 |
Previous Article | Next Article 
The Journal of Neuroscience, November 15, 1999, 19(22):10116-10124
Heat Stress and Protection from Permanent Acoustic Injury in
Mice
Naohiro
Yoshida1, 2, 3,
Arthur
Kristiansen1, 2, and
M. Charles
Liberman1, 2
1 Eaton-Peabody Laboratory, Massachusetts Eye and Ear
Infirmary, Boston, Massachusetts 02114, 2 Department of
Otology and Laryngology, Harvard Medical School, Boston, Massachusetts
02114, and 3 Department of Otolaryngology, Tohoku
University, Graduate School of Medicine, Sendai, 980-8574 Japan
 |
ABSTRACT |
The inner ear can be permanently damaged by overexposure to
high-level noise; however, damage can be decreased by previous exposure
to moderate level, nontraumatic noise (Canlon et al., 1988 ). The
mechanism of this "protective" effect is unclear, but a role for
heat shock proteins has been suggested. The aim of the present study
was to directly test protective effects of heat stress in the ear. For
physiological experiments, CBA/CaJ mice were exposed to an intense
octave band of noise (8-16 kHz) at 100 dB SPL for 2 hr, either
with or without previous whole-body heat stress (rectal temperature to
41.5 °C for 15 min). The interval between heat stress and sound
exposure varied in different groups from 6 to 96 hr. One week later,
inner ear function was assessed in each animal via comparison of
compound action potential thresholds to mean values from unexposed
controls. Permanent threshold shifts (PTSs) were ~40 dB in the group
sound-exposed without previous heat stress. Heat-stressed animals were
protected from acoustic injury: mean PTS in the group with 6 hr
heat-stress-trauma interval was reduced to ~10 dB. This heat stress
protection disappeared when the treatment-trauma interval surpassed 24 hr. A parallel set of quantitative PCR experiments measured heat-shock
protein mRNA in the cochlea and showed 100- to 200-fold increase over control 30 min after heat treatment, with levels returning to baseline
at 6 hr after treatment. Results are consistent with the idea that
upregulation of heat shock proteins protects the ear from acoustic injury.
Key words:
sound conditioning; acoustic trauma; cochlea; hearing; heat shock; quantitative PCR
 |
INTRODUCTION |
Overexposure to intense sound
damages inner ear sensory cells and can lead to permanent threshold
shift (PTS) if exposure is sufficiently intense or prolonged.
"Conditioning" the ear by pre-exposure to moderate level,
nontraumatic sound can dramatically reduce PTS from a subsequent
traumatic exposure (Canlon et al., 1988 ). Such conditioning-related
protective effects have been demonstrated in several mammalian species,
including humans (Miyakita et al., 1992 ), guinea pigs (Canlon et al.,
1988 ), rabbits (Franklin et al., 1991 ), chinchillas (Subramaniam et
al., 1996 ), gerbils (Ryan et al., 1994 ), and rats (Pukkila et al.,
1997 ). Most studies have used conditioning exposures of many days
duration; however, protective effects have been reported for
conditioners as short as a few hours (Pukkila et al., 1997 ). Most
studies have interposed an interval of several days between conditioner
and traumatic exposure; however, the build-up and decay of these
protective effects has not been systematically investigated.
The mechanism(s) whereby previous sound exposure can reduce subsequent
acoustic injury are poorly understood. The effects of the sound
conditioning per se on the structure and/or function of the cochlea
have been evaluated in only a limited manner. One physiological study
found significant enhancement of distortion product otoacoustic
emissions (DPOAEs) in the sound-conditioned ear (Kujawa and Liberman
1996 ), suggesting that conditioning modifies the function of the
electromotile outer hair cells (OHCs). An ultrastructural study of the
conditioned ear reported elaboration of membranous tubules/vesicles in
the basal pole of OHCs (Canlon et al., 1991 , 1993 ); however, no other
structures within the cochlear duct have been carefully examined.
In the search for mechanisms, it is useful to consider whether the
protective effect of sound conditioning is a special case of the more
generalized phenomenon whereby exposure to sublethal stressors protect
against subsequent exposure to more severe conditions. The protective
effects of stress-induced gene expression have been extensively studied
in a number of systems from yeast to mammals, with a variety of
stressors including heat shock, ischemia, and physical restraint
(Lindquist and Craig, 1988 ; Welch 1992 ). Such protective effects
involve multiple changes in gene expression. One pathway that has
received considerable attention is the upregulation of inducible heat
shock proteins (HSPs). HSPs are known to be expressed in the cochlea,
and immunohistochemical studies suggest they are upregulated in
response to acoustic overexposure and ischemia, as well as heat stress
(Myers et al., 1992 ; Thompson and Neely, 1992 ; Lim et al., 1993 ;
Akizuki et al., 1995 ). In the eye, whole-animal heat stress protects
from light damage with elevation of inducible HSPs (Barbe et al., 1988 ;
Tytell et al., 1993 ). Although the involvement of HSPs in the
sound-conditioning of the cochlea has been proposed (e.g., Lim et al.,
1993 ), the protective effects of heat stress on the ear have never been
directly evaluated. Thus, the aims of this study were to assess the
effects of whole-animal heat stress on vulnerability to acoustic injury and cochlear HSP production and thereby begin to address the idea that
manipulation of stress-induced gene expression may underlie a variety
of cochlear protective effects.
 |
MATERIALS AND METHODS |
Experimental groups and design
Experimental animals were male mice of the CBA/CaJ strain (The
Jackson Laboratory, Bar Harbor, ME), aged 10-12 weeks (23-29 gm). All procedures were approved by the animal care committee of the Massachusetts Eye and Ear Infirmary.
Electrophysiological test groups. All animals in these
groups were tested physiologically at 10-12 weeks of age in a terminal procedure to evaluate cochlear function. Before the final test, animals
in different groups were subjected to different experimental manipulations, as schematized in Figure
1. Each experimental manipulation is
described in more detail below. The five groups were as follows: (1) a
Control group to establish normal cochlear thresholds
for the 10- to 12-week-old CBA/CaJ mouse; (2) a Trauma Only
group, exposed to the traumatic noise-band (without heat stress or
anesthesia) 1 week before final test, to demonstrate the normal
vulnerability of the ear; (3) five Anesthesia+Heat pre
Trauma groups, anesthetized and heat-stressed (for 15 min) at
varying time intervals (6, 12, 24, 48, or 96 hr) before the traumatic
exposure to assess whether previous heat stress protects the ear; (4)
four Anesthesia Only pre Trauma groups, anesthetized
(without heat stress) at varying times (6, 12, 24, or 48 hr) before the
acoustic trauma to differentiate effects of heat stress from effects of
anesthetization; and (5) an Anesthesia+ Heat Only group,
anesthetized and heat-stressed (without acoustic trauma) 6 hr before
final test to evaluate whether the heat stress has compromised basic
cochlear function at the time animals would have been traumatized.
