 |
Previous Article | Next Article 
The Journal of Neuroscience, 1999, 19:RC36:1-8
RAPID COMMUNICATION
Molecular Mechanisms of Long-Term Potentiation in the Insular
Cortex In Vivo
Matthew W.
Jones,
Pim J.
French,
T. V. P.
Bliss, and
Kobi
Rosenblum
Division of Neurophysiology, National Institute for Medical
Research, London NW7 1AA, United Kingdom
 |
ABSTRACT |
We have investigated molecular mechanisms of synaptic plasticity in
the pathway between two forebrain structures important for taste
learning, the basolateral amygdala (BLA) and the insular cortex. We
report here that in vivo long-term potentiation (LTP) induced by BLA stimulation requires functional NMDA receptors and is modulated by muscarinic acetylcholine receptors. In addition, LTP results in the activation of cortical extracellular regulated kinase 1/2 (ERK1/2) and is blocked by inhibitors of ERK1/2 activation. Previous findings demonstrated the involvement of the same molecular mechanisms in the same cortical area during novel taste learning. The
results demonstrate that both synaptic and behavioral plasticity share
common molecular mechanisms in the insular cortex.
Key words:
long-term potentiation; basolateral amygdala; insular
cortex; muscarinic acetylcholine receptors; extracellular-regulated
kinases; ERK1/2; mitogen-activated protein kinase; immediate early
gene
 |
INTRODUCTION |
Many
studies of the biological basis of memory have attempted to link
neurophysiological phenomena such as long-term potentiation (LTP) with
experimentally defined behaviors. LTP is an attractive model for the
cellular basis of learning and memory: activity-dependent, sustained
increases in synaptic efficacy hold clear parallels with changes in
behavior after salient learning events (Bliss and Collingridge, 1993 ).
LTP was first described in the hippocampus, a structure that has been
implicated in various forms of learning and memory. The rodent
hippocampus has most notably been linked with learning related to
spatial information (Morris et al., 1986 ), but its specific role
remains controversial. Similarly, although molecular mechanisms of
synaptic plasticity in the hippocampus have been studied extensively,
it is becoming evident that different mechanisms subserve different
phases of LTP in different subregions (Bliss and Collingridge, 1993 ).
We hoped to limit such complications by studying LTP and its molecular
substrates in the insular cortex, a region clearly involved in well
defined taste learning paradigms such as conditioned taste aversion
(CTA; Garcia et al., 1955 ).
Rodents rely heavily on their chemical senses, making taste learning in
the rat a natural and robust behavior useful for study of the
anatomical, physiological, and molecular substrates of learning. The
neuroanatomical structures involved in receiving and processing taste
information include the brainstem, the pons, the thalamus, and two
forebrain areas: the amygdala and the central gustatory area, which
resides in the insular cortex (IC; Fig. 1a). Quantified
behavioral paradigms of novel taste learning (e.g., CTA and latent
inhibition of CTA) enable the study of molecular mechanisms of learning
and memory in the above brain areas (Berman et al., 1998 ). Furthermore,
it was reported recently that high-frequency stimulation of the
basolateral amygdala (BLA) induces LTP at synapses in the IC
(Escobar et al., 1998 ), a pathway involved in well defined-taste learning paradigms (Yamamoto et al., 1984 ).
A range of molecular changes have been described in the IC after novel
taste learning. These include tyrosine phosphorylation of the 2B
subunit of the NMDA receptor (Rosenblum et al., 1995 ), release of
acetylcholine (Shimura et al., 1995 ), increased PKC activity (Yasoshima
and Yamamoto, 1997 ), and increased activation of extracellular
regulated kinase 1/2 (ERK1/2) (Berman et al., 1998 ). In addition, an
obligatory role for functional NMDA receptors, muscarinic acetylcholine
(mACh) receptors, activation of MAP/ERK kinase (MEK, the kinase
that specifically activates ERK1/2), and protein synthesis machinery
was reported (Rosenblum et al., 1993 ). To establish correlations with
these molecular substrates of learning, we have begun to dissect the
molecular events that underlie LTP in the pathway from basolateral
amygdala to insular cortex.
 |
MATERIALS AND METHODS |
Electrophysiology. All procedures were performed in
accordance with the UK Home Office Animals (Scientific Procedures) Act, 1986. Adult male Wistar rats (250-350 gm) were anesthetized with sodium pentobarbitone (initial dose, 60 mg/kg, i.p.; supplementary doses of 10 mg/kg as required) and mounted in a stereotaxic frame. Body
temperature was maintained at 37-38°C throughout. A concentric bipolar stimulating electrode was placed in the medial perforant path
(PP; 4-4.2 mm lateral of , 1.5-2.0 mm dorsal to pial surface) and
a recording micropipette in the hilus of the dentate gyrus (DG; 4 mm
caudal to bregma, 2.5 mm lateral, 3-3.5 mm dorsal). Once DG field
potentials had been maximized, the stimulating electrode was removed
from the PP (except in MK801-treated animals; see below) and
lowered into the BLA (3 mm caudal to bregma, 5 mm lateral, 7 mm
dorsal). Successful stimulation of this amygdaloid nucleus was
confirmed by evoking characteristic responses in the DG. A second
recording electrode was then placed in the rostral IC (1 mm rostral of
bregma, 5.5 mm lateral, 4.5 mm dorsal), with placement confirmed by
histology in initial experiments (data not shown).
