 |
 Previous Article | Next Article 
The Journal of Neuroscience, October 1, 1999, 19(19):8409-8418
Olfactory Neurons Expressing Closely Linked and Homologous
Odorant Receptor Genes Tend to Project Their Axons to Neighboring
Glomeruli on the Olfactory Bulb
Akio
Tsuboi1,
Sei-ichi
Yoshihara1,
Nika
Yamazaki2,
Hiroaki
Kasai2,
Hisae
Asai-Tsuboi2,
Madoka
Komatsu1,
Shou
Serizawa1,
Tomohiro
Ishii1,
Yoichi
Matsuda3,
Fumikiyo
Nagawa1, and
Hitoshi
Sakano1, 2
1 Department of Biophysics and Biochemistry, Graduate
School of Science, University of Tokyo, Tokyo 113-0032, Japan,
2 Department of Cell Biology, National Institute for Basic
Biology, Okazaki 444-8585, Japan, and 3 Laboratory of
Animal Genetics, Graduate School of Agricultural Sciences, Nagoya
University, Nagoya 464-8601, Japan
 |
ABSTRACT |
We have characterized two separate odorant receptor (OR) gene
clusters to examine how olfactory neurons expressing closely linked and
homologous OR genes project their axons to the olfactory bulb. Murine
OR genes, MOR28, MOR10, and MOR83, share 75-95% similarities in the
amino acid sequences and are tightly linked on chromosome 14. In
situ hybridization has demonstrated that the three genes are
expressed in the same zone, at the most dorsolateral and ventromedial portions of the olfactory epithelium, and are rarely expressed simultaneously in individual neurons. Furthermore, we have found that
olfactory neurons expressing MOR28, MOR10, or MOR83 project their axons
to very close but distinct subsets of glomeruli on the medial and
lateral sides of the olfactory bulb. Similar results have been obtained
with another murine OR gene cluster for A16 and MOR18 on chromosome 2, sharing 91% similarity in the amino acid sequences. These results may
indicate an intriguing possibility that olfactory neurons expressing
homologous OR genes within a cluster tend to converge their axons to
proximal but distinct subsets of glomeruli. These lines of study will
shed light on the molecular basis of topographical projection of
olfactory neurons to the olfactory bulb.
Key words:
axonal projection; odorant receptor gene; olfactory bulb; olfactory epithelium; olfactory sensory map; gene cluster
| |
INTRODUCTION |
The olfactory system of mammals can
recognize a large number of different odorants. The initial step in
odor perception occurs on the cilia of olfactory sensory neurons
(OSNs), where odorous ligands interact with G-protein-coupled seven
transmembrane (TM) receptors (Reed, 1992 ; Shepherd, 1994; Buck, 1996;
Hildebrand and Shepherd, 1997). A multigene family encoding odorant
receptors (ORs) was first identified in rat (Buck and Axel, 1991), and
usually contains hundreds of related genes in mammals (Parmentier et
al., 1992). OR genes are clustered within multiple loci that are
broadly distributed throughout the genome (Sullivan et al., 1996). The discrimination of different odors is most likely achieved by a large
repertoire of OR genes. In situ hybridization analyses in rodents reveal that the olfactory epithelium can be divided into four
topographically distinct zones, and that each member of the OR gene
family is expressed only in a particular zone, although OSNs expressing
a particular OR gene are randomly distributed within a zone (Ressler et
al., 1993; Vassar et al., 1993; Strotmann et al., 1994a,b). It has been
assumed that only a single OR gene is expressed in individual neurons
(Ressler et al., 1993; Chess et al., 1994; Malnic et al., 1999), and
that only one allele, either maternal or paternal, is activated for
transcription (Chess et al., 1994).
To discriminate a variety of odorants, the CNS must be able to
determine which OSNs have been activated. It has been shown that
neurons expressing a given OR gene project their axons to a limited
number of topographically fixed glomeruli among ~2000 on the
olfactory bulb (Ressler et al., 1994; Vassar et al., 1994; Mombaerts et
al., 1996). It appears that the chemical information, of which OSNs had
been activated by a given odorant, is converted to a topographical
information, of which glomeruli had been activated. In addition,
studies on the basis of 2-deoxyglucose uptake (Stewart et al., 1979;
Jourdan et al., 1980; Shepherd, 1994), c-fos expression (Guthrie et al., 1993; Sallaz and Jourdan, 1993) and voltage-sensitive dye recordings (Kauer and Cinelli, 1993) indicate that the physical map
of glomeruli at the bulbar surface represents a topographical map of OR
types encoding odor quality. Furthermore, electrophysiological recordings of single units suggest that ORs mapped to neighboring glomeruli tend to have similar structures in their receptive sites for
odor molecules (Mori, 1995; Mori and Yoshihara, 1995).
In the present study, we have characterized two OR gene clusters,
MOR28-MOR10-MOR83 on chromosome 14 and A16-MOR18 on chromosome 2, to examine how OSNs expressing closely linked and homologous OR genes project their axons to the olfactory bulb. Our results may
indicate an intriguing possibility that olfactory neurons expressing
homologous OR genes within a cluster tend to converge their axons to
very close but distinct subsets of glomeruli.
| |
MATERIALS AND METHODS |
Oligonucleotides. The following oligonucleotides were
used as primers in the present study. OR-II:
CGGAATTCCC(A/G/C/T)ATGTA(C/T)(C/T)T(A/G/C/T)TT(C/T)CT (Levy et al.,
1991); OR-VI:
ATAAGCTTAG(A/G)TG(A/G/C/T)(G/C)(A/T)(A/G/C/T)(G/C)C(A/G)CA(A/G/C/T)GT (Levy et al., 1991); OSP-1: CCTGTGAGCCGAAATGACATC (see Fig.
3A); OSP-2:
GTTTGGTTGATGAGGACAGCC (see Fig. 3A); OSP-3:
GGACAGCCTTTTCCATTCTTTTAG (see Fig. 3A); OSP-4:
TGGAGAAGGTGAGAAATCCTG (see Fig. 3A); OSP-5: GGAATAGTGCCTCTCTGC (see Fig. 3A); OSP-6:
GACAAGG(A/G)CAGTGTAT (see Fig. 3A); OSP-7:
TTCACATA(A/G)GGTCACT (see Fig. 3A); OSP-8: TGCTTACAAAGTTAGAGTCCC; ORM28: CTCTTGCTTGAATTCGGACTA (Peterson, 1998); ORM29: TAGTCCGAATTCAAGCAAGAGCACA (Peterson, 1998); A16F: AAGCCCCTACACTATACCAC (Ressler et al., 1993); A16R:
AGACAGAGCTTTCCGTCTTC (Ressler et al., 1993);
QT:
CCAGTGAGCAGAGTGACGAGGACTCGAGCTCAAGC(T)17 (Frohman, 1993); Qo: CCAGTGAGCAGAGTGACG
(Frohman, 1993); QI: GAGGACTCGAGCTCAAGC (Frohman, 1993).
Cloning of the MOR28, MOR10 and MOR83 genes. A pair of
degenerate primers were synthesized from two conserved peptide
sequences of the OR molecules expressed in the murine olfactory
epithelium: PMY(L/F)FL for the OR-II primer was taken from the TM-II
domain; and TC(G/A)SHL for the OR-VI primer was from the TM-VI domain (Levy et al., 1991). Poly(A)+ RNA from the
olfactory epithelium was prepared from BALB/c mice with a Fast Track
kit (Invitrogen, San Diego, CA). Reverse transcription (RT) with random
hexamers was performed using Superscript Preamplification system (Life
Technologies, Rockville, MD): 1 µg of the olfactory mRNA was
used for each RT reaction after DNase I (Life Technologies) digestion.
PCR for the first-strand cDNA was performed with the degenerate
primers using Taq polymerase (Promega, Madison, WI) under
the following conditions: one cycle of 97°C (3 min), 37°C (2 min),
and 72°C (3 min), followed by 36 cycles of 94°C (1 min), 37°C (2 min), and 72°C (3 min). PCR products were subcloned into the
pBluescript vector (Stratagene, La Jolla, CA) and sequenced with an
fmol DNA cycle sequence system (Promega).
