 |
Previous Article | Next Article 
The Journal of Neuroscience, November 1, 1999, 19(21):9160-9169
Receptors of the Glial Cell Line-Derived Neurotrophic Factor
Family of Neurotrophic Factors Signal Cell Survival through the
Phosphatidylinositol 3-Kinase Pathway in Spinal Cord
Motoneurons
Rosa M.
Soler,
Xavier
Dolcet,
Mario
Encinas,
Joaquim
Egea,
Jose R.
Bayascas, and
Joan X.
Comella
Grup de Neurobiologia Molecular, Departament de Ciències
Mèdiques Bàsiques, Facultat de Medicina, Universitat de
Lleida, 25198 Lleida, Catalonia, Spain
 |
ABSTRACT |
The members of the glial cell line-derived neurotrophic factor
(GDNF) family of neurotrophic factors (GDNF, neurturin, persephin, and
artemin) are able to promote in vivo and in
vitro survival of different neuronal populations, including
spinal cord motoneurons. These factors signal via multicomponent
receptors that consist of the Ret receptor tyrosine kinase plus a
member of the GDNF family receptor (GRF ) family of
glycosylphosphatidylinositol-linked coreceptors. Activation of the
receptor induces Ret phosphorylation that leads the survival-promoting
effects. Ret phosphorylation causes the activation of several
intracellular pathways, but the biological effects caused by the
activation of each of these pathways are still unknown. In the present
work, we describe the ability of the GDNF family members to promote
chicken motoneuron survival in culture. We show the presence of Ret and
GFR -1, GFR -2, and GFR -4 in chicken motoneurons using in
situ hybridization and reverse transcription-PCR techniques. By
Western blot analysis and kinase assays, we demonstrate the ability of
these factors to induce the phosphatidylinositol 3 kinase (PI 3-kinase)
and the extracellular regulated kinase (ERK)-mitogen-activated protein (MAP) kinase pathways activation. To characterize the involvement of
these pathways in the survival effect, we used the PI 3-kinase inhibitor LY 294002 and the MAP kinase and ERK kinase (MEK)
inhibitor PD 98059. We demonstrate that LY 294002, but not PD 98059, prevents GDNF-, neurturin-, and persephin-induced motoneuron survival, suggesting that PI 3-kinase intracellular pathway is responsible in
mediating the neurotrophic effect.
Key words:
GDNF; persephin; neurturin; artemin; motoneuron; neurotrophic factor; GFR receptors; chicken; intracellular signaling
pathway
 |
INTRODUCTION |
Glial cell line-derived neurotrophic
factor (GDNF), neurturin (NTN), persephin (PSP), and artemin (ART) are
the members of a new family of neurotrophic factors distantly related
to the members of the TGF family (Lin et al., 1993 ; Buj-Bello et
al., 1995 ; Trupp et al., 1995 ; Kotzbauer et al., 1996 ; Maxwell et al., 1996 ; Klein et al., 1997 ; Baloh et al., 1998 ; Horger et al., 1998 ; Milbrandt et al., 1998 ). All of them can support the survival of a wide
variety of neuronal populations in both the peripheral nervous system
and CNS, including motoneurons (MTN) (Henderson et al., 1994 ;
Oppenheim et al., 1995 ; Klein et al., 1997 ; Milbrandt et al., 1998 ).
GDNF family members signal via multicomponent receptors that consist of
the Ret receptor tyrosine kinase plus a glycosylphosphatidylinositol (GPI)-linked coreceptor named GDNF family receptor (GFR ), which gives binding specificity. GDNF binds preferentially to GFR -1, NTN
shows binding preference to GFR -2, PSP to GFR -4, and ART to
GFR -3 (Buj-Bello et al., 1997 ; Klein et al., 1997 ; Baloh et al.,
1998 ; Enokido et al., 1998 ). Recently, deficient mice for the GDNF
family members GDNF (Moore et al., 1996 ; Pichel et al., 1996 ; Sanchez
et al., 1996 ) and NTN (Heuckeroth et al., 1999 ), for their cognate
receptors GFR -1 (Cacalano et al., 1998 ; Enomoto et al., 1998 ) and
GFR -2 (Rossi et al., 1999 ) or for Ret (Schuchardt et al., 1994 ),
have been generated. Analysis of the trigeminal motor nucleus and the
spinal cord show moderate loss of MTNs in GDNF (Moore et al., 1996 ;
Sanchez et al., 1996 ) and GFR -1 (Cacalano et al., 1998 ) mutants.
However, the facial nucleus does not show significant variation in the
number of MTNs in the same animals.
Binding of GDNF family of neurotrophic factors to Ret and GFR family
members induce Ret phosphorylation (Durbec et al., 1996 ; Jing et al.,
1996 ; Treanor et al., 1996 ; Trupp et al., 1996 ). After phosphorylation,
Ret induces the activation of several intracellular pathways, among
which the extracellular regulated kinase (ERK)-mitogen-activated protein (MAP) kinase and the phosphatidylinositol 3 kinase (PI 3-kinase) are of particular interest (Kotzbauer et al., 1996 ; Creedon
et al., 1997 ). PI 3-kinase has been implicated in the survival-promoting mechanisms (Yao and Cooper, 1995 ; Dudek et al.,
1997 ; Miller et al., 1997 ; Crowder and Freeman, 1998 ; Dolcet et al.,
1999 ) and ERK-MAP kinase seems to be involved in differentiation processes (Qiu and Green, 1992 ; Cowley et al., 1994 ; Fukuda et al.,
1995 ; Pang et al., 1995 ). To understand the mechanisms implicated in
the GDNF family-mediated MTN survival and the intracellular pathways
involved in this process, we have investigated the ability of GDNF,
NTN, and PSP to activate PI 3-kinase and ERK-MAP kinase pathways. We
provide evidence showing that all these neurotrophic factors are able
to activate both pathways in our culture system, and the PI 3-kinase
pathway has an important role on MTN survival, whereas the Ras/MAP
kinase does not have a relevant contribution in this process.
 |
MATERIALS AND METHODS |
MTN isolation, survival evaluation, and cell death
characterization. MTNs were purified from embryonic day 5.5 (E5.5) chick embryos according to Comella et al. (1994) with
minor modifications described by Dolcet et al. (1999) . Survival
evaluation was performed as described by Soler et al. (1998) .
Neurotrophic factors were obtained from E. M. Johnson and J. Milbrandt (Washington University, St. Louis, MO) and were prepared as
described by Creedon et al. (1997) .
To evaluate the cell death process, cultures were stained with the
Hoechst 33258 dye (Sigma, Madrid, Spain). MTNs (2 × 105) were grown in 35 mm culture
dishes for 48 hr in the presence of muscle extract (MEX), and then
cells were washed and grown for an additional 15 hr with culture medium
containing different supplements or drugs. At that time, medium was
removed, and cells were washed once with PBS and fixed with 4% (w/v)
paraformaldehyde (Fluka, Buchs, Switzerland) in PBS for 30 min. Neurons
were stained for 30 min with 0.5 µg/ml Hoechst 33258 and were mounted
with glass coverslips using Fluoprep (Biomerieux, Marcy-l'Etoile,
France). Stained cells were observed and counted with a vertical
microscope equipped with epifluorescence and UV filters. Results are
expressed as the percentage of apoptotic cells with respect to the
total cell number counted in each condition (1000 cells) and show the mean ± SEM of the percentages for three independent experiments. Where applicable, statistical analysis was performed with the Student's t test.
To assess the enzymatic activity of caspases in dying MTNs, cultures
were grown in the presence of MEX during 48 hr. After this period of
time, cells were washed and treated in the indicated culture media. At
the adequate time, cells were rinsed with ice-cold PBS and lysed in a
buffer containing 100 mM HEPES, pH 7.4, 5 mM DTT, 5 mM EGTA, 0.04% NP-40, and 20% glycerol. Extracts
were then centrifuged at 5000 × g for 10 min, and
protein concentrations were determined by Bradford assay (Bradford,
1976 ). Eight micrograms of cell extracts were diluted in 50 µl of
reaction buffer (100 mM HEPES, pH 7.4, 5 mM DTT, 5 mM EGTA, 0.04%
NP-40, and 20% glycerol) and incubated with 100 µM fluorescent substrate Z-DEVD-AFC (Enzyme System Products, Livermore, CA) at 37°C for 1 hr. The fluorescent signals were determined with a spectrofluo-rometer (Bio-Tek
Instruments, Winooski, Vermont) at an excitation wavelength of 360 nm
and an emission wavelength of 530 nm. Protease activity was expressed as the amount of cleaved substrate per microgram of protein per minute
(pmol of AFC · min-1 · µg of protein).
In situ hybridization. Probes were generated by transcribing
linearized plasmids containing the cDNA for the desired chicken gene,
obtained from Alun M. Davies (University of St. Andrews, Fife,
Scotland). The GFR -1-, GFR -2-, and GFR -3-containing plasmids were linearized with PstI, SphI, and
SacII, respectively, and transcribed with T7, T3, and SP6
RNA polymerases to generate 686, 626, and 800 bp antisense probes,
respectively. The Ret probe was synthesized from total RNAs of MTNs
using specific primers corresponding to positions 983-1007 for the
forward direction and 2035-2059 for the reverse direction of the
published sequence (Robertson and Mason, 1995 ). The amplified fragment
gives a product of 1076 bp that was subcloned in pBluescript SK
(Stratagene, La Jolla, CA). Antisense probes were obtained by digesting
the plasmid with BamHI and transcribed with T7.