The BLA was stimulated using 60 µsec current pulses of an amplitude
that evoked a 50% maximal response in the IC (60-100 µA; mean ± SD, 81 ± 4.6 µA). Test stimuli were delivered at
0.033 Hz, and tetanic stimulation of the BLA (six trains of 100 pulses at 100 Hz, 20 sec between trains) was delivered once a stable baseline
had been established. In some animals, the same number and intensity of
stimuli were given at 0.1 Hz to determine the effects of
nonpotentiating activity on gene expression. In animals treated with
MK801, the PP was tetanically stimulated (three trains of 50 pulses at
250 Hz, 30 sec between trains) 40 min after injection to confirm that
the drug was effective in blocking the induction of LTP in the
hippocampus. The 0.033 Hz stimulation was continued for 20-60 min,
according to the post-tetanic time point at which the brain was removed.
Drugs and delivery. MK801 (Tocris Cookson, Bristol, UK) and
atropine (Sigma, St. Louis, MO) were dissolved in water or water mixed
with a few drops of ethanol, respectively. PD98059 (Calbiochem, Nottingham, UK) was dissolved in 1:500 DMSO. An injection micropipette was placed 0.5 mm dorsal to the IC, and 1 µl injections of either 38 µM PD98059 (test hemisphere) or 0.2% DMSO (control
hemisphere) were made over 10 min. The injection pipette was then
removed and replaced by a recording micropipette.
In situ hybridization. One hour after tetanic stimulation of
the BLA, brains were removed, frozen on dry ice, and stored at 70°C. Fourteen-micrometer-thick sections were cut on a cryostat and
mounted on poly-L-lysine-coated glass slides and
stored at 70°C. In situ hybridization was performed
essentially as described by Wisden et al. (1990) . Briefly, sections
were thawed at room temperature, fixed in 4% paraformaldehyde,
actetylated in 1.4% triethanolamine and 0.25% acetic anhydride,
dehydrated through graded ethanol solutions, and delipidated in
chloroform. Sections were hybridized overnight at 42°C in 100 µl of
buffer containing 50% formamide, 4× SSC (150 mM
sodium chloride and 15 mM sodium citrate), 10%
dextran sulfate, 5× Denhardt's solution, 200 µg/ml acid- and
alkali-cleaved salmon testis DNA, 100 µg/ml long-chain polyadenylic acid, 25 mM sodium phosphate, pH
7.0, 1 mM sodium pyrophosphate, and 100,000 cpm
radiolabeled probe (~1 ng/ml) under Parafilm coverslips. Sections
were washed in 1× SSC at room temperature, 1× SSC at 55°C (30 min),
and 0.1× SSC at room temperature (5 min) and dehydrated in 70 and 95%
ethanol. Sections were then exposed to autoradiographic film.
35S-ATP end-labeled probes (New England
Nuclear, Boston, MA) were generated using terminal deoxynucleotidyl
transferase (Promega, Madison, WI) according to manufacturer's
instructions (Promega) and purified over Sephadex G50 columns
(Promega). A 50-fold excess of unlabeled oligonucleotide was used as a
negative control. Autoradiographs were analyzed by measuring the
integrated density relative to a C14
standard using the NIH Image program. Oligonucleotides of unique sequence were supplied by Oswel (Southampton, UK). Probe sequences were
zif268, CCGTGGCTCAGCAGCATCATCTCCTCCAGTTTGGGGTAGTTGTCC,
complementary to nucleotides spanning amino acids 2-16 (Milbrandt,
1987 ); c-Fos, GCAGCGGGAGGATGACGCCTCGTGTCCGCGTTGAAACCCGAGAA, complementary to nucleotides spanning amino acids 1-15 (Morgan et al., 1987 ); except in
the experiment using PD98059, in which the virtually identical oligonucleotide against murine cFos was used; the
specificity of this oligonucleotide was determined by competing with
excess unlabeled rat c-Fos oligonucleotide; Arc,
GTTCTTCACCGAGCCCTGTTTGAACTCCCACCACTTCTTGGCTGG, complementary to
nucleotides spanning amino acids 249-263 (Lyford et al.,
1995 ); and Homer,
GTCAGTTCCATCTTCTCCTGCGACTTCTCCTTTGCCAG, complementary to
nucleotides spanning amino acids 111-123 (Brakeman et al., 1997 ; Kato
et al., 1998 ).
Homogenization. Thirty minutes after tetanic stimulation,
rats were decapitated, and the insular cortex was excised on ice (the
crossing of the rhinal fissure and the middle cerebral artery was used
as a reference point). The samples were immediately homogenized in a
glass-Teflon homogenizer in 300 ml of SDS sample buffer (10% glycerol,
5% -mercaptoethanol, and 2.3% SDS, in 62.5 mM
Tris-Hcl, pH 6.8) and boiled for 5 min. Samples were stored at 20°C
until further use.
Western blot analysis. Similar amounts of protein (Lowry
method) in SDS-sample buffer were separated by SDS-PAGE (10%
polyacrylamide; see Laemmli,1970 ) and identified by Western blot
analysis. After separation, the blots were blocked with 1% BSA
for 1 hr at room temperature. The blots were reacted either overnight
in a cold room or for 1 hr at room temperature with primary antibody.
