 |
Previous Article | Next Article 
The Journal of Neuroscience, October 1, 1999, 19(19):8443-8453
Tenascin-C Contains Domains That Independently Regulate Neurite
Outgrowth and Neurite Guidance
Sally
Meiners,
Mary Lynn T.
Mercado,
Mohammed S. A.
Nur-e-Kamal, and
Herbert M.
Geller
Department of Pharmacology, University of Medicine and Dentistry of
New Jersey, Robert Wood Johnson Medical School, Piscataway, New Jersey
08854
 |
ABSTRACT |
Tenascin-C has been implicated in regulation of both neurite
outgrowth and neurite guidance. We have shown previously that a
particular region of tenascin-C has powerful neurite
outgrowth-promoting actions in vitro. This region
consists of the alternatively spliced fibronectin type-III (FN-III)
repeats A-D and is abbreviated fnA-D. The purpose of this study was to
investigate whether fnA-D also provides neurite guidance cues and
whether the same or different sequences mediate outgrowth and guidance.
We developed an assay to quantify neurite behavior at sharp substrate
boundaries and found that neurites demonstrated a strong preference for
fnA-D when given a choice at a poly-L-lysine-fnA-D
interface, even when fnA-D was intermingled with otherwise repellant
molecules. Furthermore, neurites preferred cells that overexpressed the
largest but not the smallest tenascin-C splice variant when given a
choice between control cells and cells transfected with tenascin-C. The
permissive guidance cues of large tenascin-C expressed by cells were
mapped to fnA-D. Using a combination of recombinant proteins
corresponding to specific alternatively spliced FN-III domains and
monoclonal antibodies against neurite outgrowth-promoting sites, we
demonstrated that neurite outgrowth and guidance were facilitated by
distinct sequences within fnA-D. Hence, neurite outgrowth and neurite
guidance mediated by the alternatively spliced region of tenascin-C are separable events that can be independently regulated.
Key words:
tenascin-C; FN-III domain; alternatively spliced region; neurite guidance; neurite outgrowth; inert substrate; cellular
substrate
 |
INTRODUCTION |
Development of the nervous system is
absolutely dependent on targeted growth of axons and dendrites. Not
only must neuronal processes elongate to reach their correct
destination (neurite outgrowth), but they must navigate in the proper
direction (neurite guidance). Both neurite outgrowth (Smith et al.,
1986 ) and guidance (Letourneau et al., 1994 ) are thought to be
regulated by astrocyte-derived surface molecules. Among these molecules
is tenascin-C, an extracellular matrix protein transiently expressed at
the boundaries of migratory pathways in the developing cortex
(Steindler et al., 1989 ) and reexpressed on glial scars in the adult
CNS (Lochter et al., 1991 ; McKeon et al., 1991 ; Laywell et al.,
1996 ). Based on its localization, tenascin-C was originally thought to
form barriers to advancing neurites by stunting their outgrowth and/or
deflecting them elsewhere (Steindler et al., 1989 ). However, functional
studies in vivo (Gates et al., 1996 ; Gotz et al., 1997 ;
Zhang et al., 1997 ) and in vitro (Faissner and Kruse, 1990 ;
Lochter et al., 1991 ; Meiners and Geller, 1997 ) have demonstrated that
tenascin-C can provide permissive, as well as inhibitory, cues for
neuronal growth.
Tenascin-C is not a single molecule but is instead a family of
alternatively spliced variants with potentially diverse actions (Chung
et al., 1996 ; Meiners and Geller, 1997 ; Gotz et al., 1997 ). Tenascin-C
splice variants differ only in their number of fibronectin type-III
(FN-III) domains; for example, the largest splice variant of
human tenascin-C has seven alternatively spliced FN-III domains [FN-III repeats A-D (fnA-D)] (Fig.
1) which are missing in the smallest.
Phases of increased cell migration and axonal growth in the developing
CNS have been closely correlated with expression of large but not small
tenascin-C (Crossin et al., 1989 ; Steindler et al., 1989 ; Kaplony et
al., 1991 ; Bartsch et al., 1992 ; Tucker, 1993 ), suggesting that fnA-D
might facilitate cell and neurite motility during embryogenesis. Our
own work demonstrated that fnA-D avidly promoted neurite outgrowth
in vitro from a variety of neuronal types, by itself as a
recombinant protein and also as part of large tenascin-C (Meiners and
Geller, 1997 ; Meiners et al., 1999 ).

View larger version (19K):
[in this window]
[in a new window]
|
Figure 1.
Multidomain structure of human tenascin-C. This
diagram is adapted from Aukhil et al. (1993) . The N termini of three
arms are joined to form a trimer, and two trimers are connected via a
disulfide bond to form a hexamer. Each arm consists of 14 EGF domains,
8-15 FN-III domains depending on alternative RNA splicing, and a
single fibrinogen domain. The universal FN-III domains (fn1-5 and
fn6-8) are present in all tenascin-C splice variants. The largest
tenascin-C splice variant contains seven alternatively spliced FN-III
domains (designated A1, A2, A4, B, C, and D, or fnA-D), which are
missing in the shortest splice variant.
|
|
Our previous work suggests that neurite outgrowth and guidance may be
separable events (Powell and Geller, 1999 ). We therefore used two
complementary choice assays to investigate the hypothesis that fnA-D
imparts distinct outgrowth and guidance cues. In one, growing neurites
were allowed to choose between poly-L-lysine (PLL) and
recombinant proteins corresponding to alternatively spliced and
universal tenascin-C FN-III domains, as well as large and small
tenascin-C splice variants. In the other, neurites were allowed to
choose between transfected cells that overexpressed either large or
small tenascin-C combined in heterogenous monolayers with untransfected
cells. Neurites demonstrated a strong preference for fnA-D, which was
masked in large tenascin-C on inert substrates but revealed in large
tenascin-C on cellular substrates. Guidance and outgrowth cues were
further localized to different sequences using monoclonal antibodies
against neurite outgrowth-promoting sites and recombinant proteins
corresponding to specific alternatively spliced FN-III domains. Hence,
neurite outgrowth and guidance can be independently regulated by the
alternatively spliced region of tenascin-C.
 |
MATERIALS AND METHODS |
Proteins and antibodies. Transfected baby hamster
kidney (BHK) cells, recombinant proteins expressed in bacteria, and
rabbit polyclonal tenascin-C antibodies were gifts of Dr. Harold
Erickson (Department of Cell Biology, Duke University Medical Center,
Durham, NC). Splice variants of human tenascin-C were produced in the transfected cells (Aukhil et al., 1993 ). Native large and small tenascin-C were purified from culture supernatants of these cells by
gelatin-Sepharose and hydroxyapatite chromatography (Aukhil et al.,
1990 ; Erickson and Briscoe, 1995 ), followed by electroelution from
nondenaturing gels (S. Meiners, unpublished data). Recombinant proteins expressed in bacteria (Aukhil et al., 1993 ) corresponded to
the following: universal FN-III domains 1-5 and 6-8 (fn1-5 and
fn6-8); fnA-D, the alternatively spliced FN-III domains of large
tenascin-C; and fnA-D ( ) C, the alternatively spliced domains minus
FN-III domain C (fnC). Fn1-5, fn6-8, and fnA-D were produced using
the PCR and cDNA isolated from BHK cells transfected with large
tenascin-C as the template. FnA-D ( ) C was produced using PCR and
cDNA isolated from U251-MG glioma cells as the template. [U251-MG
cells produce alternatively spliced transcripts of tenascin-C that
contain fnA-D as well as fnA-D ( ) C, although the species that
contains fnA-D predominates (Erickson and Bourdon, 1989 ).] Rabbit
polyclonal full-length tenascin-C antibody was prepared against highly
purified tenascin-C from U251-MG cells, which is almost entirely large
tenascin-C (Erickson and Bourdon, 1989 ). Rabbit polyclonal antibodies
against fn1-5 and fnA-D were prepared against the corresponding
recombinant protein. All reagents cited correspond to the human protein.
Recombinant proteins corresponding to fnA1-A4, the N-terminal region of
fnA-D, and fnB-D, the C-terminal region of fnA-D, were gifts of Drs.
Harold Erickson and Fransçoise Coussen (University of Bordeaux,
Bordeaux, France). Both of these correspond to the human protein.
Monoclonal antibody J1/tn2 against mouse tenascin-C was a gift of Dr.
Andreas Faissner (Department of Neurobiology, University of Heidelberg,
Heidelberg, Germany). The epitope for J1/tn2 is contained on fnD of
mouse tenascin-C (Gotz et al., 1996 ).
Chondroitin sulfate proteoglycan (CSPG) mixture isolated from
embryonic chick brain (consisting primarily of neurocan, phosphacan, versican, and aggrecan) was obtained from Chemicon (Temecula, CA).
Aggrecan was from Sigma (St. Louis, MO), and laminin-1 was from Life
Technologies (Rockville, MD). Monoclonal antibody CS-56, which
reacts with the glycosaminoglycan portion of native chondroitin sulfate
proteoglycans, was from Sigma. Monoclonal antibody RT97 against
neurofilament was from the Developmental Studies Hybridoma Bank (Iowa
City, IA), and a polyclonal antibody against neurofilament 200 was from
Sigma. Monoclonal antibody tenascin-IIIB, which recognizes an epitope
in fnB of human tenascin-C, was from Chemicon.