To isolate genomic clones, a BALB/c mouse library in a phage vector
 EMBL3-SP6/T7 (Clontech, Palo Alto, CA) was screened with the MOR28
cDNA probe. Two clones, 28-2 and 28-71, were isolated for the
MOR28 and MOR10 genes, respectively, and subcloned into the pBluescript
vector (Stratagene). Furthermore, two clones, 28-L11 and 28-R7,
linked physically with 28-2 were isolated for characterizing
sequences upstream and downstream of the MOR28 gene.
Genomic libraries of a 129/SvJ mouse in a P1 phage vector
pAd 10-SacBII (Genome Systems, St. Louis, MO) and
of the 129/SvJ mouse in a BAC plasmid vector pBeloBAC11 (Genome
Systems) were screened by PCR using two primers, OSP-1 and OSP-8. A 43 kb region covering the sequence between the MOR28 and MOR10 genes as
well as a 5 kb region of the MOR83 gene were sequenced with an ABI 373A
sequencer (PE; Applied Biosystems, Foster City, CA).
To characterize the 5' regions of MOR10 and MOR28 transcripts in the
olfactory epithelium, we performed 5'-rapid amplification of cDNA ends
(RACE) analyses as described below. OSP-1-directed cDNA was
amplified by a first-round PCR with the OSP-2 primer, followed by a
second-round PCR with the OSP-3 primer (see Fig. 3A).
Sequencing indicated that 5'-RACE products contained both the 16 bp
coding sequence and the 585-621 bp noncoding sequence of MOR28 (see
Fig. 3A). The noncoding sequences of the MOR28-RACE products
did not continuously match its genomic sequence from 10 bp upstream of
the ATG codon (see Fig. 3A). Sequence analysis of the
genomic clone revealed that the unmatched sequences in the RACE
products were located 4.14 kb upstream of the initiation codon. A
similar situation was found for MOR10: the other 5'-RACE products
contained the 16 bp coding sequence as well as the ~260 bp noncoding
sequence that were also interrupted by a 2.83 kb spacer. To further
characterize the MOR10-specific transcripts, we amplified the
OSP-1-directed cDNA by a first-round PCR with the OSP-2 primer,
followed by a second-round PCR with the OSP-4 primer (see Fig.
3A). Sequencing revealed that MOR10-RACE products contained
the 399-459 bp noncoding sequence (see Fig. 3A).
5'-RACE. The 5'-RACE analysis was performed according to the
method of Frohman (1993). Poly(A)+ RNA was
prepared as described above, followed by digestion with DNase I. After
reverse transcription with olfactory mRNA (1 µg) and the OSP-1 primer
(see Fig. 3A), dATP was added to the 3' end of cDNAs with
terminal deoxynucleotidyl transferase (Life Technologies). The first
round amplification was performed with three primers of OSP-2 (see Fig.
3A), Qo and QT:
the QT primer contains oligo-dT, Qo, and QI sequences. The
second round amplification was performed with two primers,
QI and OSP-3 (see Fig. 3A). The
purified PCR products were cloned into the pGEM-T vector (Promega). To
further identify the start sites of MOR10 transcripts, the
MOR10-specific primers, OSP-3 and OSP-4 (see Fig. 3A), were
used for the first and the second set of amplifications, respectively.
RNase protection assay. The 5'-noncoding MOR28 sequence of
530 bp was amplified with 28-2 DNA using two primers, OSP-6 and OSP-7 (see Fig. 3A), whereas the noncoding MOR10 sequence of
506 bp was also amplified with 28-71 DNA using the same primers. The amplified DNA was subcloned into the pGEM-T vector and sequenced. An antisense RNA probe was prepared with an in vitro
transcription kit T7/SP6 (Boehringer Mannheim, Indianapolis, IN) using
the linearized plasmid. The assay was performed with an RNase
Protection kit (Boehringer Mannheim). The
32P-labeled antisense probe (3 × 105 cpm) was hybridized to
poly(A)+ RNA (5 µg) isolated from the
liver or olfactory tissue. After RNase A and T1 digestion, and
inactivation, protected fragments were separated in a polyacrylamide
gel (6%) containing 8 M urea. The autoradiograph
was visualized with a bioimage analyzer BAS-2000 II (Fuji Photo Film,
Tokyo, Japan).
Direct cDNA selection. Direct cDNA selection was performed
as described by Peterson (1998). Poly(A)+
RNA was prepared as described above, followed by digestion with DNase
I. Double-stranded cDNA was synthesized from 5 µg of mRNA using
Superscript II cDNA synthesis kit (Life Technologies) with random
hexamers. One microgram of double-stranded cDNA was ligated to a pair
of primer-adapter oligonucleotides, ORM28 and ORM29. The
primer-adapter-ligated cDNA (100 ng) was preamplified with the ORM28
primer by PCR (20 cycles of 94°C for 30 sec, 58°C for 30 sec, and
72°C for 1 min).
BAC plasmid DNA (50 ng) was biotinylated with biotin-14-dATP (Life
Technologies), random hexamers, and DNA polymerase I Klenow fragment
(New England Biolabs, Beverly, MA), and purified with Chroma Spin-10
columns (Clontech). Five micrograms of preamplified cDNA and 5 µg of
mouse Cot-1 DNA (Life Technologies) were prehybridized in 4 µl at
65°C for 90 min to block the repetitive sequences in the cDNA. Then,
1 µg of the prehybridized cDNA and 100 ng of the biotinylated BAC DNA
fragments were hybridized in 5 µl at 65°C for 40 hr. After
hybridization, BAC-cDNA hybrids were captured on streptavidin-coated
magnetic beads (Dynabeads M-280; Dynal, Oslo, Norway), washed twice in
0.1× SSC/0.1% SDS for 15 min at room temperature, and washed twice in
0.1× SSC/0.1% SDS for 15 min at 65°C. The cDNA was eluted with 50 µl of 50 mM NaOH for 5 min at room temperature, followed
by neutralization with 50 µl of 1 M Tris-HCl (pH 7.0).
The eluted cDNA was amplified with the ORM28 primer by PCR (20 cycles
of 94°C for 30 sec, 58°C for 30 sec, and 72°C for 1 min). The
secondary cycle of enrichment was performed under the same condition as
described above. After the secondary hybridization, wash, and elution,
cDNA was amplified by PCR, and cloned into the pGEM-T vector (Promega).
Cloning of the A16 and MOR18 genes. A partial coding
sequence of the A16 gene (Ressler et al., 1993) was amplified from
mouse genomic DNA with A16F and A16R primers by PCR (40 cycles of
94°C for 30 sec, 56°C for 30 sec, and 72°C for 1 min). To isolate
genomic clones, the 129/SvJ mouse genomic library in the BAC vector
pBeloBAC11 (Genome Systems) was screened with the A16 coding probe. One
clone, BAC15577, was found to contain the A16 gene and a novel gene, MOR18. The coding regions of the A16 and MOR18 genes were subcloned into the pBluescript vector (Stratagene). The 5'-noncoding regions of
these genes were characterized by the 5'-RACE analysis as described above.
In situ hybridization of olfactory epithelium sections.
DNA fragments including the 5'-noncoding exon 1 regions (constructed in
the pBluescript vector; Stratagene) were used as templates to
synthesize probes for the MOR10 and MOR28 genes. For the MOR83, MOR18,
and A16 genes, the coding regions were used to make probes. Digoxigenin
(DIG)- and fluorescein (FLU)-labeled probes were prepared by a DIG RNA
Labeling kit (Boehringer Mannheim).