Numbers of animals in each experimental group are shown in Table
1.
Molecular biology test groups. An additional six animals
were tested at 10-12 weeks of age in a terminal procedure to evaluate cochlear mRNA levels. Before bilateral cochlear extraction, two groups
(of two animals each) were anesthetized and heat-stressed before
cochlear extraction, and a third group (also of two animals) served as
a control (anesthesia without heat shock). The time interval between
heat stress and extraction was 30 min for one group and 6 hr for the
other. Two independent molecular analyses (described below) were run,
each using one animal from each of the three groups.
 |
Anesthesia and heat stress |
Animals were heat-stressed while anesthetized with ketamine (60 mg/kg, i.p.) and xylazine (rompun) (6 mg/kg, i.p.). Immediately after
injection, animals were placed in a pan on a heating pad in a warm room
(ambient temperature ~34 °C) to prevent hypothermia during the
onset of anesthesia. Once surgical levels of anesthesia were reached
(~10 min later), a rectal thermometer was inserted; initial
temperature was 37°C (± 0.5°C), as shown in Figure
2. Each animal was then placed in an
aluminum "boat" floating in a hot-water bath maintained at
46.5°C. To avoid direct thermal effects to the ear, the animal's
head was placed on a gauze pad, left ear down, and only right ear
function was ultimately measured. The rectal temperature, continuously
monitored with a digital thermometer, rose at an average rate of
0.6°C/min, and within ~8 min, reached 41.5°C at which it was
maintained for 15 min (Fig. 2A). After the
appropriate elapsed time, the animal was removed from the heat and
placed in a small box within the warm room to fully recover from the
anesthesia (~30 min) before being returned to the animal facility
when fully awake. As shown in Figure 2C, heat-stressed
animals, on average, recovered from the anesthesia ~60 min after
initial injection.

View larger version (22K):
[in this window]
[in a new window]
|
Figure 2.
Temperature records during anesthesia are shown
for one group of Anesthesia+Heat pre Trauma animals
(A) and for the Anesthesia Only pre
Trauma group (B); the mean ± SEM
durations of anesthetization for the same two groups of animals are
shown in C. For each animal, a rectal thermometer was
inserted as soon as possible after injection of anesthetics and was
removed only when the anesthesia began to wear off and the animal began
to move. During heat stress, the temperature was read every minute
under computer control (accuracy better than 0.1°C); after anesthesia
plus heat or during the anesthesia only protocol, temperature was read
by eye off a meter (to the nearest 0.25°C). The
Anesthesia+Heat pre Trauma group shown in
A was the one with the shortest treatment-trauma
interval (6 hr).
|
|
As a control for the effects of anesthetization, a separate group of
animals was anesthetized without being heat-stressed Anesthesia
Only pre Trauma. For this group, care was also taken that the
rectal temperature was maintained near 37°C during the entire
anesthetization period. Without such special precautions, the rectal
temperature of an anesthetized mouse can quickly fall to 32°C at
typical ambient temperatures. Temperature records for all these animals
are shown in Figure 2B. As shown in Figure
2C, without heat stress, animals recovered more quickly from
the anesthesia (50 vs 60 min after injection).
 |
Acoustic overexposure |
Animals were exposed, unanesthetized and unrestrained, within
cages (one per cage division) suspended inside a small reverberant sound exposure box (Liberman and Gao, 1995 ). The stimulus for the
acoustic overexposure was an octave band of noise (8.0-16.0 kHz)
presented at 100 dB SPL for 2 hr. The stimulus was generated by a
custom-made white noise generator, filtered [Brick Wall (San Diego,
CA) filter with a 60 dB/octave slope], amplified [Crown International
(Elkhart, IN) power amplifier], and delivered [JBL Scientific (San
Luis Obispo) compression driver] through an exponential horn fitted
securely to a hole in the top of reverberant box. Sound exposure levels
were measured at four positions within each cage using a 1/4 inch Brüel and Kjaer (Atlanta, GA) condenser microphone; sound
pressure was found to vary by <0.5 dB across these measurement positions.
 |
Testing of compound action potential and DPOAEs |
For the final test, animals were anesthetized with xylazine
(rompun) (8 mg/kg, i.p.), followed by urethane (1.2 gm/kg, i.p.). Surgical levels of anesthesia were maintained with booster injection of
rompun and urethane ( original dose), when necessary.
Surgical preparation for the terminal experiment involved insertion of
a tracheotomy tube and severing the right ear canal near the tympanic
ring. DPOAEs were measured at this point. Then, the bulla was exposed
on right side by removing the overlying muscle layers and was opened
with a #11 scalpel blade for recording of compound action potentials (CAPs).
CAP was recorded from right cochlea of each case via fine silver wire
on the round window referred to the tongue. The response was amplified
(10,000×), filtered (100 Hz to 3 kHz), and averaged with and
analog-to-digital board in a LabVIEW-driven data acquisition system. CAP thresholds were measured under computer control in response
to 5 msec tone pips (0.5 msec rise-fall with a
cos2 onset envelope, delivered at 10/sec).
At each SPL, 32 responses were averaged (with stimulus polarity flipped
on half of the presentations to remove microphonic potentials).
Thresholds were defined as the sound pressure required to produce a
peak-to-peak neural response of 3 µV.
The DPOAEs were measured using an ER-10C (Etymotics Research) acoustic
system consisting of two sound sources and one microphone. The
sensitivity of the microphone was measured by coupling a calibrated Brüel and Kjaer condenser microphone to the output port of the ER-10C system. Stimuli consisted of two primary tones
(f1/f2 = 1:2), presented
with f2 level always 10 dB < f1 level. Stimuli were generated digitally, but
attenuation was provided with external analog attenuators. The ear
canal sound pressure was filtered (high-pass at 1000 Hz), amplified,
and digitized by a digital-to-analog board. A fast Fourier transform
(FFT) was computed, and the sound pressures at
f1, f2, and
2f1-f2 were extracted after
spectral averaging from serial waveform traces. The noise floor also
was measured (defined as the average of six points in the FFT on either side of the 2f1-f2
frequency) and ranged between 20 and 5 dB SPL, depending on frequency.