Neuronal cell culture. Cerebellar granule neuronal cultures
were prepared as described by Levi et al. (1984) . Neuronal cultures were cultivated from postnatal day 8 (P8) rat pups. Brains were removed
into a Petri dish containing 5 ml of BMEM with 2 M HEPES buffer (BMEM-HEPES). Cerebella were
removed, and meninges and blood vessels were peeled off and discarded
to ensure minimal contamination from endothelial cells. Cerebella were
then minced into fine pieces (<0.5 mm) with dissecting knives and
incubated in BMEM-HEPES containing 0.025% trypsin for 10 min at
37°C. After incubation, the trypsinization was halted by adding 1 ml
of BMEM containing 0.025% soybean trypsin inhibitor and 0.05% DNase
I. The tissue was then gently triturated through a fire-polished Pasteur pipette until it was dispersed into a homogeneous suspension. The suspension was transferred into a fresh tube. DMEM-25
mM KCl-10% heat-inactivated FCS (3-4 ml) was
added to any remaining tissue clumps, and the trituration was repeated.
Cells were then filtered through an ethanol-sterilized 40 µm mesh and
centrifuged for 10 min at 1500 rpm. The pellet of cerebellar granule
neurons was resuspended in DMEM-25 mM KCl-10%
FCS and used for neurite guidance and neurite outgrowth assays as
described below.
Neurite guidance assay. Neurite guidance is operationally
defined as directed neurite movement that is significantly different from chance. The two most frequently used guidance assays are the
stripe assay (Vielmetter et al., 1990 ) and the spot assay (Snow et al.,
1991 ). However, in neither has neurite behavior been quantified. We
therefore modified the spot assay to quantify the behavior of neurites
at an interface created between PLL and tenascin-C FN-III
recombinant proteins, native tenascin-C splice variants, or CSPGs. The
PLL-protein interface was created by placing a 5 µl drop of the
protein of interest (300 nM in HBSS) in
the center of a 12 mm PLL-coated glass coverslip. Coverslips in 24-well trays were incubated with the protein drop for 2 hr at 37°C, and excess protein solution was rinsed away with HBSS. Similar coating efficiencies between the tenascin-C splice variants and recombinant proteins (~5 pmol/cm2) were verified by
incubating entire coverslips with proteins conjugated to amine reactive
fluorescein (Pierce, Rockford, IL). Coated proteins were removed
after 2 hr by adding 2% SDS. The fluorescence of proteins bound to
PLL-coated glass was then assessed in a Cytofluor II fluorescence
microplate reader (PerSeptive Biosystems, Framingham, MA) as we have
described previously for proteins bound to cellular monolayers (Meiners
et al., 1999 ). In agreement with the results of others (Dorries et al.,
1996 ; Fischer et al., 1997 ), no major differences in coating
efficiencies could be observed.
Cerebellar granule neurons were plated onto the coverslips at a density
of 60,000 neurons per well and cultured for 48 hr in DMEM-25
mM KCl-10% FCS. At this time, coverslips were fixed with
acetic acid/ethanol (5%:95%) for 5 min at 20°C. After fixation, coverslips were rinsed in PBS (pH 7.4, 0.14 M NaCl, 2.7 mM KCl, 1.5 mM
KH2PO4, and 4.3 mM NaHPO4) and incubated with the
appropriate primary antibody against the protein in the drop
(polyclonal full-length tenascin-C antibody for native tenascin-C
splice variants and recombinant proteins, or monoclonal antibody CS-56
for CSPGs) diluted 1:100 in PBS containing 10% FCS (PBS-serum). After
rinsing in PBS, the coverslips were incubated with
fluorescein-conjugated secondary antibodies diluted 1:100 in PBS-serum
(goat anti-rabbit secondary antibodies for tenascin-C spots and goat
anti-mouse secondary antibodies for CSPG spots) (Organon-Technika
Cappel, Durham, NC). The coverslips were again rinsed in PBS, and those containing tenascin-C spots were incubated with monoclonal antibody RT97 against neurofilament, followed by a rhodamine-conjugated goat
anti-mouse secondary antibody, whereas those containing CSPG spots were
incubated with polyclonal antibody against neurofilament 200, followed
by a rhodamine-conjugated goat anti-rabbit secondary antibody. All
primary and secondary antibody incubations were for 30 min at 4°C.
Coverslips were rinsed in PBS, followed by ddH2O,
and then mounted in Fluoromount-G (Southern Biotechnology, Birmingham,
AL) on microscope slides. Nonspecific binding of secondary antibodies
was controlled for by omitting the appropriate primary antibody in
parallel cultures.
Cultures were examined using a Zeiss (Oberkochen, Germany)
Axioplan microscope equipped with an epifluorescence illuminator with
appropriate filter sets to visualize the fluorochromes. Images of the
cultures were captured using a Macintosh (Apple Computers, Cupertino,
CA) Quadra 700 with a Scion (Frederick, MD) LG-3 frame grabber board.
Images were analyzed by counting the number of neurites on both sides
of the PLL-protein interface that either remained on their substrate
(by virtue of either stopping or turning at the interface) or crossed
to the other side. A sample of 75 neurites was considered for each side
of the interface for each condition. Only single, nonfasiculated
neurites within 10 µm of the protein-PLL interface were considered
for the analysis. This distance was chosen because filopodia have been
shown to extend 10-50 µm (Gomez and Letourneau, 1994 ). In addition,
only neurites moving toward the interface were counted (the angle
between the neurite and the interface was <90°), and no neurite
whose soma was sitting on the interface was counted. The percentage of
neurites that crossed from PLL to the protein of interest or from the
protein to PLL was then assessed.
Neurite outgrowth assay. To investigate the neurite
outgrowth-promoting properties of fnA-D versus fnA-D ( ) C, PLL-coated glass coverslips in 24-well trays were incubated with recombinant proteins (300 nM in HBS) for 2 hr at 37°C. In
some experiments, coverslips were incubated with a mixture of fnA-D and
monoclonal antibody J1/tn2 (75 µg/ml). Excess protein solution was
rinsed away with HBS, and cerebellar granule neurons were plated onto the coverslips at a density of 60,000 neurons per well and allowed to
extend neurites for 48 hr in DMEM-25 mM
KCl-10% FCS. The extent of neurite outgrowth was then determined via
carboxyfluorescein diacetate (CFDA) labeling (Petroski and Geller,
1994 ). CFDA (Sigma) intensely stains the soma and all processes of
cultured, living neurons. Images of the cultures were captured using a
Macintosh Quadra 700 and analyzed with NIH Image software (available at http://rsb.info.nih.gov/). A sample of 100 neurons with processes equal
to or greater than one cell soma was considered for each condition. The
length of each primary process and its branches was measured for each
neuron, and the total neurite length was calculated as the sum of the
lengths of individual neurites.
Neurite guidance assay on cellular substrates. To
investigate regulation of neurite guidance in a cellular context, we
generated cellular interfaces between untransfected BHK cells, which
express no tenascin-C, and transfected BHK cells, which overexpress
either the largest or smallest tenascin-C splice variant (Aukhil et
al., 1993 ), according to a modified method of Powell et al. (1997) . First, transfected BHK cells were labeled with the red fluorescent cell
linker PKH26 (Sigma) according to the manufacturer's instructions. This dye binds irreversibly within the membranes of cells by selective partitioning with no apparent transfer of the label to unlabeled cells
(Ford et al., 1996 ). Single cell suspensions of transfected cells and
untransfected cells were then mixed in a 1:10 ratio. The cell mixture
was plated onto PLL-coated glass coverslips in 24-well trays at a
density of 1 × 105 cells per
coverslip. This density yielded confluent monolayers 24 hr later with
readily distinguishable "islands" of individual PKH26-labeled,
transfected cells interspersed among the untransfected cells. The
transfected cells were also readily distinguished from untransfected
cells by tenascin-C immunoreactivity.
Cerebellar granule neurons were plated onto BHK monolayers in DMEM-25
mM KCl-10% FCS and were allowed to extend neurites for 48 hr. At this time, neurons and their processes were labeled with CFDA.
Images of the cultures were captured, and neurite behavior was analyzed
on both sides of the interface formed between an untransfected cell and
a transfected cell. The number of neurites that originated on an
untransfected cell and either remained on the untransfected cell or
crossed to a transfected cell was assessed, as was the number of
neurites that originated on a transfected cell and either remained on
the transfected cell or crossed to an untransfected cell. A sample of
75 neurites was considered for each of these conditions. Only neurites
within 10 µm of the interface were included in the analysis.
Antibody blocking experiments on cellular substrates. To
investigate the role of specific FN-III sequences in the regulation of
neurite guidance by cellular tenascin-C, blocking experiments were
conducted using polyclonal antibodies against full-length tenascin-C,
alternatively spliced domains fnA-D, and universal domains fn1-5.
Monoclonal antibody J1/tn2, which reacts within fnD of fnA-D, was also
used in blocking experiments. Mixed monolayers containing untransfected
and transfected BHK cells were incubated with 75 µg/ml antibody in
DMEM-25 mM KCl-10% FCS for 1 hr at 37°C. Cerebellar granule neurons were plated onto the cells and cultured for
48 hr in the presence of antibodies. Neurite behavior at the interface
between transfected and untransfected cells was then evaluated.
Amplification of tenascin-C fragments by reverse
transcription-PCR. For the identification and
characterization of fnC-containing tenascin-C mRNA isoforms in
vivo, PCR (Saiki et al., 1988 ) was performed on
reverse-transcribed total RNA isolated from P3 rat cerebellum.
Total RNA was isolated using the RNeasy mini kit according to the
manufacturer's instructions (Qiagen, Santa Clarita, CA). Reverse
transcription (RT) of total RNA was done using 10 µg of RNA and
random primers with or without reverse transcriptase according to the
manufacturer's instructions (Amersham Pharmacia Biotech, Piscataway,
NJ). Amplification of tenascin-C fragments was done using the following
primers: A1-5' (5' GAAGAAGTACCTTCTCTG 3'), C-5' (5'
GAGGCCCTGCCCCTTCTGGAA 3'), C-3' (5' TGTAACAATCTCAGCCCTCAA 3'), and D-3'
(5' TGTTGTTGCTATGGCACT 3'). A1-5' represents a sequence at the 5' end
of the first alternatively spliced exon (fnA1) of rat tenascin-C
(LaFleur, 1994 ). C-5' represents a sequence at the 5' end of
alternatively spliced exon fnC of human tenascin-C, and C-3' represents
a sequence complementary to the 3' end of human fnC. These primers are
based on the published nucleotide sequence of the human protein (Siri
et al., 1991 ) because the corresponding rat sequences are not known.