For in situ hybridization, chicken embryos were
immersion-fixed for 12-16 hr at 4°C in 4% paraformaldehyde in 0.1 M sodium phosphate buffer, pH7.4, cryoprotected
overnight in 30% sucrose, embedded in Tissue-Tek(Miles, Inc, Elkhart,
IN), and frozen. Fourteen micrometers of transversal
sections were cut using a cryostat, collected onto
3-aminopropyltriethoxysilane-coated slides, and stored at 80° until
they were used. Sections were air dried for 2-3 hr before use, treated
during 30 min with 1% Triton X-100 in PBS, post-fixed with 4%
paraformaldehyde for 10 min, and acetylated in 0.25% acetic anhydride
and 0.1 M triethanolamine HCl for 10 min.
Sections were prehybridized 1 hr at room temperature in a solution
containing 50% formamide, 5× SSC, 2% blocking reagent (Boehringer
Mannheim, Barcelona, Spain), 1 mM EDTA, 1 mg/ml
tRNA, 0.5 mg/ml Herring sperm DNA, 0.1% CHAPS, and 0.1% Tween 20. Hybridization was performed in the same solution containing 500 ng/ml
the respective denatured probe for 16-20 hr at 60°C and subsequently
washed three times for 15 min in 0.2× SSC at the hybridization
temperature. Sections were blocked with 10% fetal calf serum (Life
Technologies, Barcelona, Spain) and 2 mg/ml BSA in 0.1 M Tris, pH7.5, and 0.150 M
NaCl 1 hr at room temperature. Digoxigenin-labeled nucleotides were
detected with an alkaline phosphatase-conjugated anti-digoxigenin antibody. The antibody was developed with 4-nitro blue tetrazolium chloride and 5-brom-4-chlor-indolyl-phosphate.
Reverse transcription-PCR. A semiquantitative reverse
transcription (RT)-PCR assay was used to compare the expression levels for Ret, GFR -1, GFR -2, and GFR -4 in E7.5 chicken spinal cord and 48 hr cultured MTNs. One microgram of total RNA (Chomczynski and Sacchi, 1987 ) was digested with 2 U of DNase I RNase-free (Amersham
Pharmacia Biotech, Uppsala, Sweden) and was reverse transcribed using 1 nmol of random hexamers (Boehringer Mannheim) and 200 U of Moloney
Murine Leukemia Virus Reverse Transcriptase (Promega, Madison,
WI) for 1 hr at 37°C. Ten nanograms of cDNA were used to perform a
multiplex PCR amplification, with 200 nM each
Ret, GFR -1, GFR -2, and GFR -4 set of primers and 20 nM each housekeeping L27 ribosomal protein as an
internal control. Samples were subjected to 27-30 cycles of 94°C for
20 sec (60°C for Ret and GFR -4, 50°C for GFR -1, and 53°C
for GFR -2) and 72°C for 30 sec on a Perkin-Elmer (Emeryville, CA)
thermal cycler, with hot start at 94°C. All products were analyzed on
3% ethidium bromide-stained gels. Care was taken to arrest the
amplification in the linear phase that was determined in pilot
experiments. To achieve this, the amount of product was plotted against
number of cycles and amount of starting sample.
Primer sequences were as follows: Ret forward,
TCGCTACCACAAGAATTCTCCAAAG; Ret reverse, GATGGGATATGACTGGGCTGGGCGC;
GFR -1 forward, ACCTGAGAAGGAGGATGG; GFR -1 reverse,
TGACATCCTTGATAATCT; GFR -2 forward, CCTTTGTGGATCAGAAGGC; GFR -2
reverse, AGCTTCAGCAGCACAATGG; GFR -4 forward, ACCATCGTTCCGGCCTGCTCC;
GFR -4 reverse, GCATAACGCGACCTACAGACG; L27 forward,
AGCTGTCATCGTGAAGAACAT; and L27 reverse, CTTGGCGATCTTCTTCTTGCC.
Primers for GFR -1 and GFR -2 were described previously by Thompson
et al. (1998) and those for L27 by Allsopp et al. (1993) . The amplified
products for Ret, GFR -1, GFR -2, GFR -4, and L27 were 82, 99, 82, 101, and 128, respectively.
Immunoprecipitation, Western blot analysis, and kinase
assays. Ret phosphorylation assay was performed as described by
Creedon et al. (1997) with minor modifications. Briefly, 100 µg of
protein was immunoprecipitated with 1 µg of 4G10
anti-phospho-tyrosine antibody (Upstate Biotechnology, Lake Placid,
NY). Immunocomplexes were collected with a mixture of Protein A and
Protein G (Sigma) and resolved by Western blot as described below.
Before the immunoprecipitation, 10 µg of protein was removed and
blotted to assess equal loading of the lanes.
For detection of the phosphorylated forms of MAP kinase and ERK kinase
(MEK), ERK2, and Akt in total cell lysates, 10 µg of total protein
was resolved in SDS-polyacrylamide gels and transferred onto
polyvinylidene difluoride Immobilon-P transfer membrane filters (Millipore, Bedford, MA) using an Amersham Pharmacia Biotech semidry Trans-Blot according to the manufacturer's instructions. The membranes were blotted with specific anti-phospho-MEK (anti-P-MEK),
anti-phospho-ERK (anti-P-ERK), and anti-phospho-Akt (anti-P-Akt),
antibodies (New England Biolabs, Beverly, MA) following the
instructions of the provider. To control the content of the specific
protein per lane, membranes were stripped with 100 mM
-mercaptoethanol and 2% SDS in 62.5 mM Tris-HCl, pH
6.8, for 30 min at 70°C and reprobed with a rabbit
anti-pan-MEK antibody (New England Biolabs), a mouse monoclonal
anti-pan-ERK antibody (Transduction Laboratories, Lexington, KY), or a
goat anti-pan-Akt antibody (Santa Cruz Biotechnology, Santa Cruz, CA)
as described by the providers. Ret was detected with a similar
protocol, but antibodies specific for this protein were used (Santa
Cruz Biotechnology). Blots were developed using the Super Signal
Chemiluminescent Substrate (Pierce, Rockford, IL).
ERK-MAP kinase activity assay was performed as described by Dolcet et
al. (1999) . Kinase activity was assayed on whole-cell lysates
using as substrates [ 32P]ATP
(Amersham Pharmacia Biotech) and a specific peptide provided by the
BIOTRAK p42/p44 MAP kinase enzyme assay (Amersham Pharmacia Biotech)
following the manufacturer's instructions. Incorporation of
radioactivity was measured in a scintillation counter. Results were
obtained as picomoles of inorganic phosphate incorporated per minute
per microgram of protein extract and are expressed in the figures as
the fold induction over the activity found in nonstimulated cultures.
Akt activity was performed essentially as described by Khwaja et
al. (1998) . Briefly, 150 µg of total protein was immunoprecipitated with 1 µg of anti-Akt1 antibody (C-20) (Santa Cruz Biotechnology) for
1 hr at 4°C. Immunocomplexes were collected with protein G (Sigma),
washed, and incubated with 3 µCi of
[ 32P]ATP (Amersham Pharmacia Biotech)
and histone H2B (Boehringer Mannheim) as substrates. Reaction was
performed for 30 min at room temperature and stopped by adding sample
buffer and boiling for 5 min. Immunocomplexes were resolved by
SDS-PAGE. Quantification of H2B phosphorylation was performed by
PhosphorImager Analysis (Molecular Dynamics, Sunnyvale, CA).
 |
RESULTS |
Ret and GFR receptors are expressed in embryonic chicken MTNs
in vivo and in vitro
GDNF family of neurotrophic factors mediate neuronal survival
through a receptor complex composed of Ret and a member of the GFR
family of GPI-linked receptors (GFR -1, GFR -2, and GFR -4) (Jing
et al., 1996 ; Buj-Bello et al., 1997 ; Enokido et al., 1998 ; Trupp et
al., 1998 ). Because we wanted to study whether this family of
neurotrophic factors promoted cell survival in our culture system, we
were first interested to know whether the functional receptors were
present in the corresponding embryonic day in chicken spinal cord MTNs.
Thus, in situ hybridization analysis using antisense riboprobes specific for each of the receptors were performed in E7.5
chicken sections. In the spinal cord, low-to-moderate levels of Ret and
moderate-to-high levels of GFR -1, GFR -2, and GFR -4 expression
were observed in the ventral horn in which MTN cell bodies are located
(Fig. 1). The GFR -1 and GFR -4
expression patterns were found to be complementary, and
GFR -2-positive cells were found in the peripheral area of the
ventral horn. This expression pattern suggests that the GFR family
receptors could be expressed in different MTN subpopulations located in
the ventral horn, whereas Ret expression was homogeneously distributed
in this spinal cord area (Fig. 1).

View larger version (168K):
[in this window]
[in a new window]
|
Figure 1.
