 |
Previous Article | Next Article 
The Journal of Neuroscience, December 15, 1999, 19(24):10627-10634
C Terminus of Presenilin Is Required for Overproduction of
Amyloidogenic A 42 through Stabilization and Endoproteolysis of
Presenilin
Taisuke
Tomita1,
Rie
Takikawa1,
Akihiko
Koyama1,
Yuichi
Morohashi1,
Nobumasa
Takasugi1,
Takaomi C.
Saido2,
Kei
Maruyama3, and
Takeshi
Iwatsubo1
1 Department of Neuropathology and Neuroscience,
Graduate School of Pharmaceutical Sciences, University of Tokyo, 7-3-1 Hongo Bunkyoku Tokyo 113-0033, Japan, 2 Laboratory for
Proteolytic Neuroscience, Brain Science Institute, RIKEN, Wako, Saitama
351-0198, Japan, and 3 Laboratory of Molecular Biology,
Tokyo Institute of Psychiatry, Kamikitazawa, Setagayaku, Tokyo
156-8585, Japan
 |
ABSTRACT |
Mutations in presenilin (PS) genes cause early onset familial
Alzheimer's disease (FAD) by increasing production of the
amyloidogenic form of amyloid peptides ending at residue 42 (A 42). To identify a PS subdomain responsible for overproduction of
A 42, we analyzed neuro2a cell lines expressing modified forms
of PS2 that harbor an N141I FAD mutation. Deletion or addition of amino
acids at the C terminus and Ile448 substitution in PS2 with the N141I
FAD mutation abrogated the increase in A 42 secretion, and A 42
overproduction was dependent on the stabilization and endoproteolysis
of PS2. The same C-terminal modifications in PS1 produced similar
effects. Hence, we suggest that the C terminus of PS plays a crucial
role in the overproduction of A 42 through stabilization of
endoproteolytic PS derivatives and that these derivatives may be the
pathologically active species of PS that cause FAD.
Key words:
presenilin 2; presenilin 1; C terminus; amyloid peptide; A 42; endoproteolysis; stabilization; familial Alzheimer's
disease
 |
INTRODUCTION |
Alzheimer's disease (AD) is
characterized pathologically by a massive deposition of amyloid peptides (A ), which are proteolytically produced from
-amyloid precursor proteins ( APP) through two sequential
cleavages by as yet unidentified proteases termed the - and
-secretases (Selkoe, 1991 , 1994 ). Two major forms of A have
distinct C termini ending at the 40th and 42nd residues (A 40 and
A 42, respectively), which are differentially cleaved by
-secretase(s) (Suzuki et al., 1994 ). A 42 aggregates much faster
than A 40 in vitro (Jarrett and Lansbury, 1993 ), and
A 42 is the initially and predominantly deposited A species in the
brains of patients with AD and Down's syndrome (Iwatsubo et al., 1994 ,
1995 ). Moreover, missense mutations in APP genes, a rare cause of
familial AD (FAD), lead to increased production of A 42, strongly
implicating A 42 in the pathogenesis of AD (Suzuki et al., 1994 ).
Presenilin (PS) 1 (Sherrington et al., 1995 ) and PS2 (Levy-Lahad et
al., 1995 ) genes were identified as the major causative genes for early
onset FAD that encode homologous polytopic membrane proteins spanning
the membrane eight times (Doan et al., 1996 ; Li and Greenwald, 1998 ).
Although a major proportion of nascent PS is rapidly degraded (Kim et
al., 1997 ), a small fraction of PS is stabilized and undergoes
endoproteolysis, resulting in a heterodimeric complex of N- and
C-terminal derivatives (NTF and CTF, respectively) (Thinakaran et al.,
1996 ; Capell et al., 1998 ) with an unusually long half-life (Thinakaran
et al., 1996 , 1997 ; Ratovitski et al., 1997 ). Overexpression of
exogenous PS results in the replacement of endogenous PS fragments,
suggesting that stabilization of PS is a saturable process competing
for a limiting cellular factor (Thinakaran et al., 1996 , 1997 ).
The finding that ablation of PS1 in mice dramatically decreased
-cleavage of APP indicated that PS1 physiologically serves as a
coactivator of -secretase (De Strooper et al., 1998 ).
Moreover, data from studies in Caenorhabditis elegans
(Levitan and Greenwald, 1995 ; Baumeister et al., 1997 ), PS1
knock-out mice (Shen et al., 1997 ; Wong et al., 1997 ; De Strooper et
al., 1999 ), and Drosophila melanogaster (Song et al., 1999 ;
Struhl and Greenwald, 1999 ; Ye et al., 1999 ) suggest that PS1
facilitates Notch signaling by activating a
-secretase-like protease to release Notch intracellular domain (NICD), which activates transcription in nucleus.
More than 50 missense mutations in PS1, and two in PS2, have been
identified in FAD pedigrees (Hardy, 1997 ). Accumulating data suggest
that PS mutations cause AD by promoting the secretion of A 42
(Borchelt et al., 1996 ; Duff et al., 1996 ; Citron et al., 1997 ; Tomita
et al., 1997 ), although the mechanism whereby mutant (mt) PS
leads to the increased production of A 42 remains unknown.
We recently reported that NTF of FAD mt PS2 alone cannot promote
secretion of A 42 (Tomita et al., 1998 ), and others showed that NTF
of mt PS1 also does not enhance A 42 production (Citron et al., 1998 ;
Steiner et al., 1998 ). These data prompted us to postulate that a
subdomain in the PS C terminus mediates A 42 overproduction and to
undertake molecular dissection studies to identify this subdomain.
 |
MATERIALS AND METHODS |
Construction of expression plasmids. A full-length
cDNA encoding wild-type (wt) or N141I FAD mt human PS2 was obtained as described (Tomita et al., 1997 , 1998 ). cDNAs encoding C-terminally modified wt or mt PS2 were generated by PCR using Pfu
polymerase (Stratagene, La Jolla, CA), and the following
oligonucleotides were used as PCR primers:
5'-CCGGGATCCAGACCTCTCTGCGGCCCCAAG-3' as a sense primer,
5'-CCGGATCCCTACTTCTTGAACACAGC-3' for PS2/411stop, 5'-CTGCTCGAGCTACAGGGTGTCCATGAA-3' for PS2/441stop,
5'-CCGGAATTCTACTGATGGGAGGCCAG-3'forPS2/445stop, 5'-GGGCTCGAGTCAGATGTAGGCCTGATGGGA-3' for PS2/L446A,
5'-ACACCAGAATTCTCAGATGGCGAGCTGATGGGA-3' for PS2/Y447A,
5'-ACACCAGAATTCTCAGGCGTAGAGCTGATGGGA-3' for PS2/I448A, 5'-CCGGAATTCTAGACGTAGAGCTGATGGGA-3'
forPS2/I448V,5'-CCGGAATTCTAGAAGTAGAGCTGAT- GGGA-3'
for PS2/I448F, 5'-CCGGAATTCTACCTGTAGAGCTGATGGGA-3' for PS2/I448R,
5'-CCCGGGAATTCTAATGGTGATGGTGATGATGGATGTAGAGCTGATGGGA for PS2/CHis
and 5'-CCCGGGAATTCTATATATATAATTGGTGACTGATGTAGAGCTGATGGGA for
PS2/CDup as antisense primers, respectively. cDNAs encoding N-terminally truncated wt or mt PS2 were similarly generated by PCR
using the following primers: 5'-GGCACTCGAGTGTAAAACTATACAACTGC as
an antisense primer, 5'-CCGGATCCACCATGTCGGCCGAGAGC-3' for PS2/dAS, and
5'-CCGGGATCCATGGAGGAAGAGCTGA-3' for PS2/dN as sense primers, respectively. A full-length cDNA encoding wt human PS1 containing VRSQ
motif was obtained by PCR from a normal human brain cDNA library, and
the P267S PS1 mutation was introduced by the dU-template method as
described previously (Tomita et al., 1997 ). cDNAs encoding C-terminally modified wt or mt PS1 were generated by PCR using the
following primers: 5'-CCCAAGCTTGCCACCATGACAGAGTTACCT-3' as a sense
primer, 5'-CCCGGGAATTCTATAATTGGTCCATAAA-3' for PS1/460stop, and
5'-CCCGGGAATTCTAGCGATAAAATTGATG-3' for PS1/I467R as antisense primers, respectively. Schematic depictions of truncated and/or mutated
PS derivatives are shown in Figure 1. All constructs were sequenced
using Thermosequenase (Amersham, Arlington Heights, IL) on an automated
sequencer (Li-Cor, Lincoln, NE) as described (Tomita et al., 1997 ,
1998 ).