D-3' represents a sequence complementary to the 3' end of the last
alternatively spliced exon (fnD) of rat tenascin-C (LaFleur et
al., 1994 ).
The primer pair C-5'/C-3' was used for amplification of a presumptive
rat fnC homolog. FnA-C and fnA-D were amplified using primer pairs
A-5'/C-3' and A-5'/D-3', respectively. PCR was performed in the
presence of 1.5 mM MgCl2 and 50 mM KCl by repeating the cycle (94°C for 1 min, 50°C for
1 min, and 72°C for 2 min) 35 times. The amplification products were
then characterized by agarose gel (1%) electrophoresis.
Western blot analysis of tenascin-C polypeptides. Expression
of tenascin-C in P3 rat cerebellum was examined using Western blotting
techniques. Cerebellar tissue was homogenized on ice in Laemmli sample
buffer (Laemmli, 1970 ). Protein concentrations were determined using
the Bio-Rad (Hercules, CA) DC protein assay. The homogenate (20 µg)
was subjected to SDS-PAGE (6%) (Laemmli, 1970 ) and then
transferred to nitrocellulose paper (100 mA, 6 hr) (Towbin et al.,
1979 ). Tenascin-C polypeptides were visualized as we have reported
previously (Meiners and Geller, 1997 ) using polyclonal
full-length tenascin antibody and an alkaline phosphatase-conjugated goat anti-rabbit secondary antibody (Sigma).
 |
RESULTS |
The alternatively spliced region of tenascin-C provides permissive
neurite guidance cues
FnA-D avidly promotes neurite outgrowth from a variety of CNS
neurons (Meiners and Geller, 1997 ). We therefore investigated whether
fnA-D can also provide guidance cues to growing neurites. Rat
cerebellar granule neurons were cultured for 48 hr on PLL-coated glass
coverslips containing spots of alternatively spliced or universal
tenascin-C FN-III domains. The behavior of the neurites was then
analyzed at the protein-PLL interface. Figure
2A shows that
cerebellar granule neurites demonstrated a strong preference for fnA-D
when encountering an interface between fnA-D and PLL. The neurites
(red) and the fnA-D (green)-PLL interface
are visualized in Figure 2B. More than 80% of the
neurites originating on PLL crossed to fnA-D, and <20% of the
neurites originating on fnA-D crossed to PLL. This was significantly
different from results obtained with neurites growing across a control
fluorescein-labeled BSA-PLL interface in which ~50% of the neurites
originating on PLL crossed to BSA and vice versa. The same 50:50
crossing ratio was observed for neurites growing across an imaginary
interface, created by drawing an ink circle approximating the size of a
5 µl protein drop on the back of the PLL-coated coverslip (data not
shown). The increased number of neurites crossing onto fnA-D indicates
that the alternatively spliced region provides permissive neurite
guidance cues. In contrast, universal FN-III domains fn1-5 and fn6-8
did not elicit neurite behavior, which differed significantly from the
control.

View larger version (32K):
[in this window]
[in a new window]
|
Figure 2.
The alternatively spliced region of tenascin-C
provides permissive neurite guidance cues. A, Cerebellar
granule neurons were cultured for 48 hr on PLL-coated coverslips
containing spots of fn1-5, fnA-D, fn6-8, large tenascin-C (TN.L) or
small tenascin-C (TN.S). The percentage of neurites that crossed from
PLL to the protein spot and vice versa was then assessed. Bars
represent the mean ± SEM (n = 4). In control
experiments, 51 ± 4% of the neurites crossed from PLL to a
fluorescein-labeled BSA control, and 50 ± 2% crossed from BSA to
PLL. Neurite behavior at fn1-5-PLL or fn6-8-PLL interfaces did not
vary significantly from the control. The percentage of neurites
crossing from PLL to fnA-D was significantly higher than control
(asterisk), and the percentage of neurites crossing from
fnA-D to PLL was significantly lower than control (double
asterisk) (p < 0.05;
Student-Newman-Keuls test). In contrast to fnA-D, the percentage of
neurites crossing from PLL to large or small tenascin-C
(crosses) was significantly lower than control
(p < 0.05; Student-Newman-Keuls test). A
polyclonal antibody (pAb) against fnA-D further
reduced the percentage of neurites crossing to large tenascin-C
(double cross); the reduction was significant
(p < 0.05; Student-Newman-Keuls test).
B, Double immunocytochemistry was performed using a
polyclonal antibody against full-length tenascin-C, followed by a
fluorescein-conjugated secondary antibody to detect fnA-D spots,
and monoclonal antibody RT97 followed by a rhodamine-conjugated
secondary antibody to detect neurons. Neurites on both sides of the
PLL-fnA-D interface showed a preference for fnA-D. Scale bar, 10 µm.
|
|
Because fnA-D promotes neurite outgrowth as a recombinant protein and
as a part of the largest tenascin-C splice variant (Meiners and Geller,
1997 ), we investigated its ability to guide neurites in the context of
native tenascin-C. Neurites were allowed to choose between PLL and
either the largest or smallest tenascin-C splice variant. We only
assessed neurite behavior on the PLL side of the interface because very
few neurons adhered to purified tenascin-C. Neurites consistently
avoided both splice variants (Fig. 2A). This is in
agreement with qualitative results of others showing cerebellar granule
neurite deflection by spots of tenascin-C (representing a mixture of
splice variants) isolated from neonatal mouse brain (Dorries et al.,
1996 ; Gotz et al., 1996 ). Therefore, the permissive guidance properties
of fnA-D were masked by other parts of the tenascin-C molecule,
indicating that tenascin-C was more inhibitory on a molar basis than
fnA-D was permissive. This observation was also reflected in
dose-response curves obtained for tenascin-C and fnA-D actions; the
inhibitory effect of both tenascin-C splice variants and the permissive
effect of fnA-D were dose-dependent with a tendency toward saturation
at 100 and 300 nM, respectively (data not shown).
On the other hand, the smallest tenascin-C splice variant was always
more repellant than the largest tenascin-C splice variant, with only
1-2% of the neurites crossing from PLL to small tenascin-C as opposed
to ~10% for large tenascin-C. Blocking large tenascin-C with a
polyclonal antibody against fnA-D reduced the percentage of neurites
that crossed to 1%, showing that the difference in the results with
the splice variants was attributable to the alternatively
spliced region. Given that homogenous substrates of fn6-8 (Meiners and
Geller, 1997 ) and large and small tenascin-C splice variants (Chiquet and Wehrle-Haller, 1994 ; Meiners and Geller, 1997 ) all promote neurite
outgrowth, the results of this experiment indicate that the ability to
facilitate neurite extension does not necessarily correlate with the
ability to provide permissive neurite guidance cues.
The alternatively spliced region overcomes tenascin-C boundaries to
neurite advance
We next investigated the hypothesis that a molar excess of the
alternatively spliced region could overcome the inhibition of the rest
of the tenascin-C molecule. To address this issue, we incubated
PLL-coated coverslips with spots of protein consisting of a mixture of
fnA-D and small tenascin-C. The concentration of small tenascin-C was
held constant at 100 nM, whereas that of fnA-D was
increased from 100 to 400 nM (Fig.
3A). As in Figure 2, only
1-2% of the neurites crossed onto small tenascin-C. This number
increased to 8-10% for small tenascin-C in combination with 100 nM fnA-D, precisely the same percentage of
neurites that crossed to large tenascin-C (Fig. 2). The percentage of
neurites that crossed onto mixtures of small tenascin-C and fnA-D
increased as the concentration of fnA-D was increased and reached the
maximum with 300 nM fnA-D. This concentration
resulted in 60-70% of the neurites crossing; larger concentrations of
fnA-D did not further increase the percentage of neurites crossing.
Hence, the concentration of fnA-D that is the most efficacious at
providing neurite guidance cues by itself (Fig. 2) is also best to
overcome the inhibitory guidance cues of small tenascin-C. Neurites
more readily crossed onto 300 nM fnA-D (Fig. 2)
than onto a mixture of 300 nM fnA-D and 100 nM small tenascin-C, indicating that fnA-D
primarily mitigates, but does not entirely abolish, the inhibitory
properties of small tenascin-C.

View larger version (25K):
[in this window]
[in a new window]
|
Figure 3.
FnA-D overcomes tenascin-C boundaries to neurite
advance. Cerebellar granule neurons were cultured for 48 hr on
PLL-coated coverslips containing spots of protein comprised of both
small tenascin-C and fnA-D (A) or large
tenascin-C and fnA-D (B) (n = 3). The concentration of tenascin-C was held constant at 100 nM, and that of fnA-D was increased from 100 nM
(a 1:1 ratio of fnA-D to tenascin-C) to 400 nM (a 4:1
ratio). The percentage of neurites crossing from PLL to the
tenascin-C-fnA-D spot increased with increasing concentrations of
fnA-D. The maximal effect was observed with 300 nM fnA-D
for small tenascin-C and 200 nM fnA-D for large
tenascin-C.
|
|
We also investigated the ability of the alternatively spliced region to
overcome the inhibitory guidance cues of large tenascin-C. We found
that a molar excess of fnA-D weakened the boundary formed by this
tenascin-C splice variant (100 nM); however, the maximal effect was observed with 200 nM fnA-D (Fig. 3B)
rather than 300 nM. The lower concentration of
fnA-D necessary to overcome the boundaries formed by large as opposed
to small tenascin-C probably reflects the fact that large tenascin-C
already contains one fnA-D sequence, whereas small tenascin-C contains none.