After three short washes the blots were subsequently incubated for 1 hr
at room temperature with HRP-linked protein A or HRP-conjugated protein
G (Chemicon, Temecula, CA). The blots than were exposed to ECL
substrate and film (Amersham, Arlington Heights, IL). The antibodies
used were dpERK (Promega; 1:30,000; New England Biolabs, Beverly, MA;
1:5000), ERK1/2 (New England Biolabs; 1:2000), and ERKII (Santa Cruz
Biotechnology, Santa Cruz, CA; 1:4000). Quantification was performed
using a computerized densitometer and image analyzer (Molecular
Dynamics, Sunnyvale, CA).
Statistics. Mean ± SEM values are given throughout.
For LTP experiments, drug effects on the level of potentiation in
different groups of animals were compared using an unpaired Student's
t test, comparing mean values over the period indicated. A
t test was also used to compare densitometric Western blot
analyses. Effects were considered significant at p < 0.05.
 |
RESULTS |
Single-pulse stimulation of the BLA evoked characteristic
positive-going field potentials in the DG and IC (Fig.
1b). The DG responses were
biphasic at maximal stimulation intensities, with early and late
components. The early component was not elicited by the test stimulus
intensities used for LTP experiments; the late component had a latency
of 20 ± 1.1 msec to peak and amplitude of 6.7 ± 0.89 mV at
test intensity (measured during the 10 min period before the tetanus;
n = 4). This late component of the BLA DG response
reversed polarity when the recording electrode was raised to the
synaptic layer of the DG (data not shown). The BLA IC evoked
potential (EP) was monophasic (mean amplitude, 0.97 ± 0.06 mV;
mean latency to peak, 12 ± 0.5 msec over 10 min before tetanus;
n = 8) and did not show clear reversal. Neither DG nor IC responses exhibited a population spike at any stimulation intensity tested. EEG was monitored throughout, and no sign of seizure was observed during any of the protocols used.

View larger version (16K):
[in this window]
[in a new window]
|
Figure 1.
Anatomy and physiology of projections to and from
the basolateral amygdala. a, Arrows
indicate how three cranial nerves carry taste information from the oral
cavity to the nucleus tractus solitaruis (NTS) in the
brainstem. From there, the information flows to the parabrachial
nucleus (PBN) of the pons, specific regions of
the thalamus (Th), and forebrain areas including the
amygdala and the IC. We have studied connections from the BLA, to the
dentate gyrus of the hippocampal formation (HF),
and to the IC. Field potentials were evoked in the dentate gyrus by stimulation of the PP. The crossing of the rhinal
fissure (RF) and middle cerebral artery was used
as a guide for dissection of the IC. b, Characteristic
field potentials recorded in the hilus of the dentate gyrus during
single-pulse stimulation of the medial perforant path
(PP DG; 80 µA, 60 µsec) or
basolateral amygdala (BLA DG; 150 µA,
60 µsec). These responses were used to establish the correct position
of the BLA-stimulating electrode so that a second recording electrode
could be used to record the field potential evoked in the insular
cortex by BLA stimulation (BLA IC; 80 µA, 60 µsec). c, Stimulus-response curves for EP1,
the field potential evoked in the IC by stimulation of the BLA
(n = 3). Sixty microsecond stimulus pulses of
increasing current were given at 10 sec intervals, evoking responses of
increasing slope and amplitude. The arrow on the
horizontal axis marks mean test intensity used for LTP
experiments.
|
|
As shown in Figure 2, a and
b, tetanic stimulation of the BLA induced a stable
potentiation of the BLA IC response (slope increased by 43 ± 5% and amplitude by 46 ± 1% of control, comparing mean
measurement made 50-60 min after tetanus with mean baseline responses
in the 10 min before the tetanus). BLA IC responses were not affected
under these conditions, remaining within 7 ± 5% of control
levels. Block of either NMDA receptors or mACh receptors in the insular
cortex significantly attenuates novel taste learning in the rat (Naor
and Dudai,1996 ; Rosenblum et al., 1997 ). We therefore tested the
dependency of this form of cortical LTP on the same two receptors.
Induction of LTPBLA IC was blocked (responses remained within 2 ± 1% of control 10-30 min after tetanus;
p < 0.05) by the irreversible NMDA receptor channel
blocker MK801 (Fig. 2b), administered systemically 60 min
before tetanic stimulation at a dose (1 mg/kg, i.p.) shown in the same
animals to block induction of LTPPP DG in the
hippocampus (where PP DG EPSP slope remained within 6 ± 1% of
control 5-10 min after tetanus). LTPBLA IC was
also significantly attenuated (slope only increased by 32 ± 1%
of control 10-40 min after tetanus; p < 0.05) by the
muscarinic ACh receptor antagonist atropine (60 mg/kg, i.p., 40 min
before tetanus), although unlike the NMDA receptor antagonist, this
dose of atropine clearly did not completely block
LTPBLA IC (Fig. 2c). Neither MK801
nor atropine affected test responses, which maintained a mean
pretetanus amplitude of 1.1 ± 0.04 and 0.88 ± 0.06 mV,
respectively, at these doses (compared with the control response
amplitude of 0.97 ± 0.06 mV, values given as mean for 5 min
before tetanus). This suggests that BLA IC low-frequency synaptic
transmission was not affected by systemic administration of these
antagonists.

View larger version (41K):
[in this window]
[in a new window]
|
Figure 2.
Long-term potentiation induced by tetanic
stimulation of the BLA. a, Test responses were evoked 1 per 30 sec at a test intensity that elicited a half-maximal EP1 slope.
