 |
Previous Article | Next Article 
The Journal of Neuroscience, October 15, 1999, 19(20):8885-8893
A Role for the Eph Ligand Ephrin-A3 in Entorhino-Hippocampal Axon
Targeting
Eckart
Stein1,
Nicolai
E.
Savaskan1,
Olaf
Ninnemann1,
Robert
Nitsch1,
Renping
Zhou2, and
Thomas
Skutella1
1 Institute of Anatomy, Department of Cell and
Neurobiology, Humboldt University Hospital (Charité), 10098 Berlin, Germany, and 2 Laboratory for Cancer Research,
Department of Chemical Biology, College of Pharmacy, Rutgers
University, Piscataway, New Jersey 08855
 |
ABSTRACT |
Neurons of layers II and III of the entorhinal cortex constitute
the major afferent connection of the hippocampus. The molecular mechanisms that target the entorhinal axons to specific layers in the
hippocampus are not known. EphA5, a member of the Eph receptor family,
which has been shown to play critical roles in axon guidance, is
expressed in the entorhinal cortex, the origin of the perforant pathway. In addition, ligands that interact with EphA5 are expressed in
distinct hippocampal regions during development of the
entorhino-hippocampal projection. Of these ligands, ephrin-A3 mRNA is
localized both in the granular cell layer of the dentate gyrus and in
the pyramidal cell layer of the cornu ammonis, whereas ephrin-A5 mRNA
is only expressed in the pyramidal cell layer of the cornu ammonis. In the dentate gyrus, the ligand protein is not present in the termination zone of the entorhinal efferents (the outer molecular layer of the
dentate gyrus) but is concentrated in the inner molecular layer into
which entorhinal efferents do not grow. We used outgrowth and stripe
assays to test the effects of ephrin-A3 and ephrin-A5 on the outgrowth
behavior of entorhinal axons. This functional analysis revealed that
entorhinal neurites were repelled by ephrin-A3 but not by ephrin-A5.
These observations suggest that ephrin-A3 plays an important role in
the layer-specific termination of the perforant pathway and that this
ligand may interact with the EphA5 receptor to restrict entorhinal axon
terminals in the outer molecular layer of the dentate gyrus.
Key words:
axonal targeting; entorhino-hippocampal system; dentate
gyrus; development; Eph receptors; ephrins; axon outgrowth; stripe
assay
 |
INTRODUCTION |
The entorhinal cortex (EC) is the
major integration zone of the neocortex, distributing its efferents to
the hippocampus via the perforant and alvear pathways in a highly
organized manner (Steward and Scoville, 1976 ; Tamamaki and Nojyo, 1993 ;
Witter, 1993 ). Entorhinal fibers originating from stellate neurons in layer II and pyramidal cells in layer III terminate on distal dendritic
segments in the outer molecular layer of the fascia dentata and stratum
lacunosum moleculare of the hippocampus proper, on both sides of the
hippocampal fissure. The entorhinal efferents thereby form a highly
demarcated lamina at a certain distance parallel to the granular cell
layer at a right angle to the apical dendrites (Fig.
1). In contrast, hippocampal commissural
and associational fibers occupy the inner third of the molecular layer.
This leads to the assumption that specific guidance molecules are
expressed in the inner and outer molecular layers determining the
ingrowth of these fiber systems.

View larger version (104K):
[in this window]
[in a new window]
|
Figure 1.
Lamina-specific entorhino-hippocampal projection
visualized by tracing with the fluorescent dye (Mini Ruby) injected
into the ipsilateral entorhinal cortex of postnatal day 15 rat
(horizontal section, 100 µm). Note that entorhinal fibers enter the
outer molecular layer (OML) of the dentate gyrus
(A, B), and no labeled entorhinal fibers
can be observed in the inner molecular layer (IML).
Inset, Schematic illustration of the perforant pathway.
CA, Cornu ammonis; dg, dentate gyrus;
ec, entorhinal cortex.; pp, perforant
pathway. Scale bar: A, B, 250 µm.
|
|
A number of diffusible and membrane-associated attractive or repulsive
axon guidance molecules have been identified. These include netrins,
semaphorins, and Eph tyrosine kinase receptors and their ligands (for
review, see Culotti and Kolodkin, 1996 ; Friedman and O`Leary, 1996 ;
Tessier-Lavigne and Goodman, 1996 ; Zhou, 1998 ). At present, it is not
known whether these guidance molecules function in the lamina-specific
axon targeting of the entorhino-hippocampal pathway. Recent studies
have shown that the Eph family of tyrosine kinases and their ligands
are involved in the specification of topographic maps in the brain (for
review, see Friedman and O`Leary, 1996 ; Flanagan and Vanderhaeghen,
1998 ; Holt and Harris, 1998 ; Zhou, 1998 ) and may also play a role in the development of hippocampal efferent and afferent pathways. It has
been shown that several Eph receptors and ephrins are expressed during
development of the hippocampal system and its efferent and afferent
connections (Taylor et al., 1994 ; Zhou et al., 1994 ; Mori et al., 1995 ;
Gao et al., 1996 ; Zhang et al., 1996 , 1997 ; Kozlosky et al., 1997 ;
Martone et al., 1997 ; Zhou, 1997 ). For example, Mori et al.
(1995) and Martone et al. (1997) have shown by in situ
hybridization or immunohistochemistry that EphA4 is localized in
the entorhinal cortex, subiculum, and hippocampus during development.
EphA5 is highly expressed in all limbic structures, including the
entorhinal cortex and the pyramidal cell layer of the cornu ammonis of
the hippocampus during development (Taylor et al., 1994 ; Zhou et al.,
1994 ; Zhang et al., 1996 ; Zhou, 1997 ). In contrast to most members of
the EphA subfamily, EphA6 shows only a very weak expression during
development of the brain but is highly expressed in adult hippocampus
(Maisonpierre et al., 1993 ). Also, EphA7 has been localized in the
hippocampus but not in the entorhinal cortex (Ciossek et al., 1995 ). In
addition, several EphA subfamily ligands, including ephrin-A1,
ephrin-A3, ephrin-A4, and ephrin-A5, are expressed during hippocampal
development (Carpenter et al., 1995 ; Zhang et al., 1996 ; Kozlosky et
al., 1997 ; Zhou, 1998 ).
