 |
Previous Article | Next Article 
The Journal of Neuroscience, October 1, 1999, 19(19):8327-8336
The Inwardly Rectifying K+ Channel Subunit GIRK1
Rescues the GIRK2 weaver Phenotype
Ping
Hou,
Shuizhong
Yan,
Weijen
Tang, and
Deborah J.
Nelson
Department of Neurobiology, Pharmacology, and Physiology, The
University of Chicago, Chicago, Illinois 60637
 |
ABSTRACT |
The weaver (wv) gene has been
identified as a glycine to serine substitution at residue 156 in the H5
region of inwardly rectifying K+ channel, GIRK2. The
mutation is permissive for the expression of homotetrameric channels
that are nonselective for cations and G-protein-independent.
Coexpression of GIRK2wv with GIRK1, GIRK2, or GIRK3 in
Xenopus oocytes along with expression of subunit
combinations linked as dimers and tetramers was used to investigate the
effects of the pore mutation on channel selectivity and gating as a
function of relative subunit position and number within a
heterotetrameric complex. GIRK1 formed functional,
K+ selective channels with GIRK2 and GIRK3.
Coexpression of GIRK2wv with GIRK1 gave rise to a
component of K+-selective, G-protein-dependent
current. Currents resulting from coexpression of GIRK2wv
with GIRK2 or GIRK3 were weaver-like. Current from
dimers of GIRK1-GIRK2wv, GIRK2-GIRK2wv,
and GIRK3-GIRK2wv was phenotypically similar to that
obtained from coexpression of monomers. Linked tetramers containing
GIRK1 and GIRK2wv in an alternating array gave rise to
wild-type, K+-selective currents. When two mutant
subunits were arranged adjacently in a tetramer, currents were
weaver-like. These results support the hypothesis that
in specific channel stoichiometries, GIRK1 rescues the
weaver phenotype and suggests a basis for the selective neuronal vulnerability that is observed in the weaver mouse.
Key words:
K+ channels; weaver mice; G-proteins; Xenopus
oocytes; voltage clamp; neurons
 |
INTRODUCTION |
Members of the family of G-protein
activated, inwardly rectifying K+
channels, GIRK1-5, have been cloned and characterized in a number of
heterologous expression systems (Kubo et al., 1993a ; Dascal, 1997 ; Jan
and Jan, 1997a ) where their activity is similar to that characterized
in native heart and nerve cells (Dascal et al., 1993 ; Kofuji et al.,
1995 ; Krapivinsky et al., 1995 ; Lesage et al., 1995 ). Functional
recombinant channels are assumed to assemble as heterotetrameric
polypeptides usually formed through the interaction of GIRK1 with
either GIRK2 or GIRK3 in the brain, or GIRK4 in the atrium of the heart
(Lesage et al., 1994 ; Kofuji et al., 1995 ; Krapivinsky et al., 1995 ;
Lesage et al., 1995 ). The single amino acid mutation in the
K+ channel signature sequence in the P
region of GIRK2 (G156S) identified in the weaver mouse
(Patil et al., 1995 ) has been shown to result in a constitutive
Na+ conductance after heterologous
expression in Xenopus oocytes (Kofuji et al., 1996 ; Navarro
et al., 1996 ; Slesinger et al., 1996 ) and mammalian cells (Navarro et
al., 1996 ).
The weaver phenotype has provided a classic paradigm for
developmental neurobiology and also serves as a model system for studying neurodegenerative disease (Rakic and Sidman, 1973 ; Schmidt et
al., 1982 ; Hatten et al., 1984 ; Goldowitz, 1989 ; Smeyne and Goldowitz,
1989 ; Graybiel et al., 1990 ; Gao and Hatten, 1993 ; Bayer et al., 1995 ;
Goldowitz and Smeyne, 1995 ; Patil et al., 1995 ; Hess, 1996 ; Migheli et
al., 1997 ). In this study, we demonstrate that rescue of the
weaver phenotype may involve formation of heteromultimeric channels between mutant GIRK2wv subunits and wild-type GIRK1
subunits that function normally. Heteromultimeric channels between
mutant GIRK2wv subunits and GIRK2 or 3 retain their
weaver phenotype. Therefore, susceptibility to cell death
among different populations of neurons in the brain may result from
differences in expression of GIRK subunit isoforms among the different
neuronal populations.
We undertook these studies in an attempt to explore the functional
relationships between GIRK channel subunits. Because GIRK2 is
ubiquitously expressed in the brain, we reasoned that insight into
interaction of both the wild-type GIRK2 and the mutant
GIRK2wv subunit might suggest a mechanistic basis for the
selective loss of a subset of cerebellar as well as substantia nigra
neurons in the weaver mouse (Surmeier et al., 1996 ).
GIRK1/GIRK2wv heteromultimeric currents are
G-protein-dependent and K+-selective in
contrast to GIRK2/GIRK2wv or GIRK3/GIRK2wv
heteromultimeric channels, which retain the characteristic
nonselective, G-protein-independent weaver phenotype.
Tandem-linked tetramers containing GIRK1 and GIRK2wv
subunits in an alternating array formed functional
K+-selective, G-protein-dependent
channels. When two mutant subunits were arranged adjacent in a
tetramer, resultant expressed currents were weaver-like. In
summary, these data suggest that susceptibility to cell death among
different types of neurons may result from differences in expression of
GIRK subunit isoforms available for heteromultimer formation among the
different neuronal populations.
 |
MATERIALS AND METHODS |
DNA clone. GIRK1 was cloned from a rat insulinoma
tumor cell (RIN) library and has a predicted amino acid sequence
identical to the cardiac clone originally described (Kubo et al.,
1993b ); GIRK2 and GIRK2wv, GIRK3, and GIRK5, were generous
gifts from Drs. P. Kofuji (California Institute of Technology,
Pasadena, CA), A. Karschin (Max-Planck-Institute, Göttingen,
Germany), and D. Clapham (Children's Hospital/Howard Hughes Medical
Institute, Boston, MA), respectively. The m2 muscarinic receptor was
purchased from Clontech (Palo Alto, CA) in the pGEM3Z vector. All GIRK
constructs were subcloned into the pMXT vector, obtained from Dr. P. Kofuji (California Institute of Technology). The m2 receptor was
linearized with HindIII, and cRNA was transcribed using the
T7 polymerase mMessage mMachine kit (Ambion, Austin, TX). All GIRK
constructs were linearized with SalI, and cRNA was
transcribed using T3 polymerase mMessage mMachine kit (Ambion). The
cRNA concentration was determined by UV absorption
(A260) and confirmed by intensity on ethidium bromide-stained agarose gels.
