WWW.JNEUROSCI.ORG
-
The Journal of Neuroscience
 QUICK SEARCH:   [advanced]


     
-


HOME
  |  
SEARCH  |   ARCHIVE  |   SUBSCRIBE  |   CONTACT  |   HELP

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit an eLetter
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (67)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tomita, T.
Right arrow Articles by Iwatsubo, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tomita, T.
Right arrow Articles by Iwatsubo, T.

 Previous Article  |  Next Article 

The Journal of Neuroscience, December 15, 1999, 19(24):10627-10634

C Terminus of Presenilin Is Required for Overproduction of Amyloidogenic Abeta 42 through Stabilization and Endoproteolysis of Presenilin

Taisuke Tomita1, Rie Takikawa1, Akihiko Koyama1, Yuichi Morohashi1, Nobumasa Takasugi1, Takaomi C. Saido2, Kei Maruyama3, and Takeshi Iwatsubo1

1 Department of Neuropathology and Neuroscience, Graduate School of Pharmaceutical Sciences, University of Tokyo, 7-3-1 Hongo Bunkyoku Tokyo 113-0033, Japan, 2 Laboratory for Proteolytic Neuroscience, Brain Science Institute, RIKEN, Wako, Saitama 351-0198, Japan, and 3 Laboratory of Molecular Biology, Tokyo Institute of Psychiatry, Kamikitazawa, Setagayaku, Tokyo 156-8585, Japan


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Mutations in presenilin (PS) genes cause early onset familial Alzheimer's disease (FAD) by increasing production of the amyloidogenic form of amyloid beta  peptides ending at residue 42 (Abeta 42). To identify a PS subdomain responsible for overproduction of Abeta 42, we analyzed neuro2a cell lines expressing modified forms of PS2 that harbor an N141I FAD mutation. Deletion or addition of amino acids at the C terminus and Ile448 substitution in PS2 with the N141I FAD mutation abrogated the increase in Abeta 42 secretion, and Abeta 42 overproduction was dependent on the stabilization and endoproteolysis of PS2. The same C-terminal modifications in PS1 produced similar effects. Hence, we suggest that the C terminus of PS plays a crucial role in the overproduction of Abeta 42 through stabilization of endoproteolytic PS derivatives and that these derivatives may be the pathologically active species of PS that cause FAD.

Key words: presenilin 2; presenilin 1; C terminus; amyloid beta  peptide; Abeta 42; endoproteolysis; stabilization; familial Alzheimer's disease


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Alzheimer's disease (AD) is characterized pathologically by a massive deposition of amyloid beta  peptides (Abeta ), which are proteolytically produced from beta -amyloid precursor proteins (beta APP) through two sequential cleavages by as yet unidentified proteases termed the beta - and gamma -secretases (Selkoe, 1991, 1994). Two major forms of Abeta have distinct C termini ending at the 40th and 42nd residues (Abeta 40 and Abeta 42, respectively), which are differentially cleaved by gamma -secretase(s) (Suzuki et al., 1994). Abeta 42 aggregates much faster than Abeta 40 in vitro (Jarrett and Lansbury, 1993), and Abeta 42 is the initially and predominantly deposited Abeta species in the brains of patients with AD and Down's syndrome (Iwatsubo et al., 1994, 1995). Moreover, missense mutations in beta APP genes, a rare cause of familial AD (FAD), lead to increased production of Abeta 42, strongly implicating Abeta 42 in the pathogenesis of AD (Suzuki et al., 1994).

Presenilin (PS) 1 (Sherrington et al., 1995) and PS2 (Levy-Lahad et al., 1995) genes were identified as the major causative genes for early onset FAD that encode homologous polytopic membrane proteins spanning the membrane eight times (Doan et al., 1996; Li and Greenwald, 1998). Although a major proportion of nascent PS is rapidly degraded (Kim et al., 1997), a small fraction of PS is stabilized and undergoes endoproteolysis, resulting in a heterodimeric complex of N- and C-terminal derivatives (NTF and CTF, respectively) (Thinakaran et al., 1996; Capell et al., 1998) with an unusually long half-life (Thinakaran et al., 1996, 1997; Ratovitski et al., 1997). Overexpression of exogenous PS results in the replacement of endogenous PS fragments, suggesting that stabilization of PS is a saturable process competing for a limiting cellular factor (Thinakaran et al., 1996, 1997).

The finding that ablation of PS1 in mice dramatically decreased gamma -cleavage of beta APP indicated that PS1 physiologically serves as a coactivator of gamma -secretase (De Strooper et al., 1998). Moreover, data from studies in Caenorhabditis elegans (Levitan and Greenwald, 1995; Baumeister et al., 1997), PS1 knock-out mice (Shen et al., 1997; Wong et al., 1997; De Strooper et al., 1999), and Drosophila melanogaster (Song et al., 1999; Struhl and Greenwald, 1999; Ye et al., 1999) suggest that PS1 facilitates Notch signaling by activating a gamma -secretase-like protease to release Notch intracellular domain (NICD), which activates transcription in nucleus.

More than 50 missense mutations in PS1, and two in PS2, have been identified in FAD pedigrees (Hardy, 1997). Accumulating data suggest that PS mutations cause AD by promoting the secretion of Abeta 42 (Borchelt et al., 1996; Duff et al., 1996; Citron et al., 1997; Tomita et al., 1997), although the mechanism whereby mutant (mt) PS leads to the increased production of Abeta 42 remains unknown.

We recently reported that NTF of FAD mt PS2 alone cannot promote secretion of Abeta 42 (Tomita et al., 1998), and others showed that NTF of mt PS1 also does not enhance Abeta 42 production (Citron et al., 1998; Steiner et al., 1998). These data prompted us to postulate that a subdomain in the PS C terminus mediates Abeta 42 overproduction and to undertake molecular dissection studies to identify this subdomain.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Construction of expression plasmids. A full-length cDNA encoding wild-type (wt) or N141I FAD mt human PS2 was obtained as described (Tomita et al., 1997, 1998). cDNAs encoding C-terminally modified wt or mt PS2 were generated by PCR using Pfu polymerase (Stratagene, La Jolla, CA), and the following oligonucleotides were used as PCR primers: 5'-CCGGGATCCAGACCTCTCTGCGGCCCCAAG-3' as a sense primer, 5'-CCGGATCCCTACTTCTTGAACACAGC-3' for PS2/411stop, 5'-CTGCTCGAGCTACAGGGTGTCCATGAA-3' for PS2/441stop, 5'-CCGGAATTCTACTGATGGGAGGCCAG-3'forPS2/445stop, 5'-GGGCTCGAGTCAGATGTAGGCCTGATGGGA-3' for PS2/L446A, 5'-ACACCAGAATTCTCAGATGGCGAGCTGATGGGA-3' for PS2/Y447A, 5'-ACACCAGAATTCTCAGGCGTAGAGCTGATGGGA-3' for PS2/I448A, 5'-CCGGAATTCTAGACGTAGAGCTGATGGGA-3' forPS2/I448V,5'-CCGGAATTCTAGAAGTAGAGCTGAT- GGGA-3' for PS2/I448F, 5'-CCGGAATTCTACCTGTAGAGCTGATGGGA-3' for PS2/I448R, 5'-CCCGGGAATTCTAATGGTGATGGTGATGATGGATGTAGAGCTGATGGGA for PS2/CHis and 5'-CCCGGGAATTCTATATATATAATTGGTGACTGATGTAGAGCTGATGGGA for PS2/CDup as antisense primers, respectively. cDNAs encoding N-terminally truncated wt or mt PS2 were similarly generated by PCR using the following primers: 5'-GGCACTCGAGTGTAAAACTATACAACTGC as an antisense primer, 5'-CCGGATCCACCATGTCGGCCGAGAGC-3' for PS2/dAS, and 5'-CCGGGATCCATGGAGGAAGAGCTGA-3' for PS2/dN as sense primers, respectively. A full-length cDNA encoding wt human PS1 containing VRSQ motif was obtained by PCR from a normal human brain cDNA library, and the P267S PS1 mutation was introduced by the dU-template method as described previously (Tomita et al., 1997). cDNAs encoding C-terminally modified wt or mt PS1 were generated by PCR using the following primers: 5'-CCCAAGCTTGCCACCATGACAGAGTTACCT-3' as a sense primer, 5'-CCCGGGAATTCTATAATTGGTCCATAAA-3' for PS1/460stop, and 5'-CCCGGGAATTCTAGCGATAAAATTGATG-3' for PS1/I467R as antisense primers, respectively. Schematic depictions of truncated and/or mutated PS derivatives are shown in Figure 1. All constructs were sequenced using Thermosequenase (Amersham, Arlington Heights, IL) on an automated sequencer (Li-Cor, Lincoln, NE) as described (Tomita et al., 1997, 1998).

