptor component for SEMA-3C but not for SEMA-3F. Sympathetic
reaggregates were transfected with truncated Trk-B, full-length
neuropilin-1, or C-deletion neuropilin-1 and treated with 10 c.u.
of AP-SEMA-3C or 10 c.u. of AP-SEMA-3F. A, Growth
cones expressing truncated Trk-B or full-length neuropilin-1 collapse
when exposed to AP-SEMA-3C. Neurons expressing C-deletion neuropilin-1
do not respond to AP-SEMA-3C. B, Growth cones expressing
truncated Trk-B or C-deletion neuropilin-1 collapse normally in
response to AP-SEMA-3F. The SEM of four experiments is shown.
**p 0.001 by Student's two-tailed
t test.
|
|
C-deletion neuropilin-1 does not block collapse of sympathetic
growth cones induced by SEMA-3F
We have shown that C-deletion neuropilin-1 acts as a dominant
negative receptor for at least two secreted semaphorin family members.
SEMA-3F is another secreted semaphorin family member that induces the
collapse of sympathetic growth cones (Chen et al., 1997 ; Giger et al.,
1998b ). SEMA-3F-induced collapse is thought to be mediated not
by neuropilin-1 but by neuropilin-2 (Chen et al., 1998 ; Giger et al.,
1998b ; Takahashi et al., 1998 ). C-deletion neuropilin-1 was
therefore tested for its ability to prevent SEMA-3F-induced collapse of
sympathetic growth cones. Sympathetic neurons transfected with
truncated Trk-B or C-deletion neuropilin-1 collapse normally when
exposed to 10 c.u. of SEMA-3F (Fig. 5B). The C-deletion
neuropilin-1 construct therefore does not act as a dominant negative
receptor component for SEMA-3F, consistent with the proposal that
neuropilin-2 mediates SEMA-3F signaling without any involvement of
neuropilin-1.
C-deletion neuropilin-1 does not block collapse of sympathetic
growth cones induced by the semaphorin domain of SEMA-3A
Neuropilin-1 appears to have at least two binding sites for
SEMA-3A, one located in the b1 and b2 domains that bind the Ig-basic tail of SEMA-3A and at least one outside the b1 and b2 domains required
for the binding of the semaphorin domain (see above). The semaphorin
domain of SEMA-3A forms a biologically active dimer when made as a
fusion protein with an Fc fragment (Koppel and Raper, 1998 ). This
semaphorin domain dimer is ~30-fold less potent than full-length
SEMA-3A, presumably because it is missing the Ig-basic portion of
SEMA-3A that binds so strongly to the B domain of neuropilin-1.
Sympathetic neurons transfected with truncated Trk-B or C-deletion
neuropilin-1 collapse normally when exposed to 5 c.u. of the
Sema-Fc construct (Fig. 6). The
C-deletion neuropilin-1 construct therefore only acts as an effective
dominant negative receptor component when the SEMA-3A ligand contains
the Ig-basic domains.

View larger version (29K):
[in this window]
[in a new window]
|
Figure 6.
C-deletion neuropilin-1 is not a dominant negative
receptor component for collapse induced by the semaphorin domain of
SEMA-3A. Sympathetic reaggregates were transfected with truncated Trk-B
or C-deletion neuropilin-1 and treated with 5 c.u. of the
semaphorin domain from Sema-Fc. This truncated form of SEMA-3A that is
missing the Ig-basic domains induces growth cone collapse, even in
growth cones expressing C-deletion neuropilin-1. The SEM of four
experiments is shown for each condition.
|
|
 |
DISCUSSION |
Neuropilin-1 has been identified as a candidate receptor for
SEMA-3A (He and Tessier-Lavigne, 1997 ; Kolodkin et al., 1997 ). We have
generated a variety of neuropilin-1 deletion constructs and tested them
for both their ability to bind full-length and truncated forms of
SEMA-3A and their ability to interfere with SEMA-3A function in
sympathetic neurons.