The alternatively spliced region overcomes CSPG boundaries
Our next objective was to investigate whether the permissive
guidance cues of fnA-D could also override inhibitory guidance cues
provided by other types of molecules. We investigated its effects in
combination with CSPGs, because CSPGs deflect neuronal processes in
culture (Snow et al., 1990 ) and because tenascin-C and CSPGs are often
coregulated on astrocytes (McKeon et al., 1991 ; Meiners et al., 1995 ;
Powell et al., 1997 ). We first assessed neurite behavior at an
interface formed between PLL and a mixture of CSPGs (Table
1) consisting primarily of neurocan,
phosphacan, versican, and aggrecan. Because native CSPGs with intact
glycosaminoglycan side chains revealed a smear on SDS-PAGE gels and
accurate molecular weights could not be assigned (data not shown), we
used 10 µg/ml CSPG mixture in this experiment rather than a specified
molar concentration. Neurites avoided the CSPG mixture, with only
1-2% crossing from PLL to the CSPGs. As with tenascin-C, neurons did not adhere to the CSPG mixture, and neurite behavior on the CSPG side
of the interface was not assessed. When the CSPGs were combined with
fnA-D (300 nM), ~60% of the neurites now crossed onto
the mixture of CSPGs and fnA-D. Larger concentrations of fnA-D did not
further increase the percentage of neurites crossing.
We compared the effects of fnA-D with laminin-1, a potent promoter of
neurite outgrowth. Laminin-1 was not nearly as effective in guiding
neurites by itself (45% of the neurites crossed onto 300 nM laminin-1 (M.L.T. Mercado, unpublished data) as opposed to 80% for fnA-D) or in overcoming the CSPG barrier (only ~10% of
the neurites crossed onto the mixture of CSPGs and laminin-1). Increasing the concentration of laminin-1 to 1 µM only
increased the percentage of crossed neurites to 25-30%. The
experiment was repeated using a single CSPG, aggrecan, instead of a
mixture, and similar results were obtained. FnA-D was more effective
than laminin-1 in mitigating the inhibitory guidance cues of aggrecan. FnA-D was also more effective than fn6-8, another neurite
outgrowth-promoting molecule (Meiners and Geller, 1997 ) that does not
provide guidance information to neurites (Fig. 2A).
Thus, fnA-D specifically overcomes boundaries to neurite advance that
are formed by a variety of different CSPGs.
Neurite guidance and neurite outgrowth are mediated by different
sequences within fnA-D
Facilitation of neurite outgrowth by fnA-D bound to inert
substrates has been mapped to fnD (Gotz et al., 1996 ). We therefore explored this question: are neurite outgrowth and neurite guidance mediated by the same or different sequences within fnA-D? To do this,
we evaluated the ability of monoclonal antibody J1/tn2 to alter neurite
behavior in both neurite guidance and neurite outgrowth assays. This
antibody specifically blocks the neurite outgrowth-promoting site
within fnD (Gotz et al., 1996 , 1997 ; Meiners et al., 1999 ). Spots of
fnA-D or a mixture of fnA-D and J1/tn2 were made in the center of
PLL-coated coverslips, and neurite behavior was quantified at the
interface. J1/tn2 did not alter the percentage of neurites crossing
from PLL onto fnA-D (Fig.
4A) or the percentage
of neurites crossing from fnA-D to PLL (data not shown). Neurite
outgrowth assays were then conducted to quantify process extension on
PLL or homogenous substrates of fnA-D or a mixture of fnA-D and J1/tn2 adsorbed to PLL-coated coverslips. Box-and-whisker plots of
total neurite length are shown in Figure 4B.
Boxes enclose 25th and 75th percentiles of each distribution
and are bisected by the median; whiskers indicate 5th and
95th percentiles. As expected, neurites were considerable longer on
fnA-D compared with PLL, and J1/tn2 eliminated the promotion of neurite
outgrowth by fnA-D. In control experiments, monoclonal antibody
tenascin III-B, which reacts within fnB (Chemicon), failed to alter
outgrowth or guidance by fnA-D. These results indicate that neurite
guidance by fnD is regulated by a different sequence from that
promoting neurite outgrowth.

View larger version (23K):
[in this window]
[in a new window]
|
Figure 4.
The neurite outgrowth-promoting site in fnD does
not mediate neurite guidance. A, Cerebellar granule
neurons were cultured for 48 hr on PLL-coated coverslips containing
spots of fnA-D, a mixture of fnA-D, and monoclonal antibody (mAb)
J1/tn2, or a mixture of fnA-D and monoclonal antibody tenascin III-B
(mAb III-B) (n = 4). J1/tn2, which reacts in fnD,
did not change the percentage of neurites that crossed from PLL to
fnA-D, nor did mAb III-B, which reacts in fnB. B,
Cerebellar granule neurons were allowed to extend neurites for 48 hr on
PLL-coated glass coverslips or PLL-coated glass coverslips to which
fnA-D or mixtures of fnA-D and J1/tn2 or mAb III-B had been adsorbed.
Distributions of the total neurite length are presented as a
box-and-whisker plot. One representative experiment of
four is shown. Boxes enclose 25th and 75th percentiles
of each distribution and are bisected by the median;
whiskers indicate 5th and 95th percentiles. Outgrowth
was significantly greater on fnA-D (asterisk) and the
fnA-D-mAb III-B mixture (cross) than on the PLL control
(p < 0.05; Kolmogorov-Smirnov test);
hence, mAb III-B had no effect on the neurite outgrowth-promoting
properties of fnA-D. Outgrowth on the fnA-D-J1/tn2 mixture did not
differ significantly from the PLL control; hence, J1/tn2 eliminated the
neurite outgrowth-promoting qualities of fnA-D.
|
|
To begin to localize neurite guidance site(s) within fnA-D to a
particular region of the protein, cerebellar granule neurons were
cultured for 48 hr on PLL-coated coverslips containing spots of the
following: fnA1-A4, the N-terminal portion of fnA-D; fnB-D, the
C-terminal portion of fnA-D; or a mixture of fnA1-A4 and fnB-D (300 nM of each). Neurite behavior was then evaluated at the
recombinant protein-PLL interface (Fig.
5). Only 20% of the neurites originating on the PLL side of a PLL-fnA1-A4 interface crossed onto fnA1-A4, whereas neurites originating on the fnA1-A4 side of the interface showed no bias for either PLL or fnA1-A4 (compare with neurite behavior
at the BSA-PLL control interface in Fig. 2). This suggests that
neurite behavior on one side of an interface cannot necessarily predict
neurite behavior on the other side. Hence, neurites growing on PLL
avoid fnA1-A4, but neurites growing on fnA1-A4 seem to "acclimate"
to the molecule rather than opting to cross off of it. On the other
hand, neurites on both sides of the interface showed a preference for
fnB-D; the percentages of neurites crossing to fnB-D from PLL and to
PLL from fnB-D were nearly identical to those observed for fnA-D
(compare with Fig. 2). Hence, fnB-D mimicked the actions of fnA-D. An
equimolar mixture of fnA1-A4 plus fnB-D also mimicked the actions of
fnA-D, suggesting that the C-terminal portion of fnA-D provides
permissive neurite guidance cues and overcomes the inhibitory boundary
formed by the N-terminal portion.

View larger version (27K):
[in this window]
[in a new window]
|
Figure 5.
Neurite guidance is localized to the C-terminal
portion of fnA-D. Cerebellar granule neurons were cultured for 48 hr on
PLL-coated coverslips containing spots of fnA1-A4, fnB-D, or a mixture
of fnA1-A4 and fnB-D (n = 3). The dashed
line indicates random neurite behavior at a control BSA-PLL
interface. The percentage of neurites crossing from PLL to fnA1-A4 was
significantly lower than control (asterisk)
(p < 0.05; Student-Newman-Keuls test),
whereas behavior for neurites originating on fnA1-A4 was more or less
random. On the other hand, the percentage of neurites crossing from PLL
to fnB-D or fnA1-A4 plus fnB-D was significantly higher than control
(crosses), and the percentage of neurites crossing from
fnB-D or fnA1-A4 plus fnB-D to PLL was significantly lower than control
(double crosses) (p < 0.05;
Student-Newman-Keuls test).
|
|
We next explored the hypothesis that fnC provides guidance cues to
growing neurites. The rationale for this hypothesis was based on
published work demonstrating that cerebellar granule neurites avoid
rodent fnA-D recombinant proteins, which lack fnC (Gotz et al., 1996 ).
We compared fnA-D with an fnA-D recombinant protein missing fnC (fnA-D
( ) C) in neurite guidance and neurite outgrowth assays. Neurite
behavior was quantified at fnA-D or fnA-D ( ) C (300 nM)-PLL interfaces (Fig.
6A). As in Figure
2A, >80% of the neurites crossed from PLL onto
fnA-D. This was reduced to ~25% for neurites crossing onto fnA-D
( ) C. These data are consistent with the hypothesis that fnC provides
permissive guidance cues, which overcome the barrier to neurite advance
formed by fnA1-A4, the N-terminal portion of fnA-D (Fig. 5). As with
fnA1-A4, neurites originating on fnA-D ( ) C did not show a preference for either fnA-D ( ) C or PLL. When neurite outgrowth assays
were performed for neurons cultured on fnA-D or fnA-D ( ) C adsorbed to PLL-coated coverslips (Fig. 6B), both proteins
were found to be equally permissive to process extension compared with
PLL alone. These results, along with those of Figure 5, imply that
neurite guidance and neurite outgrowth by fnA-D are mediated through
different alternatively spliced FN-III domains: fnC for neurite
guidance and fnD for neurite outgrowth.