Ret and GFR receptors are expressed in
embryonic chick spinal cord. In situ hybridization
analysis of GRF -1 (A, B), GRF -2
(C, D), GRF -4 (E,
F), and Ret (G,
H) expression in E7.5 chicken. Serial transversal
sections through the spinal cord were hybridized to antisense
riboprobes against the four receptors. B,
D, F, and H are
amplifications of the lateral motor column showing the expression in
MTNs of GRF -1, GRF -2, GRF -4, and Ret, respectively. Control
sense probe did not show any specific patterns of hybridization signal
(data not shown).
|
|
To investigate further the expression of these receptors in our system,
MTNs were cultured in the presence of MEX for 48 hr. After this period
of time, we used semiquantitative RT-PCR with specific primers to
detect Ret, GFR -1, GFR -2, and GFR -4 mRNA. Figure
2A shows that the four
transcripts were present in cultured MTNs with levels similar to those
detected in the E7.5 chicken dissociated spinal cord, suggesting that,
after 48 hr in culture, MTNs are still expressing all these genes.
Moreover, we could also detect an enrichment of Ret, GFR -1, and
GFR -2 mRNA levels in the cultured MTN with respect to the entire
spinal cord. This is probably caused by an enrichment of cells
expressing these genes during the MTN purification process.
Furthermore, we were able to detect the expression of Ret protein in
cultured MTNs by Western blot analysis. The expression increased with
time in culture, and the maximum levels were observed after 24 hr (Fig. 2B). Thereafter, the levels tend to slightly decrease
(Fig. 2B). Moreover, we also investigated the ability
of GDNF to induce Ret tyrosine phosphorylation. Thus, after GDNF
stimulation, cells were lysated and immunoprecipitated with an
anti-phospho-tyrosine antibody. Figure 2C shows that
cultures treated with GDNF contained tyrosine-phosphorylated Ret
protein, whereas nonstimulated control cultures did not. We can
conclude that GFR family of receptors and Ret are expressed in
chicken spinal cord MTNs both in vivo and in
vitro and that GDNF treatment is able to activate Ret in cultured
MTNs.

View larger version (42K):
[in this window]
[in a new window]
|
Figure 2.
Ret and GFR receptors are expressed in cultured
MTNs. A, Agarose gel showing the RT-PCR products for
Ret, GFR -1, GFR -2, and GFR -4 in E7.5 spinal cord
(SP) and 48 hr cultured MTNs
(M). Coamplification of the L27 mRNA
(top band in each lane) serves as an
internal control. All RNAs were present at similar levels in spinal
cord and cultured MTNs, and for all, except GFR -4, there was an
enrichment of these transcripts in cultured MTNs. Control reactions
performed without reverse transcriptase synthesis
[C( )] show that there was no detectable
contamination by genomic DNA. m corresponds to the 50 bp
molecular size marker (Amersham Pharmacia Biotech). The same results
were obtained without L27 amplification (data not shown).
B, Western blot analysis of Ret expression in 0, 12, 24, and 48 hr MEX-cultured MTNs. After these periods of time in culture,
cells were lysed, and protein extracts were analyzed by Western blot
with an anti-c-Ret antibody. To assess the protein content in each
lane, membranes were stripped and reprobed with an anti- -tubulin
antibody. C, GDNF induces Ret tyrosine phosphorylation
in MTNs. Cultures were deprived of MEX for 5 hr and then treated with
medium containing no additions (NS) or 100 ng/ml GDNF.
After 7 min, cultures were lysed. Western blot of phospho-tyrosine
immunoprecipitates (left) or total lysates
(right) were probed with an anti-Ret antibody.
|
|
GDNF, NTN, and PSP promote chick MTN survival in culture
To analyze the effect of GDNF family of neurotrophic factors on
chicken spinal cord MTN survival in culture, MTNs were isolated from
E5.5 embryos essentially as described by Comella et al. (1994) . Isolated MTNs are able to survive in culture in the presence of a
saturating concentration (300 µg/ml) of muscle extract (MEX) (Comella
et al., 1994 ). However, when MTN were cultured in the absence of MEX,
<30% of the cells initially plated remained alive after 36 hr in
culture (data not shown). To study the ability of GDNF, NTN, and PSP to
promote MTN survival, MTNs were cultured in the presence of MEX for
2 d. Afterward, the culture medium was replaced and the different
conditions were established. On readdition of a medium containing 10 ng/ml GDNF, NTN, or PSP, ~90% of the MTNs remained alive after an
additional 24 hr of culture (Fig.
3A). These survival
percentages were comparable with those observed in cultures
supplemented with MEX (94.7 ± 6.2). However, when they were
deprived of MEX and maintained in the basal medium (no extract medium,
NE), significantly lower percentages of MTNs (~60%) survived. The
survival-promoting effect of GDNF family of neurotrophic factors was
clearly dose-dependent (Fig. 3B). Concentrations above 100 pg/ml were saturating, and ~90% of viable MTNs were maintained.
These results showed that GDNF family members are able to maintain the
survival of chicken cultured MTNs to approximately the same level of
that observed with MEX. No major morphological differences were
observed between MTNs treated with MEX and those treated with any of
the different trophic factors assayed.

View larger version (34K):
[in this window]
[in a new window]
|
Figure 3.
GDNF family of neurotrophic factors promote
MTN survival in culture. A, Percentages of MTN survival
after 24 hr in the presence of 10 ng/ml GDNF, NTN, or PSP.
B, Dose-dependence curves of MTN survival after 24 hr in
the presence of different doses of GDNF, NTN, or PSP. C,
In the left half, bars show the percentage of MTN
survival after 24 hr in the presence of 10 pg/ml GDNF, NTN, or PSP. In
the right half, bars show the percentage of survival in
cultures treated during 24 hr with different combinations of factors,
all of them added at doses of 10 pg/ml. D, Percentage of
MTN survival after 24 hr in 10 ng/ml GDNF-, NTN-, or PSP-treated
cultures in the absence (filled bars) or presence
(open bars) of 1 U/ml PIPLC. Broken lines
in A-D show survival of cells in sibling control
cultures maintained in the presence (top line,
MEX) or absence (bottom line,
NE) of MEX culture medium for the same culture period.
Values are the mean ± SEM of eight wells from a representative
experiment that was repeated twice more with results comparable with
those presented. Asterisk in C indicates
that the values are significantly different
(p < 0.01) between cultures treated with a
single factor and cultures treated with a combination of factors as
determined by the Student's t test.
Asterisk in D indicates survival values
significantly different (p < 0.01) when
comparing cultures treated with PIPLC or not as determined by the
Student's t test.
|
|
In these survival experiments, we found that saturating concentrations
of a single factor rescued ~90% of the cultured MTNs. Because the
expression of the GFR receptors is distributed in different neuronal
subpopulations in the spinal cord, we were interested to know whether
combinations of factors used at 10 pg/ml would improve MTN survival.
Figure 3C shows that all of the combinations of factors
studied did an additive effect on cell survival. This result suggests
that, at high concentrations, a single factor could also promote
survival acting through any of the GFR receptors.
To know whether GPI-linked proteins are normally required for the
survival response of MTNs to GDNF, NTN, and PSP, we treated 48 hr
cultured MTNs with phosphoinositide-specific phospholipase C (PIPLC),
an enzyme that specifically cleaves GPI linkages (Koke et al., 1991 ).
PIPLC treatment reduced the number of surviving neurons in the presence
of GDNF, NTN, or PSP to the level observed in basal medium (NE)
(~60%) (Fig. 3D). However, addition of PIPLC to NE-,
MEX-, or BDNF-supplemented cultures did not have any effect on MTN
survival (data not shown). All of these results suggest that PIPLC
treatment eliminated the specific survival response of cultured MTNs to
GDNF family of neurotrophic factors, indicating the involvement of the
GPI-linked receptors in this process.
GDNF family of neurotrophic factors activates PI 3-kinase and
ERK-MAP kinase pathways in cultured MTNs
Neurotrophic factors, such as neurotrophins, induce tyrosine
phosphorylation of Trk receptors and the activation of several intracellular pathways in several neuronal populations, including chicken MTNs (Dolcet et al., 1999 ). Two of these pathways, ERK-MAP kinase and PI 3-kinase, are the best characterized signaling pathways activated by Trk receptors, and they have been related in neuronal differentiation and survival (Kaplan and Miller, 1997 ). To know whether
GDNF family of neurotrophic factors induces activation of ERK-MAP
kinase and PI 3-kinase intracellular signaling pathways, MTNs were
cultured in the presence of MEX during 48 hr. Then, cells were washed
and stimulated with 50 ng/ml GDNF, NTN, and PSP for 7 min. MTNs were
lysed, and cell lysates were analyzed by immunoblotting using
anti-P-MEK, anti-P-ERK antibodies (two kinases of the MAP kinase
pathway), and anti-P-Akt antibodies (a well known downstream effector
of the PI 3-kinase). Figure 4 shows an
increase of tyrosine phosphorylation of MEK, ERK, and Akt after GDNF,
NTN, and PSP treatment compared with the basal level observed in
nonstimulated cultures. When the same filters were stripped and
reprobed with anti-pan-MEK, anti-pan-ERK, and anti-pan-Akt antibodies,
bands with similar intensities appeared in nonstimulated and stimulated
cultures.

View larger version (42K):
[in this window]
[in a new window]
|
Figure 4.
Effect of GDNF family of
neurotrophic factors treatment on the activation of MEK, ERK, and Akt.