Multimeric GIRK constructs. To allow simple construction of
a variety of multimers, we followed an approach previously described by
Silverman et al. (1996b) . Two new unique restriction enzyme sites were
introduced by PCR in GIRK1, GIRK2, and GIRK3 at both the 5' and 3' ends
of the coding sequences, such that digestion with appropriate
restriction enzymes would provide compatible overhangs between the 3'
end of one coding sequence and the 5' end of the other. GIRK1, with 5'
ClaI and 3' XbaI sites, was ligated to GIRK2 or
GIRK2wv with 5' XbaI and 3' NotI
sites, which allowed construction of the GIRK1-2 and
GIRK1-GIRK2wv dimer sequences. Ligation of GIRK2 or GIRK3
with 5' ClaI and 3' XbaI sites to
GIRK2wv with 5' XbaI and 3' NotI sites
resulted in GIRK2-GIRK2wv or GIRK3-GIRK2wv dimer
sequences. Two new residues (serine and arginine) were introduced at
the junctions within all the dimers. The dimer sequences were subcloned
into pMXT vector at the ClaI and NotI multiple
cloning sites. The primers were synthesized at the Howard Hughes
Medical Institute (HHMI; University of Chicago, Chicago, IL). Primer
sequences were as follows: GIRK1, 5' ClaI,
GCGCATCGATATGTCTGCACTCCGAAGG; GIRK1, 3' XbaI, TGC
TCTAGACTGCAGGGACCCCTC; GIRK2, 5' ClaI,
GCGCGCATCGATATGACAATGGCCAA; GIRK2, 3' XbaI,
TGCTGCTCTAGACCCATTCCTCTCC; GIRK2, 5' XbaI,
CGCGGCTCTAGAATGACAATGGCCAA; GIRK2, 3' NotI,
AATATTGCGGCCGCTCACCCATTAATC; GIRK2wv, 5' XbaI, CGCGGCTCTAGAATGACAATGGCCAA; GIRK2wv, 3' NotI,
AATATTGCGGCCGCTCACCCATTAATC; GIRK3, 5' ClaI,
GCGCATCGATATGGCGCAGGAGAACGC; and GIRK3, 3' AvrII, TATATACCTAGGGCTCCATCTCCTGCG.
The linked heterotetramers,
GIRK1-GIRK2wv-GIRK1-GIRK2wv
(1-wv-1-wv) and
GIRK1-GIRK1-GIRK2wv-GIRK2wv
(1-1-wv-wv), were constructed by removing the
stop codons of the dimeric constructs GIRK1-GIRK2wv (1-wv) and GIRK1-GIRK1 (1-1) in pMXT vector using
site-directed mutagenesis (Promega, Madison, WI) while introducing a
new NarI restriction enzyme site. The 1-wv or
wv-wv dimers with and 3' NotI sites
were linked to 1-wv or 1-1 dimers at NarI
and NotI sites. The primers were synthesized at Operon
(Alameda, CA). Primer sequences were as follows: 1-wv NarI,
GGCGGCGGCGCCCCCATTCCTCTCCGTCAGTTCTT; and 1-1 NarI, TAACCAGATCCGCGGTGGCGGCGGCGCCCTGCAGGGA.
The junction sequences of all linked constructs were verified by
automated fluorescent cycle sequencing (DNA Sequencing Facility at The
University of Chicago Cancer Research Center).
Oocyte preparation and injection. Oocytes were removed from
Xenopus laevis as described (Yoshii and Kurihara, 1989 ) and
maintained at 18°C in OR-2+ solution that was changed once daily. The
OR-2+ solution contained (in mM) 90 NaCl, 1 MgCl2, 1 CaCl2, 2.5 KCl, and 5 HEPES, supplemented with 100 µg/ml gentamycin and 5 mM pyruvate, pH 7.6. Oocytes injected with
GIRK2wv cRNA were incubated in
Ca2+-free OR-2+ solution, which has been
shown to enhance cellular survival by preventing possible swelling and
Ca2+ overload (Silverman et al., 1996a ).
In those experiments investigating the effects of free
G on basal current activity, oocytes were
maintained in a high glucose (5 mM)-containing
solution. Oocytes were injected with 50 nl containing constant amounts
of each single subunit cRNA (~5 ng), m2 receptor (~2.5 ng) together with 12.5 ng of fully phosphothiolated GIRK5 antisense oligonucleotide KHA1 (5'-CTGAGGACTTGGTGCCATTCT-3') prepared at HHMI.
Electrophysiology. Two-electrode voltage recordings were
performed 2-3 d after injection at room temperature using a TURBO TEC-10C amplifier (NPI, Tamm, Germany), ITC-16 interface (Instrutech, Great Neck, NY), and IBM-compatible PC. Microelectrodes were filled with 3 M KCl and had resistances of 0.5-2 M .
Oocytes were continuously superfused with a bath solution of 90 mM NaCl or KCl, 1 mM
MgCl2, and 5 mM HEPES, pH 7.6, with
NaOH/KOH. G-protein-dependent currents were induced with the addition
of 5 µM carbachol (Sigma, St. Louis, MO) to the bath
solution. In all experiments, the holding potential was 80 mV; test
potentials were delivered once every second and stepped between 150
and 50 mV in intervals. Data collection and analysis were performed
using Pulse/Pulse Fit (Heka, Lambrecht, Germany), and data were plotted
using the integrated graphics package Igor (WaveMetrics, Lake Oswego,
OR). Data are presented as mean ± SEM with the number of oocytes
in parentheses. All experiments were conducted at room temperature.
Gs protein purification. Expression of
the N-terminal hexohistidine-tagged short form of
Gs was performed in Escherichia coli BL21(DE3) that carried pUBS520 and
H6-pQE60-Gs grown to cell density of OD
600 = 0.4 at 30°C and induced by adding IPTG and
chloramphenical to a final concentration of 30 and 1 µM, respectively. The expression of dna Y from
pUBS520 enhanced Gs expression threefold to
fourfold. After a 19 hr induction period, E. coli were
harvested and lysed; Gs was purified using the
nickel-nitrilotriacetic acid (Ni-NTA) and FPLC Q-Sepharose column as
described (Lee et al., 1994 ). Coomassie blue staining of SDS-PAGE was
used to determine the protein peak in the fractions eluted from the
Q-Sepharose column. The purified Gs was
concentrated by pressure filtration using an Amicon 30 filter and
centricon, and the protein concentration was determined using the
Bradford reagent and bovine serum albumin as a standard (Bradford,
1976 ).
 |
RESULTS |
Coexpression of monomeric GIRK subunits in
Xenopus oocytes
Expression of recombinant GIRK channels was studied in
Xenopus oocytes after injection of GIRK1, GIRK2, GIRK3, and
GIRK5 subunit cRNA or combinations of two isoforms along with m2,
muscarinic receptor cRNA. In all experiments, G-protein-independent
(basal) as well as G-protein-dependent (carbachol-induced) currents
were recorded in solutions containing 90 mM
K+. Currents were recorded at 36-72 hr
after injection. Experiments were replicated in at least three batches
of oocytes.