Once responses had stabilized, six trains of 100 test intensity pulses
at 100 Hz, 20 sec between trains, were delivered to the BLA
(arrowhead, time 0), and responses were followed for up
to 60 min. Percent changes in BLA IC slope are plotted
(n = 8). Representative responses taken 10 min
before ( 10min) and 40 min after (40min)
the tetanus are also shown Calibration: 1 mV, 5 msec. b,
c, LTP was completely blocked by systemic MK801
(b) (1 mg/kg, i.p., injected 60 min before
tetanus) and significantly attenuated by atropine
(c) (60 mg/kg, i.p., 40 min before tetanus;
p < 0.05 10-40 min after tetanus).
|
|
Because both ACh receptor and NMDA receptor activation induce ERK1/2
activation in primary cortical cultures (K. Rosenblum and M. Futter,
unpublished data), and ERK1/2 activation is correlated with novel
taste learning in the insular cortex (Rosenblum et al., 1995 ), we next
investigated the involvement of the enzymes ERK1/2 in this form of LTP.
ERK1/2 belong to the mitogen-associated protein kinase (MAPK) family of
serine/threonine kinases and are highly expressed in the mature CNS
(Fukunaga and Miyamoto, 1998 ). MAPKs take part in transmembrane
signaling cascades, conveying information from extracellular receptor
proteins to cytoplasm and nucleus. MAPKs are well established as
playing a crucial role in differentiation, proliferation, and
development and have recently been implicated in learning and
memory-related plasticity in different species (Orban et al., 1999 ).
ERK1/2 activation (via dual phosphorylation on Thr-201 and Tyr-203 by
MEK) is correlated with novel taste learning and has been reported to
underlie long-term but not short-term memory (Berman et al., 1998 ). We
tested the possibility that ERK1/2 are activated after
LTPBLA IC and that activation occurred with a
time course similar to that previously observed after learning (Berman
et al., 1998 ). Consistent with previous findings, 30 min after the
induction of LTPBLA IC there was a significant activation of ERK1/2 in the IC (1.7 ± 0.1-fold greater activation than in the unstimulated, contralateral IC) without change in the
amount of ERK1/2 protein expressed in this region (Fig.
3a). Using a specific
inhibitor of MAPK kinase (MEK), the upstream kinase required for ERK1/2
activation, we tested whether ERK1/2 activation was required for
LTPBLA IC. Microinjection of the specific MEK
inhibitor PD948059 (Alessi et al., 1995 ) into the IC 30 min before
tetanic stimulation of BLA blocked the induction of stable LTP.
Although some post-tetanic potentiation (to 128 ± 1.5% of
control 0-10 min after tetanus) was evident under these conditions,
responses were not significantly potentiated 30-40 min after the
tetanus (Fig. 3b). PD98059 had no effect on test response
amplitude (1.05 ± 0.15 mV compared with the control response amplitude of 0.97 ± 0.06 mV). These results parallel those
obtained in an in vivo study of LTP in the hippocampus,
in which we observed a block of LTP by PD98059 with a similar time
course (K. Rosenblum and M. W. Jones, unpublished data).

View larger version (36K):
[in this window]
[in a new window]
|
Figure 3.
ERK1/2 activation is correlated with and necessary
for LTPBLA IC. a, Thirty minutes after the
induction of LTP, the insular cortex was dissected out and processed
for SDS-PAGE and immunoblotting with antiphosphospecific antibodies
(Thr-201-Tyr-203) recognizing the activated form of ERK1/2 or with
anti ERKII recognizing the ERKII polypeptide. Blots were analyzed using
a densitometer, and the ratio between the signal on the potentiated
versus the control insular cortex was calculated. Significant increases
in ERK1/2 activation were observed in potentiated tissue
(n = 4; *p < 0.05). Sample
blots for ERKII (top) and dpERK1/2
(bottom) are shown on the left.
b, Microinjection of 1 µl of 38 µM
PD98059 0.5 mm above the insular cortex 30 min before tetanic
stimulation of the BLA (arrowhead, time 0; as for Fig.
1) prevents long-lasting potentiation of IC responses. The right
panel shows superimposed sample responses recorded 10 min
before (gray) and 40 min after
(black) tetanus in a control rat and a PD98059-injected
rat (top and bottom traces,
respectively). Calibration: 1 mV, 5 msec.
|
|
One hypothesis regarding the maintenance of long-term plasticity
suggests that modulation of gene expression is required to support
remodeling of synaptic efficacy and/or morphology (Frey et al., 1988 ).
Thus in biochemical terms, late-phase LTP, like long-term memory, can
be distinguished from earlier phases by a dependence on protein
synthesis. Because taste learning has itself been shown to be protein
synthesis-dependent (Rosenblum et al., 1993 ), and the MEK inhibitor
PD98059 specifically blocks long- but not short-term novel taste memory
(Berman et al., 1998 ), we tested the possibility that
LTPBLA IC is correlated with altered gene
expression. The genes studied were immediate early genes (IEGs) whose
induction is correlated with synaptic activity: Zif268, Fos,
Arc, and Homer. Zif 268 and Fos are transcription factors (Dragunow, 1996 ); Arc is associated with the cytoskeleton (Steward et al., 1998 ); and Homer binds metabotropic glutamate receptors (Brakeman et al., 1997 ).
In situ hybridization showed that the expression of Zif268,
Fos, Homer, and Arc mRNAs was markedly upregulated throughout the
majority of cortical areas, including IC, 1 hr after tetanic stimulation of the BLA (Fig. 4).