MTNs were cultured for 48 hr in the presence of MEX, deprived of MEX
for 5 hr, and then stimulated as indicated for 7 min with 50 ng/ml (for
Western blot analysis) or 100 ng/ml (for kinase activity) GDNF, NTN, or
PSP. After treatment, cells were lysed, and protein extracts were
obtained. A, Protein extracts were analyzed by Western
blot with an anti-P-MEK1/2 antibody ( -P-MEK1/2)
or with an anti- P-ERK1/2 antibody ( -P-ERK1/2) and
stripped and reprobed with an anti-MEK1/2 antibody
( -MEK1/2) or an anti-pan-ERK antibody
( -pan-ERK). NS
indicates nonstimulated control cultures.
Arrows labeled P-MEK1/2,
MEK1/2, P-ERK2, and ERK2
indicate the position of the phosphorylated and nonphosphorylated forms
of MEK1/2 and ERK2 proteins, respectively. Protein extracts were
subjected to an ERK-MAP kinase assay. Results are expressed as fold
induction over basal activity. Asterisk indicates
survival values significantly different (p < 0.01) when comparing cultures treated with GDNF or not as determined
by the Student's t test. B,
Protein extracts were analyzed by Western blot with an anti-P-Akt
antibody ( -P-Akt) and stripped and reprobed with an
anti-Akt antibody ( -Akt). NS indicates
nonstimulated control cultures. Arrows labeled
P-Akt and Akt show the position of the
phosphorylated and nonphosphorylated forms of Akt protein,
respectively. Protein extracts were subjected to immunoprecipitation
with an anti-Akt antibody, and the immunoprecipitates were tested by an
Akt kinase assay. Results are expressed as fold induction over basal
activity. Asterisk indicates survival values
significantly different (p < 0.01) when
comparing cultures treated with GDNF or not as determined by the
Student's t test.
|
|
Moreover ERK-MAP kinase and Akt kinase assays were performed in cell
lysates of MTNs stimulated with 100 ng/ml GDNF for 7 min. Results in
Figure 4 show that GDNF stimulation caused an induction of Akt
(2.8-fold induction) and ERK-MAP kinase (2.1-fold induction) activity
when we compared it with the level of kinase activity in nonstimulated cells.
Taking together all of these observations, we conclude that both
ERK-MAP kinase and PI 3-kinase pathways could be activated by GDNF,
NTN, and PSP, suggesting the possibility that they could transduce the
survival effect of these neurotrophic factors on MTNs.
Inhibition of PI 3-kinase, but not ERK-MAP kinase, reverts GDNF
family of neurotrophic factors-promoted MTN survival
To further investigate the role of PI 3-kinase and ERK-MAP kinase
intracellular pathways mediating the survival-promoting effect of GDNF
family members, we analyzed the effect of the PI 3-kinase inhibitor LY
294002 and the MEK inhibitor PD 98059 on cultured MTNs. Cells were
cultured for 2 d in the presence of MEX, washed with L15H, and
switched to culture medium supplemented with neurotrophic factors (10 ng/ml) in the presence or absence of LY 294002 (Fig.
5A) or PD 98059 (Fig.
5B). After 24 hr, evaluation of MTN survival showed that LY
204002, but not PD 98059, reverted the survival-promoting effect
mediated by GDNF, NTN, and PSP (Fig. 5). The effect of LY 294002 was
dose-dependent (data not shown) and, at 50 µM,
the number of surviving neurons was comparable with the one obtained in
control cultures maintained in basal medium (NE). The same dose of LY
294002 was also able to prevent the increase in the Akt phosphorylation
levels after GDNF, NTN, or PSP stimulation, demonstrating the
functional blockade of PI 3-kinase activity (Fig.
6B).

View larger version (20K):
[in this window]
[in a new window]
|
Figure 5.
Effects of MEK and PI 3-kinase inhibitors on MTN
survival mediated by GDNF family of neurotrophic factors.
A, MTN survival in cultures treated during 24 hr in
basal medium (NE), MEX, or 10 ng/ml GDNF, NTN, or PSP medium in the
absence (filled bars) or presence
(open bars) of 50 µM LY 294002. Asterisk indicates survival values significantly
different (p < 0.01) when comparing
cultures treated with LY 294002 or not as determined by the Student's
t test. B, MTN survival in cultures
treated during 24 hr in basal medium (NE), MEX, or 10 ng/ml GDNF, NTN,
or PSP medium in the absence (filled bars) or
presence (open bars) of 20 µM PD 98059. No
significant differences in cell survival were found after this MEK
inhibitor treatment.
|
|

View larger version (51K):
[in this window]
[in a new window]
|
Figure 6.
Effect of MEK and PI 3-kinase inhibitors on the
activation of ERK and Akt, respectively. MTNs were cultured for 48 hr
in the presence of MEX, were MEX-starved for 5 hr, pretreated (+) or
not ( ) for 30 min with 50 µM PD 98059 (A) or LY 294002 (B), and
then stimulated (+) or not ( ) for 7 min with 50 ng/ml GDNF, NTN, or
PSP. After treatment, cells were lysed, and protein extracts were
analyzed by Western blot with an anti-phospho-ERK1/2 antibody
( -P-ERK1/2) or an anti-phospho-Akt antibody
( -P-Akt) and stripped and reprobed with an
anti-pan-ERK antibody ( -pan-ERK) or with an
anti-Akt antibody ( -Akt). Arrows
labeled P-ERK2, ERK2,
P-Akt, and Akt indicate the position of
the phosphorylated and nonphosphorylated forms of ERK2 and Akt,
respectively.
|
|
On the other hand, Western blot analysis of 20 µM PD
98059-treated cultures showed that ERK phosphorylation was prevented after neurotrophic factor treatment (Fig. 6A). At the
same dose of PD 98059, the level of MTN survival was not affected, and
the number of surviving neurons after 24 hr of treatment was the same as the one obtained in control cultures (MEX, GDNF, NTN, or PSP) (Fig.
5B). Moreover, the 20 µM dose of PD
98059 was unable to alter the level of phosphorylation of Akt after
GDNF, NTN, or PSP stimulation (data not shown). Together, these results
suggest that the downstream elements activated by ERK-MAP kinases are not necessary for GDNF-, NTN-, and PSP-mediated survival; however, the
PI 3-kinase pathway is one of the key elements involved in the survival
process induced by the GDNF family of neurotrophic factors.
To asses whether LY 294002 suppresses the survival effects of these
neurotrophic factors inducing the same kind of neuronal cell death as
that observed after trophic factor deprivation (i.e., MEX withdrawal),
we have quantified the percentage of apoptotic MTNs after LY 294002 treatment. Experiments were performed with the Hoechst 33258 dye, which
binds specifically to the chromatinic DNA. Apoptotic cells display a
highly condensed DNA that is normally fragmented in two or more
chromatin aggregates (Fig.
7A). In cultures grown in the
presence of MEX, GDNF, NTN, or PSP, the percentage of cells displaying
this morphological feature was found to be <6%. However, after 15 hr
of MEX deprivation or 50 µM LY 294002 treatment, the percentage of apoptotic cells greatly increased, and the
percentage of apoptotic cells was found to be doubled when compared
with their LY 294002 untreated counterparts (Fig. 7B). These
results suggest that LY 294002 reverted the trophic effect promoted by
GDNF, NTN, or PSP, inducing an apoptotic cell death process at the same
dose that blocked Akt phosphorylation induced by these neurotrophic
factors.

View larger version (31K):
[in this window]
[in a new window]
|
Figure 7.
Cell death induced by LY 294002 shared
apoptotic features with that observed after MEX deprivation.
A, MTNs were maintained in culture in the presence of
MEX for 48 hr. Then, cells were grown for 15 hr in different culture
conditions: basal medium without any trophic support (NE); supplemented
with MEX; or supplemented with 10 ng/ml GDNF, NTN, or PSP in the
presence or absence of 50 µM LY 294002. After this time,
MTN nuclei were stained with Hoechst. Representative photomicrographs
of cultures treated with basal medium (NE), MEX, GDNF, or GDNF plus LY
294002. B, Percentage of apoptotic cells in each
condition. Quantification of apoptotic nuclei was performed as
described in Materials and Methods. The percentages in control cultures
were 8.5 ± 2.7 for NE and 5.9 ± 1.3 for MEX.
C, Assay of caspase activity performed in cultures
treated for 8 hr with 10 ng/ml GDNF, NTN, or PSP in the presence
(open bars) or absence (filled
bars) of 50 µM LY 294002, MEX, or basal medium
(NE). At the end of the treatment, cells were lysed, and protein
extracts were assayed for its caspase activity as described in
Materials and Methods. Results are expressed as pmol of
AFC · min-1 · µg of protein.