Four-week-old C57BL/6 and BALB/c mice were anesthetized with sodium
pentobarbital (2.5 mg/animal) and perfused intracardially with 4%
paraformaldehyde. Olfactory tissues were dissected out and fixed
overnight in 4% paraformaldehyde in PBS. Tissues were decalcified by incubation for 2 d in 0.5 M EDTA at
4°C, placed in 30% sucrose, and embedded rapidly in O.C.T. compound
(Tissue-Tek, Torrance, CA) in dry ice acetone. Serial coronal sections
(9 µm) were cut with a JUNG CM3000 cryostat (Leica, Nussloch,
Germany) and collected on 3-aminopropyl-triethoxysilane-coated slide glasses.
The procedures used for hybridization, washings, antibody reaction, and
color reaction were as described by Hirota et al. (1992). In
double-label in situ hybridization, antisense RNA probes labeled with either FLU or DIG were hybridized to sections (Hauptmann and Gerster, 1994). After washing, slides were incubated with alkaline
phosphatase-conjugated anti-FLU antibody (anti-FLU-AP; Boehringer
Mannheim), and positive cells were stained red with Fast Red
(Boehringer Mannheim) in the first round. After washing out the
anti-FLU-AP with acid (0.1 M glycine-HCl, pH
2.2), the slides were incubated with alkaline phosphatase-conjugated
anti-DIG antibody (anti-DIG-AP; Boehringer Mannheim) in the second
round, and positive cells were stained purple with nitroblue
tetrazolium salt (NBT) and 5-bromo-4-chloro-3-indolyl phosphate
toludinium salt (BCIP). The sections were analyzed and photographed on
an Olympus AX70 microscope (Olympus Optical, Tokyo, Japan), and then images were processed by Adobe Photoshop. Except for small adjustments of brightness and contrast, the images were not altered.
In situ hybridization of olfactory bulb sections.
In situ hybridization was performed essentially as described
by Vassar et al. (1994). Probes for the exon 1 regions of the MOR28 and
MOR10 genes and for the coding regions of the MOR83, MOR18, and A16 genes were synthesized in a 20 µl reaction with 50 µCi of
[33P]UTP (3000 Ci/mmol; Amersham
Pharmacia Biotech, Uppsala, Sweden) using an AmpliScribe T3 or T7
Transcription kit (Epicentre">Epicentre Technologies, Madison, WI).
Fresh-frozen olfactory bulbs of adult C57BL/6 mice (7 weeks old) were
oriented for coronal sections and cut to 20 µm thickness. Serial
sections of entire bulbs were dried and fixed for 10 min in 4%
paraformaldehyde in PBS at room temperature. After rinsing twice in
PBS, sections were incubated 0.25% acetic anhydride and 0.1 M triethanolamine, pH 8, washed in PBS, dehydrated with
ethanol, and prehybridized in the hybridization buffer (Vassar et al., 1994) for 1 hr. Probes were diluted to a concentration of 1 × 105 cpm/µl in the same hybridization
buffer, and 100 µl was applied to each slide. After a 16-20 hr
incubation at 60°C, sections were washed in 0.2× SSC for 1 hr at
60°C, treated with 2 µg/ml of RNase A for 30 min, and washed twice
in 0.2× SSC at 60°C for 20 min. After dehydration, slides were
dipped in Hypercoat film-emulsion LM-1 (Amersham Pharmacia Biotech) and
allowed to expose at 4°C. After 4-6 weeks, the slides were
developed, and sections were counterstained with toluidine blue O
(Sigma, St. Louis, MO). The slides were viewed using a Nikon Optiphot
microscope equipped with a dark-field illumination device (Nikon,
Tokyo, Japan). Images were acquired with an HC-2500 CCD camera (Fuji
Photo Film) using Photograb-2500 software (Fuji Photo Film) and
processed by Adobe Photoshop. With the exception of minor adjustments
in brightness and contrast, the images were not altered.
| |
RESULTS |
Cloning and genomic structure of three adjacent OR genes
Murine OR gene fragments were isolated from olfactory mRNA by
RT-PCR, using a pair of degenerate primers, OR-II and OR-VI (Levy et
al., 1991). The resulting PCR products of ~560 bp contained at least
five novel OR genes. Among them, MOR10 and MOR28 clones were chosen for
further analyses since they were found frequently in the PCR products
and were highly homologous in sequence. To characterize the genomic
structure, we isolated phage clones of mouse DNA hybridizing to the
MOR28 clone. Among 23 prospective clones, 28-2 and 28-71 were
characterized further by both restriction mapping and DNA sequencing
(Fig. 1). The MOR10 gene has a coding sequence of 930 bp (310 amino acids), and the MOR28 gene has one of 939 bp (313 amino acids) (Fig. 2). The coding
sequences of the MOR10 and MOR28 genes share 92% DNA identity and 95%
amino acid similarity.
View larger version (15K):
[in this window]
[in a new window]
|
Figure 1.
Genomic structure of the MOR28, MOR10, and MOR83
genes. At the top, isolated phage and BAC clones are
shown as horizontal lines. The bottom
represents schematically the 5'-RACE analysis. The flanking regions of
the MOR28, MOR10, and MOR83 genes are enlarged. Boxes
indicate exons, and hatched portions depict coding
regions. DCRs and MARs are shown by ovals and
triangles, respectively. The MAR sites are predicted by
MAR finder according to the method of Singh et al. (1997).
E, EcoRI; H,
HindIII; P, PstI;
Sf, SfiI; X,
XbaI; Xh, XhoI.
|
|
View larger version (72K):
[in this window]
[in a new window]
|
Figure 2.
Comparison of amino acid sequences of the MOR28,
MOR10, and MOR83 proteins. The MOR28 sequence is shown with
one-letter code, whereas only amino acid differences are
indicated for the MOR10 and MOR83 sequences. Gray
shading represents conserved amino acid residues among the
three sequences. The predicted positions of the seven transmembrane
domains (TM-I to TM-VII) are depicted below the sequences and the
putative glycosylation and phosphorylation sites (black
and gray circles) above the sequences.
|
|
To determine the physical linkage of these genes, we screened mouse P1
and BAC libraries by PCR. One clone, P1/2394, was found to contain the
MOR28 gene as well as a 5'-noncoding region of the MOR10 gene (Fig. 1).
Sequence analysis has indicated that the MOR28 and MOR10 genes are
tandemly linked and separated by a 25 kb spacer in the mouse genome. In
addition, one BAC clone, 14399, was found to contain not only the MOR28
and MOR10 genes, but also a novel gene, MOR83 (Fig. 1). Further
analyses have indicated that the MOR83 gene is downstream of the MOR10
gene and is separated by a 10 kb spacer in the genome. The MOR83 gene
has a coding sequence of 924 bp (308 amino acids) and is more
homologous in nucleotide sequence to the MOR10 gene (65%) than to the
MOR28 gene (60%). It should be noted that MOR83 shares 75% amino acid
similarity with MOR10 and with MOR28 (Fig. 2).
To characterize the 5' regions of MOR28 and MOR10 transcripts, 5'-RACE
analysis was performed with poly(A)+
RNA of the olfactory epithelium. Sequence analysis of the RACE products indicated that these genes contain an intron, which separates the highly homologous coding sequences (exon 2) and the less homologous 5'-noncoding sequences (exon 1) containing transcription-initiation regions (Fig. 3A). The
transcriptional start sites of these genes were confirmed by an RNase
protection assay (Fig. 3B). To analyze the 5' region of
MOR83 transcripts as well, cDNA clones that had been selected with
BAC14399 DNA by a direct cDNA selection method were screened with the
5' terminus of the MOR83 coding sequence (330 bp) by Southern
hybridization. Among 32 prospective clones, five clones had almost the
same 5'-terminal noncoding sequences. Comparison of these sequences
with the genomic sequence has revealed that the MOR83 gene has two
introns in the 5'-noncoding region: exon 1 (112 bp), intron (0.75 kb),
exon 2 (173 bp), intron (6 kb), and exon 3 (1 kb). It should be noted
that an orientation of transcription from the MOR83 gene is opposite to
that from the MOR28 or MOR10 gene (Fig. 1).
View larger version (63K):
[in this window]
[in a new window]
|
Figure 3.