Cell culture and transfection. Mouse neuro2a (N2a) cells
were maintained in DMEM supplemented with 10% fetal calf serum
and penicillin/streptomycin at 37°C in 5% CO2
atmosphere as described (Tomita et al., 1997 , 1998 ). Stable N2a cell
lines were generated by transfecting the cDNAs in pcDNA3 vector using
Lipofectamine (Life Technologies, Gaithersburg, MD) and selection in
DMEM containing G418 (Life Technologies) at 500 µg/ml. Stable cell
lines were analyzed at polyclonal stages unless otherwise stated.
Antibodies, immunoblot analysis, and cycloheximide
treatment. The following rabbit polyclonal antibodies were used:
anti-G2N2 against glutathione S-transferase (GST) fused to
amino acids 2-84 of human PS2, anti-G2L against GST fused to amino
acids 301-361 of human PS2, (Tomita et al., 1998 ), anti-PS1N against
amino acids 1-22 of human PS1 (Tomita et al., 1997 ), and anti-G1L3
against GST fused to amino acids 297-379 of human PS1.
Cells were lysed in 2% SDS sample buffer and briefly sonicated. The
samples were separated by SDS-PAGE without previous heating, transferred to polyvinylidene difluoride membrane (Millipore, Bedford,
MA), and probed with each of the anti-PS antibodies as described
(Tomita et al., 1997 , 1998 ). The immunoblots were developed using an
ECL system (Amersham).
To evaluate the half-lives of transfected PS proteins and fragments
thereof by blocking total cellular protein synthesis, cultured cells
were treated with cycloheximide (30 µg/ml) for 4, 10, 12, or 24 hr
and then analyzed by immunoblotting with appropriate PS antibodies.
The capacity of transfected PS2 derivatives to replace endogenous PS1
was examined by immunoblotting cell lysates with anti-PS1N or anti-G1L3
antibodies that react with both human and mouse PS1.
Quantitation of A by two-site ELISAs. Two-site ELISAs
that specifically detect the C terminus of A were used. BNT77, which was raised against human A 11-28 and recognizes full-length as well
as N-terminally truncated A , was used as a capture antibody; BNT77
binds human as well as rodent-type A , but does not react with the 3 kDa fragment (p3) beginning at the Leu-17 residue of A (Fukumoto et
al., 1999 ). BA27 and BC05, monoclonal antibodies that specifically
recognize the C termini of A 40 and A 42, respectively, were
conjugated with horseradish peroxidase and used as detector antibodies.
The specificity and sensitivity of these ELISAs have been characterized
previously (Asami-Odaka et al., 1995 ). Culture media were collected
after an incubation period of 24 hr and subjected to BNT77/BA27 or BC05
ELISAs as described (Tomita et al., 1997 , 1998 ). Four independent
measurements in duplicate were performed for each clone.
Quantitation of A by immunoprecipitation. Quantitation of
A by immunoprecipitation was performed according to the previously described method (Sudoh et al., 1998 ), with some modifications. Briefly, confluent N2a cells stably expressing PS2 or its derivatives were cultured in DMEM containing fetal bovine serum for 36 hr. Conditioned media (4.5 ml) were incubated with 2 µg of BNT77, 5 µl
of goat IgG against mouse IgG, IgA, and IgM (Cappel, West Chester, PA),
and 100 µl of 25% protein G agarose (Life Technologies) at 4°C for
12 hr on a rotary shaker. The immunoprecipitates were spun down, boiled
in 2% SDS sample buffer, separated by SDS-PAGE on a 16.5%
Tris/Tricine gel, and then blotted to a Hybond-ECL membrane filter
(Amersham). After boiling in PBS, the membrane was probed with BA27 or
BC05 (8 µg/ml, respectively) and then detected by the ECL system as
described above.
 |
RESULTS |
A small deletion at the C terminus of mt PS2 abrogates increased
secretion of A 42
We previously showed that C-terminally truncated PS2 harboring the
N141I FAD mutation (mt PS2) corresponding to endoproteolytic NTF
(terminating at amino acid residue 303; 303stop), or retaining the
entire sixth loop but truncated at the putative seventh transmembrane (TM) domain (388stop), lost the capacity to increase secretion of
A 42 by N2a cells stably overexpressing these proteins (Tomita et
al., 1998 ). To define the minimal PS2 C-terminal region required for
the overproduction of A 42, we constructed cDNAs encoding mt PS2
(full-length, 448 residues) with the following C-terminal deletions
ending at residues 411 (PS2/411stop), 441 (PS2/441stop), or 445 (PS2/445 stop) as shown in Figure 1.
Stably transfected N2a cells expressing these constructs were examined
to measure the secretion of A 42 by A C-terminal-specific ELISAs.
The percentage A 42 (%A 42) as a fraction of total A (=
A x-40 + A x-42) secreted by cells stably expressing mt
PS2/411stop, PS2/441stop or PS2/445stop was ~10%, and this was
similar to the %A 42 secreted by cells expressing full-length (FL),
wt PS2 or wt PS2/411stop, PS2/441stop, or PS2/445stop, whereas the
%A 42 secreted from cells expressing FL mt PS2 was constantly
elevated to ~35-55% as previously documented (Tomita et al., 1997 ,
1998 ) (Fig. 2). The total amounts of
secreted A from cells transfected with these C-terminally truncated
PS2 as determined by ELISA were comparable to those with FL PS2 (data not shown).

View larger version (48K):
[in this window]
[in a new window]
|
Figure 1.
Schematic depictions of modified presenilins.
Schematic representations of truncated or modified forms of PS2
(top) or PS1 (bottom) encoded by the
cDNAs used in this study are shown. The names of cDNAs are indicated at
the left of each bar, and
squares with numbers represent putative
TM domains. Open arrowheads on each bar
show the location of amino acid substitutions linked to FAD (i.e.,
N141I in PS2 and P267S in PS1), and arrows between the
TM 6 and 7 domains represent the sites of endoproteolytic processing.
Amino acid substitution or addition at the C terminus of PS2 are shown
below or at the right side of each
bar, respectively.
|
|

View larger version (16K):
[in this window]
[in a new window]
|
Figure 2.
Percentages of A 42 secreted from cells
expressing C-terminally truncated PS2. Percentages of A x-42 as a
fraction of total A (= A x-40 + A x-42) (%A 42) secreted from
N2a cells stably transfected with full-length (FL) or
C-terminally truncated (411stop, 441stop,
and 445stop) PS2 genes with
(mt) or without (wt) N141I FAD mutation
quantitated by two-site ELISAs. Mean values ± SE in four
independent experiments are shown. Transfected PS2 cDNAs are indicated
below the columns.
|
|
Effects of substitution of the C-terminal residues of mt PS2 on
A 42 production
Because truncation of three amino acid residues at the C terminus
of mt PS2 [i.e., Leu (L) 446, Tyr (Y) 447, and Ile (I) 448] completely inhibited the increase in secretion of A 42, we next replaced each of these single residues with Ala and examined their effects on A 42 secreted by N2a cells, to determine whether one or
more of these three residues critically affect the production of
A 42. mt PS2/L446A and PS2/Y447A increased the %A 42 to comparable levels seen in N2a cells with FL mt PS2 (~45-55%), whereas %A 42 from cells expressing mt PS2/I448A was ~25%, which was at an
intermediate level between those detected in the N2a cells with
FL wt and mt PS2 (Fig.