Recombinant GIRK subunits coassemble with endogenous Xenopus
GIRK5 subunits to form functional channels (Hedin et al., 1996 ). Antisense against GIRK5 (KHA1) has been previously reported to knock
out endogenous GIRK5 expression in oocytes (Silverman et al., 1996b ).
We conducted experiments to compare levels of homomeric GIRK subunit
expression in the presence and absence of coinjected antisense against
GIRK5. In addition, we examined the synergistic enhancement of
homomeric GIRK subunit expression in the presence of coexpressed GIRK5.
Data comparing carbachol-induced current amplitude to basal current
amplitude in high K+ solutions for GIRK1,
GIRK2, and GIRK3 are summarized in Table 1. Current expression is synergistically
enhanced for GIRK1 and GIRK2 isoforms in the presence of the endogenous
Xenopus subunit GIRK5 and reduced in the presence of
antisense against GIRK5 (Fig. 1).
View this table:
[in this window]
[in a new window]
|
Table 1.
Homomeric expression of GIRK1, GIRK2, and GIRK3 is
inhibited in the presence of antisense to GIRK5 and synergistically
enhanced when coexpressed with cloned GIRK5
|
|

View larger version (22K):
[in this window]
[in a new window]
|
Figure 1.
G-protein-dependent and independent
K+ current activation in oocytes injected with cRNA
for GIRK1, 2, and 3 as well as combinations of GIRK1, GIRK2, or GIRK3
with GIRK5 or antisense for GIRK5. Currents were recorded using a
two-microelectrode voltage clamp from oocytes injected with cRNA for
the m2 muscarinic receptor, GIRK1, 2, 3, and 5, and GIRK5 antisense
oligonucleotide KHA1, as described in Materials and Methods. Currents
were recorded from a holding potential of 80 mV in response to step
voltages between 150 and 50 mV in 20 mV increments, the interval
between steps was 1 sec. The basal current was determined in a solution
in which all the Na+ was isosmotically replaced with
K+; G-protein current activation was determined in
response to 5 µM carbachol added to the extracellular
solution. Bars represent a summary of current data at 150 mV for all
subunit combinations recorded 72 hr after injection for both basal
K+ and total current (basal plus carbachol-induced
in high K+ solutions). Bars represent mean ± SEM measure at 150 mV.
|
|
Comparative current amplitudes recorded after coexpression of GIRK1
with GIRK2 or GIRK3 are summarized in Figure
2. Coexpression of GIRK2 and GIRK3 failed
to result in the formation of functional heteromultimeric channels.
Expression of recombinant GIRK1 + GIRK2 and GIRK1 + GIRK3 resulted in
both agonist-independent and carbachol-induced currents in high
K+ solutions.

View larger version (32K):
[in this window]
[in a new window]
|
Figure 2.
G-protein-dependent and independent
K+ current activation in oocytes injected with cRNA
for combinations of GIRK1 + GIRK2 or GIRK 3. Currents in this figure
and all succeeding figures were recorded as in Figure 1. The basal
current recorded in a solution in which all the Na+
was isosmotically replaced with K+; the total
current (G-protein-dependent plus independent current) was determined
in response to 5 µM carbachol added to the extracellular
solution. A, Representative carbachol-induced
K+ current from oocytes injected with either GIRK1 + 2 or GIRK 1 + 3, as indicated. B, The corresponding
current-voltage (I-V) relationships for the
G-protein-independent (Basal) and
G-protein-dependent (Carb-induced) currents seen in
A. C, Summary of current data at 150 mV
for all subunit combinations determined 72 hr after injection for both
basal K+ (solid bars) and total
current (white bars). Bars represent mean ± SEM
based on recordings from 10-40 oocytes taken from at least three
batches.
|
|
Selectivity of heteromultimeric GIRK2wv channel is controlled by
GIRK1 subunit association
To determine whether GIRK2wv forms functional
heterooligomers, we performed coexpression experiments with wild-type
GIRK1, 2, or 3. GIRK2wv was coinjected at a ratio of 1:1
with wild-type cRNA. The selectivity of both the basal as well as the
carbachol-induced current is compared for each of the coexpression
studies in Figure 3. When GIRK1 was
coexpressed with GIRK2wv, currents resembled those obtained
after coexpression of GIRK1 with GIRK2 in that (1) the
G-protein-independent current was
K+-selective and (2) there was a
significant amount of K+-selective
carbachol-induced current. When GIRK2 was coexpressed with
GIRK2wv, both basal- and carbachol-induced
K+ currents were significantly reduced as
compared to GIRK1 + GIRK2wv expression. GIRK3 coexpression
with GIRK2wv resembled GIRK2wv homomeric currents
in that the G-protein-independent component was nonselective, and the
carbachol-sensitive component was absent. Data for the
GIRK2wv coexpression studies are compared and summarized in
Figure 3C.

View larger version (33K):
[in this window]
[in a new window]
|
Figure 3.
The selectivity of heteromultimeric channels in
coexpression experiments using wild-type cRNA for GIRK1, GIRK2, or
GIRK3 with GIRK2 wv (wv) is determined by
the wild-type coexpressed species. Currents were recorded as in Figure
1. A, B, Averaged I-V
relationships determined for basal- and carbachol-induced currents.
Current amplitude was determined 92 msec after the initiation of the
voltage pulse. C, Summary of the average current data
taken from the experiments in A and B. A
total of 10-40 oocytes taken from at least three batches were used for
each experimental condition.
|
|
The presence of GIRK1, not the number of wv subunits, determines
channel phenotype
The family of GIRK channels appears to form functional tetramers
(Dascal, 1997 ; Jan and Jan, 1997b ; Corey et al., 1998 ). Therefore, functional channels in coexpression experiments may exist in several possible channel stoichiometries. To constrain the possible functional combinations, we constructed and expressed heterodimers containing a
GIRK2wv subunit. The selectivity of the heterodimer
recombinant currents is shown in Figure
4. A comparison of the basal as well as
the carbachol-induced current for the dimeric constructs was compared
to that obtained for expression of GIRK2wv monomers. We
found that the GIRK1-wv dimer showed a phenotypic profile
that resembled the wild-type GIRK1-2 dimer currents with respect to (1) an insignificant basal Na+
permeability and (2) an equivalent basal- and carbachol-induced K+ current. However, more importantly,
both GIRK2-wv and GIRK3-wv dimer constructs gave
rise to a basal or G-protein independent Na+ current and no carbachol-induced
K+ current, a phenotypic profile that was
identical to the GIRK2wv monomeric currents. Each of the
dimeric constructs presumably gave rise to tetrameric channels
containing two GIRK2wv subunits with two possible
stoichiometries where identical subunits were positioned either across
from or adjacent to each other. Current phenotypes determined by
selectivity as well as G-protein dependence differed according to the
wild-type subunit linked to GIRK2wv subunit as summarized in
Figure 4C.

