 |
Previous Article | Next Article 
The Journal of Neuroscience, October 1, 1999, 19(19):8199-8206
Ceramide Signaling Downstream of the p75 Neurotrophin Receptor
Mediates the Effects of Nerve Growth Factor on Outgrowth of Cultured
Hippocampal Neurons
Adi B.
Brann1,
Randolph
Scott1, 2,
Yael
Neuberger1, 2,
Denise
Abulafia1, 2,
Swetlana
Boldin1,
Michael
Fainzilber1, 2, and
Anthony H.
Futerman1
1 Department of Biological Chemistry,
2 Molecular Neurobiology Group, Weizmann Institute of
Science, Rehovot 76100, Israel
 |
ABSTRACT |
The p75 neurotrophin receptor (p75NTR) binds all known
neurotrophins and has been suggested to either function as a coreceptor for the trk receptor tyrosine kinases or be involved in independent signaling leading to cell death. We have analyzed the effects of nerve
growth factor (NGF) on the growth of cultured hippocampal pyramidal
neurons and examined the possibility that the effects of NGF are
mediated via generation of ceramide produced by neutral sphingomyelinase (N-SMase). During the initial hour of culture, the
only detectable NGF receptor is p75NTR, which by comparative Western
blot is expressed at 50- to 100-fold lower levels than on PC12 cells.
At this early stage of culture, NGF accelerates neurite formation and
outgrowth and induces ceramide formation in a dose-dependent manner. An
NGF mutant that is deficient in p75NTR binding has no effect on
neuronal morphology or ceramide formation. Furthermore, two anti-p75NTR
antibodies (REX and 9651), which are known to compete with NGF
for binding to p75NTR, mimic the effects of NGF, whereas a monoclonal
antibody (MC192) targeted against a different epitope does not.
Finally, scyphostatin, a specific N-SMase inhibitor, blocks the effects
of NGF. We propose that a neurotrophin-p75NTR-ceramide signaling
pathway influences outgrowth of hippocampal neurons. This signaling
role of p75NTR may be distinct from other signaling pathways that lead
to apoptosis.
Key words:
neurotrophins; NGF; p75NTR; ceramide; sphingomyelin; neurons; axons
 |
INTRODUCTION |
Neurotrophic factors are polypeptide
growth factors with activity and expression profiles mainly, if not
exclusively, targeted to the nervous system. The paradigmal family of
neurotrophic factors are the neurotrophins (Thoenen, 1991 ). All
neurotrophins interact with two receptor types, the shared p75
neurotrophin receptor (p75NTR) (Chao, 1994 ) and discriminative receptor
tyrosine kinases of the trk family (Barbacid, 1995 ). Although it is
well established that the trk receptors are crucial in mediating the
survival role of neurotrophins (Barbacid, 1995 ), the functions of
p75NTR are still a matter of some debate. p75NTR has been proposed to
act as a coreceptor for the trks (Barker and Shooter, 1994 ;
Hantzopoulos et al., 1994 ; Chao and Hempstead, 1995 ; Huber and
Chao, 1995 ) or to initiate independent signaling pathways. The most
prominent trk-independent activity proposed for p75NTR is regulation of cell death (Casaccia-Bonnefil et al., 1996 ; Frade et al., 1996 ; Bredesen and Rabizadeh, 1997 ; Majdan et al., 1997 ; Bamji et al., 1998 ).
Other p75-mediated activities have been proposed, including influencing
the migration of Schwann cells (Anton et al., 1994 ), enhancing synaptic
transmission (Blochl and Sirrenberg, 1996 ), regulating the functions of
sensory neurons (Stucky and Koltzenburg, 1997 ), regulating myogenic
differentiation (Seidl et al., 1998 ), and modulating calcium currents
(Jiang et al., 1997 ). The proximal effectors and signaling pathways
mediating these diverse effects have not been elucidated.
One potential signaling mechanism for p75NTR involves the membrane
lipid ceramide (Cer). Over the past decade, it has become apparent that ceramide, when produced by the regulated hydrolysis of
sphingomyelin (SM), acts as a second messenger in a variety of
signaling pathways (Spiegel et al., 1996 ; Liu et al., 1997 ; Kolesnick
and Kronke, 1998 ). It has also been shown that SM hydrolysis is induced
by all four mammalian neurotrophins after binding to p75NTR,
independent of trk activation (Dobrowsky et al., 1994 , 1995 ). These
observations, coupled with the diverse effects observed for ceramide in
cultured postmitotic neurons (Schwarz et al., 1995 ; de Chaves et al.,
1997 ; Furuya et al., 1998 ; Irie and Hirabayashi, 1998 ), provide a
rationale for examining the possibility that the activity of p75NTR in
neurons might be mediated by ceramide.
Specific impetus for the current work was provided by a previous study
examining the effects of ceramide on one specific facet of the growth
of cultured hippocampal neurons (Schwarz and Futerman, 1997 ). The
in vitro development of hippocampal neurons, cultured according to protocols developed by Banker and colleagues (Goslin et
al., 1998 ), has been divided into a number of well-characterized stages
(Dotti et al., 1988 ). Immediately after plating on glass coverslips,
the neurons display many lamellipodia around the cell body (stage 1).
The second stage of growth is marked by extension of a number of short
processes, designated "minor processes" (stage 2). After some
hours, one of the minor processes starts to grow rapidly and develops
axonal characteristics (stage 3). Ceramide plays two distinct roles
during these initial stages of growth, depending on its concentration
(Schwarz and Futerman, 1997 ). The formation of minor neuronal processes
from lamellipodia can be stimulated by incubation with low
concentrations of short-acyl chain analogs of ceramide or by generation
of endogenous ceramide by incubation with exogenously added
sphingomyelinase (SMase); in contrast, high concentrations of ceramide
induce apoptosis. The purpose of the current study was to investigate
the growth-promoting effects of low concentrations of ceramide and
specifically to determine whether these effects are mediated via
activation of the p75NTR.
 |
MATERIALS AND METHODS |
Materials. Mouse 2.5S NGF was purchased from Promega
(Madison, WI),
N-{6-[(7-nitrobenzo-2-oxa-1,3-diazol-4-yl)amino]hexanoyl}-D-erythro-sphingosylphosphorylcholine (C6-NBD-SM) was from Molecular Probes (Eugene,
OR), and the monoclonal anti-p75 antibody MC192 was from Boehringer
Mannheim (Indianapolis, IN). The following reagents were provided as
indicated: the NGF triple mutant was from C. F. Ibanez (Karolinska
Institute, Stockholm, Sweden); the REX anti-p75 antibody was from G. Weskamp and L. Reichardt (University of California, San Francisco, CA);
the 9651 anti-p75 antibody was from M. Chao (Skirball Institute, New
York, NY); and scyphostatin was from T. Ogita (Sankyo Ltd., Tokyo,
Japan). Other chemicals were from Sigma (St. Louis, MO), and solvents (analytical grade) were from Bio-Lab Laboratories Ltd. (Jerusalem, Israel).
Hippocampal cultures. Hippocampal neurons were cultured at
low density as described previously (Goslin et al., 1998 ) with some
modifications (Harel and Futerman, 1993 ; Schwarz et al., 1995 ; Schwarz
and Futerman, 1997 ). Briefly, the dissected hippocampi of embryonic day
18 (E18) rats (Wistar), obtained from the Weizmann Institute
Breeding Center, were dissociated by trypsinization (0.25% w/v, for 15 min at 37°C). The tissue was washed in
Mg2+-Ca2+-free
HBSS (Life Technologies, Gaithersburg, MD) and
dissociated by repeated passage through a constricted Pasteur pipette.
Cells were plated in minimal essential medium (MEM) with 10% horse
serum at a density of 6000 or 12,000 cells per 13 mm glass coverslip that had been precoated with poly-L-lysine (1 mg/ml). After 2-4 hr, coverslips were transferred into 24-well
multidishes (Nunc, Naperville, IL) containing a monolayer of astroglia.
Coverslips were placed with the neurons facing downward and were
separated from the glia by paraffin "feet." Cultures were
maintained in serum-free medium (MEM), which included N2 supplements
(Goslin et al., 1998 ), ovalbumin (0.1%, w/v) and pyruvate (0.1 mM). In some experiments, neurons were analyzed
before plating ("preplated neurons"), and in others, neurons were
transferred into multiwell dishes that did not contain a glial
monolayer but contained glial-conditioned medium (obtained from
parallel dishes that contained a glial monolayer). Neurons cultured at
high density (230,000 cells per 24 mm glass coverslip in 100 mm petri
dishes) were used for biochemical analyses (Hirschberg et al., 1996 ;
Schwarz and Futerman, 1997 ).