Asterisk indicates significant differences
(p < 0.01) on caspase activity between
GDNF-, NTN-, or PSP-treated cultures and NE- or GDNF, NTN, or PSP plus
LY 294002-treated cultures.
|
|
It has been reported previously that apoptotic cell death is
accompanied by the enzymatic activity of a family of proteases referred
as to caspases (for review, see Cryns and Yuan, 1998 ). This activity
has been established as a good criteria to characterize the apoptotic
cell death in chicken spinal cord MTNs after trophic factor deprivation
(Li et al., 1998 ; Dolcet et al., 1999 ). To analyze caspase activity in
our culture system, we performed an in vitro assay using the
fluorogenic substrate DEVD-AFC (Talanian et al., 1997 ). Once DEVD-AFC
is cleaved by caspases, the AFC group is released from the whole
molecule, becoming fluorescent (Nicholson et al., 1995 ). Using this
approach, we observed an induction of caspase activity in MEX-deprived
cells (NE) when we compared it with the level of caspase activity found
in MEX-treated (2.3-fold induction), GDNF-treated (2.6-fold induction),
NTN-treated (2-fold induction), or PSP-treated (1.7-fold induction)
cultures (Fig. 7C). To know whether LY 294002 treatment on
GDNF family-maintained cells induced the same effect on caspase
activity as deprived cultures, MTN were treated with GDNF, NTN, or PSP
(10 ng/ml) in the presence or absence of 50 µM
LY 294002. Figure 7C shows that the level of caspase
activity in LY 294002-treated cultures was similar to that obtained in
basal medium (NE)-treated cultures and higher (p < 0.01) than that obtained in GDNF-, NTN-, or PSP-treated cells. These
results suggest that GDNF family of neurotrophic factors inhibit the
activation of caspases through a PI 3-kinase-dependent pathway.
 |
DISCUSSION |
We have shown in the present study that the members of GDNF family
of neurotrophic factors promote MTN survival through the activation of
the PI 3-kinase intracellular signaling pathway. These neurotrophic
factors are potent survival factors for different neuronal populations,
including spinal cord MTNs (Henderson et al., 1994 ; Oppenheim et al.,
1995 ; Yan et al., 1995 ; Klein et al., 1997 ; Horger et al., 1998 ;
Milbrandt et al., 1998 ). In our culture system, GDNF, NTN, and PSP
promoted the survival of MTNs deprived of MEX. The effect was
dose-dependent, and it was reverted by adding PIPLC in the culture
medium. This enzyme specifically cleaves the GPI linkage of the GFR
to the cell membrane, thus precluding the activation of Ret (Koke et
al., 1991 ). Our results indicated that these neurotrophic factors need
to bind to a GPI-linked receptor to do their survival effect on
cultured MTNs. It has been described previously that GDNF, NTN, and PSP
act through their binding to the GPI-linked coreceptors GFR -1,
GFR -2, and GFR -4, respectively (Buj-Bello et al., 1997 ; Klein et
al., 1997 ; Enokido et al., 1998 ) (for review, see Ibáñez,
1998 ). In the present work, we also demonstrated the presence of Ret
and GFR family receptors in embryonic chicken spinal cord MTNs both
in vivo and in vitro using in situ
hybridization and RT-PCR techniques. The presence of GRF -1 and
GFR -2, but not GFR -3, receptors in the ventral horn of rat
embryos spinal cord has been demonstrated previously (Yu et al., 1998 ).
Moreover, GFR -4 is expressed in embryonic chicken spinal cord MTNs
(Thompson et al., 1998 ). However, our results demonstrated the presence
of these receptors in chicken spinal cord MTNs by both methods. We also
show that the distinct GFR receptors are located on different MTN
subpopulations. This situation could not be compatible with the fact
that, in the survival experiments, high doses of a single factor were
able to promote ~100% survival of purified MTNs, but at
subsaturating concentrations, the combinations of factors always had an
additive effect on the survival of these cells. This situation could be
explained by the possibility that high doses of any of these factors
could also bind to another member of the GFR family receptors. This cross-talk between the members of both families, neurotrophic factors
and receptors, has been described previously by different authors,
especially when neuronal survival was assessed by culture methods
(Baloh et al., 1998 ; Enokido et al., 1998 ; Ibañez, 1998 ; Trupp et
al., 1998 ). Thus, the studies performed in mutant mice lacking GDNF,
NTN, or GFR -1 receptors show moderate or no loss of MTNs number in
the trigeminal motor nucleus, the spinal cord, or the facial nucleus
(Moore et al., 1996 ; Sanchez et al., 1996 ; Cacalano et al., 1998 ;
Heuckeroth et al., 1999 ). These results, together with the in
vitro observations, suggest that it may possible that this
cross-talk also exists in vivo. Experiments with double mutant mice lacking more than one of the members of family receptors or
of the neurotrophic factors will answer this question.
Little is known about the intracellular signaling pathways triggered by
the GDNF family of neurotrophic factors when they activate Ret. In the
present work, we show that GDNF, NTN, and PSP increased the
phosphorylation of MEK, ERK, and Akt, indicating that the ERK-MAP
kinase and the PI 3-kinase intracellular signaling pathways were
activated. Moreover, we present evidence that only the blockade of the
PI 3-kinase pathway using the PI 3-kinase-specific inhibitor LY 294002 was able to revert the survival effect induced by GDNF, NTN, and PSP.
This effect was found at the same doses that prevent the activation of
the PI 3-kinase. Moreover, by morphological criteria, MEX deprivation
and LY 294002 treatment induce a comparable apoptosis, suggesting that
this pathway plays a central role in the survival-promoting effects
elicited by GDNF, NTN, or PSP. Furthermore, these results were
reinforced when a specific biochemical parameter, i.e., caspase
activity, was measured. We have found that MEX deprivation and LY
294002 treatment increased the level of DEVD-specific caspase activity.
On the contrary, when cells were treated with the MEK inhibitor PD
98059, a drug that inhibits the phosphorylation and the ERK-MAP kinase
activity, it does not affect MTN survival. It has been demonstrated
previously that GDNF and NTN were able to stimulate the activation of
ERK-MAP kinase and the PI 3-kinase intracellular signaling in
sympathetic neurons (Kotzbauer et al., 1996 ; Creedon et al., 1997 ).
However, in these reports, no evidence about the role of these pathways in mediating survival effects were provided. Our study expands the
initial findings in GDNF and NTN to PSP. Moreover, we report that MTN
behaves similarly to sympathetic neurons with regard to the stimulation
of these intracellular pathways. Therefore, we demonstrate that PI
3-kinase pathway seems to mediate the survival-promoting effects
induced by this family of neurotrophic factors. The role of the PI
3-kinase pathway as a mediator of the trophic effects of several
trophic factors has been described previously in BDNF-mediated survival
of cultured cerebellar granule neurons (Nonomura et al., 1996 ; Shimoke
et al., 1997 ) or spinal cord MTNs (Dolcet et al., 1999 ), in NGF
maintained PC12 or SGC cells (Yao and Cooper, 1995 ; Crowder and
Freeman, 1998 ), and in cerebellar granule neurons maintained with IGF-1
(D'Mello et al., 1997 ; Dudek et al., 1997 ; Miller et al.,
1997 ). However, the present work is the first demonstration of
the involvement of the PI 3-kinase pathway in mediating the survival-promoting effects of the GDNF family of neurotrophic factors.
The activation of the ERK-MAP kinase pathway after trophic factor
stimulation has been described previously in different neuronal populations, such as MTNs (Becker et al., 1998 ), cerebellar granule cells (Nonomura et al., 1996 ), and hippocampal pyramidal neurons (Marsh
and Palfrey, 1996 ). In our culture system, the stimulation by
GDNF, NTN, or PSP also increases ERK and MEK phosphorylation and,
consequently, the activation of this intracellular pathway. However,
the inhibition of this pathway was unable to block the survival-promoting effect caused by GDNF family of neurotrophic factors. The present results are in accordance with those reported by
other authors using different approaches in several neuronal systems
(Creedon et al., 1996 ; Marsh and Palfrey, 1996 ; Virdee and Tolkovsky,
1996 ; Miller et al., 1997 ; Soler et al., 1998 ). These studies suggest
that the activation of the ERK-MAP kinase pathway is not involved in
the cellular events directly related with cell survival. However, the
activation of this pathway could be an important step in mediating
neuronal differentiation. In that sense, it has been reported the
involvement of this pathway mediating neurite outgrowth, which is one
of the indicators for neuronal differentiation (Qiu and Green,
1992 ; Cowley et al., 1994 ; Fukuda et al., 1995 ; Pang et al., 1995 ;
Creedon et al., 1996 ).
In conclusion, our work demonstrated the involvement of the PI 3-kinase
intracellular pathway mediating neuronal survival after GDNF family of
neurotrophic factors stimulation. It seems that this will be a general
process in signaling transduction mechanisms of different neurotrophic
factors on many neuronal populations. The involvement of other pathways
mediating different processes others than neuronal survival could allow
us to understand the mechanisms by which neurotrophic factors regulate
diverse neuronal responses.
 |
FOOTNOTES |
Received April 15, 1999; revised July 19, 1999; accepted Aug. 11, 1999.
This work was funded by Spanish Govern Comisión Interministerial
de Ciencia y Tecnologia through the Plan Nacional de Salud y Farmacia
(Contract 97-0094), Telemarató de TV3 (edició 1997: Malalties Degeneratives Hereditàries), European Union Biotech Program (Contract BIO4-CT96-0433), and Ajuntament de Lleida. We thank
Isu Sanchez for her technical support. We also thank Eugene M. Johnson
and Jeff Milbrandt (Washington University, St. Louis, MO) for supplying
the neurotrophic factors and Malú G. Tansey (Washington
University, St. Louis, MO) for her scientific comments and help. GFR
plasmids used for the in situ hybridization were a
generous gift of Alun M. Davies (University of St. Andrews, Fife,
Scotland). M.E. and J.E. are predoctoral fellows funded by Generalitat
de Catalunya, and X.D. is a predoctoral fellow funded by the Spanish
Government. J.R.B. is a postdoctoral fellow funded by European Union
Biotech Contract BIO4-CT96-0433.