 |
Assessment of histopathology |
For selected animals in each group, inner ears were harvested
for histopathological analysis. After the final test, cochleas were
dissected out, and tissue was fixed by intralabyrinthine perfusion of a
buffered solution of glutaraldehyde and paraformaldehyde. Ears were
post-fixed overnight (at 4°C) in the same solution, and then rinsed
and osmicated for 1 hr (1% OsO4), dehydrated in graded ethanols, and infiltrated with epoxy resins. After
polymerization, cochlear bone was removed with dental burrs, and the
plasticized cochlear duct was dissected with razor blades into ~12
pieces. Each piece was re-embedded in plastic (for easier handling),
thinned with sanding disks, and mounted on microscope slides. In the
final material, the entire organ of Corti could be viewed in the light microscope as a plastic-embedded surface preparation. Cochlear lengths
were measured with a drawing tube, and the hair cells were counted with
high-power Nomarski optics.
 |
Quantitative PCR |
For mRNA preparation, mice were anesthetized with
ketamine-xylazine and decapitated. Both cochleas were
dissected, cleaned of surrounding tissue, and placed on dry ice. Total
RNA was isolated using Trizol Reagent (Life Technologies, Gaithersburg,
MD). After the precipitated RNA was washed with 75% EtOH, it was
resuspended in 25 µl of sterile RNase free water and quantified on a
spectrophotometer. To remove residual genomic DNA, 1 µg of RNA was
treated with 1 µl (1 U) of RNase free DNase I (Life Technologies)
plus 2 µl of 10× reaction buffer, diluted to 20 µl of total
volume. After 20 min at 21°C, DNase was inactivated by 1 µl (25 mM) of EDTA at 65°C for 10 min. To test for genomic DNA
removal, 1 µl (~ 50 ng) of DNased solution was added to 17 µl of
PCR SuperMix (Life Technologies) and 1 µl each of mouse -tubulin
primers at 100 ng/µl. The nonreverse-transcribed RNA was subject to
PCR as follows. Samples were kept at 94°C for 2 min and then
subjected to thermocycling (40 cycles of 30 sec at 94°C, 1 min at
58°C, 1 min at 72°C, with a final extension at 72°C for 5 min).
-Tubulin primers were designed to amplify the 476-650 bp region
(GenBank accession number X04663: 5'TTCAGCTGACCCACTCACTG3' and
5'TGA- TGGACAGACAGGGTGGCAT3').
Once the absence of genomic DNA was confirmed, cDNA was generated from
10 µl (500 ng) of total RNA using the TaqMan RT Reagents kit
(Perkin-Elmer, Emeryville, CA). The RNA template was mixed with 10 µl
of 10× buffer, 22 µl of MgCl, 20 µl of dNTPs, 5 µl of random
hexamer primer, 2 µl of RNase inhibitor, 2.5 µl of
MultiScribe reverse transcriptase, and 28.5 µl RNase free
water for a total volume of 100 µl. The reactions were heated to
25°C for 10 min, then 48°C for 30 min, and finally [for reverse
transcription (RT) enzyme inactivation] to 95°C for 5 min.
Primers for quantitative PCR were designed for mouse inducible HSP70
mRNA and 18S ribosomal RNA (rRNA) (as the endogenous control). The
HSP70 primer was designed to amplify the 1225- 395 bp region of mouse
HSP70 mRNA (GenBank accession number M12572: 5'AGGCCAGGGCTGGTATTACT3'
and 5' AATGACCCGAGTTCAGGATG3'). The 18S primer was designed to amplify
the 899-999 bp region of mouse 18S rRNA (GenBank accession number
X00686: 5'TTCGGAACTGAGGCCATGATT3' and 5' TTTCGCTCTGGTCCGTCTTG3'). To
test the primers and the RT reaction, a preliminary (nonquantitative)
PCR was performed on the cDNA; samples were kept at 94°C for 2 min
and then thermocycled (40 cycles of 30 sec at 94°C, 1 min at 58°C,
1 min at 72°C, with a final extension at 72°C for 5 min). PCR
bands, resolved on a 1.5% agarose gel, were confirmed to be present at
the correct molecular weight compared with a Low Mass DNA Marker (Life Technologies).
Using the ABI Prism 7700 sequence detection system (Applied Biosystems,
Foster City, CA), a quantitative SYBR Green assay was performed to
measure relative amounts of HSP70 cDNA in the samples. One
microliter of sample was combined with 2.5 µl of 10× buffer,
2 µl of 25 mM MgCl, 3 µl of dNTPs, 0.25 µl of
AmpErase UNG, 0.125 µl of AmpliTaq Gold polymerase, 1 µl each of
specific primers (for HSP70 or 18S), and 14.125 µl of water. All
samples were run in triplicate in a 96-well microtiter plate.
Thermocycle conditions were as follows: 1 cycle at 50°C 2 min, 1 cycle at 95°C 10 min, and 40 cycles 15 sec at 95°C and 1 min
60°C.
In the SYBR Green assay, fluorescence signal is measured after each
thermocycle as it rises in proportion to the double-stranded DNA
generated by PCR (Livak et al., 1995 ; Heid et al., 1996 ). To normalize
for possible differences in sample volume, the signal arising from
wells containing the HSP70 primers was compared with those with the
primer for 18S rRNA. To compute the relative quantities of mRNA, we
used the comparative  Ct method [ABI Prism 7700 Sequence Detection System, User Bulletin #2 (1997), pp 23-27].
 |
RESULTS |
Effects of heat stress on vulnerability to acoustic injury
Threshold responses and histopathology
Overexposure to loud sound can damage sensory cells and cause
permanent elevation of CAP thresholds (for review, see Saunders et al.,
1985 ). The 2 hr exposure to octave-band noise at 100 dB SPL used in the
present study caused frequency-dependent threshold elevations. As shown
in Figure 3A, this 8-16 kHz
noise band caused chronic threshold elevations in all nonheat-stressed
(Trauma Only) mice examined, at all test frequencies above 8 kHz. The largest threshold elevations were seen at 17.5 kHz where they
averaged ~40 dB. The pattern and degree of PTSs were remarkably
similar across all mice in this experimental group; for all test
frequencies below 30 kHz, thresholds for all 10 Trauma Only
animals fell within a 20 dB range. The increased variance for test
frequencies above 30 kHz is seen in both control and noise-exposed
animals; it may arise, in part, from subtle cochlear damage from the
surgery required to expose it.

View larger version (35K):
[in this window]
[in a new window]
|
Figure 3.
The noise band used in the present study produces
a reproducible pattern of permanent threshold shift in mice exposed
without previous heat stress (A); hair cell loss
is restricted to the extreme base (B). CAP
threshold curves are shown in A for 10 Trauma
Only animals compared with the mean CAP threshold curve for 10 control animals not exposed to the traumatic noise band.
B shows the cytocochleogram for one of the
Trauma Only cases, i.e., a plot of the percentage of
hair cells remaining as a function of cochlear location. Cochlear
location is translated into frequency using published data on the map
for mouse (Ehret, 1983 ).
|
|
Hair cell loss was minimal in the Trauma Only animals.