Table 1 presents a compendium of the
results of our binding studies, along with the results of similar
experiments reported by others (Giger et al., 1998b ; Nakamura
et al., 1998 ). Although the neuropilin-1 and SEMA-3A constructs used by
the various groups are not always strictly comparable, several
interesting conclusions can be drawn. (1) Neither the A nor the C
domains of neuropilin-1 are required for full-length SEMA-3A binding.
(2) The same appears to be true for both the Ig and the basic portions
of SEMA-3A. (3) In contrast, neither the A nor the B domains of
neuropilin-1 appear to be required for the binding of the semaphorin
portion of SEMA-3A. These results suggest that the Ig-basic portion of SEMA-3A binds to the B domain, whereas the semaphorin portion of
SEMA-3A binds to the C domain. Further tentative conclusions can be
drawn about the necessity of smaller stretches of amino acids. The
amino acids 254-274 near the junction of the A and B domains of
neuropilin-1 appear to be essential for the binding of the Ig-basic
portion of SEMA-3A. It would also appear that the semaphorin portion of
SEMA-3A binds to sequences within the C domain that are exclusive of
the MAM domain. These findings reveal a complex multi-site interaction
between SEMA-3A and neuropilin-1.
The mechanism by which neuropilin-1 mediates semaphorin function is not
yet certain. Most simply, neuropilin-1 could act as a simple type I
receptor in which the binding of ligand to the extracellular portion of
neuropilin-1 causes the direct activation of an intracellular signaling
pathway via the cytoplasmic tail. Alternatively, neuropilin-1 could be
an essential component of one or more receptor complexes, each of which
is activated by specific semaphorin ligands (Feiner et al., 1997 ). The
primary objective of this work was to generate a dominant negative
neuropilin-1 that could be used to help distinguish between these
possibilities. Our results are consistent with the hypothesis
that neuropilin-1 binds specific semaphorins and then presents them to
additional receptor components that initiate signal transduction.
If neuropilin-1 were a simple type I receptor (Fig.
7A), then it is reasonably
straightforward to predict the kinds of truncations that are likely to
generate dominant negative variants. Previous experiments with type I
receptors have shown that the deletion of their cytoplasmic domains
generally makes a dominant negative receptor. When overexpressed in
cells that would normally respond to a ligand, the truncated receptor
interferes with normal receptor function by either sequestering ligand
on inactive receptors (Ross et al., 1997 ; Moriggl et al., 1998 ) or
forming inactive multimers with wild-type receptors (Ueno et al.,
1993 ; Perrot-Applanat et al., 1997 ). Alternatively,
overexpression of receptor variants in which the cytoplasmic domains
are intact and extracellular domains are missing can sometimes generate
dominant negative receptors that sequester downstream signaling
components in an inactive complex (Dosil et al., 1998 ; Maruyama et al.,
1998 ).

View larger version (20K):
[in this window]
[in a new window]
|
Figure 7.
Models for how neuropilin-1 could be involved in
Semaphorin signaling. A, Neuropilin-1 is unlikely to be
acting as a type I receptor. Semaphorin signaling is more likely to
involve a second component. Additional factor(s) may be present as
preformed complexes with neuropilin-1 on the cell surface
(B) or may be recruited into the
neuropilin-semaphorin complex after ligand binding
(C). Together, our data are most consistent with
the third model.
|
|
We therefore constructed truncated versions of neuropilin-1 missing
either the cytoplasmic or all extracellular domains. Neuropilin-1 missing the cytoplasmic domain reaches the cell surface and binds AP-SEMA-3A, suggesting that the presence or absence of the cytoplasmic domain does not affect its ability to bind ligand. Expression of
neuropilin-1 missing the cytoplasmic domain in cultured sympathetic neurons does not alter their responsiveness to SEMA-3A. It therefore does not interfere with the functional activity of endogenous neuropilin-1 and does not act as a dominant negative receptor. Similarly, a variant of neuropilin-1 that includes only its
transmembrane and cytoplasmic portions reaches the surface of
sympathetic neurons but does not alter their responsiveness to SEMA-3A
(M. J. Renzi, unpublished data; data not shown).
