 |
Previous Article | Next Article 
The Journal of Neuroscience, December 15, 1999, 19(24):10789-10802
Cloning of Components of a Novel Subthreshold-Activating
K+ Channel with a Unique Pattern of Expression in the
Cerebral Cortex
M. J.
Saganich1,
E.
Vega-Saenz
de Miera1,
M. S.
Nadal1,
H.
Baker4,
W. A.
Coetzee1, 3, and
B.
Rudy1, 2
1 Departments of Physiology and Neuroscience,
2 Biochemistry, and 3 Pediatric Cardiology, New
York University School of Medicine, New York, New York, 10016, and
4 Cornell University Medical College, Burke Medical
Research Institute, White Plains, New York 10605
 |
ABSTRACT |
Potassium channels that are open at very negative membrane
potentials govern the subthreshold behavior of neurons. These channels contribute to the resting potential and help regulate the degree of
excitability of a neuron by affecting the impact of synaptic inputs and
the threshold for action potential generation. They can have large
influences on cell behavior even when present at low concentrations
because few conductances are active at these voltages. We report the
identification of a new K+ channel pore-forming
subunit of the ether-à-go-go (Eag) family, named Eag2, that
expresses voltage-gated K+ channels that have
significant activation at voltages around 100 mV. Eag2 expresses
outward-rectifying, non-inactivating voltage-dependent K+ currents resembling those of Eag1, including a
strong dependence of activation kinetics on prepulse potential.
However, Eag2 currents start activating at subthreshold potentials that
are 40-50 mV more negative than those reported for Eag1. Because they
activate at such negative voltages and do not inactivate, Eag2 channels will contribute sustained outward currents down to the most negative membrane potentials known in neurons. Although Eag2 mRNA levels in
whole brain appear to be low, they are highly concentrated in a few
neuronal populations, most prominently in layer IV of the cerebral
cortex. This highly restricted pattern of cortical expression is unlike
that of any other potassium channel cloned to date and may indicate
specific roles for this channel in cortical processing. Layer IV
neurons are the main recipient of the thalamocortical input. Given
their functional properties and specific distribution, Eag2 channels
may play roles in the regulation of the behavioral state-dependent
entry of sensory information to the cerebral cortex.
Key words:
potassium channels; Eag; cerebral cortex; in
situ hybridization; molecular cloning; rat; layer IV; M
currents
 |
INTRODUCTION |
Potassium channels have important
functions as modulators of neuronal excitability (Llinas, 1988 ;
McCormick, 1990 ; Baxter and Byrne, 1991 ; Hille, 1992 ). Their large
diversity and differential cellular and subcellular neuronal expression
contribute to the specific electrical behavior of distinct neurons
(Llinas, 1988 ; Rudy, 1988 ; Latorre et al., 1989 ; McCormick, 1990 ;
Baxter and Byrne, 1991 ; Hille, 1992 ). Moreover, because
K+ channels are often key targets of the
second messenger cascades activated by neurotransmitters and
neuropeptides (Klein et al., 1982 ; Kaczmareck and Levitan, 1987 ;
Levitan, 1988 ; Hille, 1992 ), their diversity and differential neuronal
expression also contribute to the specificity of neuromodulatory responses.
Of special interest are those K+ channels
that are open at membrane potentials below the threshold for action
potential generation. These channels can contribute to the resting
potential and regulate the degree of excitability of a neuron. By
activating or blocking the activity of such channels, neuromodulators
can control the responsiveness of the cell to synaptic inputs
(Siegelbaum et al., 1982 ; Adams and Galvan, 1986 ; Brown, 1988 ; North,
1989 ; Yamada et al., 1989 ; Hille, 1992 ). These regulations can
profoundly affect the function of neuronal circuits. For example, a
change in firing properties during the transition from the sleep to the
awake state produced by the neurotransmitter-mediated closing of a
subthreshold-operating K+ channel in
thalamocortical neurons is thought to be responsible for the
reestablishment of the faithful transmission of sensory information
from the thalamus to the neocortex (Steriade et al., 1990 , 1993 ;
McCormick, 1992 ).
The application of molecular methods can be useful not only to identify
the protein components of known K+
channels, but it can also lead to the discovery of
K+ channel types that had not been
previously identified through electrophysiological and pharmacological
analysis (Pongs, 1992 ; Chandy and Gutman, 1995 ; Jan and Jan, 1997 ; Wang
et al., 1998 ; Coetzee et al., 1999 ; Ganetzky et al., 1999 ; Rudy et al.,
1999 ). Here we report the cloning of a cDNA encoding the principal
components of a novel subthreshold-activating voltage-gated
K+ channel expressed by only a select
population of CNS neurons. The protein (Eag2) is a member of the
ether-à-go-go (Eag) family of K+
channel pore-forming subunits (Drysdale et al., 1991 ; Warmke et al.,
1991 ; Ludwig et al., 1994 ; Warmke and Ganetzky, 1994 ; Robertson et al.,
1996 ) (for review, see Ganetzky et al., 1999 ). It is most similar to
Eag1, the one presently known mammalian homolog of the
Drosophila Eag gene, and has thus been named Eag2.