Figure 3B shows the loss pattern along the cochlear spiral
in one typical case, aligning cochlear place to test frequency
according to a cochlear map for mouse (Ehret, 1983 ). Significant hair
cell loss in this case was restricted to the extreme basal regions of
the cochlea where best frequencies are >50 kHz, i.e., above the
highest frequency routinely tested. Throughout the cochlear region in which PTS was maximal, hair cell loss was insignificant. The absence of
sensory cell loss is consistent with other studies in which noise-induced PTS on the order of 40 dB is associated with damage to
the hair cell stereocilia rather than with the destruction of the
sensory cells (Liberman and Dodds, 1984 ). Indeed, careful examination of the sensory hairs in these trauma only mice
revealed clear-cut disarray and loss of stereocilia on inner hair cells (IHCs) and OHCs in a restricted cochlear region consistent with the
frequency region showing maximal PTS (data not shown).
Pretreatment with whole-body heat stress significantly reduced PTS from
the subsequent acoustic overexposure when the interval between heat
stress and trauma was less than 24 hr. Mean PTSs for animals
heat-stressed before the acoustic overexposure (Anesthesia+Heat pre Trauma) are compared in Figure
4A with data from
animals exposed without previous heat stress (Trauma Only).
As described above, the mean PTS in the Trauma Only animals
was close to 40 dB; in contrast, the mean PTS in animals heat stressed
6 hr before acoustic overexposure was only 13 dB, a protective effect
of ~25 dB. SEs have been left off Figure 4A
for clarity; however, they are included in Figure 4B
in which the maximum PTS (i.e., PTS at 17.5 kHz) is replotted for each
of the groups shown in A. A statistical analysis (Fig.
4B) showed highly significant differences
(p 0.005 by ANOVA) between the Trauma
Only group and the Anesthesia+Heat pre Trauma groups
with the two shortest treatment-trauma interval groups, i.e., 6 hr
(F = 31.55; p 0.0001 for the group
effect; F = 2.932; p = 0.005 for the
group-frequency interaction) and 12 hr (F = 11.32;
p = 0.005 for the group effect; F = 2.351; p = 0.023 for the group-frequency interaction).
Although the small protective effect suggested by the mean data in the
24 and 48 hr interval groups was not statistically significant (Fig.
4B), the trend of the means suggests that protective
effects of the heat stress may not have completely disappeared until 96 hr after the treatment. In a separate group of animals, the effects of a shorter heat stress, i.e., 5 rather than 15 min, were assessed for
treatment-trauma intervals of 6, 12, 24, and 48 hr; although mean PTS
for the 6 hr treatment-trauma interval group was 12 dB lower than for
the Trauma Only group, for none of the 5 min heat stress
groups was the protective effect statistically significant.

View larger version (30K):
[in this window]
[in a new window]
|
Figure 4.
Heat stress significantly reduces PTS
from a subsequent acoustic overexposure. A compares mean
PTS for five Anesthesia+Heat pre Trauma groups with the
Trauma Only group. All thresholds are normalized to the
mean control thresholds seen in nontraumatized mice (Fig. 3).
B examines the effect of treatment-trauma interval by
replotting the maximum PTS (i.e., the value at 17.5 kHz) from each
graph in A, arranged with increasing time interval
between heat stress and trauma. SE bars are shown;
**p < 0.005 indicates significant group difference
between a given experimental group and the Trauma Only
group (ANOVA). Tests were performed as a series of two-way ANOVAs
(factors are frequency and group), each of which compared all PTS
values obtained at test frequencies between 7 and 40 kHz from a
particular experimental group with comparable data from the control
group.
|
|
Because the heat stress treatment in our experimental design included
anesthetization, it was necessary to control for the possible effects
of the anesthetization per se on susceptibility to subsequent acoustic
injury. As illustrated in Figure
5A, any protective effects of
previous anesthetization alone were not statistically significant. That
is to say, none of the four Anesthesia Only pre Trauma
groups (with differing treatment-trauma intervals matching those
tested in the heat stress groups) showed less PTS than the Trauma
Only group.

View larger version (28K):
[in this window]
[in a new window]
|
Figure 5.
Protective effects of heat stress are
not caused by the associated anesthesia. A, Mean PTS
values are compared for the four Anesthesia Only pre
Trauma groups versus the Trauma Only group. Data
show that anesthesia without heat stress has no protective effect at
any of the four treatment-trauma intervals investigated (6, 12, 24, or
48 hr as shown in the key). B replots maximum PTS (value
at 17.5 kHz) from each group, arranged according to treatment-trauma
interval. Error bars show SEM.
|
|
Suprathreshold responses
Data in Figures 3-5 deal only with cochlear responses to stimuli
at near-threshold sound pressure levels. In the present study, suprathreshold responses showed protective effects similar to those
seen in the threshold responses described above. Mean amplitude versus
level curves for CAP are shown in Figure
6 for two Anesthesia+Heat pre
Trauma groups compared with control and Trauma Only
animals. Data at six different test tone frequencies are illustrated in A-F, and the relation of those six test frequencies to the
overall pattern of threshold shift in the appropriate experimental
groups is shown in G. Consider first the data for the two
highest test tone frequencies: 20.0 and 28.3 kHz (E and
F, respectively). For both of these frequencies, positioned
on the high-frequency edge of the damaged region (G),
the suprathreshold responses are predicted by the near-threshold
results: i.e., (1) the Anesthesia+Heat pre Trauma group with
6 hr treatment-trauma interval (filled circles) shows similar response magnitudes to the control group, consistent with
almost complete protection from acoustic overexposure; and (2) the
Anesthesia+Heat pre Trauma group with the 96 hr interval shows similar response magnitudes to the Trauma Only group,
consistent with complete disappearance of protective effects. Indeed,
damage appears, if anything, more severe in the 96 hr interval
heat-stressed group; the significance of this trend is unclear. Similar
results were obtained with the growth functions for DPOAEs (data not
shown).

View larger version (28K):
[in this window]
[in a new window]
|
Figure 6.
Average CAP amplitude (±SEM) versus level curves
at six test frequencies for two of the Anesthesia+Heat pre
Trauma groups (6 and 96 hr treatment-trauma intervals)
compared with control and Trauma Only groups.