These results argue strongly that neuropilin-1 is unlikely to act as a
type I receptor. Further evidence supporting this conclusion is the
recent observation that SEMA-3A responsiveness can be conferred on
otherwise unresponsive retinal ganglion cell axons by the expression of
either full-length neuropilin-1 or a variant of neuropilin-1 in which
the cytoplasmic domain is missing (Nakamura et al., 1998 ; Takahashi et
al., 1998 ).
These findings suggest that neuropilin-1 interacts with an additional
receptor component that in turn initiates signal transduction. This
conclusion is further strengthened by our surprising finding that a
version of neuropilin-1 missing its extracellular C domain blocks the
response of sympathetic neurons to SEMA-3A. There are several
mechanisms by which this variant could act as a dominant negative
receptor component. The deleted portion of the molecule contains within
it a single MAM-like domain. MAM domains have been shown to be involved
in protein-protein interactions. Several studies have implicated MAM
domains in the formation of homodimeric complexes of receptor proteins
(Zondag et al., 1995 ; Marchand et al., 1996 ), and recent evidence
indicates that the MAM domains in neuropilins cause them to associate
with one another in a ligand-independent manner (Chen et al., 1998 ;
Giger et al., 1998b ; Takahashi et al., 1998 ). One possible
explanation for our finding is that C-deletion neuropilin-1 binds
SEMA-3A into incompletely organized receptor complexes that are not
functional. The association of neuropilin-1 with itself, with
neuropilin-2, or with an as yet unknown receptor component could be
prevented by the absence of the C domain.
An alternative model could explain how C-deletion neuropilin-1 acts as
a dominant negative receptor component for SEMA-3A. Previous studies
demonstrate that the semaphorin domain contains a short stretch of
sequence that determines the biological specificity of each secreted
semaphorin, and it is possible that this sequence triggers signaling
activity when presented by neuropilin-1 to a nearby transducing
molecule (Koppel et al., 1997 ). The Ig-basic domains of SEMA-3A bind to
the B domain of neuropilin-1, whereas the semaphorin domain of SEMA-3A
binds outside the B domain (Chen et al., 1998 ; Giger et al.,
1998b ; Nakamura et al., 1998 ; and this paper). Our data
indicate that semaphorin domain binding is greatly reduced in the
absence of the C domain. This suggests that the C domain contributes to
a semaphorin domain binding site. A comparison of our binding data with
those of Giger et al. (1998b) suggests that this semaphorin
domain binding site must be outside the MAM domain. It is possible
that, in the absence of this site, the semaphorin domain of SEMA-3A is
incapable of activating the signal transducing component, because
either it is mispositioned when bound to neuropilin-1 or it fails to
assume a required conformational configuration. C-deletion neuropilin-1
would then block SEMA-3A activity by binding the ligand but failing to
present it properly to a transducing receptor component.
Both of these models predict that neuropilin-1 must interact with
additional receptor components to form a functional receptor. However,
are these components preassembled with neuropilin-1 (Fig. 7B) or are they recruited after neuropilin-1 binds its
ligand (Fig. 7C)? Our data are consistent with the latter
model. This conclusion is inferred from the observation that, although
C-deletion neuropilin-1 acts as a dominant negative receptor component
for full-length SEMA-3A, it does not interfere with the action of the
Sema-Fc fusion protein.
The failure of C-deletion neuropilin-1 to block the activity of this
truncated ligand implies that Sema-Fc can either (1) act directly on
the presumptive transducing receptor component or (2) use native
full-length neuropilin-1 on the cell surface to access the transducer.