The 5'-noncoding sequences of the MOR10 and MOR28
transcripts. A, Nucleotide sequence comparison of the
5'-noncoding regions of the MOR10 and MOR28 genes. Identical
nucleotides are connected by vertical bars, and both
noncoding and coding sequences in exon 1 and exon 2 are depicted by
uppercase letters. Upstream genomic sequences as well as
intron sequences are noted by lowercase letters. The ATG
initiation codons are boxed. Underlined sequences show
regions used for antisense RNA probes in the RNase protection assay,
and cross-hatched underlining sequences indicate
protected regions. The major transcription start sites, identified by
the 5'-RACE analysis and by the RNase protection assay, are marked by
small and large arrowheads, respectively.
Primers for the 5'-RACE and RT-PCR analyses are indicated by
arrows along the sequences. B, The RNase
protection assay. Antisense RNA probes labeled with 32P
were hybridized to poly(A)+ RNAs from the mouse liver or
olfactory epithelium. After hybridization, samples were digested with
RNase and separated on a denaturing polyacrylamide gel (6%). In
olfactory poly(A)+ RNA, three protected fragments of 247, 252, and 258 nt were detected for the MOR10 probe, whereas those of
269, 271, and 276 nt were detected for the MOR28 probe. No protected
products were detected in liver mRNA.
|
|
A 43 kb region covering the sequence between the MOR28 and MOR10 genes
was determined to search for other genes or highly conserved sequences.
There are no open reading frames except for the MOR28 and MOR10 genes
in this region. Comparison of both nucleotide sequences by dot matrix
plotting using a software of Geneworks (IntelliGenetics, Mountain View,
CA) has revealed that these genes are very similar not only in the
coding sequence with 92% nucleotide identity, but also in two
noncoding sequences: a 250 bp region with 92% nucleotide identity
around the transcription-initiation site in the 5' end of exon 1, and a
500 bp region with 94% nucleotide identity ~2 kb downstream of the
coding sequence, termed downstream conserved region (DCR) (Fig. 1).
Furthermore, computer analysis with matrix attachment region (MAR)
finder (Singh et al., 1997) has predicted three MARs (~500 bp long),
where the chromatin fibers attach to the nuclear matrix: two of them
are located ~1 kb upstream of the transcription-initiation sites in
both genes (Fig. 1).
The MOR28 gene cluster was assigned to the central portion of the C
region of chromosome 14 by fluorescence in situ
hybridization (FISH) with P1/2394 DNA (data not shown).
Comparison of the R-banding pattern has indicated that the MOR28
cluster is located at the C2-D1 region of the mouse chromosome 14, and
is flanked by the T-cell receptor V gene cluster.
MOR28, MOR10, and MOR83 genes are expressed in the same
zone of the olfactory epithelium, but not simultaneously in individual
olfactory neurons
To examine the expression patterns of the three adjacent genes in
the olfactory epithelium, we performed in situ hybridization with the 5'-noncoding probes for the MOR28 and MOR10 genes as well as
with the coding probe for the MOR83 gene. DIG-labeled antisense RNA
probes for the 5'-noncoding sequences were used to detect either MOR28
or MOR10 transcript specifically in the coronal sections of the mouse
nasal cavity. The MOR28 probe clearly detected neurons expressing the
gene within the most dorsolateral and ventromedial zone, zone 4, according to the nomenclature of Sullivan et al. (1996) (Fig.
4A). The MOR10
transcripts were confined in the same zone as well (Fig.
4B). DIG-labeled antisense RNA probes for the coding
region of the MOR83 gene, which did not cross-hybridize to the other
genes, also detected positive neurons within the same zone (Fig.
4C). Within the zone, the olfactory neurons expressing these
genes appeared to be concentrated in portions of ectoturbinates 1 and
2, according to the nomenclature of Astic and Saucier (1986).
View larger version (152K):
[in this window]
[in a new window]
|
Figure 4.
The MOR28, MOR10, and MOR83 genes are expressed in
the same zone within the olfactory epithelium, but in different
olfactory neurons. A-C, Coronal sections of the mouse
olfactory epithelium were hybridized with a DIG-labeled antisense RNA
probe from the MOR28, MOR10, or MOR83 gene. Sections were washed under
a high stringency condition, followed by chromogenic reaction.
A, The MOR28 probe hybridized to neurons that lie in
some parts of ectoturbinates 1 and 2, according to the nomenclature of
Astic and Saucier (1986). The MOR10 probe (B) and
the MOR83 probe (C) also hybridized to neurons
that are located in the same zone as the MOR28 probe.
D-F, Double-label in situ hybridization
of olfactory epithelium sections with two differently labeled probes.
Coronal sections were hybridized simultaneously with the following
probes: D, MOR28 noncoding (FLU) and MOR10 noncoding
(DIG); E, MOR28 noncoding (FLU) and MOR83 coding (DIG);
F, MOR10 noncoding (FLU) and MOR83 coding (DIG).
Positive cells are red in the first reaction (FLU),
whereas positive cells are dark purple in the second
reaction (DIG). Scale bars, 200 µm.
|
|
To examine whether individual olfactory neurons express only one of the
three genes or not, their transcripts were separately detected by
in situ hybridization of the same coronal sections. As shown
in Figures 4D-F and 5, combinations of double-label
in situ hybridization were performed with two different
labeling reagents and detection dyes. Antisense RNA probe was labeled
with either FLU or DIG. Then, the two labeled probes were mixed and hybridized to coronal sections. Hybridization signals for one of the
two genes were detected as a red stain with a combination of
anti-FLU-AP antibody and the detection substrate, Fast Red. After
eliminating the first antibody with acid, signals for the second gene
were detected as a purple stain with a combination of anti-DIG-AP
antibody and the detection substrates, NBT-BCIP.
For double-staining experiments, two antisense RNA probes of the MOR10-
and MOR28-exon 1 regions were labeled with FLU and DIG, respectively.
MOR10-positive neurons were stained red (Fig. 5A), whereas MOR28-positive
neurons were stained purple (Fig. 5B). We did not find any
neurons that were simultaneously stained red and purple. Furthermore,
combinations of MOR28 (FLU)-MOR10 (DIG), MOR28 (FLU)-MOR83 (DIG), and
MOR10 (FLU)-MOR83 (DIG) antisense RNA probes detected red and purple
neurons, respectively (Fig. 4D-F). No
neurons were found to express the MOR28, MOR10, and MOR83 genes
simultaneously in coronal sections throughout the nasal cavities,
indicating that the three genes are not coexpressed in the same cells,
even though they are highly homologous and linked in the genome.
View larger version (116K):
[in this window]
[in a new window]
|
Figure 5.
The MOR10 and MOR28 genes are not expressed
simultaneously in individual neurons. Double-label in
situ hybridization of olfactory epithelium sections with two
differently labeled probes from the MOR10- and MOR28-exon 1 regions.
Coronal sections were hybridized simultaneously with the following
probes: A, B, MOR10 (FLU) and MOR28
(DIG); C, D, MOR10 (FLU) and MOR10 (DIG).
The photographs were taken sequentially after each color reaction: the
first FLU-red reaction (A, C), the second
DIG-purple reaction (B,D). Scale bars, 100 µm.
|
|
Because the second stain could be diminished through alkaline
phosphatase inactivation by acid treatment, there was a concern that
both signals could not be detected in the same neurons. To exclude this
possibility, we performed double-label hybridization with both types of
MOR10 probes; one was labeled with FLU, and the other was with DIG. All
MOR10-positive cells stained red by the first procedure (Fig.
5C) were subsequently stained purple in the second one (Fig.
5D). No newly stained cells appeared in the second staining.
OSNs expressing MOR28, MOR10, or MOR83 project their axons to
proximal glomeruli on the olfactory bulb
We next designed experiments to examine whether olfactory
neurons expressing MOR28, MOR10, or MOR83 project their axons to discrete subsets of glomeruli, which would be located near or far from
each other in the olfactory bulb. In situ hybridization was
performed to serial frontal sections of the olfactory bulb because OR
mRNA can be detected in the axon terminals of OSNs within the bulb
(Ressler et al., 1994; Vassar et al., 1994).