In this paper, we examine the roles of EphA5, ephrin-A3, and ephrin-A5
in the development of the entorhino-hippocampal system. In
situ hybridization and binding studies with a fusion protein of
the EphA5 receptor domain with alkaline phosphatase (AP) show that the two ligands are expressed in the hippocampus and the receptor
EphA5 in the entorhinal cortex. Outgrowth and stripe assays show that
entorhinal neurites are specifically repelled by ephrin-A3. These
results reveal the potential role of the interaction of EphA5 and
ephrin-A3 in the developmental construction of the entorhino-hippocampal connection.
 |
MATERIALS AND METHODS |
Tracing of the perforant pathway
Mini Ruby (Molecular Probes, Eugene, OR) was applied
stereotactically into the entorhinal cortex of postnatal day 15 (P15) rats, using a conventional spinal needle consisting of an inner needle
sheathed in a metal envelope. The most distal tip of the envelope was
cut in such a way to allow the inner needle to contact only the
entorhinal region but not brain regions above the entorhinal cortex and
meninges. By doing this, labeling of meningeal macrophages and brain
regions other than the target area could be minimized. The tracer was
applied with the inner needle brought into contact with only a few
crystals of Mini Ruby and guided within the envelope into the
entorhinal cortex (Molecular Probes). This gives better results in
myelinated axons than with Dye I tracing, as described previously
(Bechmann and Nitsch, 1997 ). One day after tracer application, animals
were transcardially perfused, and horizontal sections (100 µm) of the
brain were cut on a vibratome.
In situ hybridization. For in situ hybridization
experiments, NMRI mice were decapitated, and brains were
dissected from embryonic day 17 (E17)-P10 and adult animals and frozen
in liquid nitrogen. Horizontal cryostat sections (20 µm) were fixed
in 4% formaldehyde and washed in 0.1 M phosphate
buffer, pH 7.4.
Antisense oligonucleotides 5'GCGCTGTAACGCTGGAACTTCTCGGAGAACTTGATGG
GGCTG3' complementary to bases 355-397 of the mouse ephrin-A3 cDNA
(Zhang et al., 1996 ),
5'GCTTGATTGGGATCTTCATAAGTGTGCGGATCAATATAGGTT3' complementary
to bases 1878-1920 of the mouse EphA5 cDNA (Zhou et al., 1994 ),
and an antisense riboprobe transcribed from a 0.7 kb human ephrin-A5
cDNA cloned in pBluescript (Zhang et al., 1996 ) were used for in
situ hybridization. Sense probes served as controls and revealed
no specific hybridization.
Oligonucleotides were end-labeled using terminal deoxynucleotide
transferase (Boehringer Mannheim, Indianapolis, IN) and
[ -35S]dATP (12.5 µCi/µl; DuPont
NEN, Boston, MA) according to the manufacturer's protocol.
Hybridization was performed according to Zhang et al. (1996) for 16 hr
at 42°C in a humidified chamber, after which the slides were washed
two times for 30 min in 1× SSC at 56°C and one time for 5 min in
0.5× SSC at room temperature. Finally, the sections were rinsed in
H2O at room temperature and dehydrated.
For riboprobe preparation, the vector carrying the corresponding cDNA
was digested with appropriate restriction enzymes, and the linearized
vector was incubated for 2 hr at 37°C in 30 µl of a reaction mix
(containing: 1× reaction buffer; 10 mM ATP, GTP, and CTP
each; 0.4 mM P32 UTP; 1× BSA;
100 mM DTT; 32 U RNaseA-inhibitor (Boehringer Mannheim); and 50 U T7 RNA polymerase (Boehringer Mannheim) for antisense probes
or 50 U T3 RNA polymerase (Boehringer Mannheim) for sense riboprobes).
The reactions were then treated with DNaseI (7.5 U for 30 min at
37°C; Boehringer Mannheim), and the riboprobes were partially
degraded with vol of NaOH for 10 min at 4°C and
neutralized with 2:10 vol of acetate. After hybridization for 16 hr at
52°C in a humidified chamber, the slides were washed one time in
H2O at room temperature and then incubated with
20 µg/ml RNase-A in a buffer containing 10 mM Tris-HCl,
pH 8.0, 1 mM EDTA, and 500 mM NaCl for 15 min
at 37°C. The slides were washed one time in
H2O, two times in 1× SSC at 56°C for 30 min
each, and two times in 0.1× SSC at 56°C for 30 min each. Slides were
exposed for 1 week to Kodak (Eastman Kodak, Rochester, NY) X-OMAT AR
x-ray films.
EphA5-AP fusion protein binding
EphA5-AP binding to ligand molecules was assayed as described
previously (Gao et al., 1996 ). Briefly, to study whether the ligands
are expressed in the target tissues, we investigated the expression of
EphA5 ligands using a ligand-affinity probe, EphA5-AP, which consisted
of the extracellular domain of Eph-A5 fused in frame with a heat-stable
human placental alkaline phosphatase. To detect expression of EphA5
ligand proteins, rat embryo sections (20 µm thickness) were prepared
on a cryostat and fixed with methanol at 80°C for 5 min. After
rehydrating the sections in PBS, they were equilibrated in HBSS
without
Ca2+/Mg2+ for
5 min and incubated in HBSS supplemented with 20% fetal calf serum for
2 hr. The sections were then overlaid with concentrated conditioned
medium containing the recombinant protein diluted in HBSS plus 20% FCS
for 90 min. After one wash with HBSS and three washes with TBS (20 mM Tris-HCl and 135 mM NaCl, pH 7.5) for 5 min
each, the sections were equilibrated with PBS for 5 min and fixed in
3.7% formaldehyde in PBS for 5 min. After one wash with PBS,
endogenous phosphatases were heat-inactivated at 65°C for 50 min.