The first of these possibilities is unlikely because the presence of
neuropilin-1 has been shown to be absolutely required for full-length
SEMA-3A to induce collapse (Kitsukawa et al., 1997 ; Chen et al., 1998 ;
Giger et al., 1998b ). This result suggests that the presumptive
transducing receptor component cannot be activated without the
cooperation of neuropilin-1. Sema-Fc should therefore be unable to
activate a transducing receptor component directly. Our data show that
the C-deletion neuropilin-1 we engineered does not bind and therefore
cannot sequester Sema-Fc. We therefore hypothesize that Sema-Fc instead
interacts, as it normally would, with native neuropilin-1 that is still
present on sympathetic neurons overexpressing C-deletion neuropilin-1. The native neuropilin-1 then presents Sema-Fc to the presumptive transducing receptor component. This could only happen if native neuropilin-1 still has access to the transducing receptor component. This then implies that overexpressed C-deletion neuropilin-1 is not
preassembled with, and therefore does not prevent access of native
neuropilin-1 to, the transducer. A model consistent with these
observations is that neuropilin-1 does not preassemble with the
transducing component but recruits the transducing unit after SEMA-3A
is bound.
We previously proposed that neuropilin-1 acts as a common component of
receptor complexes that are specific for different secreted semaphorins
(Feiner et al., 1997 ). If so, then C-deletion neuropilin-1 should act
as a dominant negative receptor component for more than one secreted
semaphorin. Sympathetic neurons are known to be responsive to at least
three secreted semaphorins: SEMA-3A, SEMA-3C, and SEMA-3F. C-deletion
neuropilin-1 effectively blocks the collapse of sympathetic growth
cones induced by SEMA-3A and SEMA-3C but does not block collapse
induced by SEMA-3F. These results demonstrate that C-deletion
neuropilin-1 is specific in its dominant negative effects and is
unlikely to act through nonspecific artifactual mechanisms. These
results are also consistent with our original hypothesis that
neuropilin-1 acts as a receptor component for multiple secreted
semaphorins but demonstrates that is not involved in the activities of all.
The information currently available suggests that the specificity of
the response of a neuron to particular secreted semaphorins is
partially or even wholly determined by the combination of neuropilins present on its cell surface. Neuropilins form ligand-independent dimers. Homodimers have been shown to form when either neuropilin-1 or
neuropilin-2 are expressed alone, and heterodimers have been shown to
form when neuropilin-1 and neuropilin-2 are expressed together
(Kitsukawa et al., 1997 ; Chen et al., 1998 ; Giger et al.,
1998b ; Takahashi et al., 1998 ). Several lines of experimental evidence are consistent with a model in which the expression of neuropilin-1 homodimers confer responsiveness to SEMA-3A, neuropilin-2 homodimers confer responsiveness to SEMA-3F, and neuropilin-1/2 heterodimers confer responsiveness to SEMA-3C. One line of evidence is
that responsiveness can be altered in predictable ways by the overexpression of neuropilins in primary neurons. For example, only
neuropilin-1 is normally expressed in DRG neurons, and they are
sensitive to SEMA-3A but not to SEMA-3C or SEMA-3F. Transfection of
neuropilin-2 into DRGs makes them, like sympathetic neurons in which
both neuropilin-1 and neuropilin-2 are normally expressed, sensitive to
all three of these semaphorins (Giger et al., 1998b ; Takahashi
et al., 1998 ). Another line of evidence is that responsiveness can be
altered in predictable ways by incubating sympathetic neurons with
neuropilin-1- and neuropilin-2-specific antibodies. Antibodies against
neuropilin-1 block responsiveness to SEMA-3A and reduce responsiveness
to SEMA-3C, whereas antibodies against neuropilin-2 block
responsiveness to SEMA-3F (Chen et al., 1998 ; Giger et al., 1998b ). Finally, overexpression of C-deletion neuropilin-1 in sympathetic neurons specifically blocks responsiveness to SEMA-3A and
SEMA-3C, indicating that sensitivity to each is neuropilin-1-dependent. C-deletion neuropilin-1 does not affect responsiveness to SEMA-3F, however, consistent with the expectation that SEMA-3F sensitivity is
mediated solely by neuropilin-2 homodimers.