Sequential 20 µm sections cut through the olfactory bulbs of
7-week-old mice were hybridized with a
33P-labeled antisense RNA probe from the
MOR28 or MOR10 noncoding sequence or with a
33P-labeled antisense RNA probe from the
MOR83 coding sequence. Each probe was hybridized to either every fifth
or every sixth tissue section. Regions of hybridization were defined as
glomeruli by counterstaining hybridized sections with toluidine blue.
The MOR83 probe detected glomeruli that resided ventrolaterally in the
posterior part of the olfactory bulb (Fig.
6A). The MOR10-positive glomeruli were located at a position 60-100 µm (one glomerular width) ventral to the MOR83-positive glomeruli, and approximately in
the same anteroposterior plane (Fig. 6B). The
MOR28-positive glomeruli were located at a position 200-300 µm (two
to four glomerular widths) posterior to the MOR10-positive glomeruli,
and roughly in the same dorsoventral plane (Fig. 6C).
Furthermore, in the most posterior part of the bulb, the same set of
signals hybridizing to the MOR83, MOR10, and MOR28 probes were observed
on glomeruli that resided ventromedially (Fig.
6D-F). These relative positions were
maintained on both the lateral and medial sides of the bulb, and were
bilaterally symmetric; positive glomeruli were located in approximately
the same relative positions in the right and the left bulbs among four
animals. These results demonstrate that the neurons expressing one of
the three linked and homologous OR genes project their axons to two
sets of proximal glomeruli, on the medial and lateral portions of the
olfactory bulb (see Fig. 9).
View larger version (162K):
[in this window]
[in a new window]
|
Figure 6.
Localization of the MOR28, MOR10, and MOR83
transcripts to proximal glomeruli within the olfactory bulb. Serial
coronal sections of the mouse olfactory bulb were hybridized with a
33P-labeled antisense RNA probe, washed under a
high-stringency condition, and exposed to emulsion for 5 weeks.
Dark-field micrographs of sections show two pairs of very close, but
discrete glomeruli that hybridize to the MOR83 (A,
D) or MOR10 (B, E) probe.
It should be noted that there are almost neighboring sections
exhibiting positive glomeruli in both the ventrolateral (A,
B) and ventromedial (D, E) parts
of the bulb. In addition, micrographs of sections indicate two pairs of
proximal, but discrete glomeruli that hybridize to the MOR10
(B, E) or MOR28 (C,
F) probe. These sections are ordered in an
anteroposterior manner. Arrows depict positive glomeruli
on the bulb. Scale bars, 500 µm.
|
|
OSNs expressing either A16 or MOR18 project their axons to proximal
glomeruli on the olfactory bulb
We examined another cluster to determine if it is a general
tendency that neurons expressing homologous OR genes within a cluster
project to proximal glomeruli. The A16 gene was reported to be
expressed in the same zone (zone 4) as the MOR28-expression zone within
the olfactory epithelium (Ressler et al., 1994), and also to be located
in the OR gene locus (Olfr4) of the mouse chromosome 2 (Sullivan et al., 1996). To isolate the A16 gene and its related gene
or genes, which had been presumed to exist closely within the locus, we
screened the mouse BAC library by Southern hybridization. One clone,
BAC15577, was found to contain the A16 gene and a tightly linked novel
gene, MOR18. The A16 gene has a coding sequence of 906 bp (302 amino
acids), and the MOR18 gene has one of 924 bp (308 amino acids) (Fig.
7). The coding sequences of the A16 and MOR18 genes share 82% DNA identity and 91% amino acid similarity (Fig. 7). The 5'-RACE analysis has indicated that the A16 and MOR18
genes have an intron of 4 and 3 kb, respectively, in the 5'-noncoding
regions (data not shown). It appears to be a general feature that OR
genes have at least one intron within the 5'-noncoding sequences.
View larger version (42K):
[in this window]
[in a new window]
|
Figure 7.
Comparison of amino acid sequences of the
A16 and MOR18 proteins. The A16 sequence is shown with
one-letter code, whereas only amino acid differences are
indicated for the MOR18 sequence. Gray shading
represents conserved amino acid residues between both sequences. The
predicted positions of the seven transmembrane domains (TM-I to TM-VII)
are depicted below the sequences and the putative glycosylation and
phosphorylation sites (black and gray
circles) above the sequences.
|
|
In situ hybridization of the olfactory epithelium sections
has demonstrated that the two genes are expressed in the same spatial zone (zone 4), but not expressed simultaneously in individual olfactory
neurons (data not shown). In situ hybridization of the olfactory bulb sections revealed that the A16 probe detected glomeruli that resided ventrolaterally in the middle part of the olfactory bulb,
whereas the MOR18-positive glomeruli were located at a position 140-240 µm (two to three glomerular widths) posterior to the
A16-positive glomeruli (Fig.
8A,B). Furthermore, in
the more posterior part of the bulb, the same set of signals
hybridizing to the A16 and MOR18 probes were observed on glomeruli that
resided ventromedially (Fig. 8C,D). These relative positions
were maintained on both the lateral and medial sides of the bulb, and
were bilaterally symmetric. These results suggest an intriguing
possibility that neurons expressing homologous OR genes within the same
cluster tend to project their axons to two sets of proximal glomeruli, on the medial and lateral portions of the olfactory bulb (Fig. 9).
View larger version (161K):
[in this window]
[in a new window]
|
Figure 8.
Localization of the A16 and MOR18 transcripts to
proximal glomeruli within the olfactory bulb. Serial coronal sections
of the olfactory bulb were hybridized with a 33P-labeled
antisense RNA probe, washed under a high-stringency condition, and
exposed to emulsion for 6 weeks. Dark-field micrographs of sections
indicate two pairs of proximal, but discrete glomeruli that hybridize
to the A16 (A, C) or MOR18
(B, D) probe. These sections are ordered
in an anteroposterior manner. Arrows depict positive
glomeruli on the bulb. Scale bars, 500 µm.
|
|
View larger version (37K):
[in this window]
[in a new window]
|
Figure 9.
Relative positions of MOR28, MOR10, MOR83, MOR18,
and A16 glomeruli within the olfactory bulb. Consecutive coronal
sections of the olfactory bulb in different mice were hybridized with
five different 33P-labeled antisense RNA probes, washed
under a high stringency condition, and exposed to emulsion for 6 weeks.
To summarize the results, signals of the ventrolateral
(A, C) and ventromedial
(B, D) glomeruli within the left half of
the bulb are represented schematically. Relative positions of glomeruli
for the OR genes in the MOR28 cluster (A, B) and the A16
cluster (C, D) are shown. Four sets of
the coronal bulb sections from the four different mice were analyzed to
determine the relative distances of glomeruli using the MOR10 or A16
glomerulus as a standard position. The relative distance between two
glomeruli was calculated by a geometric mean of both distances of 20 µm coronal sections containing the center of each site and the two
sites in the anteroposterior plane. The MOR10 and MOR83 glomeruli are
arranged very closely at a distance of 80 ± 20 µm, and
approximately in the same anteroposterior plane in both sides. The
MOR10 and MOR28 glomeruli are arranged at a distance of 250 ± 50 µm and 190 ± 60 µm in the lateral and medial sides,
respectively. The A16 and MOR18 glomeruli are arranged at a distance of
190 ± 50 µm and 210 ± 60 µm in the lateral and medial
sides, respectively. Abbreviations are A (anterior),
P (posterior), D (dorsal), and
V (ventral).
|
|
| |
DISCUSSION |
We have characterized a murine OR gene cluster of MOR28, MOR10,
and MOR83 on chromosome 14. These genes share 75-95% similarities in
the amino acid sequences. In situ hybridization demonstrates that neurons expressing one of the three genes are distributed randomly
in the same zone within the olfactory epithelium, although these genes
are rarely expressed simultaneously in individual neurons. We have also
found that neurons expressing one of these genes project their axons to
proximal but distinct subsets of glomeruli in the olfactory bulb.