View larger version (20K):
[in this window]
[in a new window]
|
Figure 6.
FnC is implicated in mediation of neurite
guidance. A, Cerebellar granule neurons were cultured
for 48 hr on PLL-coated coverslips containing spots of fnA-D or fnA-D
( ) C) (n = 3). Neurites on the PLL side of the
interface showed a significant preference for fnA-D
(asterisk) and a significant aversion for fnA-D ( ) C
(cross) (p < 0.05;
Student-Newman-Keuls test). Neurites on the protein side of the
interface showed a significant preference for fnA-D (double
asterisk) (p < 0.05;
Student-Newman-Keuls test) but demonstrated random behavior
(dashed line) on fnA-D ( ) C. B,
Cerebellar granule neurons were cultured for 48 hr on PLL-coated
coverslips to which fnA-D or fnA-D ( ) C had been adsorbed. One
representative experiment of four is shown. FnA-D and fnA-D ( ) C both
significantly increased neurite outgrowth compared with PLL
(asterisks) (p < 0.05;
Kolmogorov-Smirnov test); distributions of neurite length on fnA-D and
fnA-D ( ) C were the same.
|
|
FnA-D guides neurites in the context of cellular tenascin-C
Work with purified substrates is informative but does not always
predict the in vivo situation in which many molecules are present in a biological matrix (Meiners and Geller, 1997 ). We therefore
investigated the ability of fnA-D to provide permissive neurite
guidance cues in the context of tenascin-C expressed by a cell in which
a neuron would normally encounter it. BHK cells transfected with the
largest or smallest splice variant of human tenascin-C (BHK-TN.L or
BHK-TN.S cells, respectively) were combined with control, untransfected
BHK cells in a mixed monolayer. Cerebellar granule neurons were
cultured on the mixed monolayer for 48 hr, and the behavior of neurites
at the interface formed between transfected and control cells was
assessed. Figure 7A presents
an image of the neuron-BHK coculture after double immunocytochemistry
with antibodies against full-length tenascin-C to detect transfected cells and RT97 to detect neurons. Neurites crossed quite readily from
control BHK cells to BHK-TN.L cells, but they avoided crossing from BHK
cells to BHK-TN.S cells. Similar results were obtained using cerebral
cortical neurons (data not shown). This is in contrast to results
obtained with purified substrates of tenascin-C, which always formed
barriers to neurites regardless of the splice variant present (Fig.
2).

View larger version (40K):
[in this window]
[in a new window]
|
Figure 7.
FnA-D guides neurites in the context of cellular
tenascin-C. A, Cerebellar granule neurons were cultured
for 48 hr on a mixed monolayer of BHK cells and BHK-TN.L or BHK-TN.S
cells. Double immunocytochemistry was performed using a polyclonal
antibody against full-length tenascin-C, followed by a
fluorescein-conjugated secondary antibody, and monoclonal antibody
RT97, followed by a rhodamine-conjugated secondary antibody. Neurites
crossed from BHK cells to BHK-TN.L cells but avoided BHK-TN.S cells.
Scale bar, 12 µm. B, Neurite behavior at cellular
interfaces was quantified (n = 4). In control
experiments, 45-50% of the neurites crossed from BHK cells to
PKH26-labeled BHK cells, and vice versa. The percentage of neurites
that crossed from BHK cells to BHK-TN.L cells was significantly
higher than control (asterisk), and the percentage that
crossed from BHK-TN.L cells to BHK cells was significantly lower
(double asterisk) (p < 0.05;
Student-Newman-Keuls test). In contrast, the percentage of neurites
that crossed onto BHK-TN.S cells was significantly lower than control
(cross), and the percentage that crossed off was
significantly higher (double cross)
(p < 0.05; Student-Newman-Keuls
test).
|
|
We then quantified neurite behavior at the interface formed between
transfected and control BHK cells (Fig. 7B). BHK-TN.L or
BHK-TN.S cells were labeled with the membrane marker PKH26 to ensure
that we were examining a cellular rather than a matrix boundary.
Immunocytochemistry and Western blotting demonstrated that PKH26
labeling did not interfere with the expression of tenascin-C by the
transfected cells (data not shown). Neurites demonstrated a preference
for BHK-TN.L cells compared with control BHK cells. Approximately 70%
of the neurites that originated on a BHK cell crossed to a BHK-TN.L
cell, and only 20% of the neurites that originated on a BHK-TN.L cell
crossed to a BHK cell. This was significantly different from neurite
behavior observed at a control BHK-BHK interface created between BHK
cells and PKH26-labeled BHK cells in which the percentage of neurites
that crossed to and from a PKH26-labeled cell was 45-50%. On the
other hand, neurites demonstrated a preference for BHK cells over
BHK-TN.S cells. The percentage of neurites that crossed from a BHK cell
to a BHK-TN.S cell (20%) was significantly lower than control, whereas
the percentage of neurites that crossed from a BHK-TN.S cell to a BHK
cell (60-65%) was significantly higher than control. Therefore, only
small tenascin-C provides inhibitory neurite guidance cues when
expressed by a BHK cell. This suggests that the alternatively spliced
region included in large tenascin-C overcomes the barrier formed by the rest of the molecule by providing permissive neurite guidance cues of
its own.
To ascertain that fnA-D does indeed provide permissive guidance cues in
the context of a cellular matrix, a panel of antibodies against
tenascin-C was tested for interference with neurite behavior at
cellular interfaces (Fig. 8). The
selection included polyclonal antibodies against full-length
tenascin-C, fnA-D, fn1-5, and monoclonal antibody J1/tn2. All of these
antibodies cross-react with the largest tenascin-C splice variant on
transfected BHK cells. As expected, the polyclonal antibody against
fnA-D and monoclonal antibody J1/tn2 do not cross-react with the
smallest tenascin-C splice variant, the fn1-5 antibody does not
cross-react with fnA-D, and the fnA-D antibody does not cross-react
with fn1-5 (Meiners and Geller, 1997 ).

View larger version (30K):
[in this window]
[in a new window]
|
Figure 8.
Neurite guidance in the presence of tenascin-C
antibodies. A, Cerebellar granule neurons were cultured
for 48 hr on a mixed monolayer of BHK cells and BHK-TN.L or BHK-TN.S
cells in the presence of a polyclonal antibody against full-length
tenascin-C. The antibody significantly reduced the percentage of
neurites that crossed from BHK cells to BHK-TN.L cells from ~70 to
50% (asterisk) and significantly increased the
percentage of neurites that crossed to BHK-TN.S cells from ~20 to
50% (cross) (p < 0.05;
Student-Newman-Keuls test). B, Neurons were also
cultured on a mixed monolayer of BHK cells and BHK-TN.L cells in
the presence of polyclonal antibodies against fn1-5 or fnA-D, or
monoclonal antibody (mAb) J1/tn2. The fn1-5 antibody
did not effect the percentage of neurites that crossed to BHK-TN.L
cells, nor did J1/tn2. The fnA-D antibody significantly reduced the
percentage of neurites that crossed to ~20% (double
asterisk) (p < 0.05;
Student-Newman-Keuls test).
|
|
The first antibody tested was a polyclonal antibody against full-length
tenascin-C (Fig. 8A). In the presence of this
antibody, the percentage of neurites that crossed from a BHK cell to a
BHK-TN.S or a BHK-TN.L cell was indistinguishable from the control
value obtained for neurites crossing from BHK cells to BHK cells
(compare with Fig. 7B), as was the percentage of neurites
that crossed from a BHK-TN.L or BHK-TN.S cell to a BHK cell (data not
shown). This confirms that large and small tenascin-C were directly
responsible for the permissive and inhibitory neurite guidance
properties of BHK-TN.L and BHK-TN.S cells, as opposed to some other
factor produced by the transfected cells. The polyclonal antibody
against fn1-5 did not alter the percentage of neurites that crossed to BHK-TN.L or BHK-TN.S cells, which was to be expected because a recombinant protein corresponding to this sequence did not provide neurite guidance cues (Fig. 2).
We then examined the effects of the two antibodies that react within
the alternatively spliced region, polyclonal antibody against fnA-D and
monoclonal antibody J1/tn2 (Fig. 8B). Neither of
these antibodies altered the percentage of neurites that crossed from
BHK cells to BHK-TN.S cells (data not shown). However, the polyclonal
antibody against fnA-D dramatically reduced the percentage of neurites
that crossed to BHK-TN.L cells from 70 to 20%. In the presence of this
antibody, BHK-TN.L cells repelled neurites to the same extent as
BHK-TN.S cells. Therefore, the permissive guidance cues of large
tenascin-C expressed by transfected BHK cells could be mapped to the
alternatively spliced region, suggesting that the ability of
fnA-D to guide neurites is masked in purified tenascin-C (Fig.
2) but revealed in the BHK cell matrix. Monoclonal J1/tn2 had no effect
on the percentage of neurites crossing from BHK cells to BHK-TN.L
cells. Hence, neurite-promoting sequences within fnA-D do not provide
guidance cues to neurites, indicating that neurite outgrowth and
guidance facilitated by the alternatively spliced region of tenascin-C
are distinct events that can be independently regulated on cellular, as
well as inert, substrates.
An fnC homolog is expressed in developing rat cerebellum
Our results implicate fnC and fnD in providing permissive neurite
guidance and outgrowth cues to rat cerebellar granule neurites (Figs.
5, 6). The presence of fnD, but not fnC, has been established in
alternatively spliced forms of rat tenascin-C (LaFleur et al., 1994 ).
We therefore conducted an RT-PCR analysis of the expression of the fnC
exon in the early postnatal rat cerebellum, which is a time of active
morphogenesis (Pigott and Kelly, 1984 ). Using primers based on the
human tenascin-C sequence, a single PCR product of the expected size
(273 bp) (LaFleur et al., 1994 ) was obtained (Fig.