What is the nature of the missing receptor component(s) that, along
with neuropilin-1, forms a functional semaphorin receptor? It is
interesting to note that neuropilin-1 also binds the chemoattractant vascular endothelial growth factor (VEGF) (Soker et al., 1998 ). VEGF
can activate the transmembrane tyrosine kinase KDR directly, but when neuropilin-1 is present, VEGF activation of KDR is
potentiated. VEGF has no chemoattractant effect on cells expressing
neuropilin-1 alone. Thus, just as we propose to be the case for growth
cone collapse, neuropilin-1 only acts in endothelial chemotaxis through an additional transducing receptor component.
A striking difference between the role of neuropilin-1 in growth cone
collapse and endothelial chemotaxis, however, is that neuropilin-1 is
essential for inducing growth cone collapse but not for kinase insert
domain-containing receptor (KDR) activation in chemotaxis. For this
reason, neuropilin-1 may interact with a signal transducing receptor
component in growth cone collapse, just as the interleukin-6 receptor
(IL-6R) interacts with its signal-transducing component gp130 (Taga et
al., 1989 ). The IL-6 receptor by itself is unable to transduce a
signal. IL-6 binding to the IL-6 receptor causes the recruitment of a
third component, gp130, that is responsible for signal transduction. As
with neuropilin-1, a truncated form of the IL-6 receptor that is
missing its cytoplasmic domain fails to act as a dominant negative
receptor component. This truncated IL-6 receptor is functionally intact
and retains the ability to interact with gp130. Interestingly, gp130
transduces signals mediated by several different cytokines that first
bind to additional, specific receptors (Davis et al., 1993 ). By
analogy, the missing semaphorin receptor element could be a common
signal-transducing protein that is recruited and activated by
neuropilins once they bind their ligand.
A dominant negative form of neuropilin-1 may be of considerable
practical use in studying the role semaphorins play in growth cone
guidance. If semaphorins have overlapping functions in vivo, as seems likely from their overlapping patterns of expression (Adams et
al., 1996 ; Shepherd et al., 1996 ; Giger et al., 1998b ), their
ability to share at least one receptor component (Feiner et al., 1997 ),
and their similar biological activities (Koppel et al., 1997 ), then the
analysis of animals in which any one of them is knocked out may be
relatively uninformative. One way to avoid this difficulty would be to
examine axon trajectories in animals missing the shared receptor
component neuropilin-1. However, neuropilin-1 knock-out embryos die
before the formation of many of the projections likely to be affected.
Overexpression of a dominant negative neuropilin-1 in older embryos
will provide a very useful alternative to a knock-out strategy.
 |
FOOTNOTES |
Received March 22, 1999; revised June 23, 1999; accepted June 24, 1999.
This work was supported by National Institutes of Health Grant
RO1-NS-26527 to J.A.R. and Training Grant T32HD07516 to M.J.R. and
L.F.
Correspondence should be addressed to Dr. Jonathan A. Raper, University
of Pennsylvania, School of Medicine, 215 Stemmler Hall, 36th and
Hamilton Walk, Philadelphia, PA 19104.
 |
REFERENCES |
-
Adams RH,
Betz H,
Puschel AW
(1996)
A novel class of murine semaphorins with homology to thrombospondin is differentially expressed during early embryogenesis.
Mech Dev
57:33-45[ISI][Medline].
-
Adams RH,
Lohrum M,
Klostermann A,
Betz H,
Puschel AW
(1997)
The chemorepulsive activity of secreted semaphorins is regulated by furin-dependent proteolytic processing.
EMBO J
16:6077-6086[ISI][Medline].