After equilibrating with AP buffer (100 mM Tris, 100 mM NaCl, and 5 mM MgCl2,
pH 9.5), bound EphA5-AP fusion proteins were visualized with a staining
solution containing 34 mg/ml nitro-blue-tetrazolium and 18 mg/ml
5-bromo-4-chloro-3-indolylphosphate (Boehringer Mannheim) in AP buffer.
The specificity of the EphA5-AP binding was determined by competition
through excess of unlabeled EphA5, which abolished the binding.
Neurite outgrowth assay
For assaying growth inhibition of axons from primary culture,
entorhinal cortex, hippocampus, and cerebellum were dissected, and
cells were dissociated with 0.25% trypsin. Neurons (4 × 105 cells per well) were plated in 24-well
dishes onto confluent monolayers of ephrin-A3- or ephrin-A5-expressing
NIH 3T3 cells or control NIH 3T3 cells transfected with the vector in
DMEM supplemented with fetal bovine serum (10%), penicillin (50 ng/ml), and streptomycin (50 µg/ml), cultivated for 3 d and
fixed in 4% paraformaldehyde in PBS. After fixation, neuronal
processes were incubated with an anti-neurofilament 160 kDa antibody
obtained from Boehringer Mannheim (catalog #814334) in a concentration
of 5 µg/ml, followed by an subsequent incubation in avidin-biotin
peroxidase complex (Vectastain ABC kit; Vector Laboratories,
Burlingame, CA) and visualized with 3'-3'diaminobenzidine as a
chromogen. Random fields were selected, and all anti-neurofilament
antibody-stained neurites growing out from aggregates and single cells
in these fields were scored. At least 200 fields were surveyed for each
sample assayed, and the experiments were repeated a minimum of three times.
Explant outgrowth and stripe assay
Explant preparation. Fetuses and offspring of timed
pregnant E17-E18 Wistar rats were used. To collect embryonic tissue,
pregnant rats were anesthetized with Nembutal (5 mg/100 mg), and
embryos were removed from the uterus. Embryos were placed in cold,
oxygenated L15 medium (Life Technologies, Gaithersburg, MD)
supplemented with 0.6% glucose. Animals were killed by decapitation,
the brains were dissected out, and the meninges were removed.
Horizontal sections were cut at 400 µm in cold, oxygenated PBS with a
vibratome, and entorhinal explants from the superficial layers were
dissected out with tungsten needles under binocular optics with 40×
magnification. After dissection, the explants were placed in suspension
culture in a 5.5% CO2 humidified incubator in
DMEM-F-12 supplemented with 2 mM glutamine,
0.6% glucose, 100 U/ml penicillin, 100 µg/ml streptomycin, 5%
heat-inactivated rat serum, 10% heat-inactivated fetal bovine serum,
and 10 µM cytosine arabinoside to control
proliferation of non-neuronal cells. Entorhinal explants were used for
the assays on the same day.
Preparation of membranes. Membrane suspensions were prepared
from NIH 3T3 cells expressing ephrin-A3 or ephrin-A5 or from microdissected hippocampal regions of the pig (6 months old) from which
it is possible to dissect the outer molecular layer and the inner
molecular-granular layer of the dentate gyrus. The membranes were
prepared according to a protocol of Walter et al. (1987a ,b ). All
solutions used were sterile, 4°C, pH 7.4, and supplemented with
protease inhibitors as described previously (Simon and O'Leary, 1992 ).
Cells were homogenized in homogenization buffer (10 mM Tris-HCI, pH 7.4, 1.5 mM
CaCl2, and 1 mM spermidine;
Serva Feinbiochemica, Heidelberg, Germany) by pressing the tissue first
through a narrow pipette and then two to three times through syringe
needles. The homogenate was layered on top of a step gradient of 50 and
5% sucrose in homogenization buffer and centrifuged for 10 min at 50,000 × g at 4°C in an SW 50 L rotor (Beckman
Instruments, Fullerton, CA). Cytoplasmic and mitochondrial membrane
fragments formed a turbid layer at the boundary between 5 and 50%
sucrose, while nuclei were pelleted. The membrane fragments were
collected with a syringe and washed with PBS. The concentration of the
membrane suspension was adjusted to a concentration of 100-200 µg/ml
protein as determined by a modified Bradford method with bovine serum albumin as standard. For phosphatidylinositol (PI)-specific
phospholipase C (PLC) treatment, membrane suspensions were adjusted to
an optical density of 0.5 (measured at 220 nm) in Tris buffer
containing 1.5 mM CaCl2 and
protease inhibitors. The membrane suspensions were then treated with
PI-PLC (1 U/ml; ICN Biochemicals, Montréal, Québec, Canada)
for 1 hr, washed in cold PBS containing protease inhibitors, and
resuspended in the same PBS solution.
Explant outgrowth assay. Entorhinal cortex explants were
plated on membranes prepared from the ephrin-A3, ephrin-A5, or the mock-transfected NIH 3T3 cells. Uniform membrane carpets for outgrowth measurements were made by pipetting 150 µl of membrane suspension (100-200 µg/ml) onto a filter placed over a uniform mesh and
applying suction for up to 3 min. The total outgrowth length of all
fluorescence-stained processes from the entorhinal explants was scored,
and data from each experimental group were pooled and analyzed by ANOVA
and Mann-Whitney U test.
Stripe assay. Membrane stripes were prepared with membranes
obtained either from ephrin-A3, ephrin-A5, or mock-transfected NIH 3T3
cells on polycarbonate filters precoated with laminin. Membrane
extracts from the outer molecular layer and inner molecular-granular layer were prepared using the same protocol. The membrane carpets were
then placed on sterile, porous (0.4 µm) membranes (Millicell-CM; Millipore, Eschborn, Germany) and transferred into a 35 mm tissue culture dish with 1.5 ml culture medium. Explants were positioned on
the membrane carpets using forceps. Cultures were maintained in a 5.5%
CO2 humidified incubator for up to 5 d.