3A).

View larger version (19K):
[in this window]
[in a new window]
|
Figure 3.
Percentages of A 42 secreted from cells
expressing PS2 with amino acid substitutions at the C terminus.
A, B, Percentages of A x-42 as a
fraction of total A (= A x-40 + A x-42) (%A 42) secreted from
N2a cells stably transfected with PS2 genes with Ala substitution at
Leu446 (L446A), Tyr447 (Y447A), or Ile448
(I448A) (A) or substitution at
Ile448 to Val (I448V), Phe
(I448F), or Arg (I448R)
(B) with (mt) or without
(wt) N141I FAD mutation quantitated by two-site ELISAs.
FL, Full-length PS2 without amino acid substitution at
the C terminus. Mean values ± SE in four independent experiments
are shown. Transfected PS2 cDNAs are indicated below the
columns. C, Immunoprecipitation of the 4 kDa A 40 and A 42 (arrows)
as well as the 3.7 kDa p3.740 and p3.742
(arrows) from conditioned media of N2a cells stably
expressing wt or mt FL PS2 (fl),
PS2/L446A, or PS2/I448R by BNT77. Immunoprecipitates were visualized by
Western blotting with BA27 or BC05.
|
|
We then focused on the role of residue I448, which is unusually
hydrophobic for a C-terminal residue oriented at the cytoplasmic side,
on A 42 secretion and examined the effects that resulted from
replacing this residue with amino acids having different properties,
i.e., Val (V), which is similarly hydrophobic but has a slightly
shorter carbon chain, Phe (F), which also is hydrophobic but harbors an
aromatic ring, or Arg (R), which is hydrophilic with positive charges.
mt PS2/I448V and PS2/I448F enhanced secretion of A 42 from N2a cells
at comparable levels to those in N2a cells expressing FL mt PS2. In
sharp contrast, %A 42 secreted from cells expressing mt PS2/I448R
was ~10%, which was similar to levels in cells with wt PS2 (Fig.
3B).
We further examined the secretion of A 40 and A 42 from cells
transfected with these C-terminally substituted PS2 by
immunoprecipitation with BNT77 and immunoblotting with BA27 and BC05,
respectively (Fig. 3C). In N2a cells expressing FL wt PS2,
robust 4 kDa (Fig. 3C,
A 40), and 3.7 kDa (Fig.
3C, p3.740) bands
immunoreactive with BA27 were observed, whereas BC05 detected only a
trace amount of 4 and 3.7 kDa A peptides. In N2a cells expressing FL
mt PS2, the intensities of the BA27-positive bands were weaker compared with those in cells expressing wt PS2, whereas stronger BC05-positive 4 kDa (Fig. 3C,
A 42) and 3.7 kDa (Fig.
3C, p3.742) bands were
observed. The amounts of the BC05-positive bands were similarly increased in N2a cells expressing mt PS2/L446A, whereas no increase in
the amount of BC05-positive bands was observed in cells expressing mt
PS2/I448R. These data were in agreement with those obtained by ELISA,
suggesting that the levels as well as ratios of A 40 and A 42 as
determined by ELISA correctly represent those of bona fide A
peptides (the 4 kDa peptides may correspond to full-length A and the
3.7 kDa peptides to N-terminally truncated A , respectively). The
total amounts of secreted A from cells transfected with these C-terminally substituted PS2 as determined by ELISA also were at levels
similar to those with wt PS2 (data not shown).
Addition of amino acids to the PS2 C terminus abolishes increased
A 42 secretion
We next examined the effects of the addition of amino acid
residues to the C terminus of mt PS2 on A 42 secretion. To this end,
we used two different types of six amino acid long sequences: one
contained six His residues (designated CHis), which is often used as an
epitope tag, and the other was Ser-His-Gln-Leu-Tyr-Ile (designated
CDup), which was identical to the last six amino acid residues of PS2.
The latter was designed to determine whether the effect of mt PS2 on
A 42 secretion is dependent on the integrity of the C-terminal amino
acid sequences, regardless of the length of the C terminus. When stably
transfected into N2a cells, neither mt PS2/CHis nor mt PS2/CDup
retained the capacity to increase secretion of A 42, and the %A 42
was ~10%, which was similar to cells with wt PS2 (Fig.
4). The total amounts of secreted A
from cells transfected with PS2 with additional residues at the C
terminus again were comparable to those with FL PS2 (data not
shown).

View larger version (13K):
[in this window]
[in a new window]
|
Figure 4.
Percentages of A 42 secreted from cells
expressing PS2 with addition of amino acids at the C terminus.
Percentages of A x-42 as a fraction of total A (=
A x-40 + A x-42) (%A 42) secreted from N2a cells
stably transfected with PS2 genes with additional amino acids at the C
terminus (CHis, six His residues; CDup,
duplication of the C-terminal six amino acid residues of PS2) with
(mt) or without (wt) N141I FAD mutation
quantitated by two-site ELISAs. FL, Full-length PS2.
Mean values ± SE in four independent experiments are shown.
Transfected PS2 cDNAs are indicated below the
columns.
|
|
Relationship between overproduction of A 42 and stabilization and
endoproteolysis of PS2
It has not been definitively proven whether nascent holoproteins
or stable complexes of endoproteolytic fragments (composed of NTF and
CTF) of PS are the biologically active forms of these proteins. To
investigate the relationship between stabilization and endoproteolysis
of the C-terminally modified forms of PS2 studied here and their
pathological overproduction of A 42, we analyzed the expression and
metabolism of these proteins in N2a stable cells by Western blots
combined with cycloheximide treatment. All of the C-terminally
truncated (i.e., PS2/411stop, PS2/441stop, or PS2/445stop) as well as
tagged (i.e., PS2/CHis or PS2/CDup) PS2 that lacked the capacity to
promote overproduction of A 42 also did not undergo endoproteolysis
to give rise to a ~35 kDa NTF and a ~23 kDa CTF normally produced
from FL PS2 (Fig. 5A, arrowheads), although abundant holoproteins of corresponding
sizes were expressed (Fig. 5A, arrows). With
respect to mt PS2 with C-terminal single amino acid substitution, mt
PS2/L446A, PS2/Y447A, PS2/I448V, or PS2/I448F, which promoted A 42
secretion, were cleaved to form endoproteolytic fragments, i.e., NTF
(Fig. 5B, arrowheads) as well as CTF (data not
shown), whereas mt PS2/I448R lacking this property was not cleaved
(Fig. 5B, arrowheads). mt PS2/I448A, which showed
intermediate levels of A 42 overproduction, yielded moderate levels
of endoproteolytic fragments (Fig. 5B, left,
arrowhead). Western blots after cycloheximide pretreatment
revealed that holoproteins of C-terminally modified PS2 were
short-lived with half-lives of <12 hr (Fig. 5C,
arrow), whether endoproteolysis occurs or not. In contrast,
the endoproteolytic fragments, if any, derived from transfected PS2
[e.g., NTF indicated by arrowhead in L446A of Fig.
5C, as well as corresponding CTF (data not shown)] acquired extraordinarily long half-lives of >24 hr, as observed with fragments produced from FL PS2 (Fig. 5C). These results strongly
suggest that the stable NTF/CTF complexes of mt PS are the
pathologically active forms of PS that induce overproduction of A 42,
and that the integrity of the C-terminal structure of PS is critical
for the stabilization of these complexes and the endoproteolysis of PS.

View larger version (27K):
[in this window]
[in a new window]
|
Figure 5.