-
Baird JL,
Raper JA
(1995)
A serine proteinase involved in contact mediated repulsion of retinal growth cones by DRG neurites.
J Neuroscience
15:6605-6618[Abstract/Free Full Text].
-
Beckmann G,
Bork P
(1993)
An adhesive domain detected in functionally diverse receptors.
Trends Biochem Sci
18:40-41[ISI][Medline].
-
Behar O,
Golden JA,
Mashimo H,
Schoen FJ,
Fishman MC
(1996)
Semaphorin III is needed for normal patterning and growth of nerves, bones and heart.
Nature
383:525-528[Medline].
-
Chen H,
Chedotal A,
He Z,
Goodman CS,
Tessier-Lavigne M
(1997)
Neuropilin-2, a novel member of the neuropilin family, is a high affinity receptor for the semaphorins Sema E and Sema IV but not Sema III.
Neuron
19:547-559[ISI][Medline].
-
Chen H,
He Z,
Bagri A,
Tessier-Lavigne M
(1998)
Semaphorin-neuropilin interactions underlying sympathetic axon responses to class III semaphorins.
Neuron
21:1283-1290[ISI][Medline].
-
Davis S,
Aldrich TH,
Stahl N,
Pan L,
Taga T,
Kishimoto T,
Ip NY,
Yancopoulos GD
(1993)
LIFR
and gp130 as heterodimerizing signal transducers of the tripartite CNTF receptor.
Science
260:1805-1808[Abstract/Free Full Text]. -
Dosil M,
Giot L,
Davis C,
Konopka JB
(1998)
Dominant-negative mutations in the G-protein-coupled
-factor receptor map to the extracellular ends of the transmembrane segments.
Mol Cell Biol
18:5981-5991[Abstract/Free Full Text]. -
Feiner L,
Koppel AM,
Kobayashi H,
Raper JA
(1997)
Secreted chick semaphorins bind recombinant neuropilin with similar affinities but bind different subsets of neurons in situ.
Neuron
19:539-545[ISI][Medline].
-
Giger RJ,
Pasterkamp RJ,
Heijnen S,
Holtmaat AJ,
Verhaagen J
(1998a)
Anatomical distribution of the chemorepellent semaphorin III/collapsin-1 in the adult rat and human brain: predominant expression in structures of the olfactory-hippocampal pathway and motor system.
J Neurosci Res
52:27-42[ISI][Medline].
-
Giger RJ,
Urquhart ER,
Gillespie SK,
Levengood DV,
Ginty DD,
Kolodkin AL
(1998b)
Neuropilin-2 is a receptor for semaphorin IV: insight into the structural basis of receptor function and specificity.
Neuron
21:1079-1092[ISI][Medline].
-
Hallak H,
Brass LF,
Manning DR
(1994)
Failure to myristolate the a subunit of GZ is correlated with an inhibition of palmitoylation and membrane attachment, but has no affect on phosphorylation by protein kinase C.
J Biol Chem
269:4571-4576[Abstract/Free Full Text].
-
He Z,
Tessier-Lavigne M
(1997)
Neuropilin is a receptor for the axonal chemorepellent semaphorin III.
Cell
90:739-751[ISI][Medline].
-
Ivins JK,
Pittman RN
(1989)
Growth cone-growth cone interactions in cultures of rat sympathetic neurons.
Dev Biol
135:147-157[Medline].
-
Kitsukawa T,
Shimizu M,
Sanbo M,
Hirata T,
Taniguchi M,
Bekku Y,
Yagi T,
Fujisawa H
(1997)
Neuropilin-semaphorin III/D-mediated chemorepulsive signals play a crucial role in peripheral nerve projection in mice.
Neuron
19:995-1005[ISI][Medline].
-
Kobayashi H,
Koppel AM,
Luo Y,
Raper JA
(1997)
A role for collapsin-1 in olfactory and cranial sensory axon guidance.
J Neurosci
17:8339-8352[Abstract/Free Full Text].