Analysis of neuronal morphology. For morphological analysis,
coverslips were removed from the 24-well multidishes, and neurons were
fixed in 1% (v/v) glutaraldehyde in PBS for 20 min at 37°C and mounted for microscopic examination in 50% glycerol in PBS. Neurons were examined by phase-contrast microscopy using an Achroplan 32× 0.4 NA phase two objective of a Zeiss (Oberkochen, Germany) Axiovert 35 microscope. Neuronal growth was analyzed based on the
developmental criteria of Dotti et al. (1988) . The number of cells in
stages 1, 2, and 3 was analyzed; a cell was considered to be in stage 3 when the major axonal process was 30 µm (i.e., ~10 µm longer
than the next longest minor process (Goslin and Banker, 1989 ; Schwarz
and Futerman, 1997 ).
SMase activity in vitro. Hippocampal neurons were incubated
with a short-acyl chain derivative of SM,
C6-NBD-SM, previously used to assay SMase
activity in various cells and cell homogenates (Koval and Pagano, 1989 ,
1991 ; Futerman et al., 1990 ; Futerman and Pagano, 1992 ). Neurons were
collected before plating and homogenized in TK buffer (50 mM Tris, pH 7.4, and 25 mM
KCl) for assay of neutral SMase (N-SMase) activity or in MES
buffer (2-[N-morpholino]ethanesulfonic acid), pH
4.7, for assay of acid SMase (A-SMase) activity (Futerman et al., 1990 ). After determination of protein concentration (Bradford, 1976 ), homogenates were incubated with C6-NBD-SM
(added as an equimolar complex with BSA (Pagano and Martin, 1994 ) at
37°C for various times. The reaction was terminated by addition of
CHCl3/CH3OH (1:2, v/v),
lipids were extracted (Bligh and Dyer, 1959 ) and separated by
thin-layer chromatography (TLC) using
CHCl3/CH3OH/9.8
mM CaCl2 (60:35:8, v/v/v)
as the developing solvent and identified using authentic standards. For
quantification of NBD fluorescence, lipids were recovered from the TLC
plates by scraping, followed by extraction (Bligh and Dyer, 1959 ), and
NBD fluorescence (excitation, 467 nm; emission, 520 nm) was
measured using a Perkin-Elmer (Emeryville, CA) LS-5B luminescence
spectrometer. Background fluorescence in the area corresponding to
C6-NBD-Cer was measured by incubating with the
same concentration of C6-NBD-SM in the absence of
neuronal homogenates, extracting, separating by TLC, scraping the area corresponding to C6-NBD-Cer, and subtracting from
C6-NBD-Cer fluorescence in the corresponding
experimental lane.
SMase activity in vivo. Neurons were plated at a density of
230,000 cells per 24 mm coverslip (Hirschberg et al., 1996 ) and incubated with C6-NBD-SM (dissolved in EtOH) for
1 hr before addition of NGF. After various times of incubation with
NGF, cells were removed from the coverslips by scraping with a rubber
policeman into ice-cold distilled water and lyophilized.
C6-NBD lipids were extracted and analyzed as
described above.
C6-NBD-Cer is able to exit its site(s) of
formation from C6-NBD-SM (Koval and Pagano, 1989 )
and accumulate in the Golgi apparatus in which it is metabolized to
C6-NBD-glucosylceramide
(C6-NBD-GlcCer) (Futerman and Pagano, 1991 ) and
resynthesized to C6-NBD-SM (Futerman et al.,
1990 ). Therefore, in our analysis of C6-NBD-Cer
formation, we added the amount of C6-NBD-GlcCer
formed (C6-NBD-GlcCer can only be formed from
C6-NBD-Cer) to that of
C6-NBD-Cer. In addition, C6-NBD-Cer can be metabolized back to
C6-NBD-SM. Because newly synthesized
C6-NBD-SM cannot be distinguished from
exogenously added C6-NBD-SM, the amount of newly
synthesized C6-NBD-SM (and hence the amount of
C6-NBD-Cer lost to resynthesis) was calculated by
incubating cells directly with similar amounts of
C6-NBD-Cer as generated during incubations with
C6-NBD-SM and calculating the ratio of
C6-NBD-GlcCer synthesis to
C6-NBD-SM synthesis. This ratio (1:0.39)
was then used to correct for the amount of
C6-NBD-Cer lost to resynthesis of
C6-NBD-SM, exactly as described previously (Koval
and Pagano, 1989 ).
Transcript identification. Expression of neurotrophin
receptors in hippocampal neurons was analyzed by RNase protection
assays (RPA), as described previously (Funakoshi et al., 1993 ). Total RNA from preplated hippocampal neurons was incubated with
32P-labeled antisense riboprobes
[expected protected fragment sizes (nt) in parentheses],
generated by transcription from linearized subclones of p75NTR (400),
TrkA (420), TrkB (390), TrkC (420), and glyceraldehyde 3-phosphate
dehydrogenase (GAP-DH) (150).
Reverse transcription (RT)-PCR on poly(A+)
mRNA was subsequently performed using the Titan one-tube system from
Boehringer Mannheim, as per manufacturer's instructions. The
expression of p75NTR, TrkA, and GAP-DH was examined in both pre-plated
and cultured neurons, using primer sequences as described: (1) p75NTR,
sense primer, GTCGTGGGCCTTGTGGCC; reverse primer, CTGTGAGTTCACACTGGGG; product size, 480 bp; (2) TrkA, sense primer, CGTTGATGCTGGCTTGTGC; reverse primer, GGAGAGATTCAGGTGACTGA; product size, 296 bp; (3) GAP-DH,
sense primer, TTAGCACCCCTGGCCAAGG; reverse primer,
CTTACTCCTTGGAGGCCATG; product size, 540 bp.
Western blot. Cultured neurons on coverslips were processed
for Western blotting by extraction in 0.125 M
Tris-HCl, pH 6.8, 4% SDS, and 0.2 M DTT. The
neuronal extract was passed six times through a 21-gauge syringe needle
to ensure complete homogenization, followed by pelleting of debris by
microcentrifugation. Extracts were supplemented with 10% glycerol and
loading dye and boiled for 10 min before SDS-PAGE. Gels were blotted to
nitrocellulose, and the blots were incubated overnight in ice-cold
blocking solution. The blots were then probed with primary antibodies
(anti-REX IgG at final concentration of 1 µg/ml or 9651 antiserum at
1:1000 dilution) for 2.5 hr at room temperature, before developing with secondary antibody and ECL detection. Densitometric scans of blots were
analyzed with the Bio-Rad (Hercules, CA) Multi-Analyst 1.01 program.
Statistical analysis. A one-way ANOVA was performed
to determine whether there were significant differences between
treatments (see Figs. 4-6). When ANOVA was used and when this analysis
indicated significance (p < 0.01),
post hoc Fisher's protected least significant difference test analysis was used to determine which conditions were significantly different from each other.
 |
RESULTS |
Hippocampal neurons contain high levels of N-SMase
A previous study demonstrated that addition of bacterial N-SMase
to hippocampal neurons, or incubation with short-acyl chain derivatives
of ceramide, stimulated early stages of neuronal growth in cultured
hippocampal neurons, namely the transition through stages 1 to 3 (Schwarz and Futerman, 1997 ). To ascertain whether the growth of
hippocampal neurons might be regulated by endogenous SMase, we have now
characterized the relative activities of N-SMase and A-SMase in
homogenates of hippocampal neurons, using a short-acyl chain
fluorescent derivative of SM, C6-NBD-SM, as
substrate (Koval and Pagano, 1989 ). In vitro, SMase activity
at neutral pH could be stimulated approximately twofold by addition of
MgCl2 and completely abolished by EDTA (Fig.
1A), a characteristic
of membrane-bound N-SMase (Sperker and Spence, 1983 ). Moreover, the
specific activity of N-SMase assayed in the presence of
MgCl2 was approximately threefold higher than
that of A-SMase, irrespective of whether A-SMase was assayed in the
presence of divalent cations (Fig. 1B). These data
demonstrate that N-SMase is the major SMase activity in hippocampal
neurons; similarly, earlier studies demonstrated high activity of
N-SMase in brain (Sperker and Spence, 1983 ).