Cell culture and transfection. Mouse neuro2a (N2a) cells were maintained in DMEM supplemented with 10% fetal calf serum and penicillin/streptomycin at 37°C in 5% CO2 atmosphere as described (Tomita et al., 1997, 1998). Stable N2a cell lines were generated by transfecting the cDNAs in pcDNA3 vector using Lipofectamine (Life Technologies, Gaithersburg, MD) and selection in DMEM containing G418 (Life Technologies) at 500 µg/ml. Stable cell lines were analyzed at polyclonal stages unless otherwise stated.

Antibodies, immunoblot analysis, and cycloheximide treatment. The following rabbit polyclonal antibodies were used: anti-G2N2 against glutathione S-transferase (GST) fused to amino acids 2-84 of human PS2, anti-G2L against GST fused to amino acids 301-361 of human PS2, (Tomita et al., 1998), anti-PS1N against amino acids 1-22 of human PS1 (Tomita et al., 1997), and anti-G1L3 against GST fused to amino acids 297-379 of human PS1.

Cells were lysed in 2% SDS sample buffer and briefly sonicated. The samples were separated by SDS-PAGE without previous heating, transferred to polyvinylidene difluoride membrane (Millipore, Bedford, MA), and probed with each of the anti-PS antibodies as described (Tomita et al., 1997, 1998). The immunoblots were developed using an ECL system (Amersham).

To evaluate the half-lives of transfected PS proteins and fragments thereof by blocking total cellular protein synthesis, cultured cells were treated with cycloheximide (30 µg/ml) for 4, 10, 12, or 24 hr and then analyzed by immunoblotting with appropriate PS antibodies.

The capacity of transfected PS2 derivatives to replace endogenous PS1 was examined by immunoblotting cell lysates with anti-PS1N or anti-G1L3 antibodies that react with both human and mouse PS1.

Quantitation of Abeta by two-site ELISAs. Two-site ELISAs that specifically detect the C terminus of Abeta were used. BNT77, which was raised against human Abeta 11-28 and recognizes full-length as well as N-terminally truncated Abeta , was used as a capture antibody; BNT77 binds human as well as rodent-type Abeta , but does not react with the 3 kDa fragment (p3) beginning at the Leu-17 residue of Abeta (Fukumoto et al., 1999). BA27 and BC05, monoclonal antibodies that specifically recognize the C termini of Abeta 40 and Abeta 42, respectively, were conjugated with horseradish peroxidase and used as detector antibodies. The specificity and sensitivity of these ELISAs have been characterized previously (Asami-Odaka et al., 1995). Culture media were collected after an incubation period of 24 hr and subjected to BNT77/BA27 or BC05 ELISAs as described (Tomita et al., 1997, 1998). Four independent measurements in duplicate were performed for each clone.

Quantitation of Abeta by immunoprecipitation. Quantitation of Abeta by immunoprecipitation was performed according to the previously described method (Sudoh et al., 1998), with some modifications. Briefly, confluent N2a cells stably expressing PS2 or its derivatives were cultured in DMEM containing fetal bovine serum for 36 hr. Conditioned media (4.5 ml) were incubated with 2 µg of BNT77, 5 µl of goat IgG against mouse IgG, IgA, and IgM (Cappel, West Chester, PA), and 100 µl of 25% protein G agarose (Life Technologies) at 4°C for 12 hr on a rotary shaker. The immunoprecipitates were spun down, boiled in 2% SDS sample buffer, separated by SDS-PAGE on a 16.5% Tris/Tricine gel, and then blotted to a Hybond-ECL membrane filter (Amersham). After boiling in PBS, the membrane was probed with BA27 or BC05 (8 µg/ml, respectively) and then detected by the ECL system as described above.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

A small deletion at the C terminus of mt PS2 abrogates increased secretion of Abeta 42

We previously showed that C-terminally truncated PS2 harboring the N141I FAD mutation (mt PS2) corresponding to endoproteolytic NTF (terminating at amino acid residue 303; 303stop), or retaining the entire sixth loop but truncated at the putative seventh transmembrane (TM) domain (388stop), lost the capacity to increase secretion of Abeta 42 by N2a cells stably overexpressing these proteins (Tomita et al., 1998). To define the minimal PS2 C-terminal region required for the overproduction of Abeta 42, we constructed cDNAs encoding mt PS2 (full-length, 448 residues) with the following C-terminal deletions ending at residues 411 (PS2/411stop), 441 (PS2/441stop), or 445 (PS2/445 stop) as shown in Figure 1. Stably transfected N2a cells expressing these constructs were examined to measure the secretion of Abeta 42 by Abeta C-terminal-specific ELISAs. The percentage Abeta 42 (%Abeta 42) as a fraction of total Abeta (= Abeta x-40 + Abeta x-42) secreted by cells stably expressing mt PS2/411stop, PS2/441stop or PS2/445stop was ~10%, and this was similar to the %Abeta 42 secreted by cells expressing full-length (FL), wt PS2 or wt PS2/411stop, PS2/441stop, or PS2/445stop, whereas the %Abeta 42 secreted from cells expressing FL mt PS2 was constantly elevated to ~35-55% as previously documented (Tomita et al., 1997, 1998) (Fig. 2). The total amounts of secreted Abeta from cells transfected with these C-terminally truncated PS2 as determined by ELISA were comparable to those with FL PS2 (data not shown).



View larger version (48K):
[in this window]
[in a new window]
 
Figure 1.   Schematic depictions of modified presenilins. Schematic representations of truncated or modified forms of PS2 (top) or PS1 (bottom) encoded by the cDNAs used in this study are shown. The names of cDNAs are indicated at the left of each bar, and squares with numbers represent putative TM domains. Open arrowheads on each bar show the location of amino acid substitutions linked to FAD (i.e., N141I in PS2 and P267S in PS1), and arrows between the TM 6 and 7 domains represent the sites of endoproteolytic processing. Amino acid substitution or addition at the C terminus of PS2 are shown below or at the right side of each bar, respectively.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 2.   Percentages of Abeta 42 secreted from cells expressing C-terminally truncated PS2. Percentages of Abeta x-42 as a fraction of total Abeta (= Abeta x-40 + Abeta x-42) (%Abeta 42) secreted from N2a cells stably transfected with full-length (FL) or C-terminally truncated (411stop, 441stop, and 445stop) PS2 genes with (mt) or without (wt) N141I FAD mutation quantitated by two-site ELISAs. Mean values ± SE in four independent experiments are shown. Transfected PS2 cDNAs are indicated below the columns.