-
Kolodkin AL,
Levengood DV,
Rowe EG,
Tai YT,
Giger RJ,
Ginty DD
(1997)
Neuropilin is a semaphorin III receptor.
Cell
90:753-762[ISI][Medline].
-
Koppel AM,
Raper JA
(1998)
Collapsin-1 covalently dimerizes, and dimerization is necessary for collapsing activity.
J Biol Chem
273:15708-15713[Abstract/Free Full Text].
-
Koppel AM,
Feiner L,
Kobayashi H,
Raper JA
(1997)
A 70 amino acid region within the semaphorin domain activates specific cellular response of semaphorin family members.
Neuron
19:531-537[ISI][Medline].
-
Luo Y,
Raible D,
Raper JA
(1993)
Collapsin: a protein in brain that induces the collapse and paralysis of neuronal growth cones.
Cell
75:217-227[ISI][Medline].
-
Marchand P,
Volkmann M,
Bond JS
(1996)
Cysteine mutations in the MAM domain result in monomeric meprin and alter stability and activity of the proteinase.
J Biol Chem
271:24236-24241[Abstract/Free Full Text].
-
Maruyama K,
Endoh H,
Sasaki-Iwaoka H,
Kanou H,
Shimaya E,
Hashimoto S,
Kato S,
Kawashima H
(1998)
A novel isoform of rat estrogen receptor
with 18 amino acid insertion in the ligand binding domain as a putative dominant negative regular of estrogen action.
Biochem Biophys Res Commun
246:142-147[ISI][Medline]. -
Messersmith EK,
Leonardo ED,
Shatz CJ,
Tessier-Lavigne M,
Goodman CS,
Kolodkin AL
(1995)
Semaphorin III can function as a selective chemorepellent to pattern sensory projections in the spinal cord.
Neuron
14:949-959[ISI][Medline].
-
Moriggl R,
Erhardt I,
Kammer W,
Berchtold S,
Schnarr B,
Lischke A,
Groner B,
Friedrich K
(1998)
Activation of STAT6 is not dependent on phosphotyrosine-mediated docking to the interleukin-4 receptor and can be blocked by dominant-negative mutants of both receptor subunits.
Eur J Biochem
251:25-35[ISI][Medline].
-
Nakamura F,
Tanaka M,
Takahashi T,
Kalb RG,
Strittmatter SM
(1998)
Neuropilin-1 extracellular domains mediate semaphorin D/III-induced growth cone collapse.
Neuron
21:1093-1100[ISI][Medline].
-
Perrot-Applanat M,
Gualillo O,
Pezet A,
Vincent V,
Edery M,
Kelly PA
(1997)
Dominant negative and cooperative effects of mutant forms of prolactin receptor.
Mol Endocrinol
11:1020-1032[Abstract/Free Full Text].
-
Ross RJ,
Esposito N,
Shen XY,
Von Laue S,
Chew SL,
Dobson PR,
Postel-Vinay MC,
Finidori J
(1997)
A short isoform of the human growth hormone receptor functions as a dominant negative inhibitor of the full-length receptor and generates large amounts of binding protein.
Mol Endocrinol
11:265-273[Abstract/Free Full Text].
-
Shepherd I,
Luo Y,
Raper JA,
Chang S
(1996)
The distribution of collapsin-1 mRNA in the developing chick nervous system.
Dev Biol
173:185-199[ISI][Medline].
-
Shepherd IT,
Luo Y,
Lefcort F,
Reichardt LF,
Raper JA
(1997)
A sensory axon repellent secreted from ventral spinal cord explants is neutralized by antibodies raised against collapsin-1.
Development
124:1377-1385[Abstract].
-
Soker S,
Takashima S,
Miao HQ,
Neufeld G,
Klagsbrun M
(1998)
Neuropilin-1 is expressed by endothelial and tumor cells as an isoform-specific receptor for vascular endothelial growth factor.