Similar results have been obtained with another OR gene cluster of A16
and MOR18 on the mouse chromosome 2.
Genomic structure of the MOR28 cluster
The MOR28 cluster contains the MOR28, MOR10, and MOR83 genes that
are tightly linked on the genome in this order, although the
orientation of MOR83 transcription is opposite to those of MOR28 and
MOR10 (Fig. 1). We have sequenced the 43 kb DNA region encompassing the
MOR28 and MOR10 genes to search for novel coding regions or highly
conserved sequences. Although we do not find any open reading frames
other than the MOR28 and MOR10 genes, dot matrix plotting shows that
they share significant homology in the region from exon 1 through exon
2. In particular, the MOR28 and MOR10 genes are highly homologous not
only in the coding region, but also in two noncoding regions: a 250 bp
region surrounding the transcription-initiation site in the 5' end of
exon 1 and a 500 bp segment ~2 kb downstream of the coding sequence,
termed DCR (Fig. 1). These DCR sequences share a surprising homology of
94% nucleotide identity, which is higher than that for the coding
sequences. Furthermore, Southern blot and FISH analyses revealed that
another region homologous to these DCRs was located on a different
chromosome (chromosome 10). Deletion studies of these DCRs will allow
us to know why they are highly conserved even between two separate
chromosomes. Moreover, computer analysis has predicted three MARs
(~500 bp long), two of which are located ~1 kb upstream of the
transcription-start sites in both genes (Fig. 1). The MARs are
relatively short (100-1000 bp long) sequences that anchor the
chromatin loops to the nuclear matrix, and often include the origin of
DNA replication and a concentrated area of nuclear factor-binding sites
for transcription (Singh et al., 1997). It is possible that the two
newly found homologous regions and MARs may play a role in the
transcriptional regulation of MOR28 and MOR10 genes. Our genomic
studies of the MOR28 cluster indicate that the MOR28 and MOR10 genes
may have evolved through tandem duplication. Since the choice of a gene
for expression and the choice of a glomerular target must be regulated
separately, it will be quite interesting to know how these two
regulations are interrelated each other.
Mutually exclusive expression of the MOR genes in
olfactory neurons
In situ hybridization experiments demonstrate that
MOR28-, MOR10-, and MOR83-positive neurons are distributed randomly in the same zone (zone 4) within the olfactory epithelium, but no individual neurons, so far tested, express these homologous genes simultaneously (Figs. 4, 5). These observations are in accord with
recent experiments by Malnic et al. (1999) using single cell RT-PCR,
which indicated that individual OSNs express only one OR gene. Our
in situ hybridization experiment for the adult-mouse olfactory epithelia showed that the ratio of cell numbers expressing MOR28, MOR10, or MOR83 was ~5:2:1. These results suggest that receptor choice even among the three highly homologous OR genes is
biased, rather than occurring by a purely stochastic mechanism. It has
been reported in zebrafish that the onset of specific OR expression in
a gene cluster occurs asynchronously in the olfactory placode during
development (Barth et al., 1996, 1997). It is possible that the gene
organization within the cluster MOR28-MOR10-MOR83 may give rise to a
bias of receptor choice as well as to asynchronous regulation of the
onset of specific OR expression during embryogenesis.
Proximity of projection sites of OSNs within the
olfactory bulb
It may be a general rule that OSNs expressing homologous OR genes
within a cluster tend to project their axons to two topographically fixed subsets of neighboring glomeruli on the medial and lateral sides
of the olfactory bulb (Fig. 9). Our present study indicates that MOR28
glomeruli are located at positions 200-300 µm (two to four
glomerular widths) posterior to MOR10 glomeruli, and roughly in the
same anteroposterior axis of the bulb (Fig. 6). In addition, MOR18
glomeruli also reside 140-240 µm posterior to A16 glomeruli (Fig.
8). A similar finding has been reported for other OR gene cluster,
P1-P2-P4-P3-M50-I7-P5: neurons expressing P2 or P3 project their
axons to close glomeruli ~200 µm apart from each other (Wang et
al., 1998). Moreover, both P2 deletion and substitution experiments have demonstrated that OR molecules may play an instructive role in
selecting target sites, but cannot be the sole determinant in the
guidance process (Mombaerts et al., 1996; Wang et al., 1998). These
findings suggest that projection sites of neurons expressing an OR in
the dorsoventral axis of the olfactory bulb are dependent on the zone
in which the OR is expressed, whereas projection sites in the
anteroposterior axis are dependent on the specific OR expressed
(Mombaerts et al., 1996; Wang et al., 1998; O'Leary et al., 1999).
If glomeruli targeted by neurons expressing highly homologous OR genes
within a cluster are located at close sites along the anteroposterior
axis of the bulb, it raises two possible speculations. One is that the
OR itself functions as a guidance receptor, which binds the proposed
guidance ligands present in an anteroposterior gradient across the
olfactory bulb. In this model, the binding affinities of highly
homologous ORs to these putative ligands appear to be similar, leading
to axonal projection of neurons expressing these ORs to the neighboring
glomeruli. Another speculation is that ORs do not bind the putative
anteroposterior guidance molecules, but each OR gene locus contains a
second and distinct set of receptors, which bind these guidance
molecules and are expressed if an OR gene within that locus is also
expressed. Knock-in studies as well as the transgenic approach as
described by Qasba and Reed (1998) may allow us to identify the
regulatory regions that dictate a tight linkage between the choice of a
receptor and the choice of a glomerular target.
Processing of sensory information on the olfactory bulb
We have observed that OSNs expressing highly homologous OR genes
within a cluster converge their axons to neighboring glomeruli on the
olfactory bulb. These glomeruli separated by one to four glomerular
widths may receive olfactory inputs from the OSNs that recognize
related odorant molecules. Using a combination of calcium imaging and
single-cell RT-PCR, it has been shown that ORs interacting with similar
odorants appear to be highly related (Malnic et al., 1999).
Electrophysiological data also suggest that glomeruli responding to
related odorants are closely localized on the olfactory bulb; single-unit recordings of individual rabbit mitral/tufted (M/T) cells
have revealed that neighboring M/T cells respond to highly related
molecules, but not to distant ones (Mori, 1995; Mori and Yoshihara,
1995). Moreover, individual M/T cells excited by a series of
n-aliphatic aldehydes (e.g., with a 4-, 5-, or 6-carbon chain) are often inhibited by aldehydes whose aliphatic chain is one
carbon shorter or longer (Yokoi et al., 1995). The proximity of
glomeruli targeted by OSNs recognizing related odorants may allow
individual M/T cells to respond to the olfactory inputs with excitation
as well as with suppression by lateral inhibition via interneurons from
the neighboring glomeruli, leading to sharpening the odor codes. Our
present results are consistent with those electrophysiological data and
may provide a molecular basis for topographical mapping of the
glomeruli on the olfactory bulb. These lines of studies will shed light
on the molecular basis of topographical projection of OSNs to the
olfactory bulb.
| |
FOOTNOTES |
Received March 25, 1999; revised July 16, 1999; accepted July 21, 1999.
This work was supported by the Special Promotion Research Grant from
the Ministry of Education and Culture of Japan and by grants from Toray
Science Foundation, Nissan Science Foundation, Mitsubishi Foundation,
and Sumitomo Foundation. A.T. was supported by fellowships from the
Daikou Foundation and the Tohkai Foundation for the Promotion of
Industry and Technology. We thank Drs. Hiroshi Kiyama (Asahikawa
Medical School), Ichiro Naruse (Kyoto University), and Tetsuo Yamamori
(Institute for Basic Biology) for helpful discussion and suggestions,
and Dr. Anthony J. Otsuka (Illinois State University) and Ms. Hitomi
Sakano (University of California at Berkeley) for critical reading of
this manuscript.
Dr. Tsuboi and Mr. Yoshihara contributed equally to this work.
The DDBJ accession numbers for the sequences reported in this paper are
AB030892-AB030896.