Drs. Soler and Dolcet contributed equally this work.
Correspondence should be addressed to Joan X. Comella, Grup de
Neurobiologia Molecular, Departament de Ciències Mèdiques Bàsiques, Universitat de Lleida, Rovira Roure, 44, 25198 Lleida, Spain.
 |
REFERENCES |
-
Allsopp TE,
Robinson M,
Wyatt S,
Davies AM
(1993)
Ectopic trkA expression mediates a NGF survival response in NGF-independent sensory neurons but not in parasympathetic neurons.
J Cell Biol
123:1555-1566[Abstract/Free Full Text].
-
Baloh RH,
Tansey MG,
Lampe PA,
Fahrner TJ,
Enomoto H,
Simburger KS,
Leitner ML,
Araki T,
Johnson Jr EM,
Milbrandt J
(1998)
Artemin, a novel member of the GDNF ligand family, supports peripheral and central neurons and signals through the GFR
3-Ret receptor.
Neuron
21:1291-1302[Web of Science][Medline]. -
Becker E,
Soler RM,
Yuste VJ,
Gine E,
Sanz-Rodriguez C,
Egea J,
Martin-Zanca D,
Comella JX
(1998)
Development of survival responsiveness to brain-derived neurotrophic factor, neurotrophin 3 and neurotrophin 4/5, but not to nerve growth factor, in cultured motoneurons from chick embryo spinal cord.
J Neurosci
18:7903-7911[Abstract/Free Full Text].
-
Bradford MM
(1976)
A rapid and sensitive method for the quantitation of microgram quantities of protein utilising the principle of protein-dye binding.
Anal Biochem
72:248-254[Web of Science][Medline].
-
Buj-Bello A,
Buchman VL,
Horton A,
Rosenthal A,
Davies AM
(1995)
GDNF is an age-specific survival factor for sensory and autonomic neurons.
Neuron
15:821-828[Web of Science][Medline].
-
Buj-Bello A,
Adu J,
Piñon LGP,
Horton T,
Thompson J,
Rosenthal A,
Chinchetru M,
Buchman VL,
Davies AM
(1997)
Neurturin responsiveness requires a GPI-linked receptor and the Ret receptor tyrosine kinase.
Nature
387:721-724[Medline].
-
Cacalano G,
Fariñas I,
Wang LC,
Hagler K,
Forgie A,
Moore M,
Armanini M,
Phillips H,
Ryan AM,
Reichardt LF,
Hynes M,
Davies A,
Rosenthal A
(1998)
GFR
-1 is an essential receptor component for GDNF in the developing nervous system and kidney.
Neuron
21:53-62[Web of Science][Medline]. -
Chomczynski P,
Sacchi N
(1987)
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:156-159[Web of Science][Medline].
-
Comella JX,
Sanz-Rodriguez C,
Aldea M,
Esquerda JE
(1994)
Skeletal muscle-derived trophic factors prevent motoneurons from entering an active cell death program in vitro.
J Neurosci
14:2674-2686[Abstract].
-
Cowley S,
Paterson H,
Kemp P,
Marshall CJ
(1994)
Activation of MAP kinase kinase is necessary and sufficient for PC12 differentiation and for transformation of NIH 3t3 cells.
Cell
77:841-852[Web of Science][Medline].
-
Creedon DJ,
Johnson EM,
Lawrence JC
(1996)
Mitogen-activated protein kinase-independent pathways mediate the effects of nerve growth factor and cAMP on neuronal survival.
J Biol Chem
271:20713-20718[Abstract/Free Full Text].
-
Creedon DJ,
Tansey MG,
Baloh RH,
Osborne PA,
Lampe PA,
Fahrner T,
Heuckeroth RO,
Milbrandt J,
Johnson Jr EM
(1997)
Neurturin shares receptors and signal transduction pathways with glial cell line-derived neurotrophic factor in sympathetic neurons.
Proc Natl Acad Sci USA
94:7018-7023[Abstract/Free Full Text].
-
Crowder RJ,
Freeman RS
(1998)
Phosphatidylinositol 3-kinase and Akt protein kinase are necessary and sufficient for the survival of nerve growth factor-dependent sympathetic neurons.
J Neurosci
18:2933-2943[Abstract/Free Full Text].
-
Cryns V,
Yuan J
(1998)
Proteases to die for.
Genes Dev
12:1551-1571[Free Full Text].
-
D'Mello SR,
Borodezt K,
Soltoff SP
(1997)
Insulin-like growth factor and potassium depolarization maintain neuronal survival by distinct pathways: possible involvement of PI 3-kinase in IGF-1 signaling.
J Neurosci
17:1548-1560[Abstract/Free Full Text].
-
Dolcet X,
Egea J,
Soler RM,
Martin-Zanca D,
Comella JX
(1999)
Activation of PI 3-kinase, but not ERK MAP kinases, is necessary to mediates BDNF-induced motoneuron survival.
J Neurochem
73:521-531[Web of Science][Medline].
-
Dudek H,
Datta SR,
Franke TF,
Bimbaum MJ,
Yao M,
Cooper GM,
Segal RA,
Kaplan DR,
Greenberg ME
(1997)
Regulation of neuronal survival by the serine-threonine protein kinase Akt.
Science
275:661-665[Abstract/Free Full Text].
-
Durbec P,
Marcos-Gutierrez CV,
Kilkenny C,
Grigoriou M,
Wartiowaara K,
Suvantro P,
Smith D,
Ponder B,
Costantini F,
Saarma M,
Sariola H,
Pachnis V
(1996)
GDNF signalling through the Ret receptor tyrosine kinase.
Nature
381:789-793[Medline].
-
Enokido Y,
de Sauvage F,
Hongo JA,
Ninkita N,
Rosenthal A,
Buchman VL,
Davies AM
(1998)
GFR
-4 and the tyrosine kinase Ret form a functional receptor complex for persephin.
Curr Biol
8:1019-1022[Web of Science][Medline]. -
Enomoto H,
Araki T,
Jackman A,
Heuckeroth RO,
Snider WD,
Johnson Jr EM,
Milbrandt J
(1998)
GRF
-1 deficient mice have deficits in the enteric nervous system and kidneys.
Neuron
21:317-324[Web of Science][Medline]. -
Fukuda M,
Gotoh Y,
Tachibana T,
Dell K,
Hattori S,
Yoneda Y,
Nishida E
(1995)
Induction of neurite outgrowth by MAP kinase in PC12 cells.
Oncogene
11:239-244[Web of Science][Medline].
-
Henderson CE,
Phillips HS,
Pollock RA,
Davies AM,
Lemeulle C,
Armanini M,
Simpson LC,
Moffet B,
Vandlen RA,
Koliatsos VE,
Rosenthal A
(1994)
GDNF: a potent survival factor for motoneurons present in peripheral nerve and muscle.
Science
266:1062-1064[Abstract/Free Full Text].
-
Heuckeroth RO,
Enomoto H,
Grider JR,
Golden JP,
Hanke JA,
Jackman A,
Molliver DC,
Bardgett ME,
Snider WD,
Johnson Jr EM,
Milbrandt J
(1999)
Gene targeting reveals a critical role for neurturin in the development and maintenance of enteric, sensory, and parasympathetic neurons.
Neuron
22:253-263[Web of Science][Medline].
-
Horger BA,
Nishimura MC,
Armanini MP,
Wang LC,
Poulsen KT,
Rosenblad C,
Kirik D,
Moffat B,
Simmons L,
Johnson Jr E,
Milbrandt J,
Rosenthal A,
Bjorklund A,
Vandlen RA,
Hynes MA,
Phillips H
(1998)
Neurturin exerts potent actions on survival and function of midbrain dopaminergic neurons.
J Neurosci
18:4929-4937[Abstract/Free Full Text].
-
Ibáñez CF
(1998)
Emerging themes in structural biology of neurotrophic factors.
Trends Neurosci
21:438-444[Web of Science][Medline].
-
Jing S,
Wen D,
Yu Y,
Holst PL,
Luo Y,
Fang M,
Tamir R,
Antonio L,
Hu Z,
Cupples R,
Louis JC,
Hu S,
Altrock BW,
Fox GM
(1996)
GDNF-induced activation of the Ret protein tyrosine kinase is mediated by GDNFR-
, a novel receptor for GDNF.
Cell
85:1113-1124[Web of Science][Medline]. -
Kaplan DR,
Miller FD
(1997)
Signal transduction by the neurotrophin receptors.
Curr Opin Cell Biol
9:213-221[Web of Science][Medline].
-
Khwaja A,
Lehman K,
Marte BM,
Downward J
(1998)
Phosphoinositide 3-kinase induces scattering and tubulogenesis in epithelial cells through a novel pathway.
J Biol Chem
273:18793-18801[Abstract/Free Full Text].