View larger version (33K):
[in this window]
[in a new window]
|
Figure 4.
Expression of dimeric constructs containing
wild-type GIRK1, GIRK2, or GIRK3 subunits linked to
GIRK2wv (wv) leads to functional channel
expression. The presence of GIRK1 in functional channels determined
channel selectivity and G-protein dependence. Currents were recorded as
in Figure 1. A, B, The
I-V relationships for recombinant channel currents
determined 92 msec after the initiation of the voltage pulse for 8-22
oocytes pooled from three batches for each experimental condition.
C, Summary of mean current amplitude of the basal- and
carbachol-induced currents measured at 150 mV in oocytes expressing
indicated dimers.
|
|
GIRK2wv subunit stoichiometry and positional effects
The selectivity and G-protein dependence of the currents obtained
from the dimer expression experiments strongly resembled data obtained
in the coexpression studies. This may reflect that subunit coassembly
may not be random but involve a preferred arrangement around the pore.
To date, studies on the stoichiometry of GIRK channels have relied on
the formation of multimeric concatemers. This approach has been
successfully used to constrain the stoichiometry and relative position
of both voltage-gated and inwardly rectifying K+ channel subunits (Liman et al., 1992 ;
Yang et al., 1995 ; Silverman et al., 1996b ; Tucker et al., 1996 ).
Following this approach, we linked GIRK1 and GIRK2wv
subunits into tetrameric constructs. The positional effect of the
GIRK2wv subunit was investigated using tetramers that
contained two mutant subunits in one of two alternate patterns.
Identical subunits were either adjacent
(1-1-wv-wv) or linked as an alternating array
(1-wv-1-wv). Data obtained from the expression of
the tetrameric constructs are compared with data from expression of
dimers and coexpression of monomers in Figure
5. The basal current for the
1-wv-1-wv tetramer was
K+-selective and resembled that obtained
for GIRK1 + GIRK2wv coexpression and GIRK1-wv
dimer expression. In contrast, the 1-1-wv-wv
basal currents were nonselective and were similar to monomeric
GIRK2wv currents (Fig. 5A). The relative
amplitude of the carbachol-induced currents in
Na+ versus K+
containing solutions for all the aforementioned constructs is compared
in Figure 5B. The expression of
1-wv-1-wv resulted in a significant
G-protein-dependent K+-selective current
( 1.3 ± 0.2 µA at 150 mV; n = 16) when
compared to that obtained for the 1-1-wv-wv
tetramer (-0.6 ± 0.12 µA at 150 mV; n = 12)
as seen in Figure 5B. Overall, the expression levels of
1-1-wv-wv were comparable to that obtained for
the GIRK2wv homomultimeric current.

View larger version (26K):
[in this window]
[in a new window]
|
Figure 5.
Comparison of current amplitude for expression of
dimeric versus tetrameric constructs. In these experiments, the
arrangement of the mutant subunit around the central pore appeared to
determine channel selectivity, G-protein dependence, as well as
Ba2+ sensitivity. Current means represent an average
of >10 oocytes for each experimental condition as indicated in each
panel. A, Summary of mean basal current amplitude at
150 mV for each of the experimental conditions as indicated.
B, Summary of the mean carbachol-induced current in high
Na+ versus high K+ solutions.
C, Summary of the fraction the total current in high K
+ inhibited by 500 µM
Ba2+; GIRK1+2 was 0.84 ± 0.02 (15);
1+wv, 0.78 ± 0.01 (10); 1-wv,
0.83 ± 0.04 (10); 1-wv-1-wv,
0.53 ± 0.03 (16); 1-1-wv-wv,
0.11 ± 0.05 (12); and wv, 0.11 ± 0.1 (18).
D, Comparison of the fraction of total current in high
K+ solutions inhibited at increasing concentrations
of external Ba2+ for coexpression of GIRK1 + GIRK2
and GIRK2wv.
|
|
The pharmacological sensitivity to block by 500 µM
external Ba2+ for both concatameric as
well as monomeric constructs is compared in Figure 5, C and
D. Ba2+ sensitivity is
expressed as the fraction of the total current in high
K+ solutions (carbachol-sensitive plus
insensitive K+-selective current)
inhibited after exposure to 500 µM
Ba2+. Currents obtained after
coexpression of GIRK1 with GIRK2wv and the
1-wv-1-wv tetramer maintained their
Ba2+ sensitivity. The tetrameric
1-1-wv-wv currents were insensitive to 500 µM Ba2+, similar
to GIRK2wv homomultimeric channels. A comparison of the
Ba2+ sensitivity for wild-type
heteromultimeric GIRK1/GIRK2 and homomultimeric GIRK2wv
channels is given in Figure 5D in which the
Ba2+-sensitive current is expressed as a
fraction of the total current in high K+ solutions.
The possible channel stoichiometries in each of the GIRK2wv
expression experiments summarized in Figure 5 are depicted graphically in Figure 6. Note that dimeric
GIRK1-GIRK2wv expression could yield two theoretically
possible tetrameric stoichiometries. Expression of the linked
tetramers, which would give rise to both of the possible
stoichiometries, gives currents that are separable on the basis of
their G-protein sensitivity and basal Na+
conductance. Thus, the sum of the tetrameric currents does not give rise to a current that resembles the currents obtained by expression of the GIRK1-GIRK2wv heterodimer. These results
suggest that the tetramer with two adjacent GIRK2wv subunits
is not the preferred stoichiometry in the expression of
heterodimers.

View larger version (10K):
[in this window]
[in a new window]
|
Figure 6.