Analysis of outgrowth preference. Neurites growing out from
the explants were visualized with a fluorescent vital dye, 5 and 6-carboxyfluorescein diacetate, succinimidyl ester (Molecular Probes),
which labels all living cells and their processes, or by immunolabeling
with a neurofilament antibody (Boehringer Mannheim). A 6.15 mg/ml stock
solution of dye was diluted 1:300 in PBS. Culture medium was removed
from the dishes 5 d after the explants were placed on the carpets,
and 1-2 ml of the dye solution was added for 2 min. To inhibit
photobleaching, the dye solution was then replaced with a solution of 5 mM p-phenylenediamine (Eastman Kodak) in PBS. Neurite growth from the explant was examined and photographed with FITC optics on an epifluorescence microscope.
Growth preferences for one or the other set of membrane stripes were
evaluated using a three class system: (A) clear cut preference, with
almost all of the fibers growing on one of the membrane lanes, (B)
slight or moderate preference, with most fibers growing preferentially on one membrane lane, although others cross randomly, and (C) no choice
or random outgrowth. The analysis of axonal choice behavior was
performed as a double-blind experiment by three independent observers.
Each observer scored the axon density on the different membrane stripes
prepared in each experiment. In general, it was impossible to count
individual entorhinal axons because of the variability in axon
outgrowth density and fasciculation in some experiments. Rating classes
A and B were scored 1, and rating class C was scored 0. The scores from
each experimental condition were totaled, data from individual
experiments were pooled, and 2 tests
were performed with an inter-rater reliability of >90%, which did not
vary significantly in the different experiments performed.
 |
RESULTS |
EphA5 is present in the EC, and ephrin-A3 and ephrin-A5 are
expressed in hippocampus during development of the perforant
pathway
To obtain clues about the function of EphA5 and its ligands
ephrin-A3 and ephrin-A5 in the developing entorhino-hippocampal formation, we used radioactive in situ hybridization to
investigate the spatiotemporal distribution of their mRNA. At E17, an
EphA5-specific probe detected strong signals in the cerebral cortex and
in the hippocampal anlage (Fig.
2A). At P1, EphA5
expression was localized in the cortex, EC, subiculum, and CA1-CA3
(Fig. 2B). In the EC, layers II and III showed the
strongest signal (Fig. 2E). Between P2 and P10, EphA5
expression was similar to that at P1 but with a stronger signal in the
pyramidal layer of CA3 and weaker signals in the pyramidal layer of
CA1, the granular layer of the dentate gyrus, and in the superficial
layers of the EC (data not shown), consistent with previous
observations (Zhang et al., 1997 ).

View larger version (144K):
[in this window]
[in a new window]
|
Figure 2.
Distribution of EphA5
(A-F), ephrin-A3 (G),
ephrin-A5 (H) mRNA and EphA5-AP fusion
protein binding (I-L) in the developing
entorhino-hippocampal system on horizontal sections. A,
At E17, strong hybridization signals for EphA5 mRNA signals were found
in the cortex and hippocampal primordium. B, At P1,
EphA5 expression was localized in the cortex, EC, and subiculum. In the
hippocampus, strong hybridization signals were present in the pyramidal
cell layers of CA1-CA3. C, Sense control for EphA5
in situ hybridization showed no specific labeling.
D, Emulsion-coated EphA5 in situ
hybridization of the entorhinal cortex; the boxed area
is shown in higher magnification in E. E,
At P1, EphA5 expression was localized to layers II and III of the EC,
whereas no specific labeling could be observed with the sense control
(F). G, At P2, ephrin-A3 mRNA was
expressed in the cortex, the CA1-CA3 regions, and the granular cell
layer of the dentate gyrus. H, Ephrin-A5 mRNA was
localized in the CA pyramidal cell layers from P2 onward but not in the
dentate gyrus. I, EphA5-AP fusion protein binding could
be localized in the hippocampus and the septum, whereas negative
control using alkaline phosphatase detection alone did not show binding
signals (J). K, In the
hippocampus, EphA5-AP fusion protein binding was strongest in the inner
molecular layer of the dentate gyrus and low in the outer molecular
layer; no specific labeling could be observed with the negative control
(L). hi, Hippocampus;
sep, septum; CA, Cornu ammonis;
dg, dentate gyrus; ec, entorhinal cortex;
gl, granular layer; oml, outer molecular
layer; iml, inner molecular layer; hf,
hippocampal fissure; sub, subiculum. Scale bars:
A-C, G, H,
K, 500 µm; D, I, 1 mm;
E, F, 100 µm.
|
|
We further examined the expression of the EphA subfamily ligands
ephrin-A3 and ephrin-A5 in the developing entorhino-hippocampal system.
At E17, ephrin-A3 was detected in the entire cortex and in the
hippocampus (data not shown). At P2, ephrin-A3 mRNA was strongly
expressed in the CA1-CA3 region and in the granular cell layer of the
dentate gyrus (Fig. 2G). Ephrin-A5 mRNA was not detected during embryonic stages but could be localized in all CA pyramidal cell
layers from P2 onward (Fig. 2H).
Detection of the EphA5 ligand proteins in the hippocampus
Because ephrin-A3 and ephrin-A5 mRNA were expressed in the
hippocampus and EphA5 in the EC, we were interested in studying the
localization of the EphA5 ligand proteins in the hippocampus in more
detail. To detect EphA5 binding in the hippocampus, we stained
embryonic and postnatal mouse brain sections with a ligand-affinity probe, which consisted of the extracellular domain of EphA5 fused in
frame with a human placental AP, which binds to both ephrin-A3 and
ephrin-A5. The septum, hypothalamus, and olfactory bulbus showed the
strongest binding during embryonic stages, as shown previously by Zhang
et al. (1996) . Binding in the hippocampus was most prominent in the
dendritic fields of the CA1 and dentate gyrus during postnatal
stages (Fig. 2K). No staining was observed on the
granular cell layer and in the outer molecular layers in the dentate
gyrus. The strongest EphA5-AP binding was localized in the inner
molecular layer. In CA1, the strongest EphA5-binding was detected in
the stratum radiatum, whereas in the stratum lacunosum moleculare,
EphA5-AP binding was weak.