View larger version (18K):
[in this window]
[in a new window]
|
Figure 1.
Characterization of SMase activities in
hippocampal neurons. A, Cation dependence. Homogenates
of hippocampal neurons (preplated) (20 µg of protein) were assayed in
25 mM KCl, and 50 mM Tris, pH 7.4, for N-SMase
activity or in MES buffer, pH 4.7, for A-SMase activity, by incubation
with C6-NBD-SM (10 µM) in a final volume of
200 µl, with or without addition of cations or EDTA. After 1 hr at
37°C, the reaction was terminated, and C6-NBD-Cer
formation was analyzed. Results are means ± SEM of three
independent experiments. B, Specific activity.
Homogenates of hippocampal neurons (20 µg of protein) were assayed in
25 mM KCl, 10 mM MgCl2, and
50 mM Tris, pH 7.4, for N-SMase activity or in MES buffer,
pH 4.7, for A-SMase activity, by incubation with C6-NBD-SM
in a final volume of 50 µl. After 1 hr at 37°C, the reaction was
terminated, and C6-NBD-Cer formation was analyzed. Results
are means ± SEM of two independent experiments.
|
|
Cultured hippocampal neurons express p75NTR
We next characterized neurotrophin receptor expression in cultured
hippocampal neurons. Because activated trk receptors have been reported
to block p75NTR signaling (Dobrowsky et al., 1995 ; Yoon et al., 1998 ),
it was also important to determine which trk receptors are coexpressed
with p75NTR in the neurons. RNase protection assays on preplated
neurons (Fig. 2A)
revealed robust expression of both TrkB and TrkC, low expression of
p75NTR, and no observable expression of TrkA. This was confirmed by
RT-PCR analysis in which no detectable expression of TrkA was observed
in the initial hour of culture, although extremely low levels of TrkA
transcript were detected after 1 d in culture (Fig.
2B). p75NTR mRNA is expressed in preplated neurons
and somewhat upregulated after 24 hr in culture (Fig.
2B). p75NTR protein expression in cultured neurons
was confirmed by Western blots with both the REX (Weskamp and
Reichardt, 1991 ) and 9651 (Huber and Chao, 1995 ) antibodies (Fig.
2C). Densitometric quantitation of the blots suggests that
these cultured neurons express p75NTR at a 50- to 100-fold lower level
than PC12 cells, allowing for an average of a few hundred receptor
molecules per neuron (p75 in PC12 has been quantified at ~50,000
receptors per cell) (Mahadeo et al., 1994 ; Akar and Wallace,
1998 ). To examine whether this low level of expression is
uniform, hippocampal neurons were examined by immunofluorescence
analysis using the anti-REX antibody. Low levels of immunoreactivity
were observed on axonal processes and cell bodies and were at similar
levels on nearly all neurons in the culture (data not shown).

View larger version (39K):
[in this window]
[in a new window]
|
Figure 2.
Neurotrophin receptor expression in hippocampal
neurons. A, Total RNA was extracted from neurons before
plating (preplating) and analyzed by RPA. Assays were repeated on three
different RNA extractions, producing the same results. The position of
a 400 nt marker is shown. H, hippocampal neurons; Y,
yeast tRNA. B, Poly(A+) mRNA was
extracted from neurons before plating ( 3), 1 hr after
coculturing with the glia (1), and 24 hr after
coculturing (24). Comparison samples include mRNA
from glia (G) and from PC12 cells
(PC12). RT-PCR was repeated three times producing the
same results. C, Western blot analysis was performed on
total cellular protein of hippocampal neurons after 1 hr in culture.
PC12 cell extracts were run for comparison. Each lane
represents ~300,000 cells. Right, Probed with anti-REX
IgG; left, probed with 9651 antiserum. Note that the
PC12 lane probed with anti-REX is overexposed to enable detection in
the neuronal sample.
|
|
NGF stimulates neuronal growth
Because hippocampal neurons express p75NTR, TrkB, and TrkC, but
not TrkA (Fig. 2), NGF is the only neurotrophin that can signal in a
trk-independent manner via p75NTR in this system. We therefore determined whether NGF stimulates neuronal growth. NGF was applied to
hippocampal neurons immediately after the cells were placed in culture,
and morphology was analyzed after 18 hr. Initial dose-response experiments showed that 200 ng/ml NGF significantly enhanced the outgrowth of hippocampal neurons, although lower concentrations (~50
ng/ml) also had an effect. The number of stage 3 neurons (i.e., neurons
with a defined axon) was 45% in control cells but 70% in NGF-treated
neurons (200 ng/ml), with a corresponding decrease in the number of
stages 1 and 2 neurons in NGF-treated versus control cells (Fig.
3). The number of stage 3 cells after 18 hr treatment with NGF is similar to that obtained after incubation with
exogenously added N-SMase or C6-NBD-Cer
(Schwarz and Futerman, 1997 ).

View larger version (22K):
[in this window]
[in a new window]
|
Figure 3.
Effect of NGF on neuronal development. NGF (200 ng/ml) was added to cultures immediately after the coverslips
containing the neurons were placed in multiwell dishes containing a
glial monolayer. Neuronal morphology was analyzed after 18 hr. The
left panel shows the percent of cells in each
developmental stage as means for three different cultures in which 50 cells per coverslip were analyzed for four coverslips per treatment:
stage 1 (filled bars), stage 2 (spotted
bars), and stage 3 (striped bars). The
distribution of control cells is statistically different from that of
NGF-treated cells (p = 0.0001;
2 test). The right panel shows camera
lucida drawings obtained from distinct fields of typical control and
NGF-treated cells and gives examples of each developmental stage.
|
|
To determine whether the glial cells present in the culture dishes
might be contributing to the ability of NGF to stimulate neuronal
growth, similar incubations with NGF were performed using neurons
cultured in the absence of a glial monolayer. A lower concentration of
NGF was required to accelerate neuronal outgrowth than in the presence
of glia. A 32% increase in the number of stage 3 neurons was observed
using 50 or 100 ng/ml NGF. These data confirm that the effects of NGF
are mediated by a direct interaction of NGF with neurons and not via an
indirect effect mediated by glia.
The fact that TrkA expression is almost undetectable in cultured
hippocampal neurons strongly suggests that the effects of NGF in these
neurons are mediated via p75NTR. To rigorously test this hypothesis, we
used three separate reagents that are known to discriminate between
p75NTR and TrkA. The first series of experiments was conducted with the
NGF triple mutant (NGFtm), which is
deficient in p75NTR binding but nevertheless activates TrkA (Ibanez et
al., 1992 ). Incubation of neurons with
NGFtm at 200 ng/ml did not stimulate
neuronal outgrowth, irrespective of whether neurons were cultured with
or without the glial monolayer (Fig.
4A).
NGFtm from the same batch was active when
assayed for TrkA phosphorylation on a TrkA-expressing fibroblast cell
line (data not shown); thus, the lack of effect of
NGFtm in the hippocampal cultures appears
to be caused by its deficiency in interaction with p75NTR.

View larger version (17K):
[in this window]
[in a new window]
|
Figure 4.
Effect of NGFtm and
anti-p75NTR on neuronal growth. A, Hippocampal
neurons were incubated with NGF or NGFtm immediately
after placing coverslips in multiwell dishes with or without a glial
monolayer, and development was compared with control cells
(Con); NGF and NGFtm were added at a
concentration of 200 ng/ml in the presence of glia and 50 ng/ml in the
absence of glia. Data are means ± SEM of the percent of stage 3 cells after 18 hr in culture for three different cultures in which 50 cells per coverslip were analyzed for four coverslips per treatment.
*p < 0.01, statistically significant differences
from control; ANOVA. B, Neurons were placed in
multiwell dishes that did not contain a glial monolayer and incubated
with REX IgG versus a nonrelevant (NR) IgG (both IgGs at
final concentration of 15 µg/ml), 9651 antiserum (ser)
versus a nonrelevant antiserum (sera at 1:100 dilution), or with the
192 monoclonal antibody versus a nonrelevant monoclonal antibody
(monoclonals at final concentration of 0.2 µg/ml). Development was
compared after 18 hr with control cells (100%) and with neurons
incubated with NGF (100 ng/ml). Data are means ± SEM for three to
seven different cultures in which 50 cells per coverslip were analyzed
for two (REX and 192) or four (9651) coverslips per treatment.