Cell
92:735-745[ISI][Medline].
-
Taga T,
Hibi M,
Hirata Y,
Yamasaki K,
Yasukawa K,
Matsuda T,
Hirano T,
Kishimoto T
(1989)
Interleukin-6 triggers the association of its receptor with a possible signal transducer, gp130.
Cell
58:573-581[ISI][Medline].
-
Takahashi T,
Nakamura F,
Jin Z,
Kalb RG,
Strittmatter SM
(1998)
Semaphorins A and E act as antagonists of neuropilin-1 and agonists of neuropilin-2 receptors.
Nat Neurosci
1:487-493.[ISI][Medline]
-
Takagi S,
Hirata T,
Agata K,
Mochii M,
Eguchi G,
Fujisawa H
(1991)
The A5 antigen, a candidate for the neuronal recognition molecule, has homologies to complement components and coagulation factors.
Neuron
7:295-307[ISI][Medline].
-
Takagi S,
Kasuya Y,
Shimizu M,
Matsuura T,
Tsuboi M,
Kawakami A,
Fujisawa H
(1995)
Expression of a cell adhesion molecule, neuropilin, in the developing chick nervous system.
Dev Biol
170:207-222[ISI][Medline].
-
Taniguchi M,
Yuasa S,
Fujisawa H,
Naruse I,
Saga S,
Mishina M,
Yagi T
(1997)
Disruption of semaphorin III/D gene causes severe abnormality in peripheral nerve projection.
Neuron
19:519-530[ISI][Medline].
-
Ueno H,
Escobedo JA,
Williams LT
(1993)
Dominant-negative mutations of platelet-derived growth factor (PDGF) receptors. Inhibition of receptor function by ligand-dependent formation of heterodimers between PDGF
- and -receptors.
J Biol Chem
268:22814-22819[Abstract/Free Full Text]. -
Varela-Echavarria A,
Tucker A,
Puschel AW,
Guthrie S
(1997)
Motor axon subpopulations respond differentially to the chemorepellents netrin-1 and semaphorin D.
Neuron
18:193-207[ISI][Medline].
-
Zondag GC,
Koningstein GM,
Jiang YP,
Sap J,
Moolenaar WH,
Gebbink MF
(1995)
Homophilic interactions mediated by receptor tyrosine phosphatases µ and
. A critical role for the novel extracellular MAM domain.
J Biol Chem
270:14247-14250[Abstract/Free Full Text].
Copyright © 1999 Society for Neuroscience 0270-6474/99/19187870-11$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
S. Curreli, Z. Arany, R. Gerardy-Schahn, D. Mann, and N. M. Stamatos
Polysialylated Neuropilin-2 Is Expressed on the Surface of Human Dendritic Cells and Modulates Dendritic Cell-T Lymphocyte Interactions
J. Biol. Chem.,
October 19, 2007;
282(42):
30346 - 30356.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Geretti, A. Shimizu, P. Kurschat, and M. Klagsbrun
Site-directed Mutagenesis in the B-Neuropilin-2 Domain Selectively Enhances Its Affinity to VEGF165, but Not to Semaphorin 3F
J. Biol. Chem.,
August 31, 2007;
282(35):
25698 - 25707.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Banu, J. Teichman, M. Dunlap-Brown, G. Villegas, and A. Tufro
Semaphorin 3C regulates endothelial cell function by increasing integrin activity
FASEB J,
October 1, 2006;
20(12):
2150 - 2152.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. K. Atwal, K. K. Singh, M. Tessier-Lavigne, F. D. Miller, and D. R. Kaplan
Semaphorin 3F Antagonizes Neurotrophin-Induced Phosphatidylinositol 3-Kinase and Mitogen-Activated Protein Kinase Kinase Signaling: A Mechanism for Growth Cone Collapse
J. Neurosci.,
August 20, 2003;
23(20):
7602 - 7609.
[Abstract]
[Full Text]
[PDF]
| |