Effects of substitution of the C-terminal residues of mt PS2 on Abeta 42 production

Because truncation of three amino acid residues at the C terminus of mt PS2 [i.e., Leu (L) 446, Tyr (Y) 447, and Ile (I) 448] completely inhibited the increase in secretion of Abeta 42, we next replaced each of these single residues with Ala and examined their effects on Abeta 42 secreted by N2a cells, to determine whether one or more of these three residues critically affect the production of Abeta 42. mt PS2/L446A and PS2/Y447A increased the %Abeta 42 to comparable levels seen in N2a cells with FL mt PS2 (~45-55%), whereas %Abeta 42 from cells expressing mt PS2/I448A was ~25%, which was at an intermediate level between those detected in the N2a cells with FL wt and mt PS2 (Fig. 3A).



View larger version (19K):
[in this window]
[in a new window]
 
Figure 3.   Percentages of Abeta 42 secreted from cells expressing PS2 with amino acid substitutions at the C terminus. A, B, Percentages of Abeta x-42 as a fraction of total Abeta (= Abeta x-40 + Abeta x-42) (%Abeta 42) secreted from N2a cells stably transfected with PS2 genes with Ala substitution at Leu446 (L446A), Tyr447 (Y447A), or Ile448 (I448A) (A) or substitution at Ile448 to Val (I448V), Phe (I448F), or Arg (I448R) (B) with (mt) or without (wt) N141I FAD mutation quantitated by two-site ELISAs. FL, Full-length PS2 without amino acid substitution at the C terminus. Mean values ± SE in four independent experiments are shown. Transfected PS2 cDNAs are indicated below the columns. C, Immunoprecipitation of the 4 kDa Abeta 40 and Abeta 42 (arrows) as well as the 3.7 kDa p3.740 and p3.742 (arrows) from conditioned media of N2a cells stably expressing wt or mt FL PS2 (fl), PS2/L446A, or PS2/I448R by BNT77. Immunoprecipitates were visualized by Western blotting with BA27 or BC05.

We then focused on the role of residue I448, which is unusually hydrophobic for a C-terminal residue oriented at the cytoplasmic side, on Abeta 42 secretion and examined the effects that resulted from replacing this residue with amino acids having different properties, i.e., Val (V), which is similarly hydrophobic but has a slightly shorter carbon chain, Phe (F), which also is hydrophobic but harbors an aromatic ring, or Arg (R), which is hydrophilic with positive charges. mt PS2/I448V and PS2/I448F enhanced secretion of Abeta 42 from N2a cells at comparable levels to those in N2a cells expressing FL mt PS2. In sharp contrast, %Abeta 42 secreted from cells expressing mt PS2/I448R was ~10%, which was similar to levels in cells with wt PS2 (Fig. 3B).

We further examined the secretion of Abeta 40 and Abeta 42 from cells transfected with these C-terminally substituted PS2 by immunoprecipitation with BNT77 and immunoblotting with BA27 and BC05, respectively (Fig. 3C). In N2a cells expressing FL wt PS2, robust 4 kDa (Fig. 3C, Abeta 40), and 3.7 kDa (Fig. 3C, p3.740) bands immunoreactive with BA27 were observed, whereas BC05 detected only a trace amount of 4 and 3.7 kDa Abeta peptides. In N2a cells expressing FL mt PS2, the intensities of the BA27-positive bands were weaker compared with those in cells expressing wt PS2, whereas stronger BC05-positive 4 kDa (Fig. 3C, Abeta 42) and 3.7 kDa (Fig. 3C, p3.742) bands were observed. The amounts of the BC05-positive bands were similarly increased in N2a cells expressing mt PS2/L446A, whereas no increase in the amount of BC05-positive bands was observed in cells expressing mt PS2/I448R. These data were in agreement with those obtained by ELISA, suggesting that the levels as well as ratios of Abeta 40 and Abeta 42 as determined by ELISA correctly represent those of bona fide Abeta peptides (the 4 kDa peptides may correspond to full-length Abeta and the 3.7 kDa peptides to N-terminally truncated Abeta , respectively). The total amounts of secreted Abeta from cells transfected with these C-terminally substituted PS2 as determined by ELISA also were at levels similar to those with wt PS2 (data not shown).

Addition of amino acids to the PS2 C terminus abolishes increased Abeta 42 secretion

We next examined the effects of the addition of amino acid residues to the C terminus of mt PS2 on Abeta 42 secretion. To this end, we used two different types of six amino acid long sequences: one contained six His residues (designated CHis), which is often used as an epitope tag, and the other was Ser-His-Gln-Leu-Tyr-Ile (designated CDup), which was identical to the last six amino acid residues of PS2. The latter was designed to determine whether the effect of mt PS2 on Abeta 42 secretion is dependent on the integrity of the C-terminal amino acid sequences, regardless of the length of the C terminus. When stably transfected into N2a cells, neither mt PS2/CHis nor mt PS2/CDup retained the capacity to increase secretion of Abeta 42, and the %Abeta 42 was ~10%, which was similar to cells with wt PS2 (Fig. 4). The total amounts of secreted Abeta from cells transfected with PS2 with additional residues at the C terminus again were comparable to those with FL PS2 (data not shown).



View larger version (13K):
[in this window]
[in a new window]
 
Figure 4.   Percentages of Abeta 42 secreted from cells expressing PS2 with addition of amino acids at the C terminus. Percentages of Abeta x-42 as a fraction of total Abeta (= Abeta x-40 + Abeta x-42) (%Abeta 42) secreted from N2a cells stably transfected with PS2 genes with additional amino acids at the C terminus (CHis, six His residues; CDup, duplication of the C-terminal six amino acid residues of PS2) with (mt) or without (wt) N141I FAD mutation quantitated by two-site ELISAs. FL, Full-length PS2. Mean values ± SE in four independent experiments are shown. Transfected PS2 cDNAs are indicated below the columns.

Relationship between overproduction of Abeta 42 and stabilization and endoproteolysis of PS2

It has not been definitively proven whether nascent holoproteins or stable complexes of endoproteolytic fragments (composed of NTF and CTF) of PS are the biologically active forms of these proteins. To investigate the relationship between stabilization and endoproteolysis of the C-terminally modified forms of PS2 studied here and their pathological overproduction of Abeta 42, we analyzed the expression and metabolism of these proteins in N2a stable cells by Western blots combined with cycloheximide treatment. All of the C-terminally truncated (i.e., PS2/411stop, PS2/441stop, or PS2/445stop) as well as tagged (i.e., PS2/CHis or PS2/CDup) PS2 that lacked the capacity to promote overproduction of Abeta 42 also did not undergo endoproteolysis to give rise to a ~35 kDa NTF and a ~23 kDa CTF normally produced from FL PS2 (Fig. 5A, arrowheads), although abundant holoproteins of corresponding sizes were expressed (Fig. 5A, arrows). With respect to mt PS2 with C-terminal single amino acid substitution, mt PS2/L446A, PS2/Y447A, PS2/I448V, or PS2/I448F, which promoted Abeta 42 secretion, were cleaved to form endoproteolytic fragments, i.e., NTF (Fig. 5B, arrowheads) as well as CTF (data not shown), whereas mt PS2/I448R lacking this property was not cleaved (Fig. 5B, arrowheads). mt PS2/I448A, which showed intermediate levels of Abeta 42 overproduction, yielded moderate levels of endoproteolytic fragments (Fig. 5B, left, arrowhead). Western blots after cycloheximide pretreatment revealed that holoproteins of C-terminally modified PS2 were short-lived with half-lives of <12 hr (Fig. 5C, arrow), whether endoproteolysis occurs or not. In contrast, the endoproteolytic fragments, if any, derived from transfected PS2 [e.g., NTF indicated by arrowhead in L446A of Fig. 5C, as well as corresponding CTF (data not shown)] acquired extraordinarily long half-lives of >24 hr, as observed with fragments produced from FL PS2 (Fig. 5C). These results strongly suggest that the stable NTF/CTF complexes of mt PS are the pathologically active forms of PS that induce overproduction of Abeta 42, and that the integrity of the C-terminal structure of PS is critical for the stabilization of these complexes and the endoproteolysis of PS.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 5.   Expression, metabolism, and half-lives of PS2 derivatives in N2a stable cell lines. Western blot analysis of expression of PS2 with C-terminal truncation (A, left panel), addition (A, right panel), single amino acid substitution to Ala (B, left panel), or substitution at Ile448 (B, right panel) in stably transfected N2a cells. Cell lysates (20 µg protein) from N2a cells transfected with cDNAs encoding full-length (FL) or modified PS2 were fractionated by SDS-PAGE and analyzed by immunoblotting with anti-G2N2 antibodies. PS2 cDNAs in A are on a wild-type basis, but similar results were obtained in N141I FAD mt PS2 (data not shown). The names of the transfected cDNA constructs are indicated at the top of each lane. C, Analysis of the half-lives of PS2 derivatives. Cells were grown in the presence of cycloheximide (CHX, 30 µg/ml) for 0, 12, or 24 hr and then harvested and analyzed as in A and B. The positions of FL PS2 and endoproteolytic NTF are marked by arrows and arrowheads, respectively. Molecular mass standards are shown in kilodaltons.