*p < 0.01, statistically significant differences;
ANOVA.
|
|
In the second series of experiments, we tested the effects of two
polyclonal antisera raised against the extracellular domain of p75NTR,
REX (Weskamp and Reichardt, 1991 ), and 9651 (Huber and Chao,
1995 ). Because both antisera have been shown previously to block NGF
binding to p75NTR, we assumed that the effects of NGF on neurons would
be blocked by coincubation with the antisera. Unexpectedly, preliminary
experiments applying anti-REX serum alone at dilutions of 1:200-1:100
revealed pronounced effects on neuronal outgrowth. To ensure
specificity of the response, the REX serum was purified over a
Protein G column, and purified IgG was used thereafter. The 9651 antiserum was used directly. Both anti-REX IgG and 9651 antiserum had
pronounced effects on neuronal outgrowth (Fig. 4B).
The effects were specific, because they could not be mimicked by a
number of IgGs or antisera raised against unrelated antigens (Fig.
4B). Coapplication of NGF together with REX did
not reveal any significantly additive effects above that observed with
each reagent alone (151.3 ± 13.7% increase above control with
the combination vs 138-145% with each alone); thus, it appears that,
in this assay, they act as functionally interchangeable ligands of p75NTR.
MC192 is a monoclonal antibody against an extracellular epitope on
p75NTR that appears to be distinct from the NGF binding site (Chandler
et al., 1984 ; Barker and Shooter, 1994 ). It affects trophic responses
in cells that coexpress TrkA and p75NTR (Barker and Shooter, 1994 ;
Maliartchouk and Saragovi, 1997 ) and was recently shown to block
NGF-induced p75NTR-mediated induction of dopamine release in
mesencephalic neurons (Blochl and Sirrenberg, 1996 ). We therefore
compared its effects with those of the NGF competitor antibodies used
previously. In contrast to anti-REX and 9651, MC192 application at 0.2 µg/ml [a concentration shown previously to be optimal for modulating
NGF trophic effects (Maliartchouk and Saragovi, 1997 )] did not cause
any significant changes in neuronal morphology in the hippocampal
neuron cultures (Fig. 4B).
NGF stimulates ceramide formation in a time- and
dose-dependent manner
The data presented above suggest that the outgrowth-promoting
effects of NGF are mediated via p75NTR in cultured hippocampal neurons.
Because p75NTR has been shown to signal via the SM pathway (Dobrowsky
et al., 1994 ) and because exogenously added ceramide (Schwarz and
Futerman, 1997 ) is able to accelerate the early stages of neuronal
outgrowth in a similar manner to that observed for NGF, we examined
whether NGF binding to the p75NTR receptor stimulates ceramide
formation in cultured neurons. Hippocampal neurons were incubated with
C6-NBD-SM for 1 hr and subsequently incubated for up to 24 hr with or without NGF (200 ng/ml). During the first 12 min
after addition of NGF, the rate of C6-NBD-Cer
formed from C6-NBD-SM increased more than
sevenfold in NGF-treated neurons (0.14 fmol/min per coverslip in the
presence of NGF, compared with 0.02 fmol/min per coverslip in control
neurons). This steep increase in ceramide formation results in an
accumulative approximate twofold increase in the total amount of
C6-NBD-Cer formed per coverslip in NGF-treated
versus control neurons after 24 hr (Fig. 5A). Furthermore, there is a
dose-dependent relationship between the concentration of NGF and the
amount of C6-NBD-Cer formed after 12 min (Fig.
5B) and 1 hr (data not shown).

View larger version (14K):
[in this window]
[in a new window]
|
Figure 5.
Time and dose dependence of C6-NBD-Cer
formation after incubation with NGF. A, Neurons were
incubated for 1 hr with C6-NBD-SM before addition of NGF
(200 ng/ml). C6-NBD-Cer formation was calculated as
described in Materials and Methods. Data are means ± SEM from
five experiments. Note that, as the amount of C6-NBD-SM
hydrolyzed to C6-NBD-Cer increases, more
C6-NBD-SM transfers from the medium to the neurons
(Futerman and Pagano, 1992 ), with an approximately linear relationship
between the amount of cell-associated C6-NBD-SM and the
amount of C6-NBD-Cer formed. The slope of NGF-treated cells
is significantly different from that of control cells
(p < 0.05). B, Neurons were
incubated for 1 hr with C6-NBD-SM, followed by an
additional 12 min incubation with various concentrations of NGF, before
analysis of C6-NBD-Cer formation. Note that, after 12 min
incubation, essentially no C6-NBD-GlcCer is synthesized
from C6-NBD-Cer, and the data were therefore not corrected
to take into account synthesis of C6-NBD-GlcCer and
resynthesis of C6-NBD-SM (see Materials and Methods). Data
are means ± SEM from three independent experiments.
C, Comparison of the effects of NGF and the
NGFtm on C6-NBD-Cer formation. Neurons
were incubated for 1 hr with C6-NBD-SM and for a further 1 hr with 200 ng/ml NGF or NGFtm before analysis of
C6-NBD-Cer formation. *p < 0.01, statistically significant differences; ANOVA.
|
|
In contrast to the ability of NGF to stimulate ceramide formation,
NGFtm had no such effect (Fig.
5C). This is consistent with its lack of effect on neuronal
morphology (Fig. 4A). Thus, NGF stimulation of
ceramide formation in hippocampal neurons is a direct consequence of
p75NTR binding.
NGF stimulates neuronal growth via N-SMase
To determine whether the ability of NGF to stimulate ceramide
formation after binding to p75NTR is the cause of the morphological response or simply correlated with it, we attempted to block the effects of NGF using scyphostatin, a recently described inhibitor of
N-SMase (Tanaka et al., 1997 ). We first determined the specificity and
concentration dependence of scyphostatin in embryonic rat brain tissue
in vitro. A dose-dependent inhibition of N-SMase was
observed at scyphostatin concentrations between 0.1 and 50 µM (Fig.
6A), whereas
essentially no inhibition of A-SMase was detected. Even at 50 µM scyphostatin, a concentration representing fivefold molar excess over the substrate
C6-NBD-SM, A-SMase activity was only inhibited to
a minor extent; these data are consistent with the differences in
IC50 values for N-SMase and A-SMase (Tanaka et
al., 1997 ). Thus, scyphostatin specifically inhibits N-SMase activity
in brain.

View larger version (15K):
[in this window]
[in a new window]
|
Figure 6.
Effect of scyphostatin on
C6-NBD-Cer formation. A, Rat embryonic
cerebral cortex was homogenized in TK buffer, pH 7.4 (with or without
10 mM MgCl2) or in 10 mM MES
buffer, pH 4.7, for analysis of SMase activities. Homogenates (20 µg
of protein) were incubated for 15 min with scyphostatin (dissolved in
ethanol; corresponding amounts of ethanol were added to control
samples), followed by a 30 min incubation with 10 µM
C6-NBD-SM. After terminating the reaction,
C6-NBD-Cer formation was analyzed. Results are means ± SEM of three independent experiments. The slope of A-SMase activity
is significantly different from that of N-SMase activity (with or
without Mg) (p < 0.0001).
B, Top, Coverslips containing neurons
were placed in dishes that did not contain a glial monolayer and
incubated for 1 hr with or without scyphostatin (1 µM),
followed by an additional 1 hr incubation after addition of 1.5 µM C6-NBD-SM. NGF (100 ng/ml) was then added
and, after a further 1 hr, the amount of C6-NBD-Cer formed
was analyzed. Data are means ± SEM for three independent
experiments. Bottom, Neuronal morphology was analyzed 18 hr after adding reagents. Results are means of the number of cells in
stage 3 as a percent of the control ± SEM for three different
cultures in which 50 cells per coverslip were analyzed for four
coverslips per treatment (bottom).
*p < 0.01, statistically significant differences;
ANOVA.
|
|
Preincubation of neurons with 1 µM scyphostatin
completely blocked the ability of NGF to stimulate ceramide formation
(Fig. 6B), confirming that inhibition of N-SMase
blocks ceramide signaling downstream of p75NTR. Furthermore,
preincubation (1 hr) with scyphostatin before application of NGF
abolished the ability of NGF to stimulate neuronal growth (Fig.