Low-frequency stimulation of the BLA (such that the total number of
stimuli delivered was identical to that required to induce potentiation
when given at 100 Hz) also increased IEG mRNA expression (data not
shown). Neither nonstimulated contralateral hemispheres nor any
subcortical area (e.g., caudate putamen) showed any clear change nor,
interestingly, did the cells of the hippocampal formation, despite the
sizeable responses evoked here by BLA stimulation. It is possible that
the expression of different genes is altered in these areas at time
points other than 1 hr after BLA stimulation. If so, later time points
would seem more likely, because Zif268 upregulation in the
hippocampus is rapid and peaks 1 hr after tetanic stimulation of the
perforant path (Wisden et al., 1990 ). Whereas the NMDA receptor channel blocker MK801 completely blocked LTPBLA IC, it
did not block IEG upregulation, although the increase in expression was
clearly attenuated. The mACh receptor antagonist atropine had effects similar to those of MK801 on IEG expression, whereas it failed to block
LTP completely.

View larger version (63K):
[in this window]
[in a new window]
|
Figure 4.
High-frequency stimulation of the BLA induces
immediate early gene expression in the cortex. a, One
hour after tetanic stimulation of the BLA and confirmed induction of
LTP (see Fig. 2) in the insular cortex, brains were removed and frozen
on dry ice. Sections were taken from the area containing the insular
cortex or the hippocampus, and in situ hybridization was
performed with oligonucleotides specific to Zif268 and
Fos. As shown by the representative sections on the
left, levels of Zif268 and Fos mRNA expression were
increased in much of the cortex of the stimulated hemisphere but not in
the nonstimulated contralateral cortex. There was no increased
expression in the caudate putamen (CPU) or other noncortical areas. The
histogram represents the mean ratios obtained by dividing densitometric
measures from the same areas in the ipsilateral and contralateral
hemispheres (n = 3 or 4). In the animals treated
with MK801 or atropine (see Fig. 2c,d),
the increase in Zif268 and Fos mRNA expression was attenuated but not
abolished. b, mRNA expression of the immediate early
genes Arc and Homer was significantly
increased in the same regions 1 hr after tetanic stimulation of the
BLA. No induction of any of the mRNAs described above was observed in
the dentate gyrus of the hippocampus after BLA stimulation (data not
shown). *p < 0.05 for comparison between
hemispheres.
|
|
 |
DISCUSSION |
Taste-learning paradigms have recently been used to investigate
specific molecular mechanisms associated with learning in the rat. The
emerging picture points to the involvement of glutamatergic and
cholinergic neurotransmission (via NMDA and mACh receptors, respectively), the activation of tyrosine kinases and MAPK, and a
requirement for protein synthesis (Rosenblum et al., 1993 , 1997 ; Shimura et al., 1995 ). It is important to note that it is the combination of the percept itself, i.e., the taste, and its value, i.e., novelty, that induces the correlative molecular changes observed.
These changes occurred specifically in the insular cortex, the central
gustatory area (Braun et al., 1982 ). Here we show that NMDA receptors,
mACh receptors, and members of the MAPK family ERK1/2 also subserve
synaptic plasticity in the same neocortical area.
Lesion studies confirm a role for the IC and its connections to the BLA
in taste learning (Bermudez-Rattoni and McGaugh, 1991 ) (see Fig. 1).
Retrograde labeling with horseradish peroxidase suggests direct and
reciprocal BLA-IC connections (Ottersen, 1982 ). Single-unit recording
in the IC reveals neurons with a range of response latencies after
electrical stimulation of the BLA (Yamamoto et al., 1984 ). Single-pulse
stimulation of the BLA evokes reproducible, positive-going field
potentials in the IC (Fig. 1b). Although not definitive, the
latency of these responses is consistent with a monosynaptic
connection, as is the block of LTPBLA IC by local injection of PD98059 (Fig. 3b).
We confirm the observations of Escobar et al. (1998) that tetanic
stimulation of the BLA results in a long-lasting enhancement of IC
responses. This potentiation is maintained for at least 1 hr (Fig.
2a) but could be followed for up to 3 hr without decrement (data not shown). LTPBLA IC shares properties
with LTP in the hippocampus and other cortical regions, including rapid
induction by 100 Hz stimulation, persistence, and NMDA receptor
dependence (Bliss and Lømo 1973 ; Jay et al., 1995 ),
although this is in contrast to some reports of slowly developing LTP
in the cortex in vivo (Trepel and Racine, 1998 ). Responses
evoked in the DG by BLA stimulation have been characterized previously
(Ikegaya et al., 1996 ). Stimulation of the amygdala (including the BLA)
has also been shown to affect LTPPP DG, a
possible mechanism for modulation of hippocampal-dependent learning
(Ikegaya et al., 1995 , 1997 ). This may point to a more general role of
the amygdala in signaling novelty or salience (Dunn and Everitt,
1988 ).
Cholinergic transmission at the mACh receptor has been implicated in
learning and memory in humans and other mammals (Levey, 1996 ; Mesulam,
1998 ), particularly with respect to the encoding of salient input
(Acquas et al., 1996 ). In vitro studies have shown that mACh
receptors can modulate, or even induce, synaptic plasticity in the CA1
region of the hippocampus (Blitzer et al., 1990 ; Auerbach and Segal,
1994 ); it is not known whether this occurs in the hippocampus in
vivo. Our results show that the mACh receptor antagonist atropine
attenuates LTPBLA IC (Fig. 2d). This
is the first demonstration of cholinergic modulation of LTP in the
neocortex in vivo. NMDA and mACh receptors, both shown here
to be important for LTPBLA IC, can activate
ERK1/2 in primary cortical culture (Rosenblum and Futter, unpublished
data). Indeed, LTPBLA IC is associated with
ERK1/2 activation (Fig. 3). Thus ERK1/2 could serve as a detector for
coincident activation of mACh receptors and glutamate receptors.