A-F, Each compares, for a different tone pip frequency,
the average value for the peak-peak CAP for the four groups indicated,
as a function of tone pip intensity. The test frequency is noted at the
top of each panel (A-F) and also
in G in which the mean PTS for each of these four groups
are replotted from Figure 4A.
|
|
The data for the lower test tones frequencies (5.0, 7.07, and 10.0 kHz
in A, B, and C, respectively) show
supranormal response amplitudes at the highest stimulus levels. For
these frequencies, positioned on the low-frequency side of the damaged
region (G), the amplitude versus level curves of all
three traumatized groups (i.e., Trauma Only and both
Anesthesia+Heat pre Trauma groups) cross the control group
curves: i.e., the traumatic exposure has reduced CAP amplitudes at low
stimulus levels but enhanced amplitudes at high stimulus levels. Such
supranormal responses may arise from the phenomenon of
hypersensitization (Liberman and Kiang, 1978 ); after cochlear insult,
auditory nerve fibers often show decreased sensitivity at the
characteristic frequency (CF) coupled with increased sensitivity for
frequencies below CF (on the low-frequency "tail" of the tuning
curve). Thus, high CF fibers in these traumatized ears may be more
responsive to low-frequency tones, contributing to an enhanced CAP as
the intensity of low-frequency test tones is raised. Consistent with
this explanation, supranormal response amplitudes were not seen in the
DPOAE (data not shown). Because DPOAEs are generated mainly near the CF
region for the primary tones (Siegel et al., 1982 ), hypersensitization
of basilar membrane response at frequencies well below CF should not
add to the overall DPOAE amplitude.
Effects of heat stress on cochlear function
before overexposure
In interpreting the effects of heat stress on vulnerability of the
ear to acoustic injury, it is important to consider the effects of the
heat stress per se on cochlear condition. Manipulations, which
themselves elevate cochlear threshold while they protect the ear from
acoustic injury, must be distinguished from other manipulations that
protect the ear without also compromising basic auditory function. For
example, if heat stress decreased middle ear transmission for 6-12 hr,
it would produce a dramatic reduction in acoustic injury from an
overexposure delivered within that time window.
To assess the direct effects of heat stress on cochlear function,
cochlear thresholds were measured in a group of animals 6 hr after heat
stress (Fig.
7A,B).
Because animals were anesthetized during heat stress, this group is
referred to as Anesthesia+Heat pre Trauma. Cochlear
responses in these heat-stressed animals (Fig. 7) were
indistinguishable from those seen in control mice. Cochlear function
(Fig. 7) was assessed in two ways for every animal; A shows
CAP data, which provide a sensitive functional measure of the entire
auditory periphery from sound conduction through synaptic transmission.
An alternative measure of cochlear functioning is provided by DPOAEs,
as shown in B, which assay the functional state of the
middle ear and the contribution of the OHCs to cochlear mechanical
amplification. By defining two different iso-response contours (5 and
25 dB SPL), we assess sound transmission and OHC function at both low
and high sound levels. Heat stress per se did not affect any of these
measures of basic cochlear function.

View larger version (20K):
[in this window]
[in a new window]
|
Figure 7.
Heat stress does not affect basic cochlear
function when measured at the time animals would have been exposed to
traumatic sound. Average iso-response contours are shown for CAP
(A) and DPOAE (B) for
control versus Anesthesia+Heat Only. The iso-response
amplitude defined as "threshold" for the CAP was 3 µV
(peak-to-peak). Two iso-response values were used for the DPOAE: 5 and
15 dB SPL (as indicated).
|
|
Effects of heat stress on cochlear mRNA
A quantitative RT-PCR approach (Livak et al., 1995 ; Heid et al.,
1996 ) was used to measure the changes in cochlear mRNA expression of
the major inducible heat shock protein HSP70. HSP70 mRNA levels were
assayed in the control group and in two groups of heat-stressed animals, one in which cochleas were extracted 30 min after heat stress
and a second at 6 hr. As shown in Figure
8A, the quantitative PCR approach assesses the growth of PCR reaction product after each
thermocycle by the use of fluorescent markers. The greater the amount
of a particular cDNA in the sample, the earlier the cycle number at
which the fluorescent signal begins to rise rapidly out of the noise.
To guarantee that overall RNA levels are comparable in each of the
starting samples, results with probes for HSP70 were compared in every
run with results with probes for 18S rRNA, which should be unaffected
in expression level by the heat stress manipulation. Indeed, the
quantitative PCR results for 18S rRNA were almost identical across
experimental groups; in each case, the PCR signal rises steeply at
approximately thermocycle 8.5 (Fig. 8A). This
reproducibility of the 18S data allows a direct comparison of the HSP70
results in the three experimental groups.

View larger version (29K):
[in this window]
[in a new window]
|
Figure 8.
Quantitative PCR results on expression levels of
HSP70 mRNA and 18S ribosomal RNA in three experimental groups
demonstrate dramatic upregulation of HSP70 after heat stress.
A replots raw output from the ABI Prism 7700 sequence
detection system, i.e., the fluorescent signal intensity (proportional
to amount of PCR reaction product) as a function of thermocycle number.
Fluorescence intensity ( Rn) is calculated by using
the equation Rn = (Rn+) (Rn ), where
Rn+ equals the ratio of emission
intensity of SYBR Green and emission intensity of passive reference
during a reaction, and Rn equals
the ratio during cycles 1-7. This run was based on one animal (both
cochleas) from each of the three experimental groups (control,
heat shock wait 30 min, and heat shock wait 6 hr). Each point is the
average ± SEM of three samples independently assayed.
B extracts the approximate increase in HSP70 mRNA
production re the control value for each of the six animals
tested. Arrows indicate the range of results obtained
across all samples assayed (3 or 4) from each animal. See Materials and
Methods for further details.
|
|
This comparison suggests that HSP70 mRNA levels are increased
~100-fold by 30 min after heat stress; the control and 30 min curves
are shifted by 6.7 cycles, and, assuming a doubling of PCR product on
each cycle, the approximate increase in mRNA levels is a factor of
26.7 (equal to 104). The data in Figure
8A further suggest that HSP70 mRNA levels return
toward baseline by 6 hr after heat stress. This spike of HSP70 mRNA
production was confirmed in an independent set of PCR runs using a
second set of cochleas for each of the three groups. Data from both
sets of runs are summarized in Figure 8B in which the
changes in HSP70 mRNA levels have been extracted from the raw data.
 |
DISCUSSION |
Functionally important structural changes in acoustic injury
Before considering mechanisms by which heat stress might reduce
noise-induced PTS, it is important to consider the functionally important structural changes underlying PTS in the absence of heat
stress. Threshold elevations seen immediately after an acoustic overexposure include both reversible and irreversible components (Miller et al., 1963 ). The reversible or temporary threshold shifts (TTSs) recover over a few days with an exponential time course (Miller
et al., 1963 ), leaving a PTS. In the present study, we allowed a 1 week
postexposure recovery so that thresholds would reflect PTSs.