6C). Thus, ceramide signaling induced by NGF binding to the
p75NTR is part of the signal pathway linking NGF to effects on neuronal
outgrowth during the early stages of development of cultured
hippocampal neurons.
 |
DISCUSSION |
The data presented above demonstrate that NGF stimulates the
growth-development of cultured hippocampal neurons via the generation of ceramide by N-SMase. P75NTR is the only detectable NGF-specific receptor in these neurons, and an NGF mutant deficient in
p75NTR-binding is not active. Furthermore, two anti-p75NTR antibodies
(REX and 9651), which can compete with NGF for binding to p75NTR, mimic the effects of NGF in this in vitro system, whereas another
antibody (MC192) targeted to a distinct p75NTR epitope does not.
Finally, a specific N-SMase inhibitor blocks NGF effects on hippocampal neuron outgrowth. These data strongly support a primary role for the
p75NTR-ceramide signaling pathway in mediating the effects of NGF on
the growth of cultured hippocampal neurons. It should be noted,
however, that a secondary or supplementary role for TrkB and/or TrkC
signaling cannot be ruled out, in light of the recent finding that
C2-ceramide exposure augments trk tyrosine phosphorylation (MacPhee and
Barker, 1999 ).
The mode of ceramide action in mediating various cellular responses,
particularly apoptosis, has recently received great attention (Hofmann
and Dixit, 1998 ; Kolesnick and Kronke, 1998 ). Although a number of
important issues remain to be resolved concerning the mechanism of
activation and possible distinct roles of ceramide generated from
A-SMase and N-SMase, concerning the membrane topology of SM and
ceramide, and concerning the down-stream targets of ceramide, there
appears to be little doubt that ceramide is an important second
messenger in signaling pathways that lead to a variety of cellular
responses. Although there is some evidence that ceramide generated by
de novo synthesis can act in signaling pathways (Bose et
al., 1995 ), the major mechanism for generating ceramide appears to be
via degradation of SM at the plasma membrane by SMase(s), of yet
undefined molecular identity(ies) (Liu et al., 1998 ; Tomiuk et al.,
1998 ). The complexity of these issues is illustrated by a recent study
in which TNF induced a multiphasic increase in intracellular ceramide
levels in Kym-1 rhabdomyosarcoma cells (Bourteele et al., 1998 ).
Distinct enzymes were found to contribute to three waves of ceramide
generation, N-SMase, ceramide synthase, and A-SMase, with peak
activities at 1-2, 40, and ~200 min, respectively, the latter
coinciding with progression to irreversible damage. Interestingly, we
observed an increase in the rate of generation of ceramide from SM
after as little as 12 min exposure to NGF. The low concentrations of
ceramide generated by p75NTR activation in cultured hippocampal
pyramidal neurons result in enhanced rates of neuronal growth.
Although our data suggest a role for p75NTR in regulating neuronal
growth, the most prominent trk-independent physiological role suggested
so far for p75NTR is the control of cell death in specific cell types
in the nervous system (Casaccia-Bonnefil et al., 1996 ; Frade et al.,
1996 ; Bredesen and Rabizadeh, 1997 ; Bamji et al., 1998 ). However, a
number of studies have suggested involvement of p75NTR in regulation of
neuronal function and in plasticity-related activities of neurotrophins
(Greene, 1977 ; Anton et al., 1994 ; Blochl and Sirrenberg, 1996 ; Stucky
and Koltzenburg, 1997 ; Seidl et al., 1998 ). For instance, NGF induces
the release of dopamine via activation of p75NTR in cultured
mesencephalic neurons from embryonic (E14) rats (Blochl and Sirrenberg,
1996 ). Strikingly, a short-acyl chain analog of ceramide,
C2-ceramide, as well as exogenously added SMase,
also induced dopamine release at a comparable level with that released
via NGF (Blochl and Sirrenberg, 1996 ). The MC192 antibody inhibited
ceramide generation in that study (Blochl and Sirrenberg, 1996 ), which
is consistent with its lack of effect on neuronal morphology in the
current work (Fig. 4B). These results, together with
ours, support a role for ceramide signaling downstream of p75NTR in the
regulation of neuronal physiology and function. The in vivo
significance of ceramide signaling downstream of p75NTR is currently
unknown, although it is striking that deficits in sympathetic target
innervation in p75NTR / mice were
attributed to a lack in axonal growth (Lee et al., 1994 ). The currently
available line of p75NTR / mice reveal
a relatively mild phenotype (Lee et al., 1992 ), although a suggestion
has been raised that this line is not a complete null mutation (Dechant
and Barde, 1997 ). Future analyses of
p75NTR / and
N-SMase / mice, when available, will be
required to address this issue. Furthermore, because functional effects
might not necessarily be reflected in gross anatomy or histology,
advanced physiological analyses may be the best option to shed light on
these questions (Stucky and Koltzenburg, 1997 ).
The signaling mechanisms downstream of the binding of NGF to
p75NTR may differ from the mechanisms described for other receptors, such as the well characterized cascade of protein-protein
interactions, which links the Fas/TNF receptor family to caspase
enzymes involved in apoptosis (Yuan, 1997 ). For instance, in contrast
to the Fas/TNF receptor family, the p75NTR death domain does not
self-aggregate (Liepinsh et al., 1997 ), although it has a death domain
with a similar sequence and structure to that of the Fas/TNF receptor family. Candidate downstream signaling mechanisms for p75NTR include ceramide generation via N-SMase (Dobrowsky and Carter, 1998 ;
Dobrowsky et al., 1994 , 1995 ; current study) and pathways that lead to
jun kinase or NF B activation (Carter et al., 1996 ; Casaccia-Bonnefil et al., 1996 ). Ceramide generation is the only p75NTR signaling response described to date for all neurotrophins (Dobrowsky et al.,
1995 ), whereas the other responses were originally thought to be
NGF-specific. Recently, however, it was observed that BDNF-induced apoptosis of sympathetic neurons is mediated via p75NTR and jun kinase
(Bamji et al., 1998 ). This apparent conflict can be resolved if it is
assumed that different signaling pathways are responsible for the
different effects of binding of neurotrophins to p75NTR. Such a
possibility is reminiscent of a model proposed for signaling of the p55
TNF receptor in which the death domain of p55 signals apoptosis,
although a distinct 11 amino acid domain activates the N-SMase pathway
(Adam-Klages et al., 1996 ). The effects of the REX antiserum in
blocking NGF-induced apoptosis (Frade et al., 1996 ), although inducing
neuronal outgrowth (this study), are consistent with this hypothesis.
Further support is provided by an earlier study in which deletion of
residues 249-305 of p75NTR abolished its capacity to mediate SM
hydrolysis (Dobrowsky et al., 1995 ). This region contains juxtamembrane
and cytoplasmatic sequences that are N terminal to the p75NTR death
domain. Thus, an important issue for future studies is to clarify which
segments of the p75NTR intracellular domain are required for apoptotic signaling and which are required for ceramide generation through N-SMase.
 |
FOOTNOTES |
Received April 14, 1999; revised June 4, 1999; accepted July 12, 1999.
This work was supported by grants from the Buddy Taub Foundation
(A.H.F. and M.F.), the Israel Science Foundation (A.H.F.), the Human
Frontiers Science Program (M.F.), and the Nella and Leon Benoziyo
Center For Neurosciences at the Weizmann Institute (M.F.). M.F is an
Allon fellow and the incumbent of the Daniel E. Koshland Sr. Career
Development Chair. We thank Rivka Zisling for expert help in preparing
and maintaining the hippocampal cultures and the following for
generously providing reagents and antibodies: C. F. Ibanez
(Karolinska Institute, Stockholm, Sweden), G. Weskamp (Sloan-Kettering
Cancer Center, New York, NY), L. Reichardt (University of California,
San Francisco, CA), M. V. Chao (Skirball Institute, New York, NY),
and T. Ogita (Sankyo Inc., Tokyo, Japan).
Correspondence should be addressed to Michael Fainzilber, Molecular
Neurobiology Group, Department of Biological Chemistry, Weizmann
Institute of Science, Rehovot 76100, Israel. E-mail: bmfainz{at}weizmann.weizmann.ac.il.
 |
REFERENCES |
-
Adam-Klages S,
Adam D,
Wiegmann K,
Struve S,
Kolanus W,
Schneider-Morgener J,
Kronke M
(1996)
FAN, a novel WD-repeat protein, couples the p55 TNF-receptor to neutral sphingomyelinase.