Entorhinal axons prefer membranes from the outer molecular layers
of the hippocampus to membranes obtained from the inner
molecular-granular layer
When cell membranes of the outer molecular layer and the inner
molecular-granular cell layer of the dentate gyrus were arranged in
alternating stripes and explants of embryonic EC (n = 36) were placed on the stripe carpet, the entorhinal axons showed a
selective growth preference for the outer molecular layer membranes and did not grow on inner molecular-granular layer membranes (Fig. 3, Table
1). This preference was independent of
the order of membrane application on the filter and thus not
attributable to differences in the protein content of the lanes
(Fig. 3B). Outgrowth of entorhinal neurites on uniform
membrane carpets of the inner molecular-granular layer compared with
the outer molecular layers of the dentate gyrus (stripes offered alone
and not in alternating stripes) was also reduced (data not shown).

View larger version (156K):
[in this window]
[in a new window]
|
Figure 3.
A, Entorhinal neurites show
a strong preference for membranes from the outer molecular layer of the
hippocampus when given a choice between these and inner
molecular-granular layer membranes (n = 24).
B, Entorhinal choice behavior was independent of
membrane lane order (n = 12). , Inner
molecular-granular layer. Scale bar, 100 µm.
|
|
Outgrowth of entorhinal neurites is inhibited by ephrin-A3
Entorhinal neurons from E18 rat brain were plated on a confluent
monolayer of NIH 3T3 cells expressing ephrin-A3 or ephrin-A5, or
transfected with the expression vector alone (Fig.
4). The cell lines were constructed
previously by Gao et al. (1996) , and the expression of the ligands was
further confirmed by EphA5-AP binding (Fig. 4A-C).
Neurite extension from EC neurons was strongly inhibited by 3T3 cells
expressing ephrin-A3 (Figs. 4F,
5) and to a lesser extent by those
expressing ephrin-A5 (Fig. 4E) compared with the
length of entorhinal neurons on mock-transfected NIH 3T3 cells (Fig.
4D). In contrast, neither ephrin-A3 nor ephrin-A5 inhibited neurite outgrowth from cerebellar neurons (data not shown).
In accordance with the findings of Gao et al. (1996) , the outgrowth of
hippocampal neurons was significantly inhibited by both ephrin-A3 and
ephrin-A5 (data not shown).

View larger version (201K):
[in this window]
[in a new window]
|
Figure 4.
Inhibition of entorhinal neurite
elongation by ephrin-A3. A, EphA5-AP staining was absent
on the mock-transfected cells, whereas ephrin-A5-
(B) and ephrin-A3- (C)
transfected cells showed a strong signal, indicating high levels of
expression of the corresponding ligand. E18 entorhinal cortex neurons
were supercultivated on a confluent layer of 3T3 mock-
(D), ephrin-A5- (E), or
ephrin-A3- (F) transfected cells.
D-F, Neurites were stained with anti-neurofilament
antibody. Neurons and their processes are darkly stained, and the
underlying cells show light background staining. Scale bars:
A-C, 50 µm; D-F, 30 µm.
|
|

View larger version (14K):
[in this window]
[in a new window]
|
Figure 5.
The results shown are the average length of 200 neurites measured in three independent experiments. The differences in
entorhinal outgrowth length were statistically tested between
ephrin-A3, ephrin-A5, and mock-transfected cells
(*p < 0.001; ANOVA; Mann-Whitney U
test). Error bars indicate SEM.
|
|
Similar effects were observed with entorhinal explants cultivated on
uniform membranes obtained from cells expressing ephrin-A3 (n = 62) or ephrin-A5 (n = 31), or
transfected with the expression vector alone (n = 41)
(Fig. 6). In particular, the outgrowth of entorhinal neurites was strongly inhibited by ephrin-A3 membranes (Fig.
6C), whereas membranes obtained from cells expressing
ephrin-A5 (Fig. 6E) and control cells (Fig.
6A) had significantly less effect on entorhinal fiber
extension. Because ephrin-A3 and ephrin-A5 can be removed from the
membrane preparation by PI-PLC treatment, we analyzed the effect of
PI-PLC treatment on ephrin-A3 inhibition of entorhinal neurite
outgrowth (n = 36). Removal of ephrin-A3 from the
membranes restored neurite elongation from entorhinal explants (Fig.
6D). Entorhinal outgrowth was not significantly affected on membranes obtained from ephrin-A5-transfected NIH 3T3 cells
that had been treated with PI-PLC (Fig. 6F). This
observation suggests that ephrin-A3 in particular selectively and
specifically inhibits entorhinal axon outgrowth.

View larger version (152K):
[in this window]
[in a new window]
|
Figure 6.
Inhibition of neurite outgrowth from entorhinal
explants by ephrin-A3. Entorhinal explants were cultivated on a
confluent membrane layer obtained from 3T3 mock-transfected
(n = 41) (A), ephrin-A3-
(n = 62) (C), and ephrin-A5-
(n = 31) (E) transfected
cells. Neurites were visualized with a fluorescent vital dye, 5- and
6-carboxyfluorescein diacetate, succinimidyl ester. D,
PI-PLC treatment of the obtained membranes (n = 36)
significantly prevents ephrin-A3 inhibition of entorhinal neurite
outgrowth, whereas the effect of PI-PLC treatment on neurite outgrowth
inhibition (n = 25) was not significant in the case
of ephrin-A5 (F). B,
Quantification of entorhinal neurite length under the different
conditions (±SEM). The differences of entorhinal outgrowth length were
significant between ephrin-A3 treatment and all other experimental
conditions (*p < 0.001; ANOVA; Mann-Whitney
U test). Scale bar, 100 µm.
|
|
The extension and growth preference of EC neurites is controlled
by ephrin-A3
In the stripe assay, EC explants were allowed to grow on membrane
stripes prepared from stably transfected 3T3 cells expressing ephrin-A3
(n = 15), ephrin-A5 (n = 12), or
controls (n = 10) (Fig. 7, Table
2).

View larger version (37K):
[in this window]
[in a new window]
|
Figure 7.