9A). Amplification with a
sense primer derived from the rat fnA1 sequence and an antisense primer
derived from the human fnC sequence yielded a PCR product the size of 6 FN-III domains (1638 bp), and amplification with a sense primer derived
from the rat fnA1 sequence and an antisense primer derived from the rat
fnD sequence yielded a product the size of 7 FN-III domains (1911 bp).
These results indicate that rat fnA-D contains a homolog of human fnC
that is sixth in a series of seven alternatively spliced FN-III
domains. This is consistent with reports for human (Siri et al., 1991 ),
but not mouse, fnA-D, which only has six alternatively spliced FN-III
domains (Dorries and Schachner, 1994 ; Joester and Faissner, 1999 ). In
control experiments, no PCR products were revealed for cDNA synthesized
in the absence of reverse transcriptase and then amplified with the fnC
primers.

View larger version (57K):
[in this window]
[in a new window]
|
Figure 9.
Analysis of fnC expression in developing rat
cerebellum. A, PCR was performed on P3 rat cerebellar
cDNA. Amplification was done using sense and antisense primers derived
from the human fnC nucleotide sequence; a sense primer derived from the
rat fnA1 sequence and an antisense primer derived from the human fnC
sequence; or a sense primer derived from the rat fnA1 sequence and an
antisense primer derived from the rat fnD sequence. One representative
experiment of three is shown. The PCR products (designated fnC, fnA-C,
and fnA-D) are depicted to the right of the marker
(M). They correspond in size to one, six,
and seven FN-III domains (273, 1638, and 1911 bp, respectively). No
products were obtained for cDNA synthesized without reverse
transcriptase and then amplified with the fnC primers
(contr.). B, Tissue homogenate from P3
rat cerebellum (20 µg) was analyzed on Western blots probed with a
polyclonal antibody against full-length tenascin-C, followed by an
alkaline phosphatase-conjugated secondary antibody. One representative
experiment of three is shown. Blots demonstrated one predominant
tenascin-C polypeptide with Mr of
260,000.
|
|
We did not conduct PCR experiments using combinations of primers to all
of the alternatively spliced FN-III domains, and as such, our data do
not exclude the possibility of shorter fnC-containing mRNAs in the
postnatal rat cerebellum [e.g., counterparts of the recently
identified mouse fnC-containing mRNA splice variants containing two or
four alternatively FN-III spliced domains (Joester and Faissner,
1999 )]. On the other hand, Western blot analysis of P3 rat cerebellum
with the full-length tenascin-C polyclonal antibody only identified one
predominant tenascin-C polypeptide with
Mr of 260,000 (Fig. 9B). In
agreement with the RT-PCR results (Fig. 9A), this
polypeptide is of the correct size to represent the smallest reported
rat tenascin-C splice variant (Mr of
190,000) (Chiquet-Ehrismann et al., 1986 ) with the inclusion of seven
alternatively spliced FN-III domains. Thus, our results support the
presence of alternatively spliced FN-III domains C as well as D in the developing rat cerebellum, where they may provide guidance and growth
cues to neurites.
 |
DISCUSSION |
The alternatively spliced FN-III region of tenascin-C, designated
fnA-D, promotes neurite outgrowth as a substrate-bound molecule and
also facilitates neurite guidance. Its permissive actions can be seen
whether fnA-D is presented to neurons as a purified recombinant protein
or as part of cellular tenascin-C in a biological matrix. Other
molecules, such as the netrins (Kennedy et al., 1994 ; Serafini et al.,
1994 ), also have strong effects on both the outgrowth and orientation
of axons. However, in the case of the netrins, both processes are
mediated through the same neuronal receptor, which probably interacts
with the same functional domain of the netrin molecule (de la Torre et
al., 1997 ). To our knowledge, fnA-D is the first molecule that
independently facilitates neurite outgrowth and guidance through
different sequences (located within alternatively spliced FN-III
domains D and C, respectively), providing strong evidence that
outgrowth and guidance are separable events.
The fact the human fnA-D provided permissive guidance cues was somewhat
surprising at first given published data with purified substrates of
mouse fnA-D (Gotz et al., 1996 ). Mouse fnA-D facilitates process
extension to the same extent as human fnA-D because of a common neurite
outgrowth-promoting site within fnD (Gotz et al., 1996 ) but has been
reported to form barriers to neurites. This implies that some sequence
unique to human, but not mouse, fnA-D facilitates neurite guidance and
that the common neurite outgrowth-promoting site is not involved. In
agreement with this hypothesis, monoclonal antibodies against the
neurite outgrowth-promoting site within fnD did not alter the ability
of human fnA-D to guide neurites. We also found that neurites
demonstrated a preference for human fnB-D in guidance assays but
avoided rat fnB-D (data not shown). The rat fnB-D recombinant protein
used in our assay and the mouse fnA-D recombinant protein used in the
Gotz et al. (1996) study were both obtained via PCR using rodent
tenascin-C cDNA as the template. However, it appears that these
templates corresponded to naturally occurring tenascin-C variants,
which lacked fnC. We found that a naturally occurring variant of human fnA-D lacking fnC also formed barriers to neurites instead of attracting them. Together, these data suggest that fnC is not only
responsible for the permissive guidance cues of human fnA-D but
overcomes inhibitory guidance cues provided by the rest of the
molecule. It seems likely that rodent fnC will also impart permissive
guidance cues to neurites, given that the sequence of mouse fnC
displays 95% identity with human fnC (Joester and Faissner, 1999 ).
In contrast to the permissive guidance cues provided by human fnA-D,
purified substrates of all splice variants of human (Fig. 2) and mouse
(Dorries et al., 1996 ; Gotz et al., 1996 ) tenascin-C are repulsive to
advancing growth cones (Dorries et al., 1996 ). The growth
cone-repelling properties have been attributed to the epidermal growth
factor (EGF) domains (Dorries et al., 1996 ; Gotz et al., 1996 ).
Therefore, on a molar basis, the EGF domains are more inhibitory than
the alternatively spliced region is permissive. However, a twofold to
threefold molar excess of fnA-D significantly overcomes the boundary
formed not only by tenascin-C but also by a variety of CSPGs. Much
larger concentrations of laminin-1 were not nearly as effective. This
is significant in that tenascin-C and CSPGs are upregulated on glial
scars after injury (McKeon et al., 1991 ; Pindzola et al., 1993 ) in
which they have been strongly implicated in failed axonal regeneration
(Gates et al., 1996 ; Davies et al., 1997 ). Full recovery cannot occur
after CNS injury unless axons are guided across the inhibitory terrain
of the glial scar, suggesting a potential therapeutic role for
fnA-D.
We have suggested previously that functions of the EGF domains of
tenascin-C are obscured in cellular as opposed to purified tenascin-C,
perhaps by cell-derived molecules binding to them or because of
conformational restraints on cellular tenascin-C (Meiners and Geller,
1997 ). Specifically, the EGF domains promoted neurite outgrowth as
purified recombinant proteins (Dorries et al., 1996 ; Gotz et al., 1996 )
but had no effect on outgrowth in the context of cellular tenascin-C
(Gotz et al., 1997 ; Meiners and Geller, 1997 ). We found that antibodies
directed against tenascin-C FN-III domains 6-8 and A-D blocked all
regulation of neurite outgrowth by cellular tenascin-C; the EGF domains
did not contribute (Meiners and Geller, 1997 ). We therefore reasoned
that the boundary-forming properties of the EGF domains, in addition to
the neurite-promoting properties, might be similarly attenuated in the
cellular tenascin-C. If the EGF boundary was weakened in a biological
matrix, the permissive guidance cues of fnA-D might then be revealed in
the large tenascin-C splice variant. In support of this hypothesis,
transfected BHK cells that overexpressed small tenascin-C formed a
barrier to neurites, whereas cells that overexpressed large tenascin-C
were attractive to neurites. However, more neurites crossed onto
BHK-TN.S cells than onto purified small tenascin-C, and fewer neurites crossed onto BHK-TN.L cells than onto purified fnA-D (compare Figs. 3,
8). At the same time, in early experiments, neurites preferred BHK
cells to which fnA-D was bound over BHK-TN.L cells. This suggests that
the boundary-forming properties of the EGF domains of tenascin-C were
partially but not totally eliminated in the BHK cell environment. A
monoclonal antibody against the neurite outgrowth-promoting site within
fnD did not affect the percentage of neurites that crossed to either
BHK-TN.L or BHK-TN.S cells, demonstrating that neurite guidance and
outgrowth facilitated by fnA-D were separable phenomena on cellular, as
well as inert, substrates.
Although our results were obtained using BHK cells, it seems quite
conceivable that guidance of neuronal processes by tenascin-C splice
variants could vary with cell type. Different cell type-specific molecules might bind and mask different active sites for neurite guidance within the tenascin-C molecule, as we have seen for neurite outgrowth-promoting sites within the alternatively spliced region (Meiners et al., 1999 ). Alternatively, cell-type specific molecules might provide neurite guidance cues of their own that compete with or
override those of tenascin-C. For example, when the ratio of CSPGs to
fnA-D was low, neurites were deflected, but as the ratio of fnA-D was
increased, neurites crossed. Hence, the neuronal growth regulatory
properties of tenascin-C or any other matrix protein can at best be
discussed in a relative sense, and coordinated expression of specific
tenascin-C splice variants by particular subsets of CNS cells may
provide appropriate micro-environments for regulated changes in
neuronal process outgrowth.