Cell
86:937-947[Web of Science][Medline].
-
Akar CA,
Wallace WC
(1998)
Amyloid precursor protein modulates the interaction of nerve growth factor with p75 receptor and potentiates its activation of trkA phosphorylation.
Brain Res Mol Brain Res
56:125-132[Medline].
-
Anton ES,
Weskamp G,
Reichardt LF,
Mathew WD
(1994)
Nerve growth factor and its low-affinity receptor promote Schwann cell migration.
Proc Natl Acad Sci USA
91:2795-2799[Abstract/Free Full Text].
-
Bamji SX,
Majdan M,
Pozniak CD,
Belliveau DJ,
Aloyz R,
Kohn J,
Causing CG,
Miller FD
(1998)
The p75 neurotrophin receptor mediates neuronal apoptosis and is essential for naturally occurring sympathetic neuron death.
J Cell Biol
140:911-923[Abstract/Free Full Text].
-
Barbacid M
(1995)
Structural and functional properties of the Trk family of neurotrophin receptors.
Ann NY Acad Sci
766:442-558[Web of Science][Medline].
-
Barker PA,
Shooter EM
(1994)
Disruption of NGF binding to the low affinity neurotrophin receptor p75LNTR reduces NGF binding to TrkA on PC12 cells.
Neuron
13:203-215[Web of Science][Medline].
-
Bligh EG,
Dyer WJ
(1959)
A rapid method of total lipid extraction and purification.
Can J Biochem Physiol
37:911-917.
-
Blochl A,
Sirrenberg C
(1996)
Neurotrophins stimulate the release of dopamine from rat mesencephalic neurons via trk and p75(lntr) receptors.
J Biol Chem
271:21100-21107[Abstract/Free Full Text].
-
Bose R,
Verheij M,
Haimovitz-Friedman A,
Scotto K,
Fuks Z,
Kolesnick R
(1995)
Ceramide synthase mediates daunorubicin-induced apoptosis: an alternative mechanism for generating death signals.
Cell
82:405-414[Web of Science][Medline].
-
Bourteele S,
Haubetaer A,
Doppler H,
Horn-Muller J,
Ropke C,
Schwarzmann G,
Pfizenmaier K,
Muller G
(1998)
Tumor necrosis factor induces ceramide oscillations and negatively controls sphingolipid synthases by caspases in apoptotic kym-1 cells.
J Biol Chem
273:31245-31251[Abstract/Free Full Text].
-
Bradford MM
(1976)
A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.
Anal Biochem
72:248-254[Web of Science][Medline].
-
Bredesen DE,
Rabizadeh S
(1997)
p75NTR and apoptosis: Trk-dependent and Trk-independent effects.
Trends Neurosci
20:287-290[Web of Science][Medline].
-
Carter BD,
Kaltschmidt C,
Kaltschmidt B,
Offenhauser N,
Bohm MR,
Baeuerle PA,
Barde YA
(1996)
Selective activation of NF-kappa B by nerve growth factor through the neurotrophin receptor p75.
Science
272:542-545[Abstract].
-
Casaccia-Bonnefil P,
Carter BD,
Dobrowsky RT,
Chao MV
(1996)
Death of oligodendrocytes mediated by the interaction of nerve growth factor with its receptor p75.
Nature
383:716-719[Medline].
-
Chandler CE,
Parsons LM,
Hosang M,
Shooter EM
(1984)
A monoclonal antibody modulates the interaction of nerve growth factor with PC12 cells.
J Biol Chem
259:6882-6889[Abstract/Free Full Text].
-
Chao MV
(1994)
The p75 neurotrophin receptor.
J Neurobiol
25:1373-1385[Web of Science][Medline].
-
Chao MV,
Hempstead BL
(1995)
p75 and trk: a two-receptor system.
Trends Neurosci
18:321-326[Web of Science][Medline].
-
de Chaves EIP,
Bussiere M,
Vance DE,
Campenot RB,
Vance JE
(1997)
Elevation of ceramide within distal neurites inhibits neurite growth in cultured rat sympathetic neurons.
J Biol Chem
272:3028-3035[Abstract/Free Full Text].
-
Dechant G,
Barde YA
(1997)
Signalling through the neurotrophin receptor p75NTR.
Curr Opin Neurobiol
7:413-418[Web of Science][Medline].
-
Dobrowsky RT,
Carter BD
(1998)
Coupling of the p75 neurotrophin receptor to sphingolipid signaling.
Ann NY Acad Sci
845:32-45[Web of Science][Medline].
-
Dobrowsky RT,
Werner MH,
Castellino AM,
Chao MV,
Hannun YA
(1994)
Activation of the sphingomyelin cycle through the low-affinity neurotrophin receptor.
Science
265:1596-1599[Abstract/Free Full Text].
-
Dobrowsky RT,
Jenkins GM,
Hannun YA
(1995)
Neurotrophins induce sphingomyelin hydrolysis: modulation by co-expression of p75NTR with Trk receptors.
J Biol Chem
270:22135-22142[Abstract/Free Full Text].
-
Dotti CG,
Sullivan CA,
Banker GA
(1988)
The establishment of polarity by hippocampal neurons in culture.
J Neurosci
8:1454-1468[Abstract].
-
Frade JM,
Rodriguez-Tebar A,
Barde YA
(1996)
Induction of cell death by endogenous nerve growth factor through its p75 receptor.
Nature
383:166-168[Medline].
-
Funakoshi H,
Frisen J,
Barbany G,
Timmusk T,
Zachrisson O,
Verge VMK,
Persson H
(1993)
Differential expression of mRNAs for neurotrophins and their receptors following axotomy of the sciatic nerve.
J Cell Biol
123:455-466[Abstract/Free Full Text].
-
Furuya S,
Mitoma J,
Makino A,
Hirabayashi Y
(1998)
Ceramide and its interconvertible metabolite sphingosine function as indispensable lipid factors involved in survival and dendritic differentiation of cerebellar Purkinje cells.
J Neurochem
71:366-377[Web of Science][Medline].
-
Futerman AH,
Pagano RE
(1991)
Determination of the intracellular sites and topology of glucosylceramide synthesis in rat liver.
Biochem J
280:295-302.
-
Futerman AH,
Pagano RE
(1992)
Use of N-([1-14C]hexanoyl) sphingolipids to assay sphingolipid metabolism.
Methods Enzymol
209:437-446[Web of Science][Medline].
-
Futerman AH,
Stieger B,
Hubbard AL,
Pagano RE
(1990)
Sphingomyelin synthesis in rat liver occurs predominantly at the cis and medial cisternae of the Golgi apparatus.
J Biol Chem
265:8650-8657[Abstract/Free Full Text].
-
Goslin K,
Banker G
(1989)
Experimental observations on the development of polarity by hippocampal neurons in culture.
J Cell Biol
108:1507-1516[Abstract/Free Full Text].
-
Goslin K,
Asmussen H,
Banker G
(1998)
Rat hippocampal neurons in low density.
In: Culturing nerve cells (Banker G,
Goslin K,
eds), pp 339-370. Cambridge, MA: MIT.
-
Greene LA
(1977)
Quantitative in vitro studies on the nerve growth factor (NGF) requirement of neurons. II. Sensory neurons.
Dev Biol
58:106-113[Web of Science][Medline].
-
Hantzopoulos PA,
Suri C,
Glass DJ,
Goldfarb MP,
Yancopoulos GD
(1994)
The low affinity NGF receptor, p75, can collaborate with each of the Trks to potentiate functional responses to the neurotrophins.
Neuron
13:187-201[Web of Science][Medline].
-
Harel R,
Futerman AH
(1993)
Inhibition of sphingolipid synthesis affects axonal outgrowth in cultured hippocampal neurons.
J Biol Chem
268:14476-14481[Abstract/Free Full Text].
-
Hirschberg K,
Zisling R,
van Echten-Deckert G,
Futerman AH
(1996)
Ganglioside synthesis during the development of neuronal polarity: major changes occur during axonogenesis and axon elongation, but not during dendrite growth or during synaptogenesis.
J Biol Chem
271:14876-14882[Abstract/Free Full Text].
-
Hofmann K,
Dixit VM
(1998)
Ceramide in apoptosis
does it really matter?