Acoustic overexposure can lead to permanent damage in virtually all
cochlear cell types if exposure level is high enough and/or duration is
long enough (Saunders et al., 1985 ). However, the most vulnerable
elements are hair cells. Although both IHCs and OHCs are often
destroyed by acoustic overexposure, significant PTS (>40 dB) can be
seen when all hair cells remain (Liberman and Dodds, 1984 ). In such
cases, damage is found to hair cell stereocilia (Robertson, 1982 ;
Engstrom et al., 1983 ; Liberman and Dodds, 1984 ), and the
frequency pattern and magnitude of PTS is well explained by the
cochlear pattern and degree of stereocilia damage (Liberman and Dodds,
1984 ). Given that stereocilia contain the mechanically sensitive
transduction channels, it is not surprising that their loss or damage
can lead to significant (even profound) PTS.
Although comprehensive histological analysis of the inner ear was
beyond the scope of the present study, we analyzed hair cell loss
patterns in a number of Trauma Only ears (Fig.
3B). The only significant cell loss was seen at the cochlear
base where best frequencies are >50 kHz. Although hair cell loss
cannot account for PTS spanning cochlear frequencies from 7-40 kHz in
the Trauma Only group, stereocilia disarray was seen in
appropriate cochlear regions. Thus, the heat stress treatment, which
decreased noise-induced PTS, is decreasing stereocilia damage rather
than preventing hair cell degeneration.
Mechanism of heat stress protection
In this study, 15 min heat stress transiently increased mRNA
levels of HSP70 in the cochlea (Fig. 8) and, in a separate group of
animals, significantly decreased PTS from a subsequent acoustic overexposure (Fig. 4). Appropriate control groups were studied to
demonstrate that this protective effect was caused by the heat per se and not the associated anesthetization (Fig. 5). Of course, care
had to be taken to control body temperature during anesthetization (Fig. 2), because decreasing temperature during acoustic overexposure can decrease acoustic injury (Drescher, 1976 ). The demonstration of
normal threshold and suprathreshold CAP and DPOAE responses, even as
soon as 6 hr after heat stress (Fig. 7), shows that this treatment does
not alter sound transmission through the middle ear, nor basic cochlear
mechanics, transduction, or synaptic transmission. Rather, the
protective effect must involve alterations in the initial resistance of
the inner ear or in the effectiveness of its recovery-repair processes.
Our experimental design included a variety of treatment-trauma
intervals to study the growth and decay of HSP70 gene expression in the
cochlea as well as the accompanying heat stress-mediated protection. A
dramatic increase in mRNA synthesis was seen by 30 min after heat
stress and had decayed significantly 6 hr later. Previous
nonquantitative studies have also reported upregulation of cochlear
HSP70 after heat stress or noise exposure in rat (Lim et al., 1993 ) and
guinea pig (Thompson and Neely, 1992 ; Akizuki et al., 1995 ). The
cochlear protective effects observed here were maximal at the shortest
interval tested (6 hr), were no longer statistically significant at 24 hr, and had disappeared completely by 96 hr (Fig. 4). These time
courses are slightly more rapid than those reported in analogous
studies of heat stress and retinal damage. In the eye, heat stress
reduced light damage in vivo (Barbe et al., 1988 ; Tytell et
al., 1993 ); mRNA for HSP70 peaked 6 hr after heat, and an 18 hr
interval between heat stress and light exposure afforded maximum
protection to retinal cells. Nevertheless, taken together, the
physiological and molecular data are consistent with the hypothesis
that HSPs mediate the protective effects seen in the present study.
However, as discussed below, although the rapid rise in cochlear HSP
mRNA is a necessary condition for the hypothesis, it is insufficient to
prove it.
The role of HSPs in the cochlea is poorly understood; thus, it is
difficult to provide a compelling hypothesis for mechanisms whereby
HSPs might protect the ear from acoustic injury. Nevertheless, recent
work suggests a possible line of investigation. A constitutive form of
HSP, HSP27, has recently been reported in the cuticular plate and
lateral wall of the rat cochlea (Leonova et al., 1998 ). This HSP is
interesting in the context of acoustic injury. Although its role as a
molecular chaperone is similar to other HSPs (Jakob et al., 1993 ), it
associates specifically with F-actin filaments and controls their
polymerization and depolymerization (Lavoie et al., 1993 , 1995 ).
F-Actin is particularly relevant to hearing and acoustic injury,
because it is a major protein of stereocilia and the cuticular plate
into which they insert (Raphael et al., 1994 ). As described above,
stereocilia damage is the functionally important structural change
underlying the type of PTS studied here. Ultrastructural studies have
shown that noise-induced stereocilia damage is associated with
degeneration-depolymerization of the rootlet, which anchors
stereocilia into the cuticular plate (Liberman, 1987 ). Thus, heat
stress-induced stabilization of stereocilia rootlets could underlie the
protective effects seen. Of course, changes in gene expression induced
by heat stress in particular, and stress in general, are not restricted
to changes in HSPs. It is also possible, for example, that the
heat stress leads to upregulation of enzymes, such as superoxide
dismutase, or others involved in the control of cellular redox status,
given recent studies of protection from acoustic injury via
free-radical scavengers (Jacono et al., 1998 ; Sha et al., 1998 ).
Relationship between sound conditioning and heat
stress protection
The phenomenon of sound "conditioning" (Canlon, 1996 ) in which
pre-exposure to moderate level nontraumatic sound reduces PTS from
subsequent traumatic exposures may be an ear-specific example of the
more general observation that pre-exposure to sublethal insults affords
significant protection from subsequent, more potent challenges.
Challenges for which such protective effects are demonstrable also
include hypoxia, ischemia, heat stress, and chemical toxins. In
addition to such direct cellular insults, psychological stressors, such
as physical restraint, can also induce changes in gene expression in
the same "protective" pathways induced by the direct cellular challenges (Ghoshal et al., 1998 ). These psychological effects on gene
expression are mediated via changes in circulating glucocorticoid levels and their actions on glucocorticoid receptors. Direct cellular stresses, such as changes in intracellular
Ca2+, redox status, or protein structure,
can lead to upregulation of the same protective pathways through
modulation of a variety of other transcription factors.