The number of tenascin-C mRNA splice variants identified in the
developing CNS continues to increase (Dorries and Schachner, 1994 ;
Joester and Faissner, 1999 ). FnD is present in the majority of these
alternatively spliced mRNA variants, but fnC is found in only three:
the largest variant, which contains all of the alternatively spliced
FN-III domains (Dorries and Schachner, 1994 ; Joester and Faissner,
1999 ), and two smaller variants (Joester and Faissner, 1999 ).
FnD-containing tenascin-C mRNA splice variants are expressed in a
variety of non-neural, as well as neural, tissues in the developing
rodent, whereas fnC-containing variants are apparently restricted to
the brain and spinal cord (Dorries and Schachner, 1994 ). This suggests
that fnD may play a role in the development of many cell types and
perform functions in addition to mediating neurite outgrowth, whereas
fnC may play a more specific role during neural development.
Significantly, fnC-containing tenascin-C mRNAs (Joester and Faissner,
1999 ) are found in postnatal mouse cerebella during periods of
granule cell migration, and our own work has identified a putative
fnC-containing mRNA and a corresponding high molecular weight
tenascin-C polypeptide in early postnatal rat cerebella. Thus, the fnC
domain is appropriately localized both spatially and temporally in
rodents to provide guidance cues to neurons. On the other hand,
fnC-containing tenascin-C mRNAs and polypeptides have also been
identified in the developing chicken, but these are not found in the
brain or spinal cord (Tucker et al., 1994 ). It is tempting to speculate
that chicken and rodent fnC may serve different functions and that the
evolutionary divergence between birds and mammals may be reflected in
different activities for the same protein.
In summary, we have shown that the alternatively spliced region of
human tenascin-C contains independent domains that promote either
neurite outgrowth or neurite guidance. Extension of neurites is
facilitated through alternatively spliced FN-III domain D, and
orientation of growth is influenced by alternatively spliced FN-III
domain C. Each of these processes can be regulated without affecting
the other, indicating that neurite outgrowth and neurite guidance are
distinct fundamental mechanisms of neuronal growth. Moreover, the
ability of fnA-D to promote guidance was stoichiometric, and fnA-D
could overcome inhibitory actions of both tenascin-C and CSPGs. Thus,
fnA-D on its own might find applicability as a reagent to promote
neurite growth in otherwise inhibitory environments.
 |
FOOTNOTES |
Received May 7, 1999; revised July 6, 1999; accepted July 13, 1999.
This work was supported by National Institutes of Health Grant R01
NS24168 to H.M.G. and National Institute of Environmental Health
Sciences Exploratory Research Award RQ1610 to S.M. We thank Dr. Harold
Erickson for helpful discussions and the gift of BHK cells, recombinant
proteins, and polyclonal tenascin-C antibodies, Drs. Fransçoise
Coussen and Ikramuddin Aukhil for the gift of recombinant proteins and
rat fnB-D, Dr. Andreas Faissner for helpful discussions and the gift of
monoclonal antibody J1/tn2, and Dr. Elizabeth M. Powell for helpful discussions.
Correspondence should be addressed to Dr. Sally Meiners, Department of
Pharmacology, University of Medicine and Dentistry of New Jersey,
Robert Wood Johnson Medical School, 675 Hoes Lane, Piscataway, NJ 08854.
 |
REFERENCES |
-
Aukhil I,
Slemp CC,
Lightner VA,
Nishimura K,
Briscoe G,
Erickson HP
(1990)
Purification of hexabrachion (tenascin) from cell culture conditioned medium, and separation from a cell adhesion factor.
Matrix
10:98-111[Web of Science][Medline].
-
Aukhil I,
Joshi P,
Yan Y,
Erickson HP
(1993)
Cell- and heparin-binding domains of the hexabrachion arm identified by tenascin expression proteins.
J Biol Chem
268:2542-2553[Abstract/Free Full Text].
-
Bartsch S,
Bartsch U,
Dorries U,
Faissner A,
Weller A,
Ekblom P,
Schachner M
(1992)
Expression of tenascin in the developing and adult cerebellar cortex.
J Neurosci
12:736-749[Abstract].
-
Chiquet M,
Wehrle-Haller B
(1994)
Tenascin-C in peripheral nerve morphogenesis.
Perspect Dev Neurobiol
2:67-74[Web of Science][Medline].
-
Chiquet-Ehrismann R,
Mackie EJ,
Pearson CA,
Sakakura T
(1986)
Tenascin: an extracellular matrix protein involved in tissue interactions during fetal development and oncogenesis.
Cell
47:131-139[Web of Science][Medline].
-
Chung C-Y,
Murphy-Ullrich JE,
Erickson HP
(1996)
Mitogenesis, cell migration, and loss of focal adhesions induced by tenascin-C interacting with its cell surface receptor, annexin II.
Mol Biol Cell
7:883-892[Abstract].
-
Crossin KL,
Hoffman S,
Tan SS,
Edelman GM
(1989)
Cytotactin and its proteoglycan ligand mark structural and functional boundaries in somatosensory cortex of the early postnatal mouse.
Dev Biol
136:381-392[Web of Science][Medline].
-
Davies SJ,
Fitch MT,
Memberg SP,
Hall AK,
Raisman G,
Silver J
(1997)
Regeneration of adult axons in white matter tracts of the central nervous system.
Nature
390:680-683[Medline].
-
de la Torre JR,
Hopker VH,
Ming GL,
Poo MM,
Tessier-Lavigne M,
Hemmati-Brivanlou,
Holt CE
(1997)
Turning of retinol growth cones in a netrin-1 gradient mediated by the netrin receptor DCC.
Neuron
19:1211-1244[Web of Science][Medline].
-
Dorries U,
Schachner M
(1994)
Tenascin mRNA isoforms in the developing mouse brain.
J Neurosci Res
37:336-347[Web of Science][Medline].
-
Dorries U,
Taylor J,
Xioa Z,
Lochter A,
Montag D,
Schachner M
(1996)
Distinct effects of recombinant tenascin domains on neuronal cell adhesion, growth cone guidance, and neuronal polarity.
J Neurosci Res
43:420-438[Web of Science][Medline].
-
Erickson HP,
Bourdon MA
(1989)
Tenascin: an extracellular matrix protein prominent in specialized embryonic tissues and tumors.
Annu Rev Cell Biol
5:71-92[Web of Science].
-
Erickson HP,
Briscoe G
(1995)
Tenascin, laminin, and fibronectin produced by cultured cells.
In: Extracellular matrix: a practical approach (Haralson MA,
Hassell JR,
eds), pp 187-198. Oxford: Oxford UP.
-
Faissner A,
Kruse J
(1990)
J1/tenascin is a repulsive substrate for central nervous system neurons.
Neuron
5:627-637[Web of Science][Medline].
-
Fischer D,
Brown-Ludi M,
Schulthess T,
Chiquet-Ehrismann R
(1997)
Concerted action of tenascin-C domains in cell adhesion, anti-adhesion and promotion of neurite outgrowth.
J Cell Sci
110:1513-1522[Abstract].
-
Ford JW,
Welling TH3,
Stanley JC,
Messina LM
(1996)
PKH26 and 125I-PKH95: characterization and efficacy as labels for in vitro and in vivo endothelial cell localization and tracking.
J Surg Res
62:23-28[Web of Science][Medline].
-
Gates MA,
Fillmore H,
Steindler DA
(1996)
Chondroitin sulfate proteoglycan and tenascin in the wounded adult mouse neostriatum in vitro: dopamine neuron attachment and process outgrowth.
J Neurosci
16:8005-8018[Abstract/Free Full Text].
-
Gomez TM,
Letourneau PC
(1994)
Filopodia initiate choices made by sensory neuron growth cones at laminin/fibronectin borders in vitro.
J Neurosci
14:5959-5972[Abstract].
-
Gotz B,
Scholze A,
Clement A,
Joester A,
Schutte K,
Wigger F,
Frank R,
Spiess E,
Ekblom P,
Faissner A
(1996)
Tenascin-C contains distinct adhesive, anti-adhesive, and neurite outgrowth promoting sites for neurons.
J Cell Biol
132:681-699[Abstract/Free Full Text].
-
Gotz M,
Bolz J,
Joester A,
Faissner A
(1997)
Tenascin-C synthesis and influence on axon growth during rat cortical development.
Eur J Neurosci
9:496-506[Web of Science][Medline].
-
Joester A,
Faissner A
(1999)
Evidence for combinatorial variety of tenascin-C isoforms and developmental regulation in the mouse central nervous system.
J Biol Chem
274:17144-17151[Abstract/Free Full Text].
-
Kaplony A,
Zimmermann DR,
Fischer RW,
Imhof BA,
Odermatt BF,
Winterhalter KH,
Vaughan L
(1991)
Tenascin Mr 220 000 isoform expression correlates with corneal cell migration.
Development
112:605-614[Abstract].
-
Kennedy TE,
Serafini T,
de la Torre JR,
Tessier-Lavigne M
(1994)
Netrins are diffusible chemotropic factors for commissural axons in the embryonic spinal cord.
Cell
78:425-435[Web of Science][Medline].
-
Laemmli UK
(1970)
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:680-685[Medline].
-
LaFleur DW,
Fagin JA,
Forrester JS,
Rubin SA,
Sharifi BG
(1994)
Cloning and characterization of alternatively spliced isoforms of rat tenascin. Platelet-derived growth factor-BB markedly stimulates expression of spliced variants of tenascin mRNA in arterial smooth muscle cells.
J Biol Chem
269:20757-20763[Abstract/Free Full Text].
-
Laywell ED,
Friedman P,
Harrington K,
Robertson JT,
Steindler DA
(1996)
Cell attachment to frozen sections of injured adult mouse brain - Effects of tenascin antibody and lectin perturbation of wound-related extracellular matrix molecules.
J Neurosci Methods
66:99-108[Web of Science][Medline].