N terminus of mt PS2 is dispensable for production of Abeta 42 as well as stabilization and endoproteolysis of PS2

To gain insights into the role of the N terminus of PS2 in Abeta 42 production as well as on the stabilization and endoproteolysis of PS2, we constructed cDNAs encoding two types of N-terminally truncated PS2, i.e., dAS lacking the N-terminal 20 residues encompassing the acidic stretch, and dN lacking the entire N-terminal cytoplasmic domain corresponding to residues 1-75. When stably expressed in N2a cells, PS2/dAS as well as PS2/dN with N141I FAD mutation both increased the %Abeta 42 at levels similar to that of cells with FL mt PS2 (Fig. 6A), although the total amounts of secreted Abeta were not altered (data not shown). Western blot analysis showed that both PS2/dAS and PS2/dN undergo endoproteolysis, yielding smaller NTFs and a ~23 kDa CTF of the same size as that derived from cells with FL PS2 (Fig. 6B). Cycloheximide treatment demonstrated that these endoproteolytic fragments have long half-lives (>10 hr) (Fig. 6C, arrowheads), whereas their corresponding holoproteins are short-lived (Fig. 6C, arrows). Taken together, we conclude that the N terminus of PS2 is dispensable for overproduction of Abeta 42 as well as for stabilization and endoproteolysis of PS2.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 6.   Secretion of Abeta 42 and metabolism and stability of PS2 derivatives in cells expressing N-terminally truncated PS2. A, Percentages of Abeta x-42 as a fraction of total Abeta (= Abeta x-40 + Abeta x-42) (%Abeta 42) secreted from N2a cells stably transfected with N-terminally truncated PS2 genes with (mt) or without (wt) N141I FAD mutation (mt) quantitated by two-site ELISAs. FL, Full-length PS2; dAS, PS2 lacking the N-terminal acidic stretch corresponding to residues 1-20; dN, PS2 lacking the entire N-terminal cytoplasmic domain corresponding to residues 1-75. Mean values ± SE in four independent experiments are shown. Transfected PS2 cDNAs are indicated below the columns. B, Western blot analysis of N-terminally truncated PS2 in stably transfected N2a cells. Cell lysates (20 µg protein) from N2a cells transfected with cDNAs encoding full-length (FL) or N-terminally truncated PS2 were fractionated by SDS-PAGE and analyzed by immunoblotting with anti-G2N2 antibodies for dAS (left panel) and with anti-G2L for dN, which lacks the epitopes for anti-G2N2 (right panel). Note that correspondingly smaller holoproteins (arrows in both panels) and NTFs (arrowhead in the left panel) compared with those in cells with FL PS2 were detected and that transfection of dN gave rise to increased levels of CTF (arrowhead in dN; right panel) compared with those of endogenous CTF (arrowhead in Vector, right panel), indicating an effective generation of endoproteolytic fragments. Vector, Cells transfected with an empty pcDNA3 vector. C, Analysis of the half-lives of N-terminally truncated PS2. Cells were grown in the presence of cycloheximide (CHX) for 0, 4, or 10 hr and then harvested and analyzed as in B. The positions of holoproteins of PS2/dAS or /dN are marked by arrows (both panels), and endoproteolytic NTF (left panel) and CTF (right panel) are marked by arrowheads, respectively. The names of the transfected cDNA constructs are indicated at the top of each lane. Molecular mass standards are shown in kilodaltons.

Replacement of endogenous PS1 by PS2 derivatives overexpressed in N2a cells

To determine whether various types of PS2 derivatives overexpressed in N2a cells replace endogenous PS, we selected single clonal cell lines stably expressing C- or N-terminally modified PS2 and examined the levels of endogenous PS1 in representative clones (Fig. 7). The amounts of ~30 kDa NTF and ~23 kDa CTF of endogenous mouse PS1 were decreased in cells expressing FL wt or mt PS2, as well as in cells expressing PS2/l446A or PS2/dN, whereas they were maintained at levels similar to those in mock transfectants in cells expressing wt or mt PS2/445stop, PS2/I448R, or PS2/CHis. These results clearly showed that the pathologically active forms of mt PS2 that promote overproduction of Abeta 42 can replace endogenous PS, whereas replacement does not occur with C-terminally modified PS2 lacking the Abeta 42-promoting effects.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 7.   Replacement of endogenous PS1 by PS2 derivatives overexpressed in N2a cells. Western blot analysis of the levels of NTF (PS1 moNTF, top panel) and CTF (PS1 moCTF, bottom panel) of endogenous mouse PS1 in N2a cells stably transfected with C- or N-terminally modified PS2. Cell lysates (20 µg protein) from N2a cells transfected with each cDNA were fractionated by SDS-PAGE and analyzed by immunoblotting with anti-PS1N (top panel) or anti-G1L3 (bottom panel) antibodies. The names of the transfected cDNA constructs are indicated at the top of each lane. mock, Cells transfected with an empty vector alone. Molecular mass standards are shown in kilodaltons.

Integrity of the C terminus of mt PS1 is required for overproduction of Abeta 42

To determine whether our conclusions regarding the role of PS C terminus are applicable to PS1, we constructed cDNAs encoding wt and Pro267Ser (P267S) mt PS1 lacking the last seven amino acid residues (PS1/460stop), and FL PS1 with the C-terminal residue Ile467 replaced by Arg (PS1/I467R), and stably expressed them in N2a cells. Consistent with the results obtained with PS2, FL P267S mt PS1 increased the %Abeta 42 by ~1.5-fold compared with that of wt PS1, whereas the %Abeta 42 was not elevated in cells with mt PS1/460stop nor with mt PS1/I467R (Fig. 8A), and the total amounts of secreted Abeta were not altered (data not shown). These C-terminally modified PS1 proteins were expressed as holoproteins (Fig. 8B, FL) but they were cleaved to produce only trace amounts of endoproteolytic fragments (Fig. 8B, huNTF). These results confirmed that the integrity of the C-terminal structure of PS1 also is important for the overproduction of Abeta 42 as well as for the stabilization and endoproteolysis of this protein similar to PS2.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 8.   Secretion of Abeta 42 and metabolism of PS1 derivatives in cells expressing C-terminally modified PS1. A, Percentages of Abeta x-42 as a fraction of total Abeta (= Abeta x-40 + Abeta x-42) (%Abeta 42) secreted from N2a cells stably transfected with cDNAs encoding full-length (FL) PS1, PS1 lacking the C-terminal 7 amino acid residues (460stop), or PS1 replaced at residue Ile467 with Arg (I467R) with (mt) or without (wt) P267S FAD mutation quantitated by two-site ELISAs. Mean values ± SE in four independent experiments are shown. Transfected PS1 cDNAs are indicated below the columns. B, Western blot analysis of C-terminally modified PS1 in stably transfected N2a cells. Cell lysates (20 µg protein) from N2a cells transfected with cDNAs encoding full-length (FL), C-terminally truncated (460stop) or substituted (I467R) PS1 were fractionated by SDS-PAGE and analyzed by immunoblotting with anti-PS1N antibody. The approximate position of holoproteins is marked by arrow (FL), and endogenous murine NTF (moNTF) and human NTF (huNTF) derived from transfected PS1 with a slightly faster mobility are marked by arrowheads, respectively. The names of the transfected cDNA constructs are indicated at the top of each lane. Molecular mass standards are shown in kilodaltons.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