Correspondence should be addressed to Dr. Akio Tsuboi, Room 111B,
Science Building #3, Department of Biophysics and Biochemistry, University of Tokyo, 2-11-16 Yayoi, Bunkyo-ku, Tokyo 113-0032, Japan.
| |
REFERENCES |
-
Astic L,
Saucier D
(1986)
Anatomical mapping of the neuroepithelial projection to the olfactory bulb in the rat.
Brain Res Bull
16:445-454[Web of Science][Medline].
-
Barth AL,
Justice NJ,
Ngai J
(1996)
Asynchronous onset of odorant receptor expression in the developing zebrafish olfactory system.
Neuron
16:23-34[Web of Science][Medline].
-
Barth AL,
Dugas JC,
Ngai J
(1997)
Noncoordinate expression of odorant receptor genes tightly linked in the zebrafish genome.
Neuron
19:359-369[Web of Science][Medline].
-
Buck LB
(1996)
Information coding in the vertebrate olfactory system.
Annu Rev Neurosci
19:517-544[Web of Science][Medline].
-
Buck L,
Axel R
(1991)
A novel multigene family may encode odorant receptors: a molecular basis for odorant recognition.
Cell
65:175-187[Web of Science][Medline].
-
Chess A,
Simon I,
Cedar H,
Axel R
(1994)
Allelic inactivation regulates olfactory receptor gene expression.
Cell
78:823-834[Web of Science][Medline].
-
Frohman MA
(1993)
Rapid amplification of complementary DNA ends for generation of full-length complementary DNAs: thermal RACE.
Methods Enzymol
218:340-356[Web of Science][Medline].
-
Guthrie KM,
Anderson AJ,
Leon M,
Gall C
(1993)
Odor-induced increases in c-fos mRNA expression reveal an anatomical "unit" for odor processing in olfactory bulb.
Proc Natl Acad Sci USA
90:3329-3333[Abstract/Free Full Text].
-
Hauptmann G,
Gerster T
(1994)
Two-color whole-mount in situ hybridization to vertebrate and Drosophila embryos.
Trends Genet
10:266[Web of Science][Medline].
-
Hildebrand JG,
Shepherd GM
(1997)
Mechanisms of olfactory discrimination: converging evidence for common principles across phyla.
Annu Rev Neurosci
20:595-631[Web of Science][Medline].
-
Hirota S,
Ito A,
Morii E,
Wanaka A,
Tohyama M,
Kitamura Y,
Nomura S
(1992)
Localization of mRNA for c-kit receptor and its ligand in the brain of adult rats: an analysis using in situ hybridization.
Mol Brain Res
15:47-54[Medline].
-
Jourdan F,
Duveau A,
Astic L,
Holley A
(1980)
Spatial distribution 2- deoxyglucose uptake in the olfactory bulb of rats stimulated with two different odors.
Brain Res
188:139-154[Web of Science][Medline].
-
Kauer JS,
Cinelli AR
(1993)
Are there structural and functional modules in the vertebrate olfactory bulb?
Microsc Res Tech
24:157-167[Web of Science][Medline].
-
Levy NS,
Bakalyar HA,
Reed RR
(1991)
Signal transduction in olfactory neurons.
J Steroid Biochem Mol Biol
39:633-637[Web of Science][Medline].
-
Malnic B,
Hirono J,
Sato T,
Buck LB
(1999)
Combinatorial receptor codes for odors.
Cell
96:713-723[Web of Science][Medline].
-
Mombaerts P,
Wang F,
Dulac C,
Chao SK,
Nemes A,
Mendelsohn M,
Edmondson J,
Axel R
(1996)
Visualizing an olfactory sensory map.
Cell
87:675-686[Web of Science][Medline].
-
Mori K
(1995)
Relation of chemical structure to specificity of response in olfactory glomeruli.
Curr Opin Neurobiol
5:467-474[Web of Science][Medline].
-
Mori K,
Yoshihara Y
(1995)
Molecular recognition and olfactory processing in the mammalian olfactory system.
Prog Neurobiol
45:585-619[Web of Science][Medline].
-
O'Leary DDM,
Yates PA,
McLaughlin T
(1999)
Molecular development of sensory maps: representing sights and smells in the brain.
Cell
96:255-269[Web of Science][Medline].
-
Qasba P,
Reed RR
(1998)
Tissue and zonal-specific expression of an olfactory receptor transgene.
J Neurosci
18:227-236[Abstract/Free Full Text].
-
Parmentier M,
Libert F,
Schurmans S,
Schiffmann S,
Lefort A,
Eggerickx D,
Ledent C,
Mollereau C,
Gerard C,
Perret J,
Grootegoed A,
Vassart G
(1992)
Expression of members of the putative olfactory receptor gene family in mammalian germ cells.
Nature
355:453-455[Medline].
-
Peterson AS
(1998)
Direct cDNA selection.
In: Genome analysis: a laboratory manual, Vol 2, Detecting genes (Birren B,
Green ED,
Klapholz S,
Myers RM,
Roskams J,
eds), pp 159-190. New York: Cold Spring Harbor Laboratory.
-
Reed RR
(1992)
Signaling pathways in odorant detection.
Neuron
8:205-209[Web of Science][Medline].
-
Ressler KJ,
Sullivan SL,
Buck LB
(1993)
A zonal organization of odorant receptor gene expression in the olfactory epithelium.
Cell
73:597-609[Web of Science][Medline].
-
Ressler KJ,
Sullivan SL,
Buck LB
(1994)
Information coding in the olfactory system: evidence for a stereotyped and highly organized epitope map in the olfactory bulb.
Cell
79:1245-1255[Web of Science][Medline].
-
Sallaz M,
Jourdan F
(1993)
C-fos expression and 2-deoxyglucose uptake in the olfactory bulb of odour-stimulated awake rats.
NeuroReport
4:55-58[Web of Science][Medline].
-
Shepherd GM
(1994)
Discrimination of molecular signals by the olfactory receptor neuron.
Neuron
13:771-790[Web of Science][Medline].
-
Singh GB,
Kramer JA,
Krawetz SA
(1997)
Mathematical model to predict regions of chromatin attachment to the nuclear matrix.
Nucleic Acids Res
25:1419-1425[Abstract/Free Full Text].
-
Stewart WB,
Kauer JS,
Shepherd GM
(1979)
Functional organization of rat olfactory bulb, analyzed by the 2-deoxyglucose method.
J Comp Neurol
185:715-734[Web of Science][Medline].
-
Strotmann J,
Wanner I,
Helfrich T,
Beck A,
Meinken C,
Kubick S,
Breer H
(1994a)
Olfactory neurones expressing distinct odorant receptor subtypes are spatially segregated in the nasal neuroepithelium.
Cell Tissue Res
276:429-438[Web of Science][Medline].
-
Strotmann J,
Wanner I,
Helfrich T,
Beck A,
Breer H
(1994b)
Rostro-caudal patterning of receptor expressing neurones in the rat nasal cavity.
Cell Tissue Res
278:11-20[Web of Science][Medline].
-
Sullivan SL,
Adamson MC,
Ressler KJ,
Kozak CA,
Buck LB
(1996)
The chromosomal distribution of mouse odorant receptor genes.
Proc Natl Acad Sci USA
93:884-888[Abstract/Free Full Text].
-
Vassar R,
Ngai J,
Axel R
(1993)
Spatial segregation of odorant receptor expression in the mammalian olfactory epithelium.
Cell
74:309-318[Web of Science][Medline].
-
Vassar R,
Chao SK,
Sitcheran R,
Nunez JM,
Vosshall LB,
Axel R
(1994)
Topographic organization of sensory projections to the olfactory bulb.
Cell
79:981-991[Web of Science][Medline].
-
Wang F,
Nemes A,
Mendelsohn M,
Axel R
(1998)
Odorant receptors govern the formation of a precise topographic map.
Cell
93:47-60[Web of Science][Medline].
-
Yokoi M,
Mori K,
Nakanishi S
(1995)
Refinement of odor molecule tuning by dendrodendritic synaptic inhibition in the olfactory bulb.