Expression, metabolism, and half-lives of PS2
derivatives in N2a stable cell lines. Western blot analysis of
expression of PS2 with C-terminal truncation (A,
left panel), addition (A,
right panel), single amino acid substitution to
Ala (B, left panel), or
substitution at Ile448 (B, right
panel) in stably transfected N2a cells. Cell lysates (20 µg protein) from N2a cells transfected with cDNAs encoding
full-length (FL) or modified PS2 were fractionated by
SDS-PAGE and analyzed by immunoblotting with anti-G2N2 antibodies. PS2
cDNAs in A are on a wild-type basis, but similar results
were obtained in N141I FAD mt PS2 (data not shown). The names of the
transfected cDNA constructs are indicated at the top of
each lane. C, Analysis of the half-lives
of PS2 derivatives. Cells were grown in the presence of cycloheximide
(CHX, 30 µg/ml) for 0, 12, or 24 hr and then harvested
and analyzed as in A and B. The positions
of FL PS2 and endoproteolytic NTF are marked by arrows
and arrowheads, respectively. Molecular mass standards
are shown in kilodaltons.
|
|
N terminus of mt PS2 is dispensable for production of A 42 as
well as stabilization and endoproteolysis of PS2
To gain insights into the role of the N terminus of PS2 in A 42
production as well as on the stabilization and endoproteolysis of PS2,
we constructed cDNAs encoding two types of N-terminally truncated PS2,
i.e., dAS lacking the N-terminal 20 residues encompassing the acidic
stretch, and dN lacking the entire N-terminal cytoplasmic domain
corresponding to residues 1-75. When stably expressed in N2a cells,
PS2/dAS as well as PS2/dN with N141I FAD mutation both increased the
%A 42 at levels similar to that of cells with FL mt PS2 (Fig.
6A), although the total
amounts of secreted A were not altered (data not shown). Western
blot analysis showed that both PS2/dAS and PS2/dN undergo
endoproteolysis, yielding smaller NTFs and a ~23 kDa CTF of the same
size as that derived from cells with FL PS2 (Fig.
6B). Cycloheximide treatment demonstrated that these
endoproteolytic fragments have long half-lives (>10 hr) (Fig.
6C, arrowheads), whereas their corresponding
holoproteins are short-lived (Fig. 6C, arrows).
Taken together, we conclude that the N terminus of PS2 is dispensable
for overproduction of A 42 as well as for stabilization and
endoproteolysis of PS2.

View larger version (25K):
[in this window]
[in a new window]
|
Figure 6.
Secretion of A 42 and metabolism and stability
of PS2 derivatives in cells expressing N-terminally truncated PS2.
A, Percentages of A x-42 as a fraction of total
A (= A x-40 + A x-42) (%A 42) secreted from N2a
cells stably transfected with N-terminally truncated PS2 genes with
(mt) or without (wt) N141I FAD mutation
(mt) quantitated by two-site ELISAs. FL,
Full-length PS2; dAS, PS2 lacking the N-terminal acidic
stretch corresponding to residues 1-20; dN, PS2 lacking
the entire N-terminal cytoplasmic domain corresponding to residues
1-75. Mean values ± SE in four independent experiments are
shown. Transfected PS2 cDNAs are indicated below the
columns. B, Western blot analysis of
N-terminally truncated PS2 in stably transfected N2a cells. Cell
lysates (20 µg protein) from N2a cells transfected with cDNAs
encoding full-length (FL) or N-terminally truncated PS2
were fractionated by SDS-PAGE and analyzed by immunoblotting with
anti-G2N2 antibodies for dAS (left panel) and
with anti-G2L for dN, which lacks the epitopes for anti-G2N2
(right panel). Note that correspondingly smaller
holoproteins (arrows in both panels) and
NTFs (arrowhead in the left panel)
compared with those in cells with FL PS2 were detected and that
transfection of dN gave rise to increased levels of CTF
(arrowhead in dN; right
panel) compared with those of endogenous CTF
(arrowhead in Vector, right
panel), indicating an effective generation of
endoproteolytic fragments. Vector, Cells transfected
with an empty pcDNA3 vector. C, Analysis of the
half-lives of N-terminally truncated PS2. Cells were grown in the
presence of cycloheximide (CHX) for 0, 4, or 10 hr and then harvested and analyzed as in B. The positions of holoproteins of PS2/dAS
or /dN are marked by arrows (both
panels), and endoproteolytic NTF (left
panel) and CTF (right panel) are
marked by arrowheads, respectively. The names of the
transfected cDNA constructs are indicated at the top of
each lane. Molecular mass standards are shown in
kilodaltons.
|
|
Replacement of endogenous PS1 by PS2 derivatives overexpressed in
N2a cells
To determine whether various types of PS2 derivatives
overexpressed in N2a cells replace endogenous PS, we selected single clonal cell lines stably expressing C- or N-terminally modified PS2 and
examined the levels of endogenous PS1 in representative clones (Fig.
7). The amounts of ~30 kDa NTF and
~23 kDa CTF of endogenous mouse PS1 were decreased in cells
expressing FL wt or mt PS2, as well as in cells expressing PS2/l446A or
PS2/dN, whereas they were maintained at levels similar to those in mock transfectants in cells expressing wt or mt PS2/445stop, PS2/I448R, or
PS2/CHis. These results clearly showed that the pathologically active
forms of mt PS2 that promote overproduction of A 42 can replace
endogenous PS, whereas replacement does not occur with C-terminally
modified PS2 lacking the A 42-promoting effects.

View larger version (29K):
[in this window]
[in a new window]
|
Figure 7.
Replacement of endogenous PS1 by PS2 derivatives
overexpressed in N2a cells. Western blot analysis of the levels of NTF
(PS1 moNTF, top panel) and CTF
(PS1 moCTF, bottom panel) of
endogenous mouse PS1 in N2a cells stably transfected with C- or
N-terminally modified PS2. Cell lysates (20 µg protein) from N2a
cells transfected with each cDNA were fractionated by SDS-PAGE and
analyzed by immunoblotting with anti-PS1N (top
panel) or anti-G1L3 (bottom panel)
antibodies. The names of the transfected cDNA constructs are indicated
at the top of each lane.
mock, Cells transfected with an empty vector alone.
Molecular mass standards are shown in kilodaltons.
|
|
Integrity of the C terminus of mt PS1 is required for
overproduction of A 42
To determine whether our conclusions regarding the role of PS C
terminus are applicable to PS1, we constructed cDNAs encoding wt and
Pro267Ser (P267S) mt PS1 lacking the last seven amino acid residues
(PS1/460stop), and FL PS1 with the C-terminal residue Ile467 replaced
by Arg (PS1/I467R), and stably expressed them in N2a cells. Consistent
with the results obtained with PS2, FL P267S mt PS1 increased the
%A 42 by ~1.5-fold compared with that of wt PS1, whereas the
%A 42 was not elevated in cells with mt PS1/460stop nor with mt
PS1/I467R (Fig. 8A),
and the total amounts of secreted A were not altered (data not
shown). These C-terminally modified PS1 proteins were expressed as
holoproteins (Fig. 8B, FL) but they were
cleaved to produce only trace amounts of endoproteolytic fragments
(Fig. 8B, huNTF). These results
confirmed that the integrity of the C-terminal structure of PS1 also is
important for the overproduction of A 42 as well as for the
stabilization and endoproteolysis of this protein similar to PS2.

View larger version (25K):
[in this window]
[in a new window]
|
Figure 8.
Secretion of A 42 and metabolism of PS1
derivatives in cells expressing C-terminally modified PS1.
A, Percentages of A x-42 as a fraction of total
A (= A x-40 + A x-42) (%A 42) secreted from N2a
cells stably transfected with cDNAs encoding full-length
(FL) PS1, PS1 lacking the C-terminal 7 amino acid
residues (460stop), or PS1 replaced at residue Ile467
with Arg (I467R) with (mt) or without
(wt) P267S FAD mutation quantitated by two-site ELISAs.