In this study, we have clearly shown that (1) the integrity of the C-terminal structure of PS is required for the ability of FAD mt PS to increase secretion of amyloidogenic Abeta 42; (2) subtle modifications of the C terminus of PS, especially those eliminating the hydrophobicity of the C-terminal Ile residue, abrogate the endoproteolysis of PS; (3) the pathological activity of FAD mt PS to increase Abeta 42 is most likely mediated by stabilized complexes of endoproteolytic fragments of PS; and (4) the N terminus of PS, in contrast to the C terminus, is dispensable for the overproduction of Abeta 42, as well as for the stabilization or endoproteolysis of PS.

The mechanisms whereby PS proteins mediate their physiological as well as pathological functions remain elusive. Here we showed a strict parallel between the overproduction of Abeta 42 and the stabilization and endoproteolysis of PS in a series of PS proteins harboring subtle modifications at the C terminus. Taken together with recent observations on PS1 (Steiner et al., 1998) or chimeric molecules of PS1NTF-PS2CTF (Saura et al., 1999), our data support the notion that stabilized fragments of mt PS are responsible for the pathological augumentation of Abeta 42 production, although the precise role of endoproteolytic cleavage in PS function remains unknown. FAD-associated mt PS1 lacking exon 9, which escapes cleavage within the sixth loop domain, is stabilized (Ratovitski et al., 1997), incorporated into high molecular weight stable complexes (Capell et al., 1998), and acquires the abnormal ability to promote overproduction of Abeta 42 caused by an amino acid substitution at the splice junction site (Steiner et al., 1999), suggesting that endoproteolysis merely represents a molecular signature that indicates the occurrence of stabilization but is not mandatory for the function of PS.

Very recently, it was reported that mutating either of the two conserved Asp residues in the sixth and seventh TM domains of PS1 substantially reduces gamma -cleavage of beta APP as well as PS1 endoproteolysis, whereas these Asp-mutated PS1 species can replace endogenous PS1 fragments, thereby eliminating the activity of PS1 in cells (Wolfe et al., 1999). It is conceivable that the two Asp residues are essential for the ability of PS1 to activate (or alternatively, to work as a) gamma -secretase that is mediated by the stabilized form of PS, whereas the C terminus of PS plays a critical role in the formation of the stabilized complexes of PS, which in turn leads to increased secretion and deposition of Abeta 42 in the FAD brains and cells. In this regard, it is particularly interesting that some of the loss-of-function SEL-12 mutants in C. elegans (Levitan and Greenwald, 1995) or Drosophila PS mutants (Struhl and Greenwald, 1999), which are incapable of facilitating Notch signaling, are truncated at the C terminus (e.g., within the putative seventh loop domain in the ar133 mutant of SEL-12) (Levitan and Greenwald, 1995). Further studies will be needed to determine whether these C-terminally truncated PS homologs are stabilized, and whether stabilized complex of PS is required for gamma  (-like) cleavage of Notch or beta APP to release NICD or Abeta , respectively.

What then is the mechanistic role of the PS C terminus in the stabilization and function of PS proteins? Holoproteins of C-terminally modified PS polypeptides studied here were robustly expressed, and as we have previously confirmed with NTFs of PS2, they were inserted into membranes and localized to endoplasmic reticulum [Tomita et al. (1998) and our unpublished observations], despite their relatively short half-lives. One possible mechanism would be that the highly hydrophobic cytoplasmic tails of PS (i.e., -Leu-Tyr-Ile for PS2 and -Phe-Tyr-Ile for PS1) serve as the binding domain of some interacting proteins that are required for the stabilization of PS. Notably, PDZ domain-containing proteins are known to bind to the C terminus of transmembrane proteins with specific motifs such as Ser/Thr-X-Val/Ile (for group I PDZ domains) or hydrophobic amino acids at positions -2 and 0 (for group II) (Songyang et al., 1997), the latter being very similar to those of the PS C terminus noted above. In fact, deletion, mutation, or addition of C-terminal amino acid residues abolishes their binding to PDZ domains (Saras et al., 1997). Taken together with the fact that the stabilization of PS is regulated by competition for limiting cellular factor(s), it is tempting to speculate that interacting proteins that bind to the C terminus of PS are the determinants for the stabilization and replacement of PS that are vital to the function of PS.

Another possibility would be that the C terminus of PS per se plays an important role in the proper folding or conformation of PS required for the stabilization and/or function of PS proteins. Although little is known about the roles of different domains of polytopic membrane proteins in the stabilization of polypeptides, data from deletion studies in lac permease of Escherichia coli may have interesting implications for our findings. Lac permease is a polytopic membrane protein that spans the membrane 12 times, with the N and C termini oriented to the cytoplasmic side. Kaback and colleagues (Roepe et al., 1989) have shown that a total ablation of the 17 amino acid C-terminal cytoplasmic tail of lac permease does not have any decremental effects on the stabilization and function of this protein, whereas additional deletion of five more amino acids constituting the C-terminal portion of the 12th TM domain drastically destabilized the protein after insertion into the membrane. It was also reported that removal of the C-terminal tails of two other polytopic membrane proteins, bacteriorhodopsin (Huang et al., 1981) or melibiose permease (Botfield and Wilson, 1989), did not affect their functions. Thus, it is highly likely that the C terminus of PS, especially the hydrophobic C-terminal residues, plays a unique role in the stabilization of PS as a polytopic membrane protein. The precise mechanism whereby the C terminus stabilizes PS is unknown at present; it may bind to some important domain within the TM or loop structures of PS to maintain a structure required for stabilization or function, or alternatively, the hydrophobic C terminus may interact with, or is anchored within, membranes ensuring the proper conformation of PS. It is also possible that the conformation of the whole protein maintained by the C terminus allows the binding of a limiting factor (protein) with some portion(s) of PS outside the C terminus.

The hydrophobic C terminus of PS could be a therapeutic target for the treatment of FAD because the development of small compounds that bind to the C terminus of PS and mimic these modifications may destabilize and reduce the total amount of "functional" mt PS proteins, which promote overproduction of Abeta 42, in the brains of patients with FAD linked to PS mutations. Future studies of the roles of the C terminus of PS will pave the way for understanding the pathomechanisms as well as for the development of novel therapeutic strategies for FAD and possibly sporadic AD.


    FOOTNOTES

Received July 14, 1999; revised Sept. 10, 1999; accepted Sept. 29, 1999.

This work was supported by Grants-in-Aid from the Ministry of Health and Welfare, the Ministry of Education, Science, Culture and Sports, and CREST of Japan Science and Technology Corporation, Japan. We thank Drs. J. Q. Trojanowski for helpful comments on this manuscript, H. R. Kaback for valuable suggestions on the structure and stability of membrane proteins, Hiroshi Iwata for help in immunoprecipitation experiments, and Takeda Chemical Industries for continuous support.