The growth preference of entorhinal neurites is
influenced by ephrin-A3. A, Entorhinal neurites of E18
explants avoided ephrin-A3 membrane lanes (n = 15)
but did not display any preferences when offered membrane lanes from
ephrin-A5- (n = 12) (B) or
mock- (n = 10) (C)
transfected NIH 3T3 cells. Neurites were stained as in Figure 5.
1, Ephrin-A3; 2, ephrin-A5;
3, mock-transfected 3T3 cells. Scale bar, 100 µm.
|
|
Given the choice between a membrane lane from mock-transfected cells or
laminin, entorhinal neurites did not display any preference and crossed
lane borders freely (Fig. 7C, Table 2). Even in the choice
situation between ephrin-A5 membrane lanes and laminin lanes, extending
EC neurites displayed a random growth pattern (Fig. 7B,
Table 2). However, entorhinal neurites specifically avoided membranes
prepared from ephrin-A3-expressing 3T3 cells (Fig. 7A,
Table2). These results support the finding that extending EC neurites
are selectively repelled by ephrin-A3.
 |
DISCUSSION |
Our studies demonstrate that entorhinal axons are responsive to
ephrin-A3 at the time when entorhinal fibers invade the molecular layer
of the dentate gyrus in vivo. Axons of the perforant pathway have entered their target area in the molecular layer of the dentate gyrus at E19, shortly before birth (Super and Soriano, 1994 ). EphA5
mRNA expression was found from E17 onward in layers II and III of the
EC, the origin of neurons forming the perforant pathway. Our in
situ hybridization data showed that ephrin-A3 mRNA is expressed in
the granular cell layer of the dentate gyrus. In addition, the ligand
protein was detected using EphA5-AP binding in the inner molecular
layer of the dentate gyrus, a region not invaded by EC neurites from
layer II in vivo. Because EphA5 interacts with multiple
ligands in vitro but only ephrin-A3 is present in the
dentate gyrus, the EphA5-AP binding data probably reflects the
distribution of this guidance cue in the dentate gyrus. Several observations indicate that ephrin-A3 has a specific effect in entorhino-hippocampal axon targeting. First, the neurite and outgrowth explant assay only displayed a significant inhibitory effect by ephrin-A3 but not by ephrin-A5 or controls. Second, digestion of the
GPI-anchor of ephrin-A3 by PI-PLC treatment abolished this effect. Third, the EphA5 receptor is synthesized in EC neurons, and
soluble AP-tagged EphA5 binds strongly to the inner molecular layer.
Thus, entorhinal fiber outgrowth to the inner molecular layer of the
dentate gyrus would be repelled, whereas the outer molecular layer
would be permissible for these ingrowing axons.
The afferent connections of the hippocampus and its entorhinal input,
the perforant and alvear pathways, represent a well established model
for the analysis of target-specific pathfinding, termination, and
reinnervation (Frotscher and Heimrich, 1993 ; Li et al., 1993 , 1994 ,
1995 ; Woodhams 1993 ; Woodhams and Atkinson, 1996 ; Frotscher et al.,
1997 ). It was shown that the molecular signals necessary for the
formation of an entorhino-dentate projection are present in hippocampal
tissue maintained in organotypic coculture with explants of the EC
(Frotscher and Heimrich, 1993 ; Li et al., 1993 ; Woodhams and Atkinson,
1996 ). Heterochronic slice culture experiments and transplantation of
embryonic entorhinal cells to adult hippocampus have also outlined the
presence of positional guidance cues in the adult hippocampus (Zhou et
al., 1989 ; Li et al., 1995 ). These experiments indicated that
lamina-specific molecules in the hippocampal fields play important
roles in the formation of layer-specific afferent projections. But none
of these studies provided information about the mechanisms entorhinal axons use to select their original pathways and target fields.
Del Río et al. (1997) showed that ablation of Cajal-Retzius
cells influenced the ingrowth of entorhinal fibers into the molecular layer of the dentate gyrus. This finding suggests that, in addition to
repulsive guidance factors such as ephrin-A3, which is expressed in the
granular cell layer of the dentate gyrus, Cajal-Retzius cells localized
in the molecular layer of the dentate gyrus produce an attractive
factor that guides entorhinal neurons toward the molecular layer.
Superculturing of prelabeled entorhinal neurons or membranes on
hippocampal slice preparations led to the observation of
lamina-specific adhesion in the termination zones of the
entorhino-hippocampal formation (Förster et al., 1998 ). These
adhesion experiments documented the presence of membrane-bound adhesive
properties in the outer molecular layer of the dentate gyrus and the
absence of these activities in the granular cell layer, a zone that is not targeted by most entorhinal axons in vivo. Our data and
the observations of Del Río et al. (1997) and Förster et
al. (1998) indicate the presence of attractive adhesive and repulsive
properties in the developing dentate gyrus.
The laminated expression of EphA5 ligands might repel the ingrowth of
the entorhino-hippocampal projection toward the inner molecular layer
of the dentate gyrus (see Fig. 8 for
schematic illustration). We were able to demonstrate that entorhinal
axons prefer membrane extracts from the outer molecular layer of the hippocampus to membrane preparations obtained from the inner
molecular-granular layer. The use of outgrowth and choice assays made
it possible to show that the extension and guidance of entorhinal
neurites are strongly influenced by the membrane-bound molecule
ephrin-A3. All these findings lead us to propose that Eph receptors and
ligands participate in the developmental mechanisms underlying the
termination of the lamina-specific entorhino-hippocampal
projection.

View larger version (41K):
[in this window]
[in a new window]
|
Figure 8.
Schematic illustration of the dentate gyrus
with granular cell layer (GCL), inner molecular layer
(IML), and outer molecular layer (OML).