Some K+ channel proteins are widely
distributed in brain, whereas others have a more restricted pattern of
expression and may have functions that are specific to few neuronal
systems (Chandy and Gutman, 1995 ; Jan and Jan, 1997 ; Coetzee et
al., 1999 ; Rudy et al., 1999 ). Eag2 is a striking example of the latter group.
Members of the Eag family of K+ channels
display intriguing electrophysiological properties in heterologous
expression systems and have been found to be the cause of human cardiac
genetic disease (Curran et al., 1995 ; Sanguinetti, 1999 ), highlighting
the importance of this channel family. However, little is known about
their functions in native brain tissue. As in the case of Eag1, we find
that when expressed in Xenopus oocytes, Eag2 expresses
voltage-gated K+ channels with unusual
electrophysiological properties, including no measurable inactivation,
and a strong dependence of activation kinetics on prepulse potential
(Cole-Moore shift) (Ludwig et al., 1994 ; Robertson et al., 1996 ; Terlau
et al., 1996 ). However, in contrast to Eag1, Eag2 activates at
significantly more negative membrane potentials than Eag1. Thus, Eag2
channels could have strong influences on the subthreshold behavior of
neurons containing these channels. The electrophysiological and
histological studies presented here provide the basis for the
identification of native Eag2 channels in brain neurons.
 |
MATERIALS AND METHODS |
Cloning of Eag2. RNA (1 µg) prepared from
rat thalami (see below) was reverse-transcribed using
Superscript reverse transcriptase (Life Technologies, Grand Island, NY)
using random hexamers as primers. One microliter of this RT reaction
was used as template in each of the following PCRs (with the
exception of 5' RACE reactions). All reactions (with the exception of
5' RACE) were performed using PCR reagents from Perkin-Elmer following
the manufacturers protocol with 2 mM MgCl and the following
thermocycler protocol: 94° 1 min; 55° 1 min; 72° 1 min, 35 cycles. All PCR products (including 5' RACE) were cloned directly into
pCR2.1-TOPO vector (Invitrogen, Carlsbad, CA), with the exception of
fragment F (see below), which was cloned into the pGEM-TEasy vector
(Promega, Madison, WI), for sequencing and/or further manipulations.
An alignment of all known Eag1 protein sequences was used to design a
pair of degenerate primers: forward
CCCTACGACGTGAT(ACT)AA(CT)GC(N)TT(CT)GA and reverse
CCAGGTGCTCAC(N)A(CT)(GA)TA(AG)TCCAT. These primers were used in a
PCR using rat thalamic cDNA as a template and yielded a single novel
636 bp partial Eag sequence (fragment A) that was 77% identical at the
nucleotide level to the rat Eag1 (rEag1) cloned previously by Ludwig et
al., (1994) . No amplification of rEag1 was observed in this or any
other PCR reaction that used thalamic cDNA as template. This was not
surprising because Eag1 is not expressed in rat thalamus (Ludwig et
al., 1994 ; M. Saganich and B. Rudy, unpublished observations).
At the same time, a screen of the human expressed sequence tag (EST)
database for Eag homologs revealed a new (1700 bp) partial human Eag
sequence (U69185), which was 60% identical at the amino acid level to
rEag1. To obtain the rat homolog of this apparently new Eag protein,
degenerate primers based on the human EST were developed: forward
CGGAAGGTTTT(CT)(AG)A(N)GA(AG)CA(CT)C and reverse CTGCTCGGG
(TGA)AT(TGCA)GG(GA)TA(GA)AA. This PCR yielded a single 1089 bp product
(fragment B) that was 96% identical to the human EST and 58%
identical to rEag1 at the amino acid level. A PCR with specific primers
derived from the 3' end region of fragment A (forward
TGTATGCCAACACCAACCG) and the 5' end region of fragment B (reverse
ACACTCTCTCCAGCATGGTA) produced a DNA fragment of 333 bp (fragment C),
indicating that nonoverlapping fragments A and B were part of the same
transcript and defined a novel partial Eag protein (Eag2), incomplete
at the 5' and 3' ends.
The 3' end of the clone was completed by another PCR using a forward
primer derived from the sequence of fragment B
(CGGAAGGTTTT(CT)(AG)A(N)GA(AG)CA(CT)C) and a reverse primer from the 3'
untranslated region (UTR) of the human EST: CAGAATCCAGCTGGACATGC. This
reaction yielded a single 1526 bp product (fragment D) and included a
stop codon (TAA) in frame and 182 bp of 3' UTR sequence.