Proc Natl Acad Sci USA
92:3371-3375[Abstract/Free Full Text].
Copyright © 1999 Society for Neuroscience 0270-6474/99/19198409-10$05.00/0
This article has been cited by other articles:
|
|
|
|
 
C. Dubacq, S. Jamet, and A. Trembleau
Evidence for Developmentally Regulated Local Translation of Odorant Receptor mRNAs in the Axons of Olfactory Sensory Neurons
J. Neurosci.,
August 19, 2009;
29(33):
10184 - 10190.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Nishizumi, K. Kumasaka, N. Inoue, A. Nakashima, and H. Sakano
Deletion of the core-H region in mice abolishes the expression of three proximal odorant receptor genes in cis
PNAS,
December 11, 2007;
104(50):
20067 - 20072.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. H. Cho, M. Lepine, W. Andrews, J. Parnavelas, and J.-F. Cloutier
Requirement for Slit-1 and Robo-2 in Zonal Segregation of Olfactory Sensory Neuron Axons in the Main Olfactory Bulb
J. Neurosci.,
August 22, 2007;
27(34):
9094 - 9104.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Mori, Y. K. Takahashi, K. M. Igarashi, and M. Yamaguchi
Maps of Odorant Molecular Features in the Mammalian Olfactory Bulb
Physiol Rev,
April 1, 2006;
86(2):
409 - 433.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. W. Scott
Sniffing and Spatiotemporal Coding in Olfaction
Chem Senses,
February 1, 2006;
31(2):
119 - 130.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Miyamichi, S. Serizawa, H. M. Kimura, and H. Sakano
Continuous and Overlapping Expression Domains of Odorant Receptor Genes in the Olfactory Epithelium Determine the Dorsal/Ventral Positioning of Glomeruli in the Olfactory Bulb
J. Neurosci.,
April 6, 2005;
25(14):
3586 - 3592.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S.-i. Yoshihara, K. Omichi, M. Yanazawa, K. Kitamura, and Y. Yoshihara
Arx homeobox gene is essential for development of mouse olfactory system
Development,
February 15, 2005;
132(4):
751 - 762.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. M. Igarashi and K. Mori
Spatial Representation of Hydrocarbon Odorants in the Ventrolateral Zones of the Rat Olfactory Bulb
J Neurophysiol,
February 1, 2005;
93(2):
1007 - 1019.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Lei, T. A. Christensen, and J. G. Hildebrand
Spatial and Temporal Organization of Ensemble Representations for Different Odor Classes in the Moth Antennal Lobe
J. Neurosci.,
December 8, 2004;
24(49):
11108 - 11119.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. K. Takahashi, M. Kurosaki, S. Hirono, and K. Mori
Topographic Representation of Odorant Molecular Features in the Rat Olfactory Bulb
J Neurophysiol,
October 1, 2004;
92(4):
2413 - 2427.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Tian and M. Ma
Molecular Organization of the Olfactory Septal Organ
J. Neurosci.,
September 22, 2004;
24(38):
8383 - 8390.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. A. Nikonov and J. Caprio
Odorant Specificity of Single Olfactory Bulb Neurons to Amino Acids in the Channel Catfish
J Neurophysiol,
July 1, 2004;
92(1):
123 - 134.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. A. Wilson, M. L. Fletcher, and R. M. Sullivan
Acetylcholine and Olfactory Perceptual Learning
Learn. Mem.,
January 1, 2004;
11(1):
28 - 34.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Hoppe, H. Frank, H. Breer, and J. Strotmann
The Clustered Olfactory Receptor Gene Family 262: Genomic Organization, Promotor Elements, and Interacting Transcription Factors
Genome Res.,
December 1, 2003;
13(12):
2674 - 2685.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. L. Fletcher and D. A. Wilson
Olfactory Bulb Mitral-Tufted Cell Plasticity: Odorant-Specific Tuning Reflects Previous Odorant Exposure
J. Neurosci.,
July 30, 2003;
23(17):
6946 - 6955.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. A. Carlsson and B. S. Hansson
Dose-Response Characteristics of Glomerular Activity in the Moth Antennal Lobe
Chem Senses,
May 1, 2003;
28(4):
269 - 278.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Alenius and S. Bohm
Differential function of RNCAM isoforms in precise target selection of olfactory sensory neurons
Development,
March 1, 2003;
130(5):
917 - 927.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Hamana, J. Hirono, M. Kizumi, and T. Sato
Sensitivity-dependent Hierarchical Receptor Codes for Odors
Chem Senses,
February 1, 2003;
28(2):
87 - 104.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Kobayakawa, R. Hayashi, K. Morita, K. Miyamichi, Y. Oka, A. Tsuboi, and H. Sakano
Stomatin-Related Olfactory Protein, SRO, Specifically Expressed in the Murine Olfactory Sensory Neurons
J. Neurosci.,
July 15, 2002;
22(14):
5931 - 5937.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. M. Young and B. J. Trask
The sense of smell: genomics of vertebrate odorant receptors
Hum. Mol. Genet.,
May 15, 2002;
11(10):
1153 - 1160.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Key and J. St John
Axon Navigation in the Mammalian Primary Olfactory Pathway: Where to Next?
Chem Senses,
March 1, 2002;
27(3):
245 - 260.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. P. Lane, J. C. Roach, I. Y. Lee, C. Boysen, A. Smit, B. J. Trask, and L. Hood
Genomic Analysis of the Olfactory Receptor Region of the Mouse and Human T-Cell Receptor alpha /delta Loci
Genome Res.,
January 1, 2002;
12(1):
81 - 87.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. H. Fuss and S. I. Korsching
Odorant Feature Detection: Activity Mapping of Structure Response Relationships in the Zebrafish Olfactory Bulb
J. Neurosci.,
November 1, 2001;
21(21):
8396 - 8407.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Pyrski, Z. Xu, E. Walters, D. J. Gilbert, N. A. Jenkins, N. G. Copeland, and F. L. Margolis
The OMP-lacZ Transgene Mimics the Unusual Expression Pattern of OR-Z6, a New Odorant Receptor Gene on Mouse Chromosome 6: Implication for Locus-Dependent Gene Expression
J. Neurosci.,
July 1, 2001;
21(13):
4637 - 4648.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Belluscio and L. C. Katz
Symmetry, Stereotypy, and Topography of Odorant Representations in Mouse Olfactory Bulbs
J. Neurosci.,
March 15, 2001;
21(6):
2113 - 2122.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. M. Christie, N. E. Schoppa, and G. L. Westbrook
Tufted Cell Dendrodendritic Inhibition in the Olfactory Bulb Is Dependent on NMDA Receptor Activity
J Neurophysiol,
January 1, 2001;
85(1):
169 - 173.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Ehlers, S. Beck, S. A. Forbes, J. Trowsdale, A. Volz, R. Younger, and A. Ziegler
MHC-Linked Olfactory Receptor Loci Exhibit Polymorphism and Contribute to Extended HLA/OR-Haplotypes
Genome Res.,
December 1, 2000;
10(12):
1968 - 1978.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
J. Strotmann, S. Conzelmann, A. Beck, P. Feinstein, H. Breer, and P. Mombaerts
Local Permutations in the Glomerular Array of the Mouse Olfactory Bulb
J. Neurosci.,
September 15, 2000;
20(18):
6927 - 6938.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Xu, I. Kida, F. Hyder, and R. G. Shulman
Assessment and discrimination of odor stimuli in rat olfactory bulb by dynamic functional MRI
PNAS,
September 5, 2000;
(2000)
180321397.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
R. P. Lane, T. Cutforth, R. Axel, L. Hood, and B. J. Trask
Sequence analysis of mouse vomeronasal receptor gene clusters reveals common promoter motifs and a history of recent expansion
PNAS,
January 8, 2002;
99(1):
291 - 296.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Xu, I. Kida, F. Hyder, and R. G. Shulman
Assessment and discrimination of odor stimuli in rat olfactory bulb by dynamic functional MRI
PNAS,
September 12, 2000;
97(19):
10601 - 10606.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION
Gene