Schematic representation of the possible channel
stoichiometries in the coexpression of monomeric subunit cRNA as
compared to expression of linked dimers and tetramers. A table
summarizing the resultant current selectivity and G-protein dependence
for the expressed currents is given to the right of the
representative functional channel configurations. The open
circles represent the GIRK1 subunit, and the filled
circles represent the GIRK2 wv subunit. The
abbreviations used in the text to describe the recombinant channel
constructs are given to the left of the schematized
channels.
|
|
Comparative basal activation in high K+ for
wild-type GIRK1/GIRK2 channels versus GIRK1-GIRK2wv dimers
The basal current in high K+
solutions was elevated for GIRK1 + GIRK2 heteromultimers (Figs.
2C, 3C), for GIRK1 + GIRK2wv (Fig. 3C), and for the dimeric construct GIRK1-GIRK2wv
(Fig. 4). Such high levels of basal current activation does not occur
in isolated neurons expressing GIRK channels (Surmeier et al., 1996 ;
Slesinger et al., 1997 ; Rossi et al., 1998 ). It has been proposed that
the high levels of basal activation seen with GIRK expression in the Xenopus oocyte expression system is a result of high levels
of intracellular Na+ (Silverman et al.,
1996a ) or high levels of free G (Vivaudou
et al., 1997 ). In that the K+ over
Na+ selectivity of the
GIRK1/GIRK2wv heteromultimers served as an indicator of
wild-type GIRK current, we performed experiments to determine if basal
K+ current of channels containing the
mutant subunit were differentially sensitive to free
G . Oocytes expressing either GIRK1 + GIRK2,
the dimer GIRK1-GIRK2wv, or GIRK2wv were examined
for current expression 36 hr after cRNA injection. Oocytes were
maintained in solutions in high glucose (5 mM),
low K+ (2.5 mM)
solutions. Recordings were made in solutions in which all the
Na+ was replaced with either the large
impermeant cation N-methyl-D-glucamine (NMDG) or 90 mM K+.
Approximately 30 min before recording, half of the oocytes were injected with 50 nl of purified Gs (40 µg/µl) to serve as a G sink. The
amplitude of the basal- and carbachol-induced current amplitude was
compared for all the constructs and is summarized in Figure
7.
Na+-selective currents were also
determined for the GIRK2wv homomultimeric currents. The
GIRK2wv homomultimeric currents were unchanged in the
presence of Gs . The GIRK1 + GIRK2 currents as
well GIRK1-GIRK2wv dimer currents responded to injection of
the Gs by a significant decrease in the
carbachol-induced current and a more modest decrease in the basal
current. Thus, the two heteromultimeric channel constructs were
indistinguishable based on their sensitivity of the basal K+ current to free circulating
G .

View larger version (17K):
[in this window]
[in a new window]
|
Figure 7.
Comparative regulation of G-protein-independent
current for wild-type GIRK1/GIRK2, GIRK1-GIRK2wv dimers
and GIRK2wv homomeric channels by circulating
intracellular levels of free G . Oocytes were
incubated in glucose-containing solutions (see Materials and Methods)
and injected with purified Gs 20 min before recording,
as described in Materials and Methods. Relative current
amplitudes of basal- and carbachol-induced currents were under
conditions of low intracellular-free G and compared
to currents recorded under control conditions. Mean peak current was
determined at 150 mV in high K+ solutions for six
to eight oocytes pooled from two batches for each of the experimental
conditions as indicated.
|
|
 |
DISCUSSION |
In this report, we demonstrate that GIRK1 is capable of forming
heteromultimeric channels with GIRK2wv in monomer
coexpression studies as well as in linked concatemers. The presence of
GIRK1 in a tetrameric GIRK1/GIRK2wv channel rescued the
wild-type GIRK1/GIRK2 heteromultimeric phenotype, restoring
K+ selectivity and G-protein-dependent
current activation. Furthermore, the position of two GIRK2wv
subunits within linked concatemers appears to determine current
selectivity and G-protein dependence. GIRK2 and GIRK3 formed functional
heteromultimeric channels with GIRK2wv; however, the
heteromultimeric complexes retained GIRK2wv homomultimeric
channel properties.
Our studies differ from those of Slesinger et al. (1996) , who reported
that expression of monomeric GIRK1 and GIRK2wv gave rise to
a significant decrease in the amplitude of the agonist-independent basal Na+ as well as
K+ currents over that observed for oocytes
expressing GIRK2wv alone. In their studies, a
GIRK2wv construct was used in which the first nine amino
acids were deleted. The truncation of the first nine amino acids in
GIRK2wv may have reduced the mutant subunit affinity for
heteromultimer formation, thereby, giving rise to the difference in
current expression between the two studies. In addition, our studies,
unlike those of Slesinger et al. (1996) , included antisense against the
endogenous GIRK5. The presence of GIRK5 in their studies may have also
contributed to heteromultimer formation with GIRK2wv, thereby competing with GIRK1 as a companion subunit.
In our studies, GIRK1, GIRK2, and GIRK3 failed to form functional
homomeric channels when expressed either as monomers (Fig. 1) or dimers
(data not shown). The apparent discrepancy between our data and the
data reported in previous investigations in which expression of
homomultimeric GIRK1 and GIRK2 was obtained may be caused by
significant amounts of coassembly with the endogenous Xenopus GIRK5 (Kofuji et al., 1995 , 1996 ; Slesinger et al.,
1996 ) or coexpression with G ,which has been
reported to increase current levels 16-fold above activation through
the m2 receptor alone (Velimirovic et al., 1996 ). The small but
detectable (280 ± 30 nA) carbachol-sensitive current that we
observed for GIRK2 coexpressed with GIRK5 antisense may represent GIRK2
homomultimeric current in our experiments.
GIRK1 appears to be necessary but not sufficient for channel formation.
The other interacting subunits, GIRK2, GIRK3, and GIRK4, appear to lend
subtle differences in conductance or open state probability to the
functional channel depending on number or position within the
heterotetrameric complex. Data in support of this hypothesis come from
studies of GIRK1 and GIRK4 in which current expressed from linked
concatemers was maximized when channels were comprised of alternating
subunits within the tetramers (Silverman et al., 1996b ; Tucker et al.,
1996 ; Corey et al., 1998 ). The positional studies of GIRK1 and GIRK4 in
linked concatemers (Silverman et al., 1996b ; Tucker et al., 1996 ; Corey
et al., 1998 ) suggested that the position of multiple subunits of
GIRK2wv within a heterotetramer might play a similar
role in the determination of channel selectivity and G-protein dependence.
Unlike GIRK1, GIRK3 does not enhance either GIRK2 or GIRK2wv
current expression. In addition, GIRK3 does not seem to form functional
heterotetramers with GIRK5 (Table 1). Therefore, GIRK3 seems to form
heterotetramers exclusively with GIRK1.