In this paper we demonstrate a necessary role for ERK activation in
neocortical LTP in vivo (Fig. 3). We have also found that LTP in the DG of the hippocampus in vivo is dependent on
ERK1/2 (our unpublished data). It has been suggested that MAPK
is likely to play a fundamental role in memory consolidation (Blum et
al., 1999 ; Impey et al., 1999 ). However, the time scales of the
activation of ERK1/2 and the effects of PD98059 in both the neocortex
in vivo (Fig. 3b) and in the hippocampus in
vivo and in vitro (English and Sweatt, 1997 ;
Atkins et al., 1998 ) suggest an action on the early phase(s) of LTP.
Given the range of potential cytosolic and nuclear effects of ERK,
including the modulation of gene transcription in neurons via the
proteins cAMP response element-binding protein and RSK (Impey et
al., 1999 ; Roberson et al., 1999 ), it seems reasonable to
suppose that ERK1/2 may also have a role to play in the late, protein
synthesis-dependent phase of LTP.
Immediate early genes are potential targets for the modulatory activity
of ERK. One such gene is the transcription factor Zif268, which shows
expression correlated with NMDA receptor-mediated LTP but not with
low-frequency activity, in the DG (Cole et al., 1989 ; Wisden et al.,
1990 ). In the DG, stimulation of the perforant path leads to
upregulation of mRNA for Zif268 only if the stimulation induces LTP; in
contrast, stimulation of the BLA, whether it leads to LTP, can
upregulate Zif268 message. As with Zif268, strong activation
of Fos, Arc, and Homer mRNA expression
was observed throughout most of the ipsilateral cerebral cortex after
high-frequency stimulation of the BLA (Fig. 4). Again, this activation
was not correlated simply with the degree of resulting potentiation,
because the NMDA receptor antagonist MK801 only attenuated the
increased mRNA expression but completely blocked LTP; moreover,
low-frequency stimulation also induced increased transcription. It
remains unclear how and why different activity in different brain areas
is correlated with IEG expression. However, the extent to which BLA
stimulation influences cortical IEG expression may reflect the
importance of the amygdala in modulating neocortical function.
We demonstrate here that LTP shares some of the same molecular
mechanisms as learning in the mature neocortex. The physiological role
of LTP in learning and memory remains to be fully established, but in
view of the observation that an LTP-like phenomenon is detected in the
amygdala after fear conditioning (Rogan et al., 1997 ), it will be
interesting to explore the possibility that novel taste learning
induces changes in the strength of connections between the basolateral
amygdala and the insular cortex.
 |
FOOTNOTES |
Received July 9, 1999; revised Aug. 18, 1999; accepted Aug. 28, 1999.
K.R. thanks the European Molecular Biology Organization and The Royal
Society for support.
Correspondence should be addressed to Kobi Rosenblum, Division of
Neurophysiology, National Institute for Medical Research, The Ridgeway,
Mill Hill, London NW7 1AA, UK. E-mail: krosenb{at}nimr.mrc.ac.uk.
This article is published in
The Journal of Neuroscience, Rapid Communications Section,
which publishes brief, peer-reviewed papers online, not in print. Rapid
Communications are posted online approximately one month earlier than
they would appear if printed. They are listed in the Table of Contents
of the next open issue of JNeurosci. Cite this article as:
JNeurosci, 1999, 19:RC36 (1-8). The
publication date is the date of posting online at
www.jneurosci.org.
 |
REFERENCES |
-
Acquas E,
Wilson C,
Fibiger HC
(1996)
Conditioned and unconditioned stimuli increase frontal cortical and hippocampal acetylcholine release: effects of novelty, habituation, and fear.
J Neurosci
16:3089-3096.
-
Alessi DR,
Cuenda A,
Cohen P,
Dudley DT,
Saltiel AR
(1995)
PD 098059 is a specific inhibitor of the activation of mitogen-activated protein kinase kinase in vitro and in vivo.
J Biol Chem
270:27489-27494.
-
Atkins CM,
Selcher JC,
Petraitis JJ,
Trzaskos JM,
Sweatt JD
(1998)
The MAPK cascade is required for mammalian associative learning.
Nat Neurosci
1:602-609.
-
Auerbach JM,
Segal M
(1994)
A novel cholinergic induction of long-term potentiation in rat hippocampus.
J Neurophysiol
72:2034-2040.
-
Berman DE,
Hazvi S,
Rosenblum K,
Seger R,
Dudai Y
(1998)
Specific and differential activation of mitogen-activated protein kinase cascades by unfamiliar taste in the insular cortex of the behaving rat.
J Neurosci
18:10037-10044.
-
Bermudez-Rattoni F,
McGaugh JL
(1991)
Insular cortex and amygdala lesions differentially affect acquisition on inhibitory avoidance and conditioned taste aversion.
Brain Res
549:165-170.
-
Bliss TVP,
Collingridge GL
(1993)
A synaptic model of memory: long-term potentiation in the hippocampus.
Nature
361:31-39.