Correspondence should be addressed to Dr. Takeshi Iwatsubo, Department of Neuropathology and Neuroscience, Graduate School of Pharmaceutical Sciences, University of Tokyo 7-3-1 Bunkyoku Hongo Tokyo 113-0033, Japan. E-mail: iwatsubo{at}mol.f.u-tokyo.ac.jp.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

  • Asami-Odaka A, Ishibashi Y, Kikuchi T, Kitada C, Suzuki N (1995) Long amyloid beta -protein secreted from wild-type human neuroblastoma IMR-32 cells. Biochemistry 34:10272-10278[Medline].
  • Baumeister R, Leimer U, Zweckbronner I, Jakubek C, Grünberg J, Haass C (1997) Human presenilin-1, but not familial Alzheimer's disease (FAD) mutants, facilitate Caenorhabditis elegans Notch signalling independently of proteolytic processing. Genes Function 1:149-159[Medline].
  • Borchelt DR, Thinakaran G, Eckman CB, Lee MK, Davenport F, Ratovitsky T, Prada CM, Kim G, Seekins S, Yager D, Slunt HH, Wang R, Seeger M, Levey AI, Gandy SE, Copeland NG, Jenkins NA, Price DL, Younkin SG, Sisodia SS (1996) Familial Alzheimer's disease-linked presenilin 1 variants elevate Abeta 1-42/1-40 ratio in vitro and in vivo. Neuron 17:1005-1013[Web of Science][Medline].
  • Botfield MC, Wilson TH (1989) Carboxyl-terminal truncations of the melibiose carrier of Escherichia coli. J Biol Chem 264:11643-11648[Abstract/Free Full Text].
  • Capell A, Grünberg J, Pesold B, Diehlmann A, Citron M, Nixon R, Beyreuther K, Selkoe DJ, Haass C (1998) The proteolytic fragments of the Alzheimer's disease-associated presenilin-1 form heterodimers and occur as a 100-150-kDa molecular mass complex. J Biol Chem 273:3205-3211[Abstract/Free Full Text].
  • Citron M, Westaway D, Xia W, Carlson G, Diehl T, Levesque G, Johnson-Wood K, Lee M, Seubert P, Davis A, Kholodenko D, Motter R, Sherrington R, Perry B, Yao H, Strome R, Lieberburg I, Rommens J, Kim S, Schenk D, Fraser P, St. George-Hyslop P, Selkoe DJ (1997) Mutant presenilins of Alzheimer's disease increase production of 42-residue amyloid beta -protein in both transfected cells and transgenic mice. Nat Med 3:67-72[Web of Science][Medline].
  • Citron M, Eckman CB, Diehl TS, Corcoran C, Ostaszewski BL, Xia W, Levesque G, St. George-Hyslop P, Younkin SG, Selkoe DJ (1998) Additive effects of PS1 and APP mutations on secretion of the 42-residue amyloid beta -protein. Neurobiol Dis 5:107-116[Web of Science][Medline].
  • De Strooper B, Saftig P, Craessaerts K, Vanderstichele H, Guhde G, Annaert W, Von Figura K, Van Leuven F (1998) Deficiency of presenilin-1 inhibits the normal cleavage of amyloid precursor protein. Nature 391:387-390[Medline].
  • De Strooper B, Annaert W, Cupers P, Saftig P, Craessaerts K, Mumm JS, Schroeter EH, Schrijvers V, Wolfe MS, Ray WJ, Goate A, Kopan R (1999) A presenilin-1-dependent gamma -secretase-like protease mediates release of Notch intracellular domain. Nature 398:518-522[Medline].
  • Doan A, Thinakaran G, Borchelt DR, Slunt HH, Ratovitsky T, Podlisny M, Selkoe DJ, Seegar M, Gandy SE, Price DL, Sisodia SS (1996) Protein topology of presenilin 1. Neuron 17:1023-1030[Web of Science][Medline].
  • Duff K, Eckman C, Zehr C, Yu X, Prada C-M, Perez-tur J, Hutton M, Buee L, Harigaya Y, Yager D, Morgan D, Gordon MN, Holcomb L, Refolo L, Zenk B, Hardy J, Younkin S (1996) Increased amyloid-beta 42(43) in brains of mice expressing mutant presenilin 1. Nature 383:710-713[Medline].
  • Fukumoto H, Tomita T, Matsunaga H, Ishibashi Y, Saido TC, Iwatsubo T (1999) Primary cultures of neuronal and non-neuronal rat brain cells secrete similar proportions of amyloid beta  peptides ending at Abeta 40 and Abeta 42. NeuroReport 10:2965-2969[Web of Science][Medline].
  • Hardy J (1997) The Alzheimer family of diseases: many etiologies, one pathogenesis? Proc Natl Acad Sci USA 94:2095-2097[Free Full Text].
  • Huang KS, Bayley H, Liao MJ, London E, Khorana HG (1981) Refolding of an integral membrane protein. Denaturation, renaturation, and reconstitution of intact bacteriorhodopsin and two proteolytic fragments. J Biol Chem 256:3802-3809[Abstract/Free Full Text].
  • Iwatsubo T, Odaka A, Suzuki N, Mizusawa H, Nukina N, Ihara Y (1994) Visualization of Abeta 42(43) and Abeta 40 in senile plaques with end-specific Abeta monoclonals: evidence that an initially deposited species is Abeta 42(43). Neuron 13:45-53[Web of Science][Medline].
  • Iwatsubo T, Mann DMA, Odaka A, Suzuki N, Ihara Y (1995) Amyloid beta  protein (Abeta ) deposition: Abeta 42(43) precedes Abeta 40 in Down syndrome. Ann Neurol 37:294-299[Web of Science][Medline].
  • Jarrett JT, Lansbury Jr PT (1993) Seeding "one-dimensional crystallization" of amyloid: a pathogenic mechanism in Alzheimer's disease and scrapie? Cell 73:1055-1058[Web of Science][Medline].
  • Kim TW, Pettingell WH, Hallmark OG, Moir RD, Wasco W, Tanzi RE (1997) Endoproteolytic cleavage and proteasomal degradation of presenilin 2 in transfected cells. J Biol Chem 272:11006-11010[Abstract/Free Full Text].
  • Levitan D, Greenwald I (1995) Facilitation of lin-12-mediated signalling by sel-12, a Caenorhabditis elegans S182 Alzheimer's disease gene. Nature 377:351-354[Medline].
  • Levy-Lahad E, Wasco W, Poorkaj P, Romano DM, Oshima J, Pettingell WH, Yu C-E, Jondro PD, Schmidt SD, Wang K, Crowley AC, Fu Y-H, Guenette SY, Galas D, Nemens E, Wijsman EM, Bird TD, Schellenberg GD, Tanzi RE (1995) Candidate gene for the chromosome 1 familial Alzheimer's disease locus. Science 269:973-977[Abstract/Free Full Text].
  • Li X, Greenwald I (1998) Additional evidence for an eight-transmembrane-domain topology for Caenorhabditis elegans and human presenilins. Proc Natl Acad Sci USA 95:7109-7114[Abstract/Free Full Text].