Mean values ± SE in four independent experiments are shown.
Transfected PS1 cDNAs are indicated below the columns.
B, Western blot analysis of C-terminally modified PS1 in
stably transfected N2a cells. Cell lysates (20 µg protein) from N2a
cells transfected with cDNAs encoding full-length (FL),
C-terminally truncated (460stop) or substituted
(I467R) PS1 were fractionated by SDS-PAGE and analyzed
by immunoblotting with anti-PS1N antibody. The approximate position of
holoproteins is marked by arrow (FL), and
endogenous murine NTF (moNTF) and human NTF
(huNTF) derived from transfected PS1 with a
slightly faster mobility are marked by arrowheads,
respectively. The names of the transfected cDNA constructs are
indicated at the top of each lane.
Molecular mass standards are shown in kilodaltons.
|
|
 |
DISCUSSION |
In this study, we have clearly shown that (1) the integrity of the
C-terminal structure of PS is required for the ability of FAD mt PS to
increase secretion of amyloidogenic A 42; (2) subtle modifications of
the C terminus of PS, especially those eliminating the hydrophobicity
of the C-terminal Ile residue, abrogate the endoproteolysis of PS; (3)
the pathological activity of FAD mt PS to increase A 42 is most
likely mediated by stabilized complexes of endoproteolytic fragments of
PS; and (4) the N terminus of PS, in contrast to the C terminus, is
dispensable for the overproduction of A 42, as well as for the
stabilization or endoproteolysis of PS.
The mechanisms whereby PS proteins mediate their physiological as well
as pathological functions remain elusive. Here we showed a strict
parallel between the overproduction of A 42 and the stabilization and
endoproteolysis of PS in a series of PS proteins harboring subtle
modifications at the C terminus. Taken together with recent observations on PS1 (Steiner et al., 1998 ) or chimeric molecules of
PS1NTF-PS2CTF (Saura et al., 1999 ), our data support the notion that
stabilized fragments of mt PS are responsible for the pathological augumentation of A 42 production, although the precise role of endoproteolytic cleavage in PS function remains unknown. FAD-associated mt PS1 lacking exon 9, which escapes cleavage within the sixth loop
domain, is stabilized (Ratovitski et al., 1997 ), incorporated into high
molecular weight stable complexes (Capell et al., 1998 ), and
acquires the abnormal ability to promote overproduction of A 42
caused by an amino acid substitution at the splice junction site
(Steiner et al., 1999 ), suggesting that endoproteolysis merely represents a molecular signature that indicates the occurrence of
stabilization but is not mandatory for the function of PS.
Very recently, it was reported that mutating either of the two
conserved Asp residues in the sixth and seventh TM domains of
PS1 substantially reduces -cleavage of APP as well as PS1 endoproteolysis, whereas these Asp-mutated PS1 species can replace endogenous PS1 fragments, thereby eliminating the activity of PS1 in
cells (Wolfe et al., 1999 ). It is conceivable that the two Asp residues
are essential for the ability of PS1 to activate (or alternatively, to
work as a) -secretase that is mediated by the stabilized form of PS,
whereas the C terminus of PS plays a critical role in the formation of
the stabilized complexes of PS, which in turn leads to increased
secretion and deposition of A 42 in the FAD brains and cells. In this
regard, it is particularly interesting that some of the
loss-of-function SEL-12 mutants in C. elegans (Levitan and
Greenwald, 1995 ) or Drosophila PS mutants (Struhl and
Greenwald, 1999 ), which are incapable of facilitating Notch signaling,
are truncated at the C terminus (e.g., within the putative seventh loop
domain in the ar133 mutant of SEL-12) (Levitan and
Greenwald, 1995 ). Further studies will be needed to determine whether
these C-terminally truncated PS homologs are stabilized, and whether
stabilized complex of PS is required for (-like) cleavage of Notch
or APP to release NICD or A , respectively.
What then is the mechanistic role of the PS C terminus in the
stabilization and function of PS proteins? Holoproteins of C-terminally modified PS polypeptides studied here were robustly expressed, and as
we have previously confirmed with NTFs of PS2, they were inserted into
membranes and localized to endoplasmic reticulum [Tomita et al.
(1998) and our unpublished observations], despite their relatively
short half-lives. One possible mechanism would be that the highly
hydrophobic cytoplasmic tails of PS (i.e., -Leu-Tyr-Ile for PS2 and
-Phe-Tyr-Ile for PS1) serve as the binding domain of some interacting
proteins that are required for the stabilization of PS. Notably,
PDZ domain-containing proteins are known to bind to the C
terminus of transmembrane proteins with specific motifs such as
Ser/Thr-X-Val/Ile (for group I PDZ domains) or hydrophobic amino acids
at positions 2 and 0 (for group II) (Songyang et al., 1997 ),
the latter being very similar to those of the PS C terminus noted
above. In fact, deletion, mutation, or addition of C-terminal amino
acid residues abolishes their binding to PDZ domains (Saras et al.,
1997 ). Taken together with the fact that the stabilization of PS is
regulated by competition for limiting cellular factor(s), it is
tempting to speculate that interacting proteins that bind to the
C terminus of PS are the determinants for the stabilization and
replacement of PS that are vital to the function of PS.
Another possibility would be that the C terminus of PS per se plays an
important role in the proper folding or conformation of PS required for
the stabilization and/or function of PS proteins. Although little is
known about the roles of different domains of polytopic membrane
proteins in the stabilization of polypeptides, data from deletion
studies in lac permease of Escherichia coli may
have interesting implications for our findings. Lac permease is a polytopic membrane protein that spans the membrane 12 times, with
the N and C termini oriented to the cytoplasmic side. Kaback and
colleagues (Roepe et al., 1989 ) have shown that a total ablation of the
17 amino acid C-terminal cytoplasmic tail of lac permease does not have any decremental effects on the stabilization and function
of this protein, whereas additional deletion of five more amino acids
constituting the C-terminal portion of the 12th TM domain drastically
destabilized the protein after insertion into the membrane. It was also
reported that removal of the C-terminal tails of two other polytopic
membrane proteins, bacteriorhodopsin (Huang et al., 1981 ) or melibiose
permease (Botfield and Wilson, 1989 ), did not affect their functions.
Thus, it is highly likely that the C terminus of PS, especially the
hydrophobic C-terminal residues, plays a unique role in the
stabilization of PS as a polytopic membrane protein. The precise
mechanism whereby the C terminus stabilizes PS is unknown at present;
it may bind to some important domain within the TM or loop structures
of PS to maintain a structure required for stabilization or function,
or alternatively, the hydrophobic C terminus may interact with, or is
anchored within, membranes ensuring the proper conformation of PS. It
is also possible that the conformation of the whole protein maintained
by the C terminus allows the binding of a limiting factor (protein)
with some portion(s) of PS outside the C terminus.
The hydrophobic C terminus of PS could be a therapeutic target for the
treatment of FAD because the development of small compounds that bind
to the C terminus of PS and mimic these modifications may destabilize
and reduce the total amount of "functional" mt PS proteins, which
promote overproduction of A 42, in the brains of patients with FAD
linked to PS mutations. Future studies of the roles of the C terminus
of PS will pave the way for understanding the pathomechanisms as well
as for the development of novel therapeutic strategies for FAD and
possibly sporadic AD.
 |
FOOTNOTES |
Received July 14, 1999; revised Sept. 10, 1999; accepted Sept. 29, 1999.
This work was supported by Grants-in-Aid from the Ministry of Health
and Welfare, the Ministry of Education, Science, Culture and Sports,
and CREST of Japan Science and Technology Corporation, Japan. We
thank Drs. J. Q. Trojanowski for helpful comments on this
manuscript, H. R. Kaback for valuable suggestions on the structure
and stability of membrane proteins, Hiroshi Iwata for help in
immunoprecipitation experiments, and Takeda Chemical Industries for
continuous support.