-
Klein RD,
Sherman D,
Ho WH,
Stone D,
Bennett GL,
Moffat B,
Vandlen R,
Simmons L,
Gu Q,
Hongo JA,
Devaux B,
Poulsen K,
Armanini M,
Nozaki C,
Asai N,
Goddard A,
Phillips H,
Henderson CE,
Takahashi M,
Rosenthal A
(1997)
A GPI-linked protein that interacts with Ret to form a candidate neurturin receptor.
Nature
387:717-721[Medline].
-
Koke JA,
Yang M,
Henner DJ,
Volwerk JJ,
Griffin OH
(1991)
High-level expression in Escherichia coli and rapid purification of phosphatidylinositol-specific phospholipase C from Bacillus cereus and Bacillus thuringiensis.
Protein Expr Purif
2:51-58[Medline].
-
Kotzbauer PT,
Lampe PA,
Heuckeroth RO,
Golden JP,
Creedon DJ,
Johnson Jr EM,
Milbrandt J
(1996)
Neurturin, a relative of glial-cell-line-derived neurotrophic factor.
Nature
384:467-470[Medline].
-
Li L,
Prevette D,
Oppenheim RW,
Milligan CE
(1998)
Involvement of specific caspases in motoneuron cell death in vivo and in vitro following trophic factor deprivation.
Mol Cell Neurosci
12:157-167[Web of Science][Medline].
-
Lin LF,
Doherty DH,
Lile JD,
Bektesh S,
Collins F
(1993)
GDNF: A glial cell line-derived neurotrophic factor for midbrain dopaminergic neurons.
Science
260:1130-1132[Abstract/Free Full Text].
-
Marsh HN,
Palfrey HC
(1996)
Neurotrophin-3 and brain-derived neurotrophic factor activate multiple signal transduction events but are not survival factors for hippocampal pyramidal neurons.
J Neurochem
67:952-963[Web of Science][Medline].
-
Maxwell GD,
Reid K,
Elefanty A,
Bartlett PF,
Murphy M
(1996)
Glial cell line-derived neurotrophic factor promotes the development of adrenergic neurons in mouse neural crest cultures.
Proc Natl Acad Sci USA
93:13274-13279[Abstract/Free Full Text].
-
Mildrandt J,
de Sauvage FJ,
Farçhrner TJ,
Baloh RH,
Leitner ML,
Tansey MG,
Lampe PA,
Heuckeroth RO,
Kotzbauer PT,
Simburger KS,
Golden J,
Davies JA,
Vejsada R,
Kato AC,
Hynes M,
Sherman D,
Nishimura M,
Wang LC,
Vandlen R,
Moffat B,
Klein RD,
Poulsen K,
Gray C,
Garces A,
Henderson CE,
Phillips H,
Johnson Jr EM
(1998)
Persephin a novel neurotrophic factor related to GDNF and Neurturin.
Neuron
20:245-253[Web of Science][Medline].
-
Miller TM,
Tansey MG,
Johnson EM,
Creedon DJ
(1997)
Inhibition of phosphatidylinositol 3-kinase activity blocks depolarization- and insulin-like growth factor I-mediated survival of cerebellar granule cells.
J Biol Chem
272:9847-9853[Abstract/Free Full Text].
-
Moore MW,
Klein RT,
Fariñas I,
Sauer H,
Armanini N,
Phillips H,
Reichardt LF,
Ryan AM,
Carver-Moore K,
Rosenthal A
(1996)
Renal and neuronal abnormalities in mice lacking GDNF.
Nature
382:76-79[Medline].
-
Nicholson DW,
Ali A,
Thornberry NA,
Vaillancourt JP,
Ding CK,
Gallant M,
Gareau Y,
Griffin PR,
Labelle M,
Lazebnik YA,
Munday NA,
Raju SM,
Smulson ME,
Yamin TT,
Yu VL,
Miller DK
(1995)
Identification and inhibition of ICE/CED-3 protease necessary for mammalian apoptosis.
Nature
376:37-43[Medline].
-
Nonomura T,
Kubo T,
Oka T,
Shimoke K,
Yamada M,
Enokido Y,
Hatanaka H
(1996)
Signaling pathways and survival effects of BDNF and NT-3 on cultured cerebellar granule cells.
Dev Brain Res
97:42-50[Medline].
-
Oppenheim RW,
Houenou LJ,
Johnson JE,
Lin LF,
Li L,
Lo A,
Newsome AL,
Prevette D,
Wang S
(1995)
Developing motor neurons rescued from programmed and axotomy-induced cell death by GDNF.
Nature
373:344-346[Medline].
-
Pang L,
Sawada T,
Decker SJ,
Saltiel AR
(1995)
Inhibition of MAP kinase kinase blocks the differentiation of PC-12 cells induced by nerve growth factor.
J Biol Chem
270:13585-13588[Abstract/Free Full Text].
-
Pichel JG,
Shen L,
Sheng HZ,
Granholm AC,
Drago J,
Grinberg A,
Lee EJ,
Huang SP,
Saarma M,
Hoffer BJ,
Sariola H,
Westphal H
(1996)
Defects in enteric innervation and kidney development in mice lacking GDNF.
Nature
382:73-76[Medline].
-
Qiu MS,
Green SH
(1992)
PC12 cell neuronal differentiation is associated with prolonged p21ras activity and consequent prolonged ERK activity.
Neuron
9:705-717[Web of Science][Medline].
-
Robertson K,
Mason I
(1995)
Expression of ret in the chicken embryo suggests roles in regionalisation of the vagal neural tube and somites and in development of multiple neural crest and placodal lineages.
Mech Dev
53:329-344[Web of Science][Medline].
-
Rossi J,
Luukko K,
Poteryaev D,
Laurikainen A,
Sun YF,
Laakso T,
Eerikainen S,
Tuominen R,
Lakso M,
Rauvala H,
Arumae U,
Pasternack M,
Saarma M,
Airaksinen MS
(1999)
Retarded growth and deficits in the enteric and parasympathetic nervous system in mice lacking GFR
2, a functional neurturin receptor.
Neuron
22:243-252[Web of Science][Medline]. -
Sanchez MP,
Silos-Santiago I,
Frisén J,
He B,
Lira SA,
Barbacid M
(1996)
Renal agenesis and the absence of the enteric neurons in mice lacking GDNF.
Nature
382:70-73[Medline].
-
Schuchardt A,
D'Agati V,
Larsson-Blomberg L,
Constantini A,
Pachnis V
(1994)
Defects in the kidney and enteric nervous system of mice lacking the tyrosine kinase receptor ret.
Nature
367:380-383[Medline].
-
Shimoke K,
Kubo T,
Numakawa T,
Abiru Y,
Enokido Y,
Takei N,
Ikeuchi T,
Hatanaka H
(1997)
Involvement of phosphatidylinositol-3 kinase in prevention of low K+-induced apoptosis of cerebellar granule neurons.
Dev Brain Res
101:197-206[Medline].
-
Soler RM,
Egea J,
Mintenig GM,
Sanz-Rodriguez C,
Iglesias M,
Comella JX
(1998)
Calmodulin is involved in membrane depolarization-mediated survival of motoneurons by phosphatidylinositol-3 kinase- and MAPK-independent pathways.
J Neurosci
18:1230-1239[Abstract/Free Full Text].
-
Talanian RV,
Quinlan C,
Trautz S,
Hackett MC,
Mankovich JA,
Banach D,
Ghayur T,
Brady KD,
Wong WW
(1997)
Substrate specifities of caspase family proteases.
J Biol Chem
272:9677-9682[Abstract/Free Full Text].
-
Thompson J,
Doxakis E,
Piñon LGP,
Strachan P,
Buj-Bello A,
Wyatt S,
Buchman VL,
Davies AM
(1998)
GRF
-4, a new GDNF family receptor.
Mol Cell Neurosci
11:117-126[Web of Science][Medline]. -
Treanor JJS,
Goodman L,
de Sauvage F,
Stone DM,
Poulsen KT,
Beck CD,
Gray C,
Armanini MP,
Pollock RA,
Hefti F,
Phillips H,
Goddard A,
Moore MW,
Buj-Bello A,
Davies AM,
Asai N,
Takahashi M,
Vandlen R,
Henderson CE,
Rosenthal A
(1996)
Characterization of a multicomponent receptor for GDNF.
Nature
382:80-83[Medline].
-
Trupp M,
Rydén M,
Jörnvall H,
Funakoshi H,
Timmusk T,
Arenas E,
Ibàñez C
(1995)
Peripheral expression and biological activities of GDNF, a new neurotrophic factor for avian and mammalian peripheral neurons.
J Cell Biol
130:137-148[Abstract/Free Full Text].
-
Trupp M,
Arenas E,
Fainzilber M,
Nilsson AS,
Sieber BA,
Grigoriou M,
Kilkenny C,
Salazar-Grueso E,
Pachnis V,
Arumäe U,
Sariola H,
Saarma M,
Ibañez CF
(1996)
Functional receptor for GDNF encoded by the c-ret proto-oncogene.
Nature
381:785-789[Medline].
-
Trupp M,
Raynoschek C,
Belluardo N,
Ibáñez CF
(1998)
Multiple GPI-anchored receptors control GDNF-dependent and independent activation of the c-Ret receptor tyrosine kinase.
Mol Cell Neurosci
11:47-63[Web of Science][Medline].
-
Virdee K,
Tolkovsky AM
(1996)
Inhibition of p42 and p44 mitogen-activated protein kinase activity by PD48059 does not suppress nerve growth factor- induced survival of sympathetic neurones.