  • Ratovitski T, Slunt HH, Thinakaran G, Price DL, Sisodia SS, Borchelt DR (1997) Endoproteolytic processing and stabilization of wild-type and mutant presenilin. J Biol Chem 272:24536-24541[Abstract/Free Full Text].
  • Roepe PD, Zbar RI, Sarkar HK, Kaback HR (1989) A five-residue sequence near the carboxyl terminus of the polytopic membrane protein lac permease is required for stability within the membrane. Proc Natl Acad Sci USA 86:3992-3996[Abstract/Free Full Text].
  • Saras J, Engstrom U, Gonez LJ, Heldin CH (1997) Characterization of the interactions between PDZ domains of the protein-tyrosine phosphatase PTPL1 and the carboxyl-terminal tail of Fas. J Biol Chem 272:20979-20981[Abstract/Free Full Text].
  • Saura CA, Tomita T, Davenport F, Harris CL, Iwatsubo T, Thinakaran G (1999) Evidence that intramolecular associations between presenilin domains are obligatory for endoproteolytic processing. J Biol Chem 274:13818-13823[Abstract/Free Full Text].
  • Selkoe DJ (1991) The molecular pathology of Alzheimer's disease. Neuron 6:487-498[Web of Science][Medline].
  • Selkoe DJ (1994) Cell biology of the amyloid beta -protein precursor and the mechanism of Alzheimer's disease. Annu Rev Cell Biol 10:373-403[Web of Science].
  • Shen J, Bronson RT, Chen DF, Xia W, Selkoe DJ, Tonegawa S (1997) Skeletal and CNS defects in presenilin-1-deficient mice. Cell 89:629-639[Web of Science][Medline].
  • Sherrington R, Rogaev EI, Liang Y, Rogaeva EA, Levesque G, Ikeda M, Chi H, Lin C, Li G, Holman K, Tsuda T, Mar L, Foncin J-F, Bruni AC, Montesi MP, Sorbi S, Rainero I, Pinessi L, Nee L, Chumakov I, Pollen D, Brookes A, Sanseau P, Polinsky RJ, Wasco W, Da Silva HAR, Haines JL, Pericak-Vance MA, Tanzi RE, Roses AD, Fraser PE, Rommens JM, St. George-Hyslop PH (1995) Cloning of a gene bearing missense mutations in early-onset familial Alzheimer's disease. Nature 375:754-760[Medline].
  • Song W, Nadeau P, Yuan M, Yang X, Shen J, Yankner BA (1999) Proteolytic release and nuclear translocation of notch-1 are induced by presenilin-1 and impaired by pathogenic presenilin-1 mutations. Proc Natl Acad Sci USA 96:6959-6963[Abstract/Free Full Text].
  • Songyang Z, Fanning AS, Fu C, Xu J, Marfatia SM, Chishti AH, Crompton A, Chan AC, Anderson JM, Cantley LC (1997) Recognition of unique carboxyl-terminal motifs by distinct PDZ domains. Science 275:73-77[Abstract/Free Full Text].
  • Steiner H, Capell A, Pesold B, Citron M, Kloetzel PM, Selkoe DJ, Romig H, Mendla K, Haass C (1998) Expression of Alzheimer's disease-associated presenilin-1 is controlled by proteolytic degradation and complex formation. J Biol Chem 273:32322-32331[Abstract/Free Full Text].
  • Steiner H, Romig H, Grim MG, Philipp U, Pesold B, Citron M, Baumeister R, Haass C (1999) The biological and pathological function of the presenilin-1 Delta exon 9 mutation is independent of its defect to undergo proteolytic processing. J Biol Chem 274:7615-7618[Abstract/Free Full Text].
  • Struhl G, Greenwald I (1999) Presenilin is required for activity and nuclear access of Notch in Drosophila. Nature 398:522-525[Medline].
  • Sudoh S, Kawamura Y, Sato S, Wang R, Saido TC, Oyama F, Sakaki Y, Komano H, Yanagisawa K (1998) Presenilin 1 mutations linked to familial Alzheimer's disease increase the intracellular levels of amyloid beta -protein 1-42 and its N-terminally truncated variant(s) which are generated at distinct sites. J Neurochem 71:1535-1543[Medline].
  • Suzuki N, Cheung TT, Cai X-D, Odaka A, Otvos Jr L, Eckman C, Golde TE, Younkin SG (1994) An increased percentage of long amyloid beta -protein is secreted by familial amyloid beta -protein precursor (beta APP717) mutants. Science 264:1336-1340[Abstract/Free Full Text].
  • Thinakaran G, Borchelt DR, Lee MK, Slunt HH, Spitzer L, Kim G, Ratovitsky T, Davenport F, Nordstedt C, Seeger M, Hardy J, Levey AI, Gandy SE, Jenkins NA, Copeland NG, Price DL, Sisodia SS (1996) Endoproteolysis of presenilin 1 and accumulation of processed derivatives in vivo. Neuron 17:181-190[Web of Science][Medline].
  • Thinakaran G, Harris CL, Ratovitski T, Davenport F, Slunt HH, Price DL, Borchelt DR, Sisodia SS (1997) Evidence that levels of presenilins (PS1 and PS2) are coordinately regulated by competition for limiting cellular factors. J Biol Chem 272:28415-28422[Abstract/Free Full Text].
  • Tomita T, Maruyama K, Saido TC, Kume H, Shinozaki K, Tokuhiro S, Capell A, Walter J, Grünberg J, Haass C, Iwatsubo T, Obata K (1997) The presenilin 2 mutation (N141I) linked to familial Alzheimer disease (Volga German families) increases the secretion of amyloid beta  protein ending at the 42nd (or 43rd) residue. Proc Natl Acad Sci USA 94:2025-2030[Abstract/Free Full Text].
  • Tomita T, Tokuhiro S, Hashimoto T, Aiba K, Saido TC, Maruyama K, Iwatsubo T (1998) Molecular dissection of domains in mutant presenilin 2 that mediate overproduction of amyloidogenic forms of amyloid beta  peptides. Inability of truncated forms of PS2 with familial Alzheimer's disease mutation to increase secretion of Abeta 42. J Biol Chem 273:21153-21160[Abstract/Free Full Text].
  • Wolfe MS, Xia W, Ostaszewski BL, Diehl TS, Kimberly WT, Selkoe DJ (1999) Two transmembrane aspartates in presenilin-1 required for presenilin endoproteolysis and gamma -secretase activity. Nature 398:513-517[Medline].
  • Wong PC, Zheng H, Chen H, Becher MW, Sirinathsinghji DJ, Trumbauer ME, Chen HY, Price DL, Van der Ploeg LH, Sisodia SS (1997) Presenilin 1 is required for Notch1 and Dll1 expression in the paraxial mesoderm. Nature 387:288-292[Medline].
  • Ye Y, Lukinova N, Fortini ME (1999) Neurogenic phenotypes and altered Notch processing in Drosophila Presenilin mutants. Nature 398:525-529[Medline].