Correspondence should be addressed to Dr. Takeshi Iwatsubo, Department
of Neuropathology and Neuroscience, Graduate School of Pharmaceutical
Sciences, University of Tokyo 7-3-1 Bunkyoku Hongo Tokyo 113-0033, Japan. E-mail: iwatsubo{at}mol.f.u-tokyo.ac.jp.
 |
REFERENCES |
-
Asami-Odaka A,
Ishibashi Y,
Kikuchi T,
Kitada C,
Suzuki N
(1995)
Long amyloid
-protein secreted from wild-type human neuroblastoma IMR-32 cells.
Biochemistry
34:10272-10278[Medline]. -
Baumeister R,
Leimer U,
Zweckbronner I,
Jakubek C,
Grünberg J,
Haass C
(1997)
Human presenilin-1, but not familial Alzheimer's disease (FAD) mutants, facilitate Caenorhabditis elegans Notch signalling independently of proteolytic processing.
Genes Function
1:149-159[Medline].
-
Borchelt DR,
Thinakaran G,
Eckman CB,
Lee MK,
Davenport F,
Ratovitsky T,
Prada CM,
Kim G,
Seekins S,
Yager D,
Slunt HH,
Wang R,
Seeger M,
Levey AI,
Gandy SE,
Copeland NG,
Jenkins NA,
Price DL,
Younkin SG,
Sisodia SS
(1996)
Familial Alzheimer's disease-linked presenilin 1 variants elevate A
1-42/1-40 ratio in vitro and in vivo.
Neuron
17:1005-1013[Web of Science][Medline]. -
Botfield MC,
Wilson TH
(1989)
Carboxyl-terminal truncations of the melibiose carrier of Escherichia coli.
J Biol Chem
264:11643-11648[Abstract/Free Full Text].
-
Capell A,
Grünberg J,
Pesold B,
Diehlmann A,
Citron M,
Nixon R,
Beyreuther K,
Selkoe DJ,
Haass C
(1998)
The proteolytic fragments of the Alzheimer's disease-associated presenilin-1 form heterodimers and occur as a 100-150-kDa molecular mass complex.
J Biol Chem
273:3205-3211[Abstract/Free Full Text].
-
Citron M,
Westaway D,
Xia W,
Carlson G,
Diehl T,
Levesque G,
Johnson-Wood K,
Lee M,
Seubert P,
Davis A,
Kholodenko D,
Motter R,
Sherrington R,
Perry B,
Yao H,
Strome R,
Lieberburg I,
Rommens J,
Kim S,
Schenk D,
Fraser P,
St. George-Hyslop P,
Selkoe DJ
(1997)
Mutant presenilins of Alzheimer's disease increase production of 42-residue amyloid
-protein in both transfected cells and transgenic mice.
Nat Med
3:67-72[Web of Science][Medline]. -
Citron M,
Eckman CB,
Diehl TS,
Corcoran C,
Ostaszewski BL,
Xia W,
Levesque G,
St. George-Hyslop P,
Younkin SG,
Selkoe DJ
(1998)
Additive effects of PS1 and APP mutations on secretion of the 42-residue amyloid
-protein.
Neurobiol Dis
5:107-116[Web of Science][Medline]. -
De Strooper B,
Saftig P,
Craessaerts K,
Vanderstichele H,
Guhde G,
Annaert W,
Von Figura K,
Van Leuven F
(1998)
Deficiency of presenilin-1 inhibits the normal cleavage of amyloid precursor protein.
Nature
391:387-390[Medline].
-
De Strooper B,
Annaert W,
Cupers P,
Saftig P,
Craessaerts K,
Mumm JS,
Schroeter EH,
Schrijvers V,
Wolfe MS,
Ray WJ,
Goate A,
Kopan R
(1999)
A presenilin-1-dependent
-secretase-like protease mediates release of Notch intracellular domain.
Nature
398:518-522[Medline]. -
Doan A,
Thinakaran G,
Borchelt DR,
Slunt HH,
Ratovitsky T,
Podlisny M,
Selkoe DJ,
Seegar M,
Gandy SE,
Price DL,
Sisodia SS
(1996)
Protein topology of presenilin 1.
Neuron
17:1023-1030[Web of Science][Medline].
-
Duff K,
Eckman C,
Zehr C,
Yu X,
Prada C-M,
Perez-tur J,
Hutton M,
Buee L,
Harigaya Y,
Yager D,
Morgan D,
Gordon MN,
Holcomb L,
Refolo L,
Zenk B,
Hardy J,
Younkin S
(1996)
Increased amyloid-
42(43) in brains of mice expressing mutant presenilin 1.
Nature
383:710-713[Medline]. -
Fukumoto H,
Tomita T,
Matsunaga H,
Ishibashi Y,
Saido TC,
Iwatsubo T
(1999)
Primary cultures of neuronal and non-neuronal rat brain cells secrete similar proportions of amyloid
peptides ending at A 40 and A 42.
NeuroReport
10:2965-2969[Web of Science][Medline]. -
Hardy J
(1997)
The Alzheimer family of diseases: many etiologies, one pathogenesis?
Proc Natl Acad Sci USA
94:2095-2097[Free Full Text].
-
Huang KS,
Bayley H,
Liao MJ,
London E,
Khorana HG
(1981)
Refolding of an integral membrane protein. Denaturation, renaturation, and reconstitution of intact bacteriorhodopsin and two proteolytic fragments.
J Biol Chem
256:3802-3809[Abstract/Free Full Text].
-
Iwatsubo T,
Odaka A,
Suzuki N,
Mizusawa H,
Nukina N,
Ihara Y
(1994)
Visualization of A
42(43) and A 40 in senile plaques with end-specific A monoclonals: evidence that an initially deposited species is A 42(43).
Neuron
13:45-53[Web of Science][Medline]. -
Iwatsubo T,
Mann DMA,
Odaka A,
Suzuki N,
Ihara Y
(1995)
Amyloid
protein (A ) deposition: A 42(43) precedes A 40 in Down syndrome.
Ann Neurol
37:294-299[Web of Science][Medline]. -
Jarrett JT,
Lansbury Jr PT
(1993)
Seeding "one-dimensional crystallization" of amyloid: a pathogenic mechanism in Alzheimer's disease and scrapie?
Cell
73:1055-1058[Web of Science][Medline].
-
Kim TW,
Pettingell WH,
Hallmark OG,
Moir RD,
Wasco W,
Tanzi RE
(1997)
Endoproteolytic cleavage and proteasomal degradation of presenilin 2 in transfected cells.
J Biol Chem
272:11006-11010[Abstract/Free Full Text].
-
Levitan D,
Greenwald I
(1995)
Facilitation of lin-12-mediated signalling by sel-12, a Caenorhabditis elegans S182 Alzheimer's disease gene.
Nature
377:351-354[Medline].
-
Levy-Lahad E,
Wasco W,
Poorkaj P,
Romano DM,
Oshima J,
Pettingell WH,
Yu C-E,
Jondro PD,
Schmidt SD,
Wang K,
Crowley AC,
Fu Y-H,
Guenette SY,
Galas D,
Nemens E,
Wijsman EM,
Bird TD,
Schellenberg GD,
Tanzi RE
(1995)
Candidate gene for the chromosome 1 familial Alzheimer's disease locus.
Science
269:973-977[Abstract/Free Full Text].
-
Li X,
Greenwald I
(1998)
Additional evidence for an eight-transmembrane-domain topology for Caenorhabditis elegans and human presenilins.
Proc Natl Acad Sci USA
95:7109-7114[Abstract/Free Full Text].