Acoustic exposure of the type used in sound conditioning experiments
(1) can affect cochlear blood flow (Axelsson and Vertes, 1982 ), (2)
probably changes intracellular ion concentrations and redox status, (3)
can elicit an array of psychological stress responses (Kryter, 1976 ),
and (4) must involve some degree of physical restraint. Thus, the
conditioning-mediated protective effects in the ear may involve changes
in stress-induced gene expression mediated by a combination of systemic
and local cellular signals. The recent demonstration of unilateral
protection from acoustic injury after unilateral sound conditioning
(Yamasoba et al., 1999 ) suggests that conditioning-related protection
cannot be completely caused by modulation of systemic stress levels. Indeed, the existence of multiple mechanisms, with differing time constants for onset and decay, help explain contradictions in the
conditioning literature. For example, Ryan et al. (1994) showed that
protective effects of sound conditioning were absent when the trauma
was presented immediately after conditioning, yet were clear-cut with a
treatment-trauma interval of 1 week. On the other hand, Canlon and
Fransson (1998) showed that a 2 hr conditioner-trauma interval
afforded larger protection than at a 1 week interval. The decay of
protective effects observed in the latter study is consistent with that
seen in the present heat stress paradigm, whereas the former is not.
Although protection from sound conditioning has been reported in a
number of mammalian species, it was not demonstra-ble in the one
published study of the CBA/Ca mouse (Fowler et al., 1995 ). Of
course, so many parameters are involved in choosing the conditioning and traumatic stimuli (duration, spectrum, and level for each), and the
conditioner-trauma interval, a negative result from one particular
parameter set, is not very meaningful. We have seen recently protective
effects of sound conditioning in CBA/CaJ mice using a paradigm designed
to parallel the heat stress experiments reported here, i.e., a
short-term (15 min) sound conditioner followed 6-24 hr later by
acoustic overexposure, and also designed to maximize stress by using
the loudest conditioner for which there is no residual TTS 6 hr later,
when the traumatic exposure is presented. The development of this mouse
model of acoustic-injury protection will facilitate future studies of
the molecular mechanisms involved, including direct measures of HSP
production after sound conditioning procedures, which protect the ear
from acoustic injury.
 |
FOOTNOTES |
Received March 31, 1999; revised Aug. 26, 1999; accepted Aug. 31, 1999.
This work was supported by National Institute on Deafness and Other
Communication Disorders Grant RO1 DC-0188. The skillful assistance of
S. Hequembourg in the animal surgery is gratefully acknowledged.
Correspondence should be addressed to M. Charles Liberman,
Eaton-Peabody Laboratory, Massachusetts Eye and Ear Infirmary, 243 Charles Street, Boston, MA 02114. E-mail: mcl{at}epl.meei.harvard.edu.
 |
REFERENCES |
-
Akizuki H,
Yoshie H,
Morita Y,
Takahashi K,
Hara A,
Watanabe T,
Uchiyama Y,
Kusakari J
(1995)
Nuclear transition of heat shock protein in guinea pig cochlea after hyperthermia.
Hear Res
92:126-130[Medline].
-
Axelsson A,
Vertes D
(1982)
Histological findings in cochlear vessels after noise.
In: New perspectives on noise-induced hearing loss (Hamernik RP,
Henderson D,
Salvi R,
eds), pp 49-68. New York: Raven.
-
Barbe MF,
Tytell M,
Gower DJ,
Welch WJ
(1988)
Hyperthermia protects against light damage in the rat retina.
Science
241:1817-1820[Abstract/Free Full Text].
-
Canlon B
(1996)
The effects of sound conditioning on the cochlea.
In: Auditory system plasticity and regeneration (Salvi R,
Hendserson D,
eds), pp 118-127. New York: Thieme.
-
Canlon B,
Fransson A
(1998)
Reducing noise damage by using a mid-frequency sound conditioning stimulus.
NeuroReport
9:269-274[Medline].
-
Canlon B,
Borg E,
Flock A
(1988)
Protection against noise trauma by pre-exposure to a low level acoustic stimulus.
Hear Res
34:197-200[Web of Science][Medline].
-
Canlon B,
Borg E,
Lofstrand P
(1991)
Physiologic and morphologic aspects of low-level acoustic stimulation.
In: Noise-induced hearing loss (Dancer DHA, Salvi RJ, Hamernik RP), pp 489-499 St. Louis: Mosby Year Book.
-
Canlon B,
Lofstrand P,
Borg E
(1993)
Ultrastructual changes in the presynaptic regions of outer hair cells after acoustic stimulation.
Neurosci Lett
150:103-106[Web of Science][Medline].
-
Drescher DG
(1976)
Effect of temperature on cochlear responses during and after exposure to noise.
J Acoust Soc Am
59:401-407[Medline].
-
Ehret G
(1983)
Peripheral anatomy and physiology II.
In: The auditory psychobiology of the mouse (Willott JF,
ed), pp 169-200. Springfield, IL: Thomas.
-
Engstrom B,
Flock A,
Borg E
(1983)
Ultrastructural studies of stereocilia in noise-exposed rabbits.
Hear Res
12:251-264[Web of Science][Medline].
-
Fowler T,
Canlon B,
Dolan D,
Miller JM
(1995)
The effect of noise trauma following training exposures in the mouse.
Hear Res
88:1-13[Medline].
-
Franklin DJ,
Lonsbury Martin BL,
Stagner BB,
Martin GK
(1991)
Altered susceptibility of 2f1-f2 acoustic-distortion products to the effects of repeated noise exposure in rabbits.
Hear Res
53:185-208[Medline].
-
Ghoshal K,
Wang Y,
Sheridan JF,
Jacob ST
(1998)
Metallothionein induction in response to restraint stress.
J Biol Chem
273:27904-27910[Abstract/Free Full Text].
-
Heid CA,
Stevens J,
Livak KJ,
Williams PM
(1996)
Real time quantitative PCR.
Genome Res
6:986-994[Abstract/Free Full Text].
-
Jacono AA,
Hu B,
Kopke RD,
Henderson D,
Van de Water TR,
Steinman HM
(1998)
Changes in cochlear antioxidant enzyme activity after sound conditioning and noise exposure in the chinchilla.
Hear Res
117:31-38[Web of Science][Medline].
-
Jakob U,
Gaestel M,
Engel K,
Buchner J
(1993)
Small heat shock proteins are molecular chaperones.
J Biol Chem
268:1517-1520[Abstract/Free Full Text].
-
Kryter KD
(1976)
Extraauditory effects of noise.
In: Effects of noise on hearing (Henderson D,
Dosanjh DS,
Mills JH,
eds), pp 531-546. New York: Raven.
-
Kujawa SG,
Liberman MC
(1996)
Sound conditioning enhances cochlear responses in guinea pig.
In: Abstracts of the Association for Research in Otolaryngology Midwinter Meeting 19:34.
-
Lavoie JN,
Hickey E,
Weber LA,
Landry J
(1993)
Modulation of actin microfilament dynamics and fluid phase pinocytosis by phosphorylation of heat shock protein 27.
J Biol Chem
268:24210-24214[Abstract/Free Full Text].