Trends Biochem Sci
23:374-377[Web of Science][Medline]. -
Huber LJ,
Chao MV
(1995)
A potential interaction of p75 and trkA NGF receptors revealed by affinity crosslinking and immunoprecipitation.
J Neurosci Res
40:557-563[Web of Science][Medline].
-
Ibanez CF,
Ebendal T,
Barbany G,
Murray-Rust J,
Blundell TL,
Persson H
(1992)
Disruption of the low affinity receptor-binding site in NGF allows neuronal survival and differentiation by binding to the trk gene product.
Cell
69:329-341[Web of Science][Medline].
-
Irie F,
Hirabayashi Y
(1998)
Application of exogenous ceramide to cultured rat spinal motoneurons promotes survival or death by regulation of apoptosis depending on its concentrations.
J Neurosci Res
54:475-485[Web of Science][Medline].
-
Jiang H,
Ulme DS,
Dickens G,
Chabuk A,
Lavarreda M,
Lazarovici P,
Guroff G
(1997)
Both p140trk and p75NGFR nerve growth factor receptors mediate nerve growth factor-stimulated calcium uptake.
J Biol Chem
272:6835-6837[Abstract/Free Full Text].
-
Kolesnick RN,
Kronke M
(1998)
Regulation of ceramide production and apoptosis.
Annu Rev Physiol
60:643-665[Web of Science][Medline].
-
Koval M,
Pagano RE
(1989)
Lipid recycling between the plasma membrane and intracellular compartments: transport and metabolism of sphingomyelin analogs in cultured fibroblasts.
J Cell Biol
108:2169-2181[Abstract/Free Full Text].
-
Koval M,
Pagano RE
(1991)
Intracellular transport and metabolism of sphingomyelin.
Biochim Biophys Acta
1082:113-125[Medline].
-
Lee KF,
Li H,
Huber LJ,
Landis SC,
Sharpe AH,
Chao MV,
Jaenisch R
(1992)
Targeted mutation of the gene encoding the low affinity NGF receptor p75 leads to deficits in the peripheral sensory nervous system.
Cell
69:737-749[Web of Science][Medline].
-
Lee KF,
Bachman K,
Landis S,
Jaenisch R
(1994)
Dependence on p75 for innervation of some sympathetic targets.
Science
263:1447-1449[Abstract/Free Full Text].
-
Liepinsh E,
Ilag LL,
Otting G,
Ibanez CF
(1997)
NMR structure of the death domain of the p75 neurotrophin receptor.
EMBO J
16:4999-5005[Web of Science][Medline].
-
Liu B,
Obeid LM,
Hannun YA
(1997)
Sphingomyelinases in cell regulation.
Semin Cell Dev Biol
8:311-322[Web of Science][Medline].
-
Liu B,
Hassler DF,
Smith GK,
Weaver K,
Hannun YA
(1998)
Purification and characterization of a membrane bound neutral pH optimum magnesium-dependent and phosphatidylserine-stimulated sphingomyelinase from rat brain.
J Biol Chem
273:34472-34479[Abstract/Free Full Text].
-
MacPhee I,
Barker PA
(1999)
Extended ceramide exposure activates the trkA receptor by increasing receptor homodimer formation.
J Neurochem
72:1423-1430[Web of Science][Medline].
-
Mahadeo D,
Kaplan L,
Chao MV,
Hempstead BL
(1994)
High affinity nerve growth factor binding displays a faster rate of association than p140trk binding. Implications for multi-subunit polypeptide receptors.
J Biol Chem
269:6884-6891[Abstract/Free Full Text].
-
Majdan M,
Lachance C,
Gloster A,
Aloyz R,
Zeindler C,
Bamji S,
Bhakar A,
Belliveau D,
Fawcett J,
Miller FD,
Barker PA
(1997)
Transgenic mice expressing the intracellular domain of the p75 neurotrophin receptor undergo neuronal apoptosis.
J Neurosci
17:6988-6998[Abstract/Free Full Text].
-
Maliartchouk S,
Saragovi HU
(1997)
Optimal nerve growth factor trophic signals mediated by synergy of TrkA and p75 receptor-specific ligands.
J Neurosci
17:6031-6037[Abstract/Free Full Text].
-
Pagano RE,
Martin O
(1994)
Use of fluorescent analogs of ceramide to study the Golgi apparatus of animal cells.
In: Cell biology: a laboratory handbook (Cerlis JE,
ed), pp 387-393. New York: Academic.
-
Schwarz A,
Futerman AH
(1997)
Distinct roles for ceramide and glucosylceramide at different stages of neuronal growth.
J Neurosci
17:2929-2938[Abstract/Free Full Text].
-
Schwarz A,
Rapaport E,
Hirschberg K,
Futerman AH
(1995)
A regulatory role for sphingolipids in neuronal growth: inhibition of sphingolipid synthesis and degradation have opposite effects on axonal branching.
J Biol Chem
270:10990-10998[Abstract/Free Full Text].
-
Seidl K,
Erck C,
Buchberger A
(1998)
Evidence for the participation of nerve growth factor and its low- affinity receptor (p75NTR) in the regulation of the myogenic program.
J Cell Physiol
176:10-21[Web of Science][Medline].
-
Sperker ER,
Spence MW
(1983)
Neutral and acid sphingomyelinases of rat brain: somatotopographical distribution and activity following experimental manipulation of the dopaminergic system in vivo.
J Neurochem
40:1182-1184[Web of Science][Medline].
-
Spiegel S,
Foster D,
Kolesnick R
(1996)
Signal transduction through lipid second messengers.
Curr Opin Cell Biol
8:159-167[Web of Science][Medline].
-
Stucky CL,
Koltzenburg M
(1997)
The low-affinity neurotrophin receptor p75 regulates the function but not the selective survival of specific subpopulations of sensory neurons.
J Neurosci
17:4398-4405[Abstract/Free Full Text].
-
Tanaka M,
Nara F,
Suzuki-Konagi K,
Hosoya T,
Ogita T
(1997)
Structural elucidation of scyphostatin, an inhibitor of membrane-bound neutral sphingomyelinase.
J Am Chem Soc
119:7871-7872.
-
Thoenen H
(1991)
The changing scene of neurotrophic factors.
Trends Neurosci
14:165-170[Web of Science][Medline].
-
Tomiuk S,
Hofmann K,
Nix M,
Zumbansen M,
Stoffel W
(1998)
Cloned mammalian neutral sphingomyelinase: functions in sphingolipid signaling?
Proc Natl Acad Sci USA
95:3638-3643[Abstract/Free Full Text].
-
Weskamp G,
Reichardt L
(1991)
Evidence that biological activity of NGF is mediated through a novel subclass of high affinity receptors.
Neuron
6:649-663[Web of Science][Medline].
-
Yoon SO,
Casaccia-Bonnefil P,
Carter B,
Chao MV
(1998)
Competitive signaling between TrkA and p75 nerve growth factor receptors determines cell survival.
J Neurosci
18:3273-3281[Abstract/Free Full Text].
-
Yuan J
(1997)
Transducing signals of life and death.
Curr Opin Cell Biol
9:247-251[Web of Science][Medline].
Copyright © 1999 Society for Neuroscience 0270-6474/99/19198199-08$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
N. Gomez, S. Chen, and C. E Schmidt
Polarization of hippocampal neurons with competitive surface stimuli: contact guidance cues are preferred over chemical ligands
J R Soc Interface,
April 22, 2007;
4(13):
223 - 233.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-H. Peng, C.-N. Huang, S.-P. Hsu, and C.-J. Wang
Penta-Acetyl Geniposide Induce Apoptosis in C6 Glioma Cells by Modulating the Activation of Neutral Sphingomyelinase-Induced p75 Nerve Growth Factor Receptor and Protein Kinase C{delta} Pathway
Mol. Pharmacol.,
September 1, 2006;
70(3):
997 - 1004.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. H. Zhang, M. R. Vasko, and G. D. Nicol
Intracellular sphingosine 1-phosphate mediates the increased excitability produced by nerve growth factor in rat sensory neurons
J. Physiol.,
August 15, 2006;
575(1):
101 - 113.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Massa, Y. Xie, T. Yang, A. W. Harrington, M. L. Kim, S. O. Yoon, R. Kraemer, L. A. Moore, B. L. Hempstead, and F. M. Longo
Small, nonpeptide p75NTR ligands induce survival signaling and inhibit proNGF-induced death.