-
Ratovitski T,
Slunt HH,
Thinakaran G,
Price DL,
Sisodia SS,
Borchelt DR
(1997)
Endoproteolytic processing and stabilization of wild-type and mutant presenilin.
J Biol Chem
272:24536-24541[Abstract/Free Full Text].
-
Roepe PD,
Zbar RI,
Sarkar HK,
Kaback HR
(1989)
A five-residue sequence near the carboxyl terminus of the polytopic membrane protein lac permease is required for stability within the membrane.
Proc Natl Acad Sci USA
86:3992-3996[Abstract/Free Full Text].
-
Saras J,
Engstrom U,
Gonez LJ,
Heldin CH
(1997)
Characterization of the interactions between PDZ domains of the protein-tyrosine phosphatase PTPL1 and the carboxyl-terminal tail of Fas.
J Biol Chem
272:20979-20981[Abstract/Free Full Text].
-
Saura CA,
Tomita T,
Davenport F,
Harris CL,
Iwatsubo T,
Thinakaran G
(1999)
Evidence that intramolecular associations between presenilin domains are obligatory for endoproteolytic processing.
J Biol Chem
274:13818-13823[Abstract/Free Full Text].
-
Selkoe DJ
(1991)
The molecular pathology of Alzheimer's disease.
Neuron
6:487-498[Web of Science][Medline].
-
Selkoe DJ
(1994)
Cell biology of the amyloid
-protein precursor and the mechanism of Alzheimer's disease.
Annu Rev Cell Biol
10:373-403[Web of Science]. -
Shen J,
Bronson RT,
Chen DF,
Xia W,
Selkoe DJ,
Tonegawa S
(1997)
Skeletal and CNS defects in presenilin-1-deficient mice.
Cell
89:629-639[Web of Science][Medline].
-
Sherrington R,
Rogaev EI,
Liang Y,
Rogaeva EA,
Levesque G,
Ikeda M,
Chi H,
Lin C,
Li G,
Holman K,
Tsuda T,
Mar L,
Foncin J-F,
Bruni AC,
Montesi MP,
Sorbi S,
Rainero I,
Pinessi L,
Nee L,
Chumakov I,
Pollen D,
Brookes A,
Sanseau P,
Polinsky RJ,
Wasco W,
Da Silva HAR,
Haines JL,
Pericak-Vance MA,
Tanzi RE,
Roses AD,
Fraser PE,
Rommens JM,
St. George-Hyslop PH
(1995)
Cloning of a gene bearing missense mutations in early-onset familial Alzheimer's disease.
Nature
375:754-760[Medline].
-
Song W,
Nadeau P,
Yuan M,
Yang X,
Shen J,
Yankner BA
(1999)
Proteolytic release and nuclear translocation of notch-1 are induced by presenilin-1 and impaired by pathogenic presenilin-1 mutations.
Proc Natl Acad Sci USA
96:6959-6963[Abstract/Free Full Text].
-
Songyang Z,
Fanning AS,
Fu C,
Xu J,
Marfatia SM,
Chishti AH,
Crompton A,
Chan AC,
Anderson JM,
Cantley LC
(1997)
Recognition of unique carboxyl-terminal motifs by distinct PDZ domains.
Science
275:73-77[Abstract/Free Full Text].
-
Steiner H,
Capell A,
Pesold B,
Citron M,
Kloetzel PM,
Selkoe DJ,
Romig H,
Mendla K,
Haass C
(1998)
Expression of Alzheimer's disease-associated presenilin-1 is controlled by proteolytic degradation and complex formation.
J Biol Chem
273:32322-32331[Abstract/Free Full Text].
-
Steiner H,
Romig H,
Grim MG,
Philipp U,
Pesold B,
Citron M,
Baumeister R,
Haass C
(1999)
The biological and pathological function of the presenilin-1
exon 9 mutation is independent of its defect to undergo proteolytic processing.
J Biol Chem
274:7615-7618[Abstract/Free Full Text]. -
Struhl G,
Greenwald I
(1999)
Presenilin is required for activity and nuclear access of Notch in Drosophila.
Nature
398:522-525[Medline].
-
Sudoh S,
Kawamura Y,
Sato S,
Wang R,
Saido TC,
Oyama F,
Sakaki Y,
Komano H,
Yanagisawa K
(1998)
Presenilin 1 mutations linked to familial Alzheimer's disease increase the intracellular levels of amyloid
-protein 1-42 and its N-terminally truncated variant(s) which are generated at distinct sites.
J Neurochem
71:1535-1543[Medline]. -
Suzuki N,
Cheung TT,
Cai X-D,
Odaka A,
Otvos Jr L,
Eckman C,
Golde TE,
Younkin SG
(1994)
An increased percentage of long amyloid
-protein is secreted by familial amyloid -protein precursor ( APP717) mutants.
Science
264:1336-1340[Abstract/Free Full Text]. -
Thinakaran G,
Borchelt DR,
Lee MK,
Slunt HH,
Spitzer L,
Kim G,
Ratovitsky T,
Davenport F,
Nordstedt C,
Seeger M,
Hardy J,
Levey AI,
Gandy SE,
Jenkins NA,
Copeland NG,
Price DL,
Sisodia SS
(1996)
Endoproteolysis of presenilin 1 and accumulation of processed derivatives in vivo.
Neuron
17:181-190[Web of Science][Medline].
-
Thinakaran G,
Harris CL,
Ratovitski T,
Davenport F,
Slunt HH,
Price DL,
Borchelt DR,
Sisodia SS
(1997)
Evidence that levels of presenilins (PS1 and PS2) are coordinately regulated by competition for limiting cellular factors.
J Biol Chem
272:28415-28422[Abstract/Free Full Text].
-
Tomita T,
Maruyama K,
Saido TC,
Kume H,
Shinozaki K,
Tokuhiro S,
Capell A,
Walter J,
Grünberg J,
Haass C,
Iwatsubo T,
Obata K
(1997)
The presenilin 2 mutation (N141I) linked to familial Alzheimer disease (Volga German families) increases the secretion of amyloid
protein ending at the 42nd (or 43rd) residue.
Proc Natl Acad Sci USA
94:2025-2030[Abstract/Free Full Text]. -
Tomita T,
Tokuhiro S,
Hashimoto T,
Aiba K,
Saido TC,
Maruyama K,
Iwatsubo T
(1998)
Molecular dissection of domains in mutant presenilin 2 that mediate overproduction of amyloidogenic forms of amyloid
peptides. Inability of truncated forms of PS2 with familial Alzheimer's disease mutation to increase secretion of A 42.
J Biol Chem
273:21153-21160[Abstract/Free Full Text]. -
Wolfe MS,
Xia W,
Ostaszewski BL,
Diehl TS,
Kimberly WT,
Selkoe DJ
(1999)
Two transmembrane aspartates in presenilin-1 required for presenilin endoproteolysis and
-secretase activity.
Nature
398:513-517[Medline]. -
Wong PC,
Zheng H,
Chen H,
Becher MW,
Sirinathsinghji DJ,
Trumbauer ME,
Chen HY,
Price DL,
Van der Ploeg LH,
Sisodia SS
(1997)
Presenilin 1 is required for Notch1 and Dll1 expression in the paraxial mesoderm.
Nature
387:288-292[Medline].
-
Ye Y,
Lukinova N,
Fortini ME
(1999)
Neurogenic phenotypes and altered Notch processing in Drosophila Presenilin mutants.
Nature
398:525-529[Medline].