Copyright © 1999 Society for Neuroscience  0270-6474/99/192410627-08$05.00/0


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
I. Hayashi, S. Takatori, Y. Urano, H. Iwanari, N. Isoo, S. Osawa, M. A. Fukuda, T. Kodama, T. Hamakubo, T. Li, et al.
Single Chain Variable Fragment against Nicastrin Inhibits the {gamma}-Secretase Activity
J. Biol. Chem., October 9, 2009; 284(41): 27838 - 27847.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
C. Sato, S. Takagi, T. Tomita, and T. Iwatsubo
The C-Terminal PAL Motif and Transmembrane Domain 9 of Presenilin 1 Are Involved in the Formation of the Catalytic Pore of the {gamma}-Secretase
J. Neurosci., June 11, 2008; 28(24): 6264 - 6271.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Isoo, C. Sato, H. Miyashita, M. Shinohara, N. Takasugi, Y. Morohashi, S. Tsuji, T. Tomita, and T. Iwatsubo
Abeta42 Overproduction Associated with Structural Changes in the Catalytic Pore of {gamma}-Secretase: COMMON EFFECTS OF PEN-2 N-TERMINAL ELONGATION AND FENOFIBRATE
J. Biol. Chem., April 27, 2007; 282(17): 12388 - 12396.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
C. Sato, Y. Morohashi, T. Tomita, and T. Iwatsubo
Structure of the Catalytic Pore of {gamma}-Secretase Probed by the Accessibility of Substituted Cysteines.
J. Neurosci., November 15, 2006; 26(46): 12081 - 12088.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Morohashi, T. Kan, Y. Tominari, H. Fuwa, Y. Okamura, N. Watanabe, C. Sato, H. Natsugari, T. Fukuyama, T. Iwatsubo, et al.
C-terminal Fragment of Presenilin Is the Molecular Target of a Dipeptidic {gamma}-Secretase-specific Inhibitor DAPT (N-[N-(3,5-Difluorophenacetyl)-L-alanyl]-S-phenylglycine t-Butyl Ester)
J. Biol. Chem., May 26, 2006; 281(21): 14670 - 14676.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
H. Shiraishi, T. Marutani, H.-Q. Wang, Y. Maeda, Y. Kurono, A. Takashima, W. Araki, M. Nishimura, K. Yanagisawa, and H. Komano
Reconstitution of {gamma}-secretase by truncated presenilin (PS) fragments revealed that PS C-terminal transmembrane domain is critical for formation of {gamma}-secretase complex
Genes Cells, January 1, 2006; 11(1): 83 - 93.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Watanabe, T. Tomita, C. Sato, T. Kitamura, Y. Morohashi, and T. Iwatsubo
Pen-2 Is Incorporated into the {gamma}-Secretase Complex through Binding to Transmembrane Domain 4 of Presenilin 1
J. Biol. Chem., December 23, 2005; 280(51): 41967 - 41975.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
Y. Urano, I. Hayashi, N. Isoo, P. C. Reid, Y. Shibasaki, N. Noguchi, T. Tomita, T. Iwatsubo, T. Hamakubo, and T. Kodama
Association of active {gamma}-secretase complex with lipid rafts
J. Lipid Res., May 1, 2005; 46(5): 904 - 912.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Niimura, N. Isoo, N. Takasugi, M. Tsuruoka, K. Ui-Tei, K. Saigo, Y. Morohashi, T. Tomita, and T. Iwatsubo
Aph-1 Contributes to the Stabilization and Trafficking of the {gamma}-Secretase Complex through Mechanisms Involving Intermolecular and Intramolecular Interactions
J. Biol. Chem., April 1, 2005; 280(13): 12967 - 12975.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
Y. Qi-Takahara, M. Morishima-Kawashima, Y. Tanimura, G. Dolios, N. Hirotani, Y. Horikoshi, F. Kametani, M. Maeda, T. C. Saido, R. Wang, et al.
Longer Forms of Amyloid {beta} Protein: Implications for the Mechanism of Intramembrane Cleavage by {gamma}-Secretase
J. Neurosci., January 12, 2005; 25(2): 436 - 445.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Bergman, H. Laudon, B. Winblad, J. Lundkvist, and J. Naslund
The Extreme C Terminus of Presenilin 1 Is Essential for {gamma}-Secretase Complex Assembly and Activity
J. Biol. Chem., October 29, 2004; 279(44): 45564 - 45572.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. Hayashi, Y. Urano, R. Fukuda, N. Isoo, T. Kodama, T. Hamakubo, T. Tomita, and T. Iwatsubo
Selective Reconstitution and Recovery of Functional {gamma}-Secretase Complex on Budded Baculovirus Particles
J. Biol. Chem., September 3, 2004; 279(36): 38040 - 38046.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Takahashi, I. Hayashi, Y. Tominari, K. Rikimaru, Y. Morohashi, T. Kan, H. Natsugari, T. Fukuyama, T. Tomita, and T. Iwatsubo
Sulindac Sulfide Is a Noncompetitive gamma -Secretase Inhibitor That Preferentially Reduces Abeta 42 Generation
J. Biol. Chem., May 9, 2003; 278(20): 18664 - 18670.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Takasugi, Y. Takahashi, Y. Morohashi, T. Tomita, and T. Iwatsubo
The Mechanism of gamma -Secretase Activities through High Molecular Weight Complex Formation of Presenilins Is Conserved in Drosophila melanogaster and Mammals
J. Biol. Chem., December 13, 2002; 277(51): 50198 - 50205.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. Rozmahel, H. T. J. Mount, F. Chen, V. Nguyen, J. Huang, S. Erdebil, J. Liauw, G. Yu, H. Hasegawa, Y. Gu, et al.
Alleles at the Nicastrin locus modify presenilin 1- deficiency phenotype
PNAS, October 29, 2002; 99(22): 14452 - 14457.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Morohashi, N. Hatano, S. Ohya, R. Takikawa, T. Watabiki, N. Takasugi, Y. Imaizumi, T. Tomita, and T. Iwatsubo
Molecular Cloning and Characterization of CALP/KChIP4, a Novel EF-hand Protein Interacting with Presenilin 2 and Voltage-gated Potassium Channel Subunit Kv4
J. Biol. Chem., April 19, 2002; 277(17): 14965 - 14975.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. A. Leissring, T. R. Yamasaki, W. Wasco, J. D. Buxbaum, I. Parker, and F. M. LaFerla
Calsenilin reverses presenilin-mediated enhancement of calcium signaling
PNAS, July 18, 2000; 97(15): 8590 - 8593.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Steiner, T. Revesz, M. Neumann, H. Romig, M. G. Grim, B. Pesold, H. A. Kretzschmar, J. Hardy, J. L. Holton, R. Baumeister, et al.
A Pathogenic Presenilin-1 Deletion Causes Abberrant Abeta 42 Production in the Absence of Congophilic Amyloid Plaques
J. Biol. Chem., March 2, 2001; 276(10): 7233 - 7239.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Iwata, T. Tomita, K. Maruyama, and T. Iwatsubo
Subcellular Compartment and Molecular Subdomain of beta -Amyloid Precursor Protein Relevant to the Abeta 42-promoting Effects of Alzheimer Mutant Presenilin 2
J. Biol. Chem., June 8, 2001; 276(24): 21678 - 21685.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E.-K. Choi, N. F. Zaidi, J. S. Miller, A. C. Crowley, D. E. Merriam, C. Lilliehook, J. D. Buxbaum, and W. Wasco
Calsenilin Is a Substrate for Caspase-3 That Preferentially Interacts with the Familial Alzheimer's Disease-associated C-terminal Fragment of Presenilin 2
J. Biol. Chem., May 25, 2001; 276(22): 19197 - 19204.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Tomita, T. Watabiki, R. Takikawa, Y. Morohashi, N. Takasugi, R. Kopan, B. De Strooper, and T. Iwatsubo
The First Proline of PALP Motif at the C Terminus of Presenilins Is Obligatory for Stabilization, Complex Formation, and gamma -Secretase Activities of Presenilins
J. Biol. Chem., August 24, 2001; 276(35): 33273 - 33281.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. A. Saura, T. Tomita, S. Soriano, M. Takahashi, J.-Y. Leem, T. Honda, E. H. Koo, T. Iwatsubo, and G. Thinakaran
The Nonconserved Hydrophilic Loop Domain of Presenilin (PS) Is Not Required for PS Endoproteolysis or Enhanced Abeta 42 Production Mediated by Familial Early Onset Alzheimer's Disease-linked PS Variants
J. Biol. Chem., May 26, 2000; 275(22): 17136 - 17142.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit an eLetter
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (67)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tomita, T.
Right arrow Articles by Iwatsubo, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tomita, T.
Right arrow Articles by Iwatsubo, T.

-
-

Home  |   Search  |   Archive  |   Subscribe  |   Contact  |   Help

-
Copyright 2009 by Society for Neuroscience ONLINE ISSN: 1529-2401
-