Ephrin-A3 mRNA is expressed in the granular cell layer, whereas Eph
A5-AP fusion protein binding that detects ephrin A ligands is present
in the inner molecular layer. Axons of the entorhinal cortex do not
enter the inner molecular layer and branch in the outer molecular
layer.
|
|
Because EphA5, ephrin-A3, and ephrin-A5 are all expressed in the
hippocampal formation, these molecules might also be involved in the
guidance of intrahippocampal projections. However, it will require
further investigation to determine in more detail whether subpopulations of hippocampal neurons respond differentially to these
and other guidance cues of the Eph family. It will also be interesting
to analyze the phenotype of hippocampal projections in ephrin-A3 and
ephrin-A5 knock-out mice.
It should also be emphasized that the hippocampus is well known for
structural remodeling and for lamina-specific sprouting after lesioning
its different afferent inputs (for review, see Frotscher et al., 1997 ).
The continuous expression of EphA5, ephrin-A3, and ephrin-A5 in the
hippocampal system during adulthood suggests that these molecules might
also play a role in synaptic plasticity.
In summary, our observations indicate that ephrin-A3 acts as a
repulsive signal that helps to pattern the perforant pathway by
limiting the growth of entorhinal fibers to the outer molecular layer
of the dentate gyrus. It may also perform a similar function for
intrahippocampal connections. However, the laminated distribution of
hippocampal afferents is probably the result of a cooperation between
both attractive and repulsive guidance factors. Further studies have to
address the question of how the temporal and spatial expression
patterns of these factors manage to lead the ingrowing afferents to
their appropriate target area.
 |
FOOTNOTES |
Received Jan. 27, 1999; revised July 23, 1999; accepted July 30, 1999.
Drs. Stein and Savaskan contributed equally to this work.
This work was supported by the Deutsche Forschungsgemeinschaft (SK
49/3-1) and SFB 515.
Correspondence should be addressed to Dr. Thomas Skutella, Institute of
Anatomy, Department of Cell and Neurobiology, Humboldt University
Hospital Charité, Philippstrasse 12, 10098 Berlin, Germany.
 |
REFERENCES |
-
Bechmann I,
Nitsch R
(1997)
Astrocytes and microglial cells incorporate degenerating fibers following entorhinal lesion: a light, confocal, and electron microscopical study using a phagocytosis-dependent labeling technique.
Glia
20:145-154[ISI][Medline].
-
Carpenter MK,
Shilling H,
VandenBos T,
Beckmann MP,
Cerretti DP,
Kott JN,
Westrum LE,
Davison BL,
Fletcher FA
(1995)
Ligands for EPH-related tyrosine kinase receptors are developmentally regulated in the CNS.
J Neurosci Res
42:199-206[ISI][Medline].
-
Ciossek T,
Lerch MM,
Ullrich A
(1995)
Cloning, characterization, and differential expression of MDK2 and MDK5, two novel receptor tyrosine kinases of the eck/eph family.
Oncogene
11:2085-2095[ISI][Medline].
-
Culotti JG,
Kolodkin AL
(1996)
Functions of netrins and semaphorins in axon guidance.
Curr Opin Neurobiol
6:81-88[ISI][Medline].
-
Del Río JA,
Heimrich B,
Borrell V,
Forster E,
Drakew A,
Alcantara S,
Nakajima K,
Miyata T,
Ogawa M,
Mikoshiba K,
Derer P,
Frotscher M,
Soriano E
(1997)
A role for Cajal-Retzius cells and reelin in the development of hippocampal connections.
Nature
385:70-74[Medline].
-
Flanagan JG,
Vanderhaeghen P
(1998)
The ephrins and Eph receptors in neural development.
Annu Rev Neurosci
21:309-345[ISI][Medline].
-
Förster E,
Kaltschmidt C,
Deng J,
Cremer H,
Deller T,
Frotscher M
(1998)
Lamina-specific cell adhesion on living slices of hippocampus.
Development
125:3399-3410[Abstract].
-
Friedman GC,
O'Leary DD
(1996)
Eph receptor tyrosine kinases and their ligands in neural development.
Curr Opin Neurobiol
6:127-133[ISI][Medline].
-
Frotscher M,
Heimrich B
(1993)
Formation of layer-specific fiber projections to the hippocampus in vitro.
Proc Natl Acad Sci USA
90:10400-10403[Abstract/Free Full Text].
-
Frotscher M,
Heimrich B,
Deller T
(1997)
Sprouting in the hippocampus is layer-specific.
Trends Neurosci
20:218-223[ISI][Medline].
-
Gao PP,
Zhang JH,
Yokoyama M,
Racey B,
Dreyfus CF,
Black IB,
Zhou R
(1996)
Regulation of topographic projection in the brain: Elf-1 in the hippocamposeptal system.
Proc Natl Acad Sci USA
93:11161-11166[Abstract/Free Full Text].
-
Holt CE,
Harris WA
(1998)
Target selection: invasion, mapping and cell choice.
Curr Opin Neurobiol
8:98-105[ISI][Medline].
-
Kozlosky CJ,
VandenBos T,
Park L,
Cerretti DP,
Carpenter MK
(1997)
LERK-7: a ligand of the Eph-related kinases is developmentally regulated in the brain.
Cytokine
9:540-549[ISI][Medline].
-
Li D,
Field PM,
Starega U,
Li Y,
Raisman G
(1993)
Entorhinal axons project to dentate gyrus in organotypic slice co-culture.
Neuroscience
52:799-813[ISI][Medline].
-
Li D,
Field PM,
Yoshioka N,
Raisman G
(1994)
Axons regenerate with correct specificity in horizontal slice culture of the postnatal rat entorhino-hippocampal system.
Eur J Neurosci
6:1026-1037[ISI][Medline].
-
Li D,
Field PM,
Raisman G
(1995)
Failure of axon regeneration in postnatal rat entorhinohippocampal slice coculture is due to maturation of the axon, not that of the pathway or target.
Eur J Neurosci
7:1164-1171[ISI][Medline].
-
Maisonpierre PC,
Barrezueta NX,
Yancopoulos GD
(1993)
Ehk-1 and Ehk-2: two novel members of the Eph receptor-like tyrosine kinase family with distinctive structures and neuronal expression.
Oncogene
8:3277-3288[ISI][Medline].