-
Bliss TV,
Lomo T
(1973)
Long-lasting potentiation of synaptic transmission in the dentate area of the anaesthetized rabbit following stimulation of the perforant path.
J Physiol (Lond)
232:331-356.
-
Blitzer RD,
Gil O,
Landau EM
(1990)
Cholinergic stimulation enhances long-term potentiation in the CA1 region of rat hippocampus.
Neurosci Lett
119:207-210.
-
Blum S,
Moore AN,
Adams F,
Dash PK
(1999)
A mitogen-activated protein kinase cascade in the CA1/CA2 subfield of the dorsal hippocampus is essential for long-term spatial memory.
J Neurosci
19:3535-3544.
-
Brakeman PR,
Lanahan AA,
O'Brien R,
Roche K,
Barnes CA,
Huganir RL,
Worley PF
(1997)
Homer: a protein that selectively binds metabotropic glutamate receptors.
Nature
386:284-288.
-
Braun JJ,
Lasiter PS,
Kiefer SW
(1982)
The gustatory neocortex of the rat.
Physiol Psychol
10:13-45.
-
Cole AJ,
Saffen DW,
Baraban JM,
Worley PF
(1989)
Rapid increase of an immediate early gene messenger RNA in hippocampal neurons by synaptic NMDA receptor activation.
Nature
340:474-476.
-
Dragunow M
(1996)
A role for immediate-early transcription factors in learning and memory.
Behav Genet
26:293-299.
-
Dunn LT,
Everitt BJ
(1988)
Double dissociations of the effects of amygdala and insular cortex lesions on conditioned taste aversion, passive avoidance and neophobia in the rat using the excitotoxin ibotenic acid.
Behav Neurosci
102:3-23.
-
English JD,
Sweatt JD
(1997)
A requirement for the mitogen-activated protein kinase cascade in hippocampal long term potentiation.
J Biol Chem
272:19103-19106.
-
Escobar ML,
Chao V,
Bermudez-Rattoni F
(1998)
In vivo long-term potentiation in the insular cortex: NMDA receptor dependence.
Brain Res
779:314-319.
-
Frey U,
Krug M,
Reymann KG,
Matthies H
(1988)
Anisomycin, an inhibitor of protein-synthesis, blocks late phases of ltp phenomena in the hippocampal ca1 region in vitro.
Brain Res
452:57-65.
-
Fukunaga K,
Miyamoto E
(1998)
Role of MAP kinase in neurons.
Mol Neurobiol
16:79-95.
-
Garcia J,
Kimmeldorf DJ,
Koelling RA
(1955)
Conditioned aversion to saccharin resulting from exposure to gamma radiation.
Science
122:157-158.
-
Ikegaya Y,
Saito H,
Abe K
(1995)
High-frequency stimulation of the basolateral amygdala facilitates the induction of long-term potentiation in the dentate gyrus in-vivo.
Neurosci Res
22:203-207.
-
Ikegaya Y,
Saito H,
Abe K
(1996)
Dentate gyrus field potentials evoked by stimulation of the basolateral amygdaloid nucleus in anesthetized rats.
Brain Res
718:53-60.
-
Ikegaya Y,
Nakanishi K,
Saito H,
Abe K
(1997)
Amygdala beta-noradrenergic influence on hippocampal long-term potentiation in vivo.
NeuroReport
8:3143-3146.
-
Impey S,
Obrietan K,
Storm DR
(1999)
Making new connections: role of ERK/MAP kinase signalling in neuronal plasticity.
Neuron
23:11-14.
-
Jay TM,
Burette F,
Laroche S
(1995)
NMDA receptor-dependent long-term potentiation in the hippocampal afferent fibre system to the prefrontal cortex in the rat.
Eur J Neurosci
7:247-250.
-
Kato A,
Ozawa F,
Saitoh Y,
Fukazawa Y,
Sugiyama H,
Inokuchi K
(1998)
Novel members of the Vesl/Homer family of PDZ proteins that bind metabotropic glutamate receptors.
J Biol Chem
273:23969-23975.
-
Laemmli UK
(1970)
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:680-685.
-
Levey AI
(1996)
Muscarinic acetylcholine receptor expression in memory circuits: implications for treatment of Alzheimer disease.
Proc Natl Acad Sci USA
93:13541-13546.
-
Lyford GL,
Yamagata K,
Kaufmann WE,
Barnes CA,
Sanders LK,
Copeland NG,
Gilbert DJ,
Jankins NA,
Lanahan AA,
Worley PF
(1995)
Arc, a growth factor and activity-regulated gene, encodes a novel cytoskeleton-associated protein that is enriched in neuronal dendrites.
Neuron
14:433-445.
-
Mesulam MM
(1998)
Some cholinergic themes related to Alzheimer's disease: synaptology of the nucleus basalis, location of m2 receptors, interactions with amyloid metabolism, and perturbations of cortical plasticity.
J Physiol (Paris)
92:293-298.
-
Milbrandt J
(1987)
A nerve growth factor induced gene encodes a possible transcriptional regulatory factor.
Science
238:797-799.
-
Morgan JI,
Cohen DR,
Hempstaed JL,
Curran T
(1987)
Mapping patterns of c-fos expression in the central nervous system after seizure.
Science
237:192-197.
-
Morris RGM,
Anderson E,
Lynch GS,
Baudry M
(1986)
Selective impairment of learning and blockade of long-term potentiation by an N-methyl-D-aspartate receptor antagonist, AP5.
Nature
319:774-776.