J Neurochem
67:1801-1805[Web of Science][Medline].
-
Yan Q,
Matheson C,
Lopez OT
(1995)
In vivo neurotrophic effects of GDNF on neonatal and adult facial motor neurons.
Nature
373:341-344[Medline].
-
Yao RJ,
Cooper GM
(1995)
Requirement for phosphatidylinositol-3 kinase in the prevention of apoptosis by nerve growth factor.
Science
267:2003-2006[Abstract/Free Full Text].
-
Yu T,
Scully S,
Yu Y,
Fox GM,
Jing S,
Zhou R
(1998)
Expression of GDNF family receptor components during development: implications in the mechanisms of interaction.
J Neurosci
18:4684-4696[Abstract/Free Full Text].
Copyright © 1999 Society for Neuroscience 0270-6474/99/19219160-10$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
T. W. Gould, S. Yonemura, R. W. Oppenheim, S. Ohmori, and H. Enomoto
The Neurotrophic Effects of Glial Cell Line-Derived Neurotrophic Factor on Spinal Motoneurons Are Restricted to Fusimotor Subtypes
J. Neurosci.,
February 27, 2008;
28(9):
2131 - 2146.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Perez-Garcia, M. Gou-Fabregas, Y. de Pablo, M. Llovera, J. X. Comella, and R. M. Soler
Neuroprotection by Neurotrophic Factors and Membrane Depolarization Is Regulated by Calmodulin Kinase IV
J. Biol. Chem.,
February 15, 2008;
283(7):
4133 - 4144.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Murata, M. Tsuboi, K. Hikita, and N. Kaneda
Protective Effects of Neurotrophic Factors on Tumor Necrosis Factor-related Apoptosis-inducing Ligand (TRAIL)-mediated Apoptosis of Murine Adrenal Chromaffin Cell Line tsAM5D
J. Biol. Chem.,
August 11, 2006;
281(32):
22503 - 22516.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Tosca, S. Crochet, P. Ferre, F. Foufelle, S. Tesseraud, and J. Dupont
AMP-activated protein kinase activation modulates progesterone secretion in granulosa cells from hen preovulatory follicles.
J. Endocrinol.,
July 1, 2006;
190(1):
85 - 97.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Jomary, J. Cullen, and S. E. Jones
Inactivation of the Akt Survival Pathway during Photoreceptor Apoptosis in the Retinal Degeneration Mouse.
Invest. Ophthalmol. Vis. Sci.,
April 1, 2006;
47(4):
1620 - 1629.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Y. Nakamura, A. Jeromin, G. Smith, H. Kurushima, H. Koga, Y. Nakabeppu, S. Wakabayashi, and J. Nabekura
Novel role of neuronal Ca2+ sensor-1 as a survival factor up-regulated in injured neurons
J. Cell Biol.,
March 27, 2006;
172(7):
1081 - 1091.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. D. Read, P. J. Goodfellow, E. R. Mardis, N. Novak, J. R. Armstrong, and R. L. Cagan
A Drosophila Model of Multiple Endocrine Neoplasia Type 2
Genetics,
November 1, 2005;
171(3):
1057 - 1081.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Mayorga, N. Bahi, M. Ballester, J. X. Comella, and D. Sanchis
Bcl-2 Is a Key Factor for Cardiac Fibroblast Resistance to Programmed Cell Death
J. Biol. Chem.,
August 13, 2004;
279(33):
34882 - 34889.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Veit, F. Genze, A. Menke, S. Hoeffert, T. M. Gress, P. Gierschik, and K. Giehl
Activation of Phosphatidylinositol 3-Kinase and Extracellular Signal-Regulated Kinase Is Required for Glial Cell Line-Derived Neurotrophic Factor-Induced Migration and Invasion of Pancreatic Carcinoma Cells
Cancer Res.,
August 1, 2004;
64(15):
5291 - 5300.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Perez-Garcia, V. Cena, Y. de Pablo, M. Llovera, J. X. Comella, and R. M. Soler
Glial Cell Line-derived Neurotrophic Factor Increases Intracellular Calcium Concentration: ROLE OF CALCIUM/CALMODULIN IN THE ACTIVATION OF THE PHOSPHATIDYLINOSITOL 3-KINASE PATHWAY
J. Biol. Chem.,
February 13, 2004;
279(7):
6132 - 6142.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Sakurai, T. Nagata, K. Abe, T. Horinouchi, Y. Itoyama, and K. Tabayashi
Survival and death-promoting events after transient spinal cord ischemia in rabbits: Induction of Akt and caspase3 in motor neurons
J. Thorac. Cardiovasc. Surg.,
February 1, 2003;
125(2):
370 - 377.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Martin-Caraballo and S. E. Dryer
Glial Cell Line-Derived Neurotrophic Factor and Target-Dependent Regulation of Large-Conductance KCa Channels in Developing Chick Lumbar Motoneurons
J. Neurosci.,
December 1, 2002;
22(23):
10201 - 10208.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Nakazawa, M. Tamai, and N. Mori
Brain-Derived Neurotrophic Factor Prevents Axotomized Retinal Ganglion Cell Death through MAPK and PI3K Signaling Pathways
Invest. Ophthalmol. Vis. Sci.,
October 1, 2002;
43(10):
3319 - 3326.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. P. Rakowicz, C. S. Staples, J. Milbrandt, J. E. Brunstrom, and E. M. Johnson Jr
Glial Cell Line-Derived Neurotrophic Factor Promotes the Survival of Early Postnatal Spinal Motor Neurons in the Lateral and Medial Motor Columns in Slice Culture
J. Neurosci.,
May 15, 2002;
22(10):
3953 - 3962.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-Y. Wang, F. Yang, X.-P. He, H.-S. Je, J.-Z. Zhou, K. Eckermann, D. Kawamura, L. Feng, L. Shen, and B. Lu
Regulation of Neuromuscular Synapse Development by Glial Cell Line-derived Neurotrophic Factor and Neurturin
J. Biol. Chem.,
March 15, 2002;
277(12):
10614 - 10625.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. E. Fisher, L. Michael, M. W. Barnett, and J. A. Davies
Erk MAP kinase regulates branching morphogenesis in the developing mouse kidney
Development,
November 1, 2001;
128(21):
4329 - 4338.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. L. Johnson and J. T. Bridgham
Regulation of Steroidogenic Acute Regulatory Protein and Luteinizing Hormone Receptor Messenger Ribonucleic Acid in Hen Granulosa Cells
Endocrinology,
July 1, 2001;
142(7):
3116 - 3124.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Nicole, C. Ali, F. Docagne, L. Plawinski, E. T. MacKenzie, D. Vivien, and A. Buisson
Neuroprotection Mediated by Glial Cell Line-Derived Neurotrophic Factor: Involvement of a Reduction of NMDA-Induced Calcium Influx by the Mitogen-Activated Protein Kinase Pathway
J. Neurosci.,
May 1, 2001;
21(9):
3024 - 3033.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A.L. Johnson, J.T. Bridgham, and J.A. Swenson
Activation of the Akt/Protein Kinase B Signaling Pathway Is Associated with Granulosa Cell Survival
Biol Reprod,
May 1, 2001;
64(5):
1566 - 1574.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
M. Encinas, M. G. Tansey, B. A. Tsui-Pierchala, J. X. Comella, J. Milbrandt, and E. M. Johnson Jr
c-Src Is Required for Glial Cell Line-Derived Neurotrophic Factor (GDNF) Family Ligand-Mediated Neuronal Survival via a Phosphatidylinositol-3 Kinase (PI-3K)-Dependent Pathway
J. Neurosci.,
March 1, 2001;
21(5):
1464 - 1472.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. R Hansford and L. M Mulligan
Multiple endocrine neoplasia type 2 and RET: from neoplasia to neurogenesis
J. Med. Genet.,
November 1, 2000;
37(11):
817 - 827.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
K. L. Jin, X. O. Mao, and D. A. Greenberg
Vascular endothelial growth factor: Direct neuroprotective effect in in vitro ischemia
PNAS,
August 29, 2000;
97(18):
10242 - 10247.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Garces, G. Haase, M. S. Airaksinen, J. Livet, P. Filippi, and O. deLapeyriere
GFRalpha 1 Is Required for Development of Distinct Subpopulations of Motoneuron
J. Neurosci.,
July 1, 2000;
20(13):
4992 - 5000.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. W. Oppenheim, L. J. Houenou, A. S. Parsadanian, D. Prevette, W. D. Snider, and L. Shen
Glial Cell Line-Derived Neurotrophic Factor and Developing Mammalian Motoneurons: Regulation of Programmed Cell Death Among Motoneuron Subtypes
J. Neurosci.,
July 1, 2000;
20(13):
5001 - 5011.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Mograbi, R. Bocciardi, I. Bourget, R. Busca, N. Rochet, D. Farahi-Far, T. Juhel, and B. Rossi
Glial Cell Line-derived Neurotrophic Factor-stimulated Phosphatidylinositol 3-Kinase and Akt Activities Exert Opposing Effects on the ERK Pathway. IMPORTANCE FOR THE RESCUE OF NEUROECTODERMIC CELLS
J. Biol. Chem.,
November 21, 2001;
276(48):
45307 - 45319.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|