Positional effects of GIRK2wv on channel selectivity and G-protein
dependence within a tetramer
Expression of the GIRK1 and GIRK2wv tetrameric
constructs yielded currents with biophysical signatures dependent on
the position of the mutant subunits in the tetramer. The
1-wv-1-wv tetramer currents were
G-protein-dependent and K+-selective. On
the other hand, 1-1-wv-wv tetramer currents were associated with a high basal Na+ current
and only a modest G-protein-dependent current in high K+ solutions (Fig. 5A,B).
The most parsimonious explanation for the current data obtained from
the tetrameric constructs relies on the assumption that when subunit
DNA is fixed in a concatameric array, subunit proteins will align in
the same manner in the membrane. Although highly likely, one could
imagine an alternative scenario, whereby, the concatenated
1-1-wv-wv sequence of cDNAs could give rise to
subunits that arrange 1-wv-1-wv with the long
cytoplasmic segments connecting C to N termini twisted and interwoven.
The abnormal arrangement of the C- and N-termini could provide an
alternate explanation for the aberrant channel behavior observed with
the 1-1-wv-wv construct.
Tetramers containing at least two nonweaver subunits
restore K+ selectivity and G-protein sensitivity
Previous coexpression studies of GIRK1 and GIRK2wv
monomers in oocytes have yielded conflicting results that could
possibly be accounted for, in part, by subtle experimental differences in relative subunit concentrations. Kofuji et al. (1996) found that
oocyte coexpression of GIRK1 with GIRK2wv gave rise to
currents that were similar in selectivity and G-protein sensitivity to GIRK2wv homomultimeric currents. In other studies,
coexpression of GIRK2wv with GIRK1 at a ratio of coinjected
cRNA of 1:1 led to a reduction in both basal- and carbachol-induced
currents, compared to oocytes expressing GIRK1 + GIRK2 (Slesinger et
al., 1996 ). In contrast, our coexpression studies of GIRK2wv
with GIRK1 at 1:1 ratio of injected cRNA gave rise to basal- and
carbachol-induced K+ currents with
negligible Na+ permeability (Fig.
3C), and expression of GIRK1-GIRK2wv dimer showed
current selectivity and G-protein dependence similar to expression of
the GIRK1-GIRK2 dimer and the coexpression of monomers (Fig.
4C).
Correlation between cell survival and GIRK1 expression in the
weaver mouse brain
It is our hypothesis that susceptibility to cell death among
populations of neurons in the weaver mouse may result from
differential isoform expression and, therefore, the availability of
GIRK subunits to form functional channels. In that the homomultimeric
GIRK2wv channel is the most pathological, our hypothesis
would predict that cell death would be highest in those neurons that
demonstrate the highest levels of GIRK2 expression. Substantia nigra
(SN) is the primary target for cellular degeneration in the
weaver mouse (Table 2), in
which GIRK2 protein expression is highest and in which there is a
considerable reduction in both GIRK2-positive cells as well as cell
number with increasing age (Liao et al., 1996 ). Within the SN, the
strongest GIRK2 expression was seen in the pars compacta, the region
most vulnerable to cell death. The more laterally placed neurons in SN
pars lateralis, which do not stain for GIRK2 protein expression, are
for the most part spared in weaver homozygotes (Graybiel et
al., 1990 ; Liao et al., 1996 ; Roffler-Tarlov et al., 1996 ; Wei et al.,
1997 ; Schein et al., 1998 ). Thus, in the SN there is a direct
correlation between the magnitude of GIRK2 expression and cell
death.
The early cytoarchitectural studies of the weaver mouse
cerebellum conducted by Herrup and Trenkner (1987) revealed an apparent gradient in cell death with the selective loss of granule cells only in
the medial cerebellum with a substantial number surviving in the
lateral cerebellar cortex. Patterns of protein expression for the
mutant GIRK2 protein in the weaver mouse have since provided an explanation for their initial observations. Schein et al. (1998) observed that Purkinje cells of the lateral cerebellum expressed little
GIRK2 and were also spared. However, there was selective loss of
Purkinje cells in the midline, which correlated with enhanced an
expression of GIRK2. Corroborating studies carried out by Schlesinger et al. (1996) on the highly vulnerable, developing weaver
mouse cerebellar Purkinje cells also demonstrated expression of GIRK2 but not GIRK1.
The loss of granule cells in the external germinal layer, the internal
granular layer, and the deep cerebellar nuclei of the cerebellum in the
weaver mouse that express both GIRK1 and GIRK2 would, at
first examination, appear to be an exception to our hypothesis, i.e.,
that elevated levels of GIRK1/GIRK2wv expression might spare
neurons through the formation of functional heteromultimeric channels.
The apparent inconsistency could be accounted for on a number of
levels. The weaver mutation could quantitatively exert variable toxicity in different neuronal populations depending on
relative levels of protein expression with respect to wild-type isoforms e.g., GIRK1 (Liao et al., 1996 ; Roffler-Tarlov et al., 1996 ;
Wei et al., 1997 ; Schein et al., 1998 ). The mutant toxicity could also
be a function of the splice variant of GIRK2 which is expressed
within a given region. To date, five splice variants of GIRK2 have been
reported: GIRK2-1, GIRK2A (A1 and A2), GIRK2B, and GIRK2C (Isomoto et
al., 1996 ; Wei et al., 1998 ). Wei et al (1998) detected strong
expression of GIRK2B and GIRK2C in the cerebellum and suggested that
their respective proteins may play prominent roles in the
mutation-induced pathology of the weaver mice. Isomoto et
al. (1996) demonstrated that GIRK2B forms functional homomultimers. By
analogy, GIRK2C may also form a functional channel. Based on their
observations, we speculate that the weaver mutant forms of
GIRK2B and 2C strongly expressed in the cerebellar granule cells may
have a higher affinity for the formation of homomultimeric mutant
channels than heterooligomers with GIRK1, thereby giving rise to
enhanced cell death.
In summary, our study addresses the issue of stoichiometric and
functional relationships between GIRK channel subunits. Our results
constitute strong evidence that GIRK1 forms heteromultimeric channels
with GIRK2wv, restoring G-protein sensitivity and
K+ selectivity and thereby suppressing the
lethal weaver phenotype. Thus, different susceptibilities to
cell death among different populations of neurons may result from
differences in ratio of expression of GIRK subunit isoforms among the
different neuronal populations.
 |
FOOTNOTES |
Received May 19, 1999; revised July 16, 1999; accepted July 22, 1999.