Copyright © 1999 Society for Neuroscience 0270-6474/99/192410627-08$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
C. Sato, S. Takagi, T. Tomita, and T. Iwatsubo
The C-Terminal PAL Motif and Transmembrane Domain 9 of Presenilin 1 Are Involved in the Formation of the Catalytic Pore of the {gamma}-Secretase
J. Neurosci.,
June 11, 2008;
28(24):
6264 - 6271.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Isoo, C. Sato, H. Miyashita, M. Shinohara, N. Takasugi, Y. Morohashi, S. Tsuji, T. Tomita, and T. Iwatsubo
Abeta42 Overproduction Associated with Structural Changes in the Catalytic Pore of {gamma}-Secretase: COMMON EFFECTS OF PEN-2 N-TERMINAL ELONGATION AND FENOFIBRATE
J. Biol. Chem.,
April 27, 2007;
282(17):
12388 - 12396.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Sato, Y. Morohashi, T. Tomita, and T. Iwatsubo
Structure of the Catalytic Pore of {gamma}-Secretase Probed by the Accessibility of Substituted Cysteines.
J. Neurosci.,
November 15, 2006;
26(46):
12081 - 12088.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Morohashi, T. Kan, Y. Tominari, H. Fuwa, Y. Okamura, N. Watanabe, C. Sato, H. Natsugari, T. Fukuyama, T. Iwatsubo, et al.
C-terminal Fragment of Presenilin Is the Molecular Target of a Dipeptidic {gamma}-Secretase-specific Inhibitor DAPT (N-[N-(3,5-Difluorophenacetyl)-L-alanyl]-S-phenylglycine t-Butyl Ester)
J. Biol. Chem.,
May 26, 2006;
281(21):
14670 - 14676.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Shiraishi, T. Marutani, H.-Q. Wang, Y. Maeda, Y. Kurono, A. Takashima, W. Araki, M. Nishimura, K. Yanagisawa, and H. Komano
Reconstitution of {gamma}-secretase by truncated presenilin (PS) fragments revealed that PS C-terminal transmembrane domain is critical for formation of {gamma}-secretase complex
Genes Cells,
January 1, 2006;
11(1):
83 - 93.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Watanabe, T. Tomita, C. Sato, T. Kitamura, Y. Morohashi, and T. Iwatsubo
Pen-2 Is Incorporated into the {gamma}-Secretase Complex through Binding to Transmembrane Domain 4 of Presenilin 1
J. Biol. Chem.,
December 23, 2005;
280(51):
41967 - 41975.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Urano, I. Hayashi, N. Isoo, P. C. Reid, Y. Shibasaki, N. Noguchi, T. Tomita, T. Iwatsubo, T. Hamakubo, and T. Kodama
Association of active {gamma}-secretase complex with lipid rafts
J. Lipid Res.,
May 1, 2005;
46(5):
904 - 912.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Niimura, N. Isoo, N. Takasugi, M. Tsuruoka, K. Ui-Tei, K. Saigo, Y. Morohashi, T. Tomita, and T. Iwatsubo
Aph-1 Contributes to the Stabilization and Trafficking of the {gamma}-Secretase Complex through Mechanisms Involving Intermolecular and Intramolecular Interactions
J. Biol. Chem.,
April 1, 2005;
280(13):
12967 - 12975.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Qi-Takahara, M. Morishima-Kawashima, Y. Tanimura, G. Dolios, N. Hirotani, Y. Horikoshi, F. Kametani, M. Maeda, T. C. Saido, R. Wang, et al.
Longer Forms of Amyloid {beta} Protein: Implications for the Mechanism of Intramembrane Cleavage by {gamma}-Secretase
J. Neurosci.,
January 12, 2005;
25(2):
436 - 445.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Bergman, H. Laudon, B. Winblad, J. Lundkvist, and J. Naslund
The Extreme C Terminus of Presenilin 1 Is Essential for {gamma}-Secretase Complex Assembly and Activity
J. Biol. Chem.,
October 29, 2004;
279(44):
45564 - 45572.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Hayashi, Y. Urano, R. Fukuda, N. Isoo, T. Kodama, T. Hamakubo, T. Tomita, and T. Iwatsubo
Selective Reconstitution and Recovery of Functional {gamma}-Secretase Complex on Budded Baculovirus Particles
J. Biol. Chem.,
September 3, 2004;
279(36):
38040 - 38046.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Takahashi, I. Hayashi, Y. Tominari, K. Rikimaru, Y. Morohashi, T. Kan, H. Natsugari, T. Fukuyama, T. Tomita, and T. Iwatsubo
Sulindac Sulfide Is a Noncompetitive gamma -Secretase Inhibitor That Preferentially Reduces Abeta 42 Generation
J. Biol. Chem.,
May 9, 2003;
278(20):
18664 - 18670.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Takasugi, Y. Takahashi, Y. Morohashi, T. Tomita, and T. Iwatsubo
The Mechanism of gamma -Secretase Activities through High Molecular Weight Complex Formation of Presenilins Is Conserved in Drosophila melanogaster and Mammals
J. Biol. Chem.,
December 13, 2002;
277(51):
50198 - 50205.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Rozmahel, H. T. J. Mount, F. Chen, V. Nguyen, J. Huang, S. Erdebil, J. Liauw, G. Yu, H. Hasegawa, Y. Gu, et al.
Alleles at the Nicastrin locus modify presenilin 1- deficiency phenotype
PNAS,
October 29, 2002;
99(22):
14452 - 14457.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Morohashi, N. Hatano, S. Ohya, R. Takikawa, T. Watabiki, N. Takasugi, Y. Imaizumi, T. Tomita, and T. Iwatsubo
Molecular Cloning and Characterization of CALP/KChIP4, a Novel EF-hand Protein Interacting with Presenilin 2 and Voltage-gated Potassium Channel Subunit Kv4
J. Biol. Chem.,
April 19, 2002;
277(17):
14965 - 14975.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Leissring, T. R. Yamasaki, W. Wasco, J. D. Buxbaum, I. Parker, and F. M. LaFerla
Calsenilin reverses presenilin-mediated enhancement of calcium signaling
PNAS,
July 18, 2000;
97(15):
8590 - 8593.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Steiner, T. Revesz, M. Neumann, H. Romig, M. G. Grim, B. Pesold, H. A. Kretzschmar, J. Hardy, J. L. Holton, R. Baumeister, et al.
A Pathogenic Presenilin-1 Deletion Causes Abberrant Abeta 42 Production in the Absence of Congophilic Amyloid Plaques
J. Biol. Chem.,
March 2, 2001;
276(10):
7233 - 7239.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Iwata, T. Tomita, K. Maruyama, and T. Iwatsubo
Subcellular Compartment and Molecular Subdomain of beta -Amyloid Precursor Protein Relevant to the Abeta 42-promoting Effects of Alzheimer Mutant Presenilin 2
J. Biol. Chem.,
June 8, 2001;
276(24):
21678 - 21685.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E.-K. Choi, N. F. Zaidi, J. S. Miller, A. C. Crowley, D. E. Merriam, C. Lilliehook, J. D. Buxbaum, and W. Wasco
Calsenilin Is a Substrate for Caspase-3 That Preferentially Interacts with the Familial Alzheimer's Disease-associated C-terminal Fragment of Presenilin 2
J. Biol. Chem.,
May 25, 2001;
276(22):
19197 - 19204.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Tomita, T. Watabiki, R. Takikawa, Y. Morohashi, N. Takasugi, R. Kopan, B. De Strooper, and T. Iwatsubo
The First Proline of PALP Motif at the C Terminus of Presenilins Is Obligatory for Stabilization, Complex Formation, and gamma -Secretase Activities of Presenilins
J. Biol. Chem.,
August 24, 2001;
276(35):
33273 - 33281.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. A. Saura, T. Tomita, S. Soriano, M. Takahashi, J.-Y. Leem, T. Honda, E. H. Koo, T. Iwatsubo, and G. Thinakaran
The Nonconserved Hydrophilic Loop Domain of Presenilin (PS) Is Not Required for PS Endoproteolysis or Enhanced Abeta 42 Production Mediated by Familial Early Onset Alzheimer's Disease-linked PS Variants
J. Biol. Chem.,
May 26, 2000;
275(22):
17136 - 17142.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|