-
Martone ME,
Holash JA,
Bayardo A,
Pasquale EB,
Ellisman MH
(1997)
Immunolocalization of the receptor tyrosine kinase EphA4 in the adult rat central nervous system.
Brain Res
771:238-250[ISI][Medline].
-
Mori T,
Wanaka A,
Taguchi A,
Matsumoto K,
Tohyama M
(1995)
Differential expressions of the eph family of receptor tyrosine kinase genes (sek, elk, eck) in the developing nervous system of the mouse.
Brain Res Mol Brain Res
29:325-335[Medline].
-
Simon DK,
O'Leary DD
(1992)
Responses of retinal axons in vivo and in vitro to position-encoding molecules in the embryonic superior colliculus.
Neuron
9:977-989[ISI][Medline].
-
Steward O,
Scoville SA
(1976)
Cells of origin of entorhinal cortical afferents to the hippocampus and fascia dentata of the rat.
J Comp Neurol
169:347-370[ISI][Medline].
-
Super H,
Soriano E
(1994)
The organization of the embryonic and early postnatal murine hippocampus. II. Development of entorhinal, commissural, and septal connections studied with the lipophilic tracer DiI.
J Comp Neurol
344:101-120[ISI][Medline].
-
Tamamaki N,
Nojyo Y
(1993)
Projection of the entorhinal layer II neurons in the rat as revealed by intracellular pressure-injection of neurobiotin.
Hippocampus
3:471-480[ISI][Medline].
-
Taylor V,
Miescher GC,
Pfarr S,
Honegger P,
Breitschopf H,
Lassmann H,
Steck AJ
(1994)
Expression and developmental regulation of Ehk-1, a neuronal Elk-like receptor tyrosine kinase in brain.
Neuroscience
63:163-178[Medline].
-
Tessier-Lavigne M,
Goodman CS
(1996)
The molecular biology of axon guidance.
Science
274:1123-1133[Abstract/Free Full Text].
-
Walter J,
Henke Fahle S,
Bonhoeffer F
(1987a)
Avoidance of posterior tectal membranes by temporal retinal axons.
Development
101:909-913[Abstract/Free Full Text].
-
Walter J,
Kern Veits B,
Huf J,
Stolze B,
Bonhoeffer F
(1987b)
Recognition of position-specific properties of tectal cell membranes by retinal axons in vitro.
Development
101:685-696[Abstract/Free Full Text].
-
Witter MP
(1993)
Organization of the entorhinal-hippocampal system: a review of current anatomical data.
Hippocampus
3:33-44.
-
Woodhams PL
(1993)
Laminar and region-specific cell surface markers in the entorhinal cortex and hippocampus.
Hippocampus
3:183-189[ISI][Medline].
-
Woodhams PL,
Atkinson DJ
(1996)
Entorhinal axons perforate hippocampal field CA3 in organotypic slice culture.
Brain Res Dev Brain Res
95:144-147[Medline].
-
Zhang JH,
Cerretti DP,
Yu T,
Flanagan JG,
Zhou R
(1996)
Detection of ligands in regions anatomically connected to neurons expressing the Eph receptor Bsk: potential roles in neuron-target interaction.
J Neurosci
16:7182-7192[Abstract/Free Full Text].
-
Zhang JH,
Pimenta AF,
Levitt P,
Zhou R
(1997)
Dynamic expression suggests multiple roles of the eph family receptor brain-specific kinase (Bsk) during mouse neurogenesis.
Brain Res Mol Brain Res
47:202-214[Medline].
-
Zhou CF,
Li Y,
Raisman G
(1989)
Embryonic entorhinal transplants project selectively to the deafferented entorhinal zone of adult mouse hippocampi, as demonstrated by the use of Thy-1 allelic immunohistochemistry. Effect of timing of transplantation in relation to deafferentation.
Neuroscience
32:349-362[Medline].
-
Zhou R
(1997)
Regulation of topographic projection by the Eph family receptor Bsk (EphA5) and its ligands.
Cell Tissue Res
290:251-259[ISI][Medline].
-
Zhou R
(1998)
The Eph family receptors and ligands.
Pharmacol Ther
77:151-181[ISI][Medline].
-
Zhou R,
Copeland TD,
Kromer LF,
Schulz NT
(1994)
Isolation and characterization of Bsk, a growth factor receptor-like tyrosine kinase associated with the limbic system.
J Neurosci Res
37:129-143[ISI][Medline].
Copyright © 1999 Society for Neuroscience 0270-6474/99/19208885-09$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
Y. Ohshima, T. Kubo, R. Koyama, M. Ueno, M. Nakagawa, and T. Yamashita
Regulation of Axonal Elongation and Pathfinding from the Entorhinal Cortex to the Dentate Gyrus in the Hippocampus by the Chemokine Stromal Cell-Derived Factor 1{alpha}
J. Neurosci.,
August 13, 2008;
28(33):
8344 - 8353.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Brinks, S. Conrad, J. Vogt, J. Oldekamp, A. Sierra, L. Deitinghoff, I. Bechmann, G. Alvarez-Bolado, B. Heimrich, P. P. Monnier, et al.
The Repulsive Guidance Molecule RGMa Is Involved in the Formation of Afferent Connections in the Dentate Gyrus
J. Neurosci.,
April 14, 2004;
24(15):
3862 - 3869.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Mann, C. Peuckert, F. Dehner, R. Zhou, and J. Bolz
Ephrins regulate the formation of terminal axonal arbors during the development of thalamocortical projections
Development,
March 10, 2003;
129(16):
3945 - 3955.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Uziel, S. Muhlfriedel, K. Zarbalis, W. Wurst, P. Levitt, and J. Bolz
Miswiring of Limbic Thalamocortical Projections in the Absence of Ephrin-A5
J. Neurosci.,
November 1, 2002;
22(21):
9352 - 9357.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K Senti, K Keleman, F Eisenhaber, and B. Dickson
brakeless is required for lamina targeting of R1-R6 axons in the Drosophila visual system
Development,
January 6, 2000;
127(11):
2291 - 2301.
[Abstract]
[PDF]
|
 |
|
|