This work was supported by National Institutes of Health Grants RO1
GM36823 and RO1 GM 54266. We thank Drs. Aaron P. Fox, Henry A. Lester,
Anke Di, and Dorothy A. Hanck for many helpful discussions as well as
Clark Lin and Boris Krupa for technical assistance.
Correspondence should be addressed to Dr. Deborah J. Nelson, The
University of Chicago, Department of Neurobiology, Pharmacology, and
Physiology, 947 East 58th Street, MC 0926, Chicago,
IL 60637.
 |
REFERENCES |
-
Bayer SA,
Wills KV,
Triarhou LC,
Verina T,
Thomas JD,
Ghetti B
(1995)
Selective vulnerability of late-generated dopaminergic neurons of the substantia nigra in weaver mutant mice.
Proc Natl Acad Sci USA
92:9137-9140[Abstract/Free Full Text].
-
Bradford MM
(1976)
A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.
Anal Biochem
72:248-254[Web of Science][Medline].
-
Corey S,
Krapivinsky G,
Krapivinsky L,
Clapham DE
(1998)
Number and stoichiometry of subunits in the native atrial G-protein-gated K+ channel, IKACh.
J Biol Chem
273:5271-5278[Abstract/Free Full Text].
-
Dascal N
(1997)
Signalling via the G protein-activated K+ channels.
Cell Signal
9:551-573[Web of Science][Medline].
-
Dascal N,
Schreibmayer W,
Lim NF,
Wang W,
Chavkin C,
DiMagno L,
Labarca C,
Kieffer BL,
Gaveriaux-Ruff C,
Trollinger D,
Lester HA,
Davidson N
(1993)
Atrial G protein-activated K+ channel: expression cloning and molecular properties.
Proc Natl Acad Sci USA
90:10235-10239[Abstract/Free Full Text].
-
Gao W-Q,
Hatten ME
(1993)
Neuronal differentiation rescued by implantation of weaver granule cell precursors into wild-type cerebellar cortex.
Science
260:367-369[Abstract/Free Full Text].
-
Goldowitz D
(1989)
The weaver granuloprival phenotype is due to intrinsic action of the mutant locus in granule cells: evidence from homozygous weaver chimeras.
Neuron
2:1565-1575[Web of Science][Medline].
-
Goldowitz D,
Smeyne RJ
(1995)
Tune into the weaver channel.
Nat Genet
11:107-109[Web of Science][Medline].
-
Graybiel AM,
Ohta K,
Roffler-Tarlov S
(1990)
Patterns of cell and fiber vulnerability in the mesostriatal system of the mutant mouse weaver. I. Gradients and compartments.
J Neurosci
10:720-733[Abstract].
-
Hatten ME,
Liem RKH,
Mason CA
(1984)
Defects in specific associations between astroglia and neurons occur in microcultures of weaver mouse cerebellar cells.
J Neurosci
4:1163-1172[Abstract].
-
Hedin KE,
Lim NF,
Clapham DE
(1996)
Cloning of a Xenopus laevis inwardly rectifying K+ channel subunit that permits GIRK1 expression of IKACh currents in oocytes.
Neuron
16:423-429[Web of Science][Medline].
-
Herrup K,
Trenkner E
(1987)
Regional differences in cytoarchitecture of the weaver cerebellum suggest a new model for weaver gene action.
Neuroscience
23:871-885[Web of Science][Medline].
-
Hess EJ
(1996)
Identification of the weaver mouse mutation: the end of the beginning.
Neuron
16:1073-1076[Web of Science][Medline].
-
Isomoto S,
Kondo C,
Takkahashi N,
Matsumoto S,
Yamada M,
Takumi T,
Horio Y,
Kurachi Y
(1996)
A novel ubiquitously distributed isoform of GIRK2 (GIRK2B) enhances GIRK1 expression of the G-protein-gated K+ current in Xenopus oocytes.
Biochem Biophys Res Commun
218:286-291[Web of Science][Medline].
-
Jan LY,
Jan YN
(1997a)
Cloned potassium channels from eukaryotes and prokaryotes.
Annu Rev Neurosci
20:91-123[Web of Science][Medline].
-
Jan LY,
Jan YN
(1997b)
Voltage-gated and inwardly rectifying potassium channels.
J Physiol (Lond)
505:267-282[Abstract/Free Full Text].
-
Kofuji P,
Davidson N,
Lester HA
(1995)
Evidence that neuronal G-protein-gated inwardly rectifying K+ channels are activated by G
 subunits and function as heteromultimers.
Proc Natl Acad Sci USA
92:6542-6546[Abstract/Free Full Text]. -
Kofuji P,
Hofer M,
Millen KJ,
Millonig JH,
Davidson N,
Lester HA,
Hatten ME
(1996)
Functional analysis of the weaver mutant GIRK2 K+ channel and rescue of weaver granule cells.
Neuron
16:941-952[Web of Science][Medline].
-
Krapivinsky G,
Gordon EA,
Wickman K,
Velimirovic B,
Krapivinsky L,
Clapman DE
(1995)
The G-protein-gated atrial K+ channel IKACh is a heteromultimer of two inwardly rectifying K+ channel proteins.
Nature
374:135-141[Medline].
-
Kubo Y,
Baldwin TJ,
Jan YN,
Jan LY
(1993a)
Primary structure and functional expression of a mouse inward rectifier potassium channel.
Nature
362:127-133[Medline].
-
Kubo Y,
Reuveny E,
Slesinger PA,
Jan YN,
Jan LY
(1993b)
Primary structure and functional expression of a rat G-protein-coupled muscarinic potassium channel.
Nature
364:802-806[Medline].
-
Lee E,
Linder ME,
Gilman AG
(1994)
Expression of G-protein alpha subunits in Escherichia coli.
Methods Enzymol
237:146-164[Web of Science][Medline].
-
Lesage F,
Duprat F,
Fink M,
Guillemare E,
Coppola T,
Lazdunski M,
Hugnot J-P
(1994)
Cloning provides evidence for a family of inward rectifier and G-protein coupled K+ channels in the brain.
FEBS Lett
353:37-42[Web of Science][Medline].
-
Lesage F,
Guillemare E,
Fink M,
Duprat F,
Heurteaux C,
Fosset M,
Romey G,
Barhanin J,
Lazdunski M
(1995)
Molecular properties of neuronal G-protein-activated inwardly rectifying K+ channels.
J Biol Chem
270:28660-28667[Abstract/Free Full Text].
-
Liao YJ,
Jan YN,
Jan LY
(1996)
Heteromultimerization of G-protein-gated inwardly rectifying K+ channel proteins GIRK1 and GIRK2 and their altered expression in weaver brain.