-
Naor C,
Dudai Y
(1996)
Transient impairment of cholinergic function in the rat insular cortex disrupts the encoding of taste in conditioned taste aversion.
Behav Brain Res
79:61-67.
-
Orban PC,
Chapman PF,
Brambilla R
(1999)
Is the Ras-MAPK signalling pathway necessary for long-term memory formation?
Trends Neurosci
22:38-44.
-
Ottersen OP
(1982)
Connections of the amygdala of the rat IV: cortico-amygdaloid and intra-amygdaloid connections as studied with axonal-transport of horseradish-peroxidase.
J Comp Neurol
205:30-48.
-
Roberson ED,
English JD,
Adams JP,
Selcher JC,
Kondratick C,
Sweatt JD
(1999)
The mitogen-activated protein kinase cascade couples PKA and PKC to cAMP response element binding protein phosphorylation in area CA1 of hippocampus.
J Neurosci
19:4337-4348
-
Rogan MT,
Staubli UV,
LeDoux JE
(1997)
Fear conditioning induces associative long-term potentiation in the amygdala.
Nature
390:604-607.
-
Rosenblum K,
Meiri N,
Dudai Y
(1993)
Taste memory
the role of protein-synthesis in gustatory cortex.
Behav Neural Biol
59:49-56. -
Rosenblum K,
Schul R,
Meiri N,
Hadari YR,
Zick Y,
Dudai Y
(1995)
Modulation of protein tyrosine phosphorylation in rat insular cortex after conditioned taste aversion training.
Proc Natl Acad Sci USA
92:1157-1161.
-
Rosenblum K,
Berman DE,
Hazvi S,
Lamprecht R,
Dudai Y
(1997)
NMDA receptor and the tyrosine phosphorylation of its 2B subunit in taste learning in the rat insular cortex.
J Neurosci
17:5129-5135.
-
Shimura T,
Suzuki M,
Yamamoto T
(1995)
Aversive taste stimuli facilitate extracellular acetylcholine-release in the insular gustatory cortex of the rat
a microdialysis study.
Brain Res
679:221-226. -
Steward O,
Wallace CS,
Lyford GL,
Worley PF
(1998)
Synaptic activation causes the mRNA for the IEG Arc to localise selectively near activated postsynaptic sites on dendrites.
Neuron
21:741-751.
-
Trepel C,
Racine RJ
(1998)
Long-term potentiation in the neocortex of the adult, freely moving rat.
Cereb Cortex
8:719-729.
-
Wisden W,
Errington ML,
Williams S,
Dunnett SB,
Waters C,
Hitchcock D,
Evan G,
Bliss TV,
Hunt SP
(1990)
Differential expression of immediate early genes in the hippocampus and spinal cord.
Neuron
4:603-604.
-
Yamamoto T,
Azuma S,
Kawamura Y
(1984)
Functional relations between the cortical gustatory area and the amygdala
electrophysiological and behavioral-studies in rats.
Exp Brain Res
56:23-31. -
Yasoshima Y,
Yamamoto T
(1997)
Rat gustatory memory requires protein kinase C activity in the amygdala and cortical gustatory area.
NeuroReport
8:1363-1367.
Copyright © 0000 Society for Neuroscience 0270-6474/0/$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
C. M. Alberini
Transcription Factors in Long-Term Memory and Synaptic Plasticity
Physiol Rev,
January 1, 2009;
89(1):
121 - 145.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. W.F. Shum, L.-J. Wu, M.-G. Zhao, H. Toyoda, H. Xu, M. Ren, R. Pinaud, S. W. Ko, Y.-S. Lee, B.-K. Kaang, et al.
Alteration of cingulate long-term plasticity and behavioral sensitization to inflammation by environmental enrichment
Learn. Mem.,
April 10, 2007;
14(4):
304 - 312.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. C. Selcher, E. J. Weeber, J. Christian, T. Nekrasova, G. E. Landreth, and J. D. Sweatt
A Role for ERK MAP Kinase in Physiologic Temporal Integration in Hippocampal Area CA1
Learn. Mem.,
January 1, 2003;
10(1):
26 - 39.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Vazdarjanova, B. L. McNaughton, C. A. Barnes, P. F. Worley, and J. F. Guzowski
Experience-Dependent Coincident Expression of the Effector Immediate-Early Genes Arc and Homer 1a in Hippocampal and Neocortical Neuronal Networks
J. Neurosci.,
December 1, 2002;
22(23):
10067 - 10071.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Rosenblum, M. Futter, K. Voss, M. Erent, P. A. Skehel, P. French, L. Obosi, M. W. Jones, and T. V. P. Bliss
The Role of Extracellular Regulated Kinases I/II in Late-Phase Long-Term Potentiation
J. Neurosci.,
July 1, 2002;
22(13):
5432 - 5441.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Roozendaal, D. J.-F. de Quervain, B. Ferry, B. Setlow, and J. L. McGaugh
Basolateral Amygdala-Nucleus Accumbens Interactions in Mediating Glucocorticoid Enhancement of Memory Consolidation
J. Neurosci.,
April 1, 2001;
21(7):
2518 - 2525.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. C. Selcher, T. Nekrasova, R. Paylor, G. E. Landreth, and J. D. Sweatt
Mice Lacking the ERK1 Isoform of MAP Kinase Are Unimpaired in Emotional Learning
Learn. Mem.,
January 1, 2001;
8(1):
11 - 19.
[Abstract]
[Full Text]
|
 |
|
|