-
Letourneau PC,
Snow DM,
Gomez TM
(1994)
Regulation of growth cone motility by substratum bound molecules and cytoplasmic [Ca2+].
Prog Brain Res
103:85-98[Web of Science][Medline].
-
Levi G,
Aloisi F,
Ciotti MT,
Gallo V
(1984)
Autoradiographic localization and depolarization-induced release of acidic amino acids in differentiating cerebellar granule cell cultures.
Brain Res
290:77-86[Web of Science][Medline].
-
Lochter A,
Vaughan L,
Kaplony A,
Prochiantz A,
Schachner M,
Faissner A
(1991)
J1/tenascin in substrate-bound and soluble form displays contrary effects on neurite outgrowth.
J Cell Biol
113:1159-1171[Abstract/Free Full Text].
-
McKeon RJ,
Schreiber RC,
Rudge JS,
Silver J
(1991)
Reduction of neurite outgrowth in a model of glial scarring following CNS injury is correlated with the expression of inhibitory molecules on reactive astrocytes.
J Neurosci
11:3398-3411[Abstract].
-
Meiners S,
Geller HM
(1997)
Long and short splice variants of human tenascin differentially regulate neurite outgrowth.
Mol Cell Neurosci
10:100-116.
-
Meiners S,
Powell EM,
Geller HM
(1995)
A distinct subset of tenascin/CSPG-rich astrocytes restricts neuronal growth in vitro.
J Neurosci
15:8096-8108[Abstract].
-
Meiners S,
Powell EM,
Geller HM
(1999)
Neurite outgrowth promotion by the alternatively spliced region of tenascin-C is influenced by cell type-specific binding.
Matrix Biol
18:75-87[Web of Science][Medline].
-
Petroski RE,
Geller HM
(1994)
Selective labeling of embryonic neurons cultured on astrocyte monolayers with 5(6)-carboxyfluorescein diacetate (CFDA).
J Neurosci Methods
52:23-32[Web of Science][Medline].
-
Pigott R,
Kelly JS
(1984)
A cell surface antigen present on cultured cerebellar neurones appears to be transiently expressed during cerebellar development in the rat.
Neurosci Lett
49:105-110[Web of Science][Medline].
-
Pindzola RR,
Doller C,
Silver J
(1993)
Putative inhibitory extracellular matrix molecules at the dorsal root entry zone of the spinal cord during development and after root and sciatic nerve lesions.
Dev Biol
156:34-48[Web of Science][Medline].
-
Powell EM,
Geller HM
(1999)
Dissection of astrocyte-mediated cues in neuronal guidance and process extension.
Glia
26:73-83[Web of Science][Medline].
-
Powell EM,
Fawcett JW,
Geller HM
(1997)
Proteoglycans provide neurite guidance at an astrocyte boundary.
Mol Cell Neurosci
10:27-42.
-
Saiki RK,
Gelfand DH,
Stoffel S,
Scharf SJ,
Higuchi R,
Horn GT,
Mullis KB,
Ehrlich HA
(1988)
Primer-directed enzymatic amplification of DNA with a thermostabile DNA polymerase.
Science
239:487-491[Abstract/Free Full Text].
-
Serafini T,
Kennedy TE,
Galko MJ,
Mirzayan C,
Jessell TM,
Tessier-Lavigne M
(1994)
The netrins define a family of axon outgrowth-promoting proteins homologous to C. elegans UNC-6.
Cell
78:409-424[Web of Science][Medline].
-
Siri A,
Carnemolla B,
Saginati M,
Leprini A,
Casari G,
Baralle F,
Zardi L
(1991)
Human tenascin: primary structure, pre-mRNA splicing patterns and localization of the epitopes recognized by two monoclonal antibodies.
Nucleic Acids Res
19:525-531[Abstract/Free Full Text].
-
Smith GM,
Miller RH,
Silver J
(1986)
Changing role of forebrain astrocytes during development, regenerative failure, and induced regeneration upon transplantation.
J Comp Neurol
251:23-43[Web of Science][Medline].
-
Snow DM,
Lemmon V,
Carrino DA,
Caplan AI,
Silver J
(1990)
Sulfated proteoglycans in astroglial barriers inhibit neurite outgrowth in vitro.
Exp Neurol
109:111-130[Web of Science][Medline].
-
Snow DM,
Watanabe M,
Letourneau PC,
Silver J
(1991)
A chondroitin sulfate proteoglycan may influence the direction of retinal ganglion cell outgrowth.
Development
113:1473-1485[Abstract].
-
Steindler DA,
Cooper NG,
Faissner A,
Schachner M
(1989)
Boundaries defined by adhesion molecules during development of the cerebral cortex: the J1/tenascin glycoprotein in the mouse somatosensory cortical barrel field.
Dev Biol
131:243-260[Web of Science][Medline].
-
Towbin H,
Staehelin T,
Gordon J
(1979)
Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedures and some applications.
Proc Natl Acad Sci USA
76:4350-4354[Abstract/Free Full Text].
-
Tucker RP
(1993)
The in situ localization of tenascin splice variants and thrombospondin 2 mRNA in the avian embryo.
Development
117:347-358[Abstract/Free Full Text].
-
Tucker RP,
Spring J,
Baumgartner S,
Martin D,
Hagios C,
Poss PM,
Chiquet-Ehrismann R
(1994)
Novel tenascin variants with a distinctive pattern of expression in the avian embryo.
Development
120:637-647[Abstract].
-
Vielmetter J,
Stolze B,
Bonhoeffer F,
Stuermer CA
(1990)
In vitro assay to test differential substrate affinities of growing axons and migratory cells.
Exp Brain Res
81:283-287[Web of Science][Medline].
-
Zhang Y,
Winterbottom JK,
Schachner M,
Lieberman AR,
Anderson PN
(1997)
Tenascin-C expression and axonal sprouting following injury to the spinal dorsal columns in the adult rat.
J Neurosci Res
49:433-450[Web of Science][Medline].
Copyright © 1999 Society for Neuroscience 0270-6474/99/19198443-11$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
M. R. Andrews, S. Czvitkovich, E. Dassie, C. F. Vogelaar, A. Faissner, B. Blits, F. H. Gage, C. ffrench-Constant, and J. W. Fawcett
{alpha}9 Integrin Promotes Neurite Outgrowth on Tenascin-C and Enhances Sensory Axon Regeneration
J. Neurosci.,
April 29, 2009;
29(17):
5546 - 5557.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Wang, Y. Katagiri, T. E. McCann, E. Unsworth, P. Goldsmith, Z.-X. Yu, F. Tan, L. Santiago, E. M. Mills, Y. Wang, et al.
Chondroitin-4-sulfation negatively regulates axonal guidance and growth
J. Cell Sci.,
September 15, 2008;
121(18):
3083 - 3091.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. L. Laabs, H. Wang, Y. Katagiri, T. McCann, J. W. Fawcett, and H. M. Geller
Inhibiting Glycosaminoglycan Chain Polymerization Decreases the Inhibitory Activity of Astrocyte-Derived Chondroitin Sulfate Proteoglycans
J. Neurosci.,
December 26, 2007;
27(52):
14494 - 14501.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Donato, K. M. Page, D. Koch, M. Nieto-Rostro, I. Foucault, A. Davies, T. Wilkinson, M. Rees, F. A. Edwards, and A. C. Dolphin
The ducky2J Mutation in Cacna2d2 Results in Reduced Spontaneous Purkinje Cell Activity and Altered Gene Expression
J. Neurosci.,
November 29, 2006;
26(48):
12576 - 12586.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. J. M. Marler, R. Kozma, S. Ahmed, J.-M. Dong, C. Hall, and L. Lim
Outgrowth of Neurites from NIE-115 Neuroblastoma Cells Is Prevented on Repulsive Substrates through the Action of PAK
Mol. Cell. Biol.,
June 15, 2005;
25(12):
5226 - 5241.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. L. T. Mercado, A. Nur-e-Kamal, H.-Y. Liu, S. R. Gross, R. Movahed, and S. Meiners
Neurite Outgrowth by the Alternatively Spliced Region of Human Tenascin-C Is Mediated by Neuronal {alpha}7{beta}1 Integrin
J. Neurosci.,
January 7, 2004;
24(1):
238 - 247.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Tsunoda, H. Inada, I. Kalembeyi, K. Imanaka-Yoshida, M. Sakakibara, R. Okada, K. Katsuta, T. Sakakura, Y. Majima, and T. Yoshida
Involvement of Large Tenascin-C Splice Variants in Breast Cancer Progression
Am. J. Pathol.,
June 1, 2003;
162(6):
1857 - 1867.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Rigato, J. Garwood, V. Calco, N. Heck, C. Faivre-Sarrailh, and A. Faissner
Tenascin-C Promotes Neurite Outgrowth of Embryonic Hippocampal Neurons through the Alternatively Spliced Fibronectin Type III BD Domains via Activation of the Cell Adhesion Molecule F3/Contactin
J. Neurosci.,
August 1, 2002;
22(15):
6596 - 6609.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. V. Ljubimov, M. Saghizadeh, R. Pytela, D. Sheppard, and M. C. Kenney
Increased Expression of Tenascin-C-binding Epithelial Integrins in Human Bullous Keratopathy Corneas
J. Histochem. Cytochem.,
November 1, 2001;
49(11):
1341 - 1350.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Meiners, M. S.A. Nur-e-Kamal, and M. L. T. Mercado
Identification of a Neurite Outgrowth-Promoting Motif within the Alternatively Spliced Region of Human Tenascin-C
J. Neurosci.,
September 15, 2001;
21(18):
7215 - 7225.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Murray and I. Fischer
Transplantation and Gene Therapy: Combined Approaches for Repair of Spinal Cord Injury
Neuroscientist,
February 1, 2001;
7(1):
28 - 41.
[Abstract]
[PDF]
|
 |
|
|