J Neurosci
16:7137-7150[Abstract/Free Full Text].
-
Liman ER,
Tytgat J,
Hess P
(1992)
Subunit stoichiometry of a mammalian K+ channel determined by construction of multimeric cDNAs.
Neuron
9:861-871[Web of Science][Medline].
-
Migheli A,
Piva R,
Wei J,
Attanasio A,
Casolino S,
Hodes ME,
Dlouhy SR,
Bayer SA,
Ghetti B
(1997)
Diverse cell death pathways result from a single missense mutation in weaver mouse.
Am J Pathol
151:1629-1638[Abstract].
-
Navarro B,
Kennedy ME,
Velimirovic B,
Bhat D,
Peterson AS,
Clapham DE
(1996)
Nonselective and G
 -insensitive weaver K+ channels.
Science
272:1950-1953[Abstract]. -
Patil N,
Cox DR,
Bhat D,
Faham M,
Myers RM,
Peterson AS
(1995)
A potassium channel mutation in weaver mice implicates membrane excitability in granule cell differentiation.
Nat Genet
11:126-129[Web of Science][Medline].
-
Rakic P,
Sidman RL
(1973)
Sequence of developmental abnormalities leading to granule cell deficit in cerebellar cortex of weaver mutant mice.
J Comp Neurol
152:103-132[Web of Science][Medline].
-
Roffler-Tarlov S,
Martin B,
Graybiel AM,
Kauer JS
(1996)
Cell death in the midbrain of the murine mutation weaver.
J Neurosci
16:1819-1826[Abstract/Free Full Text].
-
Rossi P,
De Filippi G,
Armano S,
Taglietti V,
D'Angelo E
(1998)
The weaver mutation causes a loss of inward rectifier current regulation in premigratory granule cells of the mouse cerebellum.
J Neurosci
18:3537-3547[Abstract/Free Full Text].
-
Schein JC,
Hunter DD,
Roffler-Tarlov S
(1998)
GIRK2 expression in the ventral midbrain, cerebellum, and olfactory bulb and its relationship to the murine mutation weaver.
Dev Biol
204:432-450[Web of Science][Medline].
-
Schmidt MJ,
Sawyer BD,
Perry KW,
Fuller RW,
Foreman MM,
Ghetti B
(1982)
Dopamine deficiency in the weaver mutant mouse.
J Neurosci
2:376-380[Abstract].
-
Silverman SK,
Kofuji P,
Dougherty DA,
Davidson N,
Lester HA
(1996a)
A regenerative link in the ionic fluxes through the weaver potassium channel underlies the pathophysiology of the mutation.
Proc Natl Acad Sci USA
93:15429-15434[Abstract/Free Full Text].
-
Silverman SK,
Lester HA,
Dougherty DA
(1996b)
Subunit stoichiometry of a heteromultimeric G protein-coupled inward-rectifier K+ channel.
J Biol Chem
271:30524-30528[Abstract/Free Full Text].
-
Slesinger PA,
Patil N,
Liao YJ,
Jan YN,
Jan LY,
Cox DR
(1996)
Functional effects of the mouse weaver mutation on g protein-gated inwardly rectifying K+ channels.
Neuron
16:321-331[Web of Science][Medline].
-
Slesinger PA,
Stoffel M,
Jan YN,
Jan LY
(1997)
Defective
-aminobutyric acid type B receptor-activated inwardly rectifying K+ currents in cerebellar granule cells isolated from weaver and Girk2 null mutant mice.
Proc Natl Acad Sci USA
94:12210-12217[Abstract/Free Full Text]. -
Smeyne RJ,
Goldowitz D
(1989)
Development and death of external granular layer cells in the weaver mouse cerebellum: a quantitative study.
J Neurosci
9:1608-1620[Abstract].
-
Surmeier DJ,
Mermelstein PG,
Goldowitz D
(1996)
The weaver mutation of GIRK2 results in a loss of inwardly rectifying K+ current in cerebellar granule cells.
Proc Natl Acad Sci USA
93:1-5[Abstract/Free Full Text].
-
Tucker SJ,
Pessia M,
Adelman JP
(1996)
Muscarine-gated K+ channel: subunit stiochiometry and structural domains essential for G protein stimulation.
Am J Physiol
271:H379-H385[Abstract/Free Full Text].
-
Velimirovic BM,
Gordon EA,
Lim NF,
Navarro B,
Clapham DE
(1996)
The K+ channel inward rectifier subunits form a channel similar to neuronal G protein-gated K+ channel.
FEBS Lett
379:31-37[Web of Science][Medline].
-
Vivaudou M,
Chan KW,
Sui J-L,
Jan LY,
Reuveny E,
Logothetis DE
(1997)
Probing the G-protein regulation of GIRK1 and GIRK4, the two subunits of the KACh channel, using functional homomeric mutants.
J Biol Chem
272:31553-31560[Abstract/Free Full Text].
-
Wei J,
Dlouhy SR,
Bayer S,
Piva R,
Verina T,
Wang Y,
Feng Y,
Dupree B,
Hodes ME,
Ghetti B
(1997)
In situ hybridization analysis of GIRK2 expression in the developing central nervous system in normal and weaver mice.
J Neuropathol Exp Neurol
56:762-771[Web of Science][Medline].
-
Wei J,
Hodes ME,
Piva R,
Feng Y,
Wang Y,
Ghetti B,
Dlouhy SR
(1998)
Characterization of murine GIRK2 transcript isoforms: Structure and differential expression.
Genomics
51:379-390[Web of Science][Medline].
-
Yang J,
Jan YN,
Jan LY
(1995)
Determination of the subunit stoichiometry of an inwardly rectifying potassium channel.
Neuron
15:1441-1447[Web of Science][Medline].
-
Yoshii K,
Kurihara K
(1989)
Inward rectifier produced by Xenopus oocytes injected with mRNA extracted from carp olfactory epithelium.
Synapse
3:234-238[Web of Science][Medline].
Copyright © 1999 Society for Neuroscience 0270-6474/99/19198327-10$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
R. Sarac, P. Hou, K. M. Hurley, D. Hriciste, N. A. Cohen, and D. J. Nelson
Mutation of Critical GIRK Subunit Residues Disrupts N- and C-Termini Association and Channel Function
J. Neurosci.,
February 16, 2005;
25(7):
1836 - 1846.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Guatteo, F. R. Fusco, P. Giacomini, G. Bernardi, and N. B. Mercuri
The weaver Mutation Reverses the Function of Dopamine and GABA in Mouse Dopaminergic Neurons
J. Neurosci.,
August 15, 2000;
20(16):
6013 - 6020.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|