-
Lavoie JN,
Lambert H,
Hickey E,
Weber LA,
Landry J
(1995)
Modulation of cellular thermoresistance and actin filament stability accompanies phosphorylation-induced changes in the oligomeric structure of heat shock protein 27.
Mol Cell Biol
15:505-516[Abstract].
-
Leonova EV,
Fairfield D,
Lomax MI,
Altschuler RA
(1998)
Expression of the HSP-27 in the organ of Corti of rat.
Abstr Mol Biol Hear Deaf
3:177.
-
Liberman MC
(1987)
Chronic ultrastructural changes in acoustic trauma: serial-section reconstruction of stereocilia and cuticular plates.
Hear Res
26:65-88[Web of Science][Medline].
-
Liberman MC,
Dodds LW
(1984)
Single-neuron labeling and chronic cochlear pathology. III. Stereocilia damage and alterations of threshold tuning curves.
Hear Res
16:55-74[Web of Science][Medline].
-
Liberman MC,
Gao WY
(1995)
Chronic cochlear de-efferentation and susceptibility to permanent acoustic injury.
Hear Res
90:158-168[Web of Science][Medline].
-
Liberman MC,
Kiang NYS
(1978)
Acoustic trauma in cats, cochlear pathology and auditory-nerve activity.
Acta Otolaryngol (Stockh)
358:5-63.
-
Lim HH,
Jenkins OH,
Myers MW,
Miller JM,
Altschuler RA
(1993)
Detection of HSP72 synthesis after acoustic overstimulation in rat cochlea.
Hear Res
69:146-150[Web of Science][Medline].
-
Lindquist S,
Craig EA
(1988)
The heat-shock proteins.
Annu Rev Genet
22:631-677[Web of Science][Medline].
-
Livak KJ,
Flood SJA,
Marmaro J,
Giusti W,
Deetz K
(1995)
Oligonucleotides with fluorescent dyes at opposite ends provide a quenched probe system for detecting PCR product and nucleic acid hybridization.
PCR Methods Appl
4:357-362[Web of Science][Medline].
-
Miller JD,
Watson CS,
Covell WP
(1963)
Deafening effects of noise on the cat.
Acta Otolaryngol Suppl (Stockh)
176:1-89.
-
Miyakita T,
Hellstrom P-A,
Frimanson E,
Axelsson A
(1992)
Effect of low level acoustic stimulation on temporary threshold shift in young humans.
Hear Res
60:149-155[Medline].
-
Myers MW,
Quirk WS,
Rizk SS,
Miller JM,
Altschuler RA
(1992)
Expression of the major mammalian stress protein in the rat cochlea following transient ischemia.
Laryngoscope
102:981-987[Medline].
-
Pukkila M,
Zhai S,
Virkkala J,
Pirvola U,
Ylikoski J
(1997)
The "toughening" phenomenon in rat's auditory organ.
Acta Otolaryngol Suppl (Stockh)
529:59-62.
-
Raphael Y,
Athey BD,
Wang Y,
Lee MK,
Altschuler RA
(1994)
F-actin, tubulin and spectrin in the organ of Corti: comparative distribution in different cell types and mammalian species.
Hear Res
76:173-187[Web of Science][Medline].
-
Robertson D
(1982)
Effects of acoustic trauma on stereocilia structure and spiral ganglion cell tuning properties in the guinea pig cochlea.
Hear Res
7:55-74[Medline].
-
Ryan AF,
Bennett TM,
Woolf NK,
Axelsson A
(1994)
Protection from noise-induced hearing loss by prior exposure to a nontraumatic stimulus: role of the middle ear muscles.
Hear Res
72:23-28[Web of Science][Medline].
-
Saunders JC,
Dear SP,
Schneider ME
(1985)
The anatomical consequences of acoustic injury: a review and tutorial.
J Acoust Soc Am
78:833-860[Web of Science][Medline].
-
Sha SH,
Dolan DF,
Schacht J
(1998)
Overexpression of superoxide dismutase protects against ototraumatic insults.
Abstr Mol Biol Hear Deaf
3:130.
-
Siegel JH,
Kim DO,
Molnar CE
(1982)
Effects of altering organ of Corti on cochlear distortion products f2-f1 and 2f1-f2.
J Neurophysiol
47:303-328[Abstract/Free Full Text].
-
Subramaniam M,
Henderson D,
Henselman L
(1996)
"Toughening" of the mammalian auditory system: spectral, temporal and intensity effects.
In: Auditory system plasticity and regeneration (Salvi R,
Henderson D,
eds), pp 128-142. New York: Thieme.
-
Thompson AM,
Neely JG
(1992)
Induction of heat shock protein in interdental cells by hyperthermia.
Otolaryngol Head Neck Surg
107:769-774[Medline].
-
Tytell M,
Barbe MF,
Brown IR
(1993)
Stress (Heat shock) protein accumulation in the central nervous system.
Adv Neurol
59:293-303[Medline].
-
Welch WJ
(1992)
Mammalian stress response: cell physiology, structure/function of stress proteins, and implications for medicine and disease.
Physiol Rev
72:1063-1081[Free Full Text].
-
Yamasoba T,
Dolan DF,
Miller JM
(1999)
Acquired resistance to acoustic trauma by sound conditioning is primarily mediated by changes restricted to the cochlea not by systemic responses.
Hear Res
127:31-40[Medline].
Copyright © 1999 Society for Neuroscience 0270-6474/99/192210116-09$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
T. Kathiresan, M. Harvey, S. Orchard, Y. Sakai, and B. Sokolowski
A Protein Interaction Network for the Large Conductance Ca2+-activated K+ Channel in the Mouse Cochlea
Mol. Cell. Proteomics,
August 1, 2009;
8(8):
1972 - 1987.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Hossain, K. Hajman, K. Charitidi, S. Erhardt, U. Zimmermann, M. Knipper, and B. Canlon
Prenatal Dexamethasone Impairs Behavior and the Activation of the BDNF Exon IV Promoter in the Paraventricular Nucleus in Adult Offspring
Endocrinology,
December 1, 2008;
149(12):
6356 - 6365.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. F. Maison, L. L. Parker, L. Young, J. P. Adelman, J. Zuo, and M. C. Liberman
Overexpression of SK2 Channels Enhances Efferent Suppression of Cochlear Responses Without Enhancing Noise Resistance
J Neurophysiol,
April 1, 2007;
97(4):
2930 - 2936.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Tahera, I. Meltser, P. Johansson, A. C. Hansson, and B. Canlon
Glucocorticoid Receptor and Nuclear Factor-{kappa}B Interactions in Restraint Stress-Mediated Protection against Acoustic Trauma
Endocrinology,
September 1, 2006;
147(9):
4430 - 4437.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|