J. Neurosci.,
May 17, 2006;
26(20):
5288 - 5300.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. D. Slonimsky, M. D. Mattaliano, J.-i. Moon, L. C. Griffith, and S. J. Birren
Role for calcium/calmodulin-dependent protein kinase II in the p75-mediated regulation of sympathetic cholinergic transmission
PNAS,
February 21, 2006;
103(8):
2915 - 2919.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Salama-Cohen, M.-A. Arevalo, J. Meier, R. Grantyn, and A. Rodriguez-Tebar
NGF Controls Dendrite Development in Hippocampal Neurons by Binding to p75NTR and Modulating the Cellular Targets of Notch
Mol. Biol. Cell,
January 1, 2005;
16(1):
339 - 347.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Hartmann, T. Brigadski, K. S. Erdmann, B. Holtmann, M. Sendtner, F. Narz, and V. Lessmann
Truncated TrkB receptor-induced outgrowth of dendritic filopodia involves the p75 neurotrophin receptor
J. Cell Sci.,
November 15, 2004;
117(24):
5803 - 5814.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Srinivasan, C. H. Roque, B. L. Hempstead, M. R. Al-Ubaidi, and R. S. Roque
Microglia-derived Pronerve Growth Factor Promotes Photoreceptor Cell Death via p75 Neurotrophin Receptor
J. Biol. Chem.,
October 1, 2004;
279(40):
41839 - 41845.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Czarny and J. E. Schnitzer
Neutral sphingomyelinase inhibitor scyphostatin prevents and ceramide mimics mechanotransduction in vascular endothelium
Am J Physiol Heart Circ Physiol,
September 1, 2004;
287(3):
H1344 - H1352.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Gehler, G. Gallo, E. Veien, and P. C. Letourneau
p75 Neurotrophin Receptor Signaling Regulates Growth Cone Filopodial Dynamics through Modulating RhoA Activity
J. Neurosci.,
May 5, 2004;
24(18):
4363 - 4372.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X.-Y. Song, J.-h. Zhong, X. Wang, and X.-F. Zhou
Suppression of p75NTR Does Not Promote Regeneration of Injured Spinal Cord in Mice
J. Neurosci.,
January 14, 2004;
24(2):
542 - 546.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Numakawa, H. Nakayama, S. Suzuki, T. Kubo, F. Nara, Y. Numakawa, D. Yokomaku, T. Araki, T. Ishimoto, A. Ogura, et al.
Nerve Growth Factor-induced Glutamate Release Is via p75 Receptor, Ceramide, and Ca2+ from Ryanodine Receptor in Developing Cerebellar Neurons
J. Biol. Chem.,
October 17, 2003;
278(42):
41259 - 41269.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Puglielli, B. C. Ellis, A. J. Saunders, and D. M. Kovacs
Ceramide Stabilizes {beta}-Site Amyloid Precursor Protein-cleaving Enzyme 1 and Promotes Amyloid {beta}-Peptide Biogenesis
J. Biol. Chem.,
May 23, 2003;
278(22):
19777 - 19783.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. C. Bronfman, M. Tcherpakov, T. M. Jovin, and M. Fainzilber
Ligand-Induced Internalization of the p75 Neurotrophin Receptor: A Slow Route to the Signaling Endosome
J. Neurosci.,
April 15, 2003;
23(8):
3209 - 3220.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. M. Frago, S. Canon, E. J. de la Rosa, Y. Leon, and I. Varela-Nieto
Programmed cell death in the developing inner ear is balanced by nerve growth factor and insulin-like growth factor I
J. Cell Sci.,
February 1, 2003;
116(3):
475 - 486.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Luberto, D. F. Hassler, P. Signorelli, Y. Okamoto, H. Sawai, E. Boros, D. J. Hazen-Martin, L. M. Obeid, Y. A. Hannun, and G. K. Smith
Inhibition of Tumor Necrosis Factor-induced Cell Death in MCF7 by a Novel Inhibitor of Neutral Sphingomyelinase
J. Biol. Chem.,
October 18, 2002;
277(43):
41128 - 41139.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Langevin, H. Jaaro, S. Bressanelli, M. Fainzilber, and C. Tuffereau
Rabies Virus Glycoprotein (RVG) Is a Trimeric Ligand for the N-terminal Cysteine-rich Domain of the Mammalian p75 Neurotrophin Receptor
J. Biol. Chem.,
September 27, 2002;
277(40):
37655 - 37662.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Copani, D. Melchiorri, A. Caricasole, F. Martini, P. Sale, R. Carnevale, R. Gradini, M. A. Sortino, L. Lenti, R. De Maria, et al.
beta -Amyloid-Induced Synthesis of the Ganglioside Gd3 Is a Requisite for Cell Cycle Reactivation and Apoptosis in Neurons
J. Neurosci.,
May 15, 2002;
22(10):
3963 - 3968.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Kashiwagi, Y. Shirai, M. Kuriyama, N. Sakai, and N. Saito
Importance of C1B Domain for Lipid Messenger-induced Targeting of Protein Kinase C
J. Biol. Chem.,
May 10, 2002;
277(20):
18037 - 18045.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. S. McQuillen, M. F. DeFreitas, G. Zada, and C. J. Shatz
A Novel Role for p75NTR in Subplate Growth Cone Complexity and Visual Thalamocortical Innervation
J. Neurosci.,
May 1, 2002;
22(9):
3580 - 3593.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Yan, Y. Liang, K. D. Nylander, J. Wong, R. M. Rudavsky, H. U. Saragovi, and N. F. Schor
p75-Nerve Growth Factor as an Antiapoptotic Complex: Independence versus Cooperativity in Protection from Enediyne Chemotherapeutic Agents
Mol. Pharmacol.,
April 1, 2002;
61(4):
710 - 719.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. B. Brann, M. Tcherpakov, I. M. Williams, A. H. Futerman, and M. Fainzilber
Nerve Growth Factor-induced p75-mediated Death of Cultured Hippocampal Neurons Is Age-dependent and Transduced through Ceramide Generated by Neutral Sphingomyelinase
J. Biol. Chem.,
March 15, 2002;
277(12):
9812 - 9818.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Fiorentini, N. Guerra, M. Facchetti, A. Finardi, L. Tiberio, L. Schiaffonati, P. Spano, and C. Missale
Nerve Growth Factor Regulates Dopamine D2 Receptor Expression in Prolactinoma Cell Lines via p75NGFR-Mediated Activation of Nuclear Factor-{kappa}B
Mol. Endocrinol.,
February 1, 2002;
16(2):
353 - 366.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-L. E. YEN, M.-H. MAR, R. B. MEEKER, A. FERNANDES, and S. H. ZEISEL
Choline deficiency induces apoptosis in primary cultures of fetal neurons
FASEB J,
August 1, 2001;
15(10):
1704 - 1710.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Kajimoto, S. Ohmori, Y. Shirai, N. Sakai, and N. Saito
Subtype-Specific Translocation of the {delta} Subtype of Protein Kinase C and Its Activation by Tyrosine Phosphorylation Induced by Ceramide in HeLa Cells
Mol. Cell. Biol.,
March 1, 2001;
21(5):
1769 - 1783.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
W. J. Friedman
Neurotrophins Induce Death of Hippocampal Neurons via the p75 Receptor
J. Neurosci.,
September 1, 2000;
20(17):
6340 - 6346.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. J. Coulson, K. Reid, M. Baca, K. A. Shipham, S. M. Hulett, T. J. Kilpatrick, and P. F. Bartlett
Chopper, a New Death Domain of the p75 Neurotrophin Receptor That Mediates Rapid Neuronal Cell Death
J. Biol. Chem.,
September 22, 2000;
275(39):
30537 - 30545.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. P. Roux, A. L. Bhakar, T. E. Kennedy, and P. A. Barker
The p75 Neurotrophin Receptor Activates Akt (Protein Kinase B) through a Phosphatidylinositol 3-Kinase-dependent Pathway
J. Biol. Chem.,
June 15, 2001;
276(25):
23097 - 23104.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. P. de Chaves, M. Bussiere, B. MacInnis, D. E. Vance, R. B. Campenot, and J. E. Vance
Ceramide Inhibits Axonal Growth and Nerve Growth Factor Uptake without Compromising the Viability of Sympathetic Neurons
J. Biol. Chem.,
September 21, 2001;
276(39):
36207 - 36214.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|