Completion of the 5' end of Eag2 was achieved by two rounds of 5' rapid
amplification of cDNA ends (5' RACE) using an adaptor-ligated cDNA
library from rat brain (Clontech, Palo Alto, CA) and Advantage cDNA
polymerase (which has 3' 5' proofreading activity) following the
manufacturers protocols (Clontech). The initial RACE reaction used a
gene-specific primer derived from the 3' end of fragment C
(GCGTCACACTCTCTCCAGCATGGTA) and adapter primer 1 (AP1) (supplied by the
manufacturer). From this reaction we isolated fragment E, which
included 1589 bp of novel sequence but did not reach the starting
methionine. A nested RACE reaction was performed with gene specific
primer AGGTAATGGTCCAGTTTCCTA, derived from the sequence of fragment G
(see below), and nested adapter primer 2 (AP2) (supplied by the
manufacturer) using reaction products from the first RACE diluted 1:50
in ddH2O as template. This reaction resulted in a
1248 bp clone (fragment F) that included the putative starting
methionine and 225 bp of 5' UTR sequence. The thermocycling protocol
was 94° 1 min; 5 cycles: 94° 30 sec, 72° 4 min; 5 cycles: 94°
30 sec, 70° 4 min; 25 cycles: 94° 20 sec, 68° 4 min for the first
RACE reaction, and 94° 1 min; 55° 1 min; 72° 1 min, 35 cycles for
the nested reaction. RACE products from both the initial and nested
RACE reactions were identified by Southern blot (Sambrook et al., 1989 )
probed with a 930 bp N-terminal fragment of Eag2 (fragment G) obtained
by PCR using forward degenerate primer
AATGCCCA(AG)AT(ACT)GT(N)GA(CT)TGG, derived from the alignment of known
Eag sequences, and specific primer AGGTAATGGTCCAGTTTCCTA derived from
the sequence of fragment A. RACE products, which hybridized with the
Eag2 fragment G probe, were subsequently gel-purified using Qiaex II
(Qiagen, Valancia, CA) following manufacturers instructions, ligated
into the pCR2.1-TOPO vector, and transformed into chemically competent
DH5 (Life Technologies) by a standard heat-shock method (Sambrook et
al., 1989 ). Individual clones were identified by colony hybridization
(Sambrook et al., 1989 ) using Eag2 fragment G probe.
The full-length clone was completed by the ligation of restriction
fragments of the overlapping RACE products E and F with a restriction
fragment of D in pCR2.1-TOPO vector using restriction sites
AatII and BsmI. Briefly, recombinant plasmids
containing fragment F were restricted with NotI, located in
the multiple cloning site (MCS) of pGEM-TEasy and AatII, and
this fragment was gel-purified. Recombinant plasmids containing
fragment E were restricted with AatII and BsmI
and gel-purified. Fragment D was restricted using NotI
(located in the MCS of pCR2.1-TOPO) and BsmI and also
gel-purified. All three purified fragments were ligated in a single
reaction, and plasmids containing the full sequence in proper
orientation were selected, resulting in a full-length clone in the
pCR2.1-TOPO vector that was fully sequenced on both strands. For oocyte
expression, the full-length Eag2 clone was subcloned into pSGEM vector
(containing the 5' and 3' UTR of Xenopus Globin) (Liman
et al., 1992 ) using BamHI and EcoRI restriction sites. Two Eag2 isolates were used as templates for the synthesis of
cRNA (see below), and both expressed the same currents in
Xenopus oocytes.
Preparation of cDNA probes for Northern/Southern blot analysis
and in situ hybridization histochemistry. Fragments G
(bp 92-1022) and B (bp 1650-2708) from the NH2
and C termini, respectively, were prepared by PCR and used to
synthesize radiolabeled probes for Southern blot, in situ
hybridization, and Northern blot analysis. Both fragments showed <80%
nucleotide identity with other sequences in the Eag family. These two
fragments gave identical results, and there was no cross-reactivity
with Eag1 under the hybridization conditions used in our experiments
because Eag2 and Eag1 probes labeled distinct structures in the brain
and recognized bands of different sizes in in situ
hybridizations and Northern blots [data not shown; also see Ludwig et
al. (1994) ].
Fragments G and B were released from the pCR2.1-TOPO vector with
EcoRI, gel-purified, and phenol/chloroform-extracted
followed by EtOH precipitation. Radioactive probes were obtained by
labeling these fragments by the random hexamer primer method with
32P- -dCTP for Northern and Southern
blot analysis, or with 35S- -dCTP for
in situ hybridization histochemistry using the Roche Molecular Biochemicals Random Prime cDNA labeling kit following manufacturers instructions.
Preparation of poly(A) RNA. Total RNA from thalamus,
olfactory bulb, and cerebral cortex were isolated from freshly
dissected brains obtained from 20-d-old Sprague Dawley rats by the acid guanidinium-thiocyanate-phenol-chloroform procedure (Chomczynski and
Sacchi, 1987 ). The RNA was poly(A)-selected by oligo-dT column chromatography (type 2 poly-T Sepharose, Collaborative Biomedical Products) following the protocol of Sambrook et al. (1989) . The RNA was
ethanol-precipitated twice and resuspended in RNase-free water at a
concentration of ~1 mg/ml and stored at 70°C.
RT-PCR analysis of Eag2 expression. The tissue
distribution of Eag2 mRNAs was determined using RT-PCR from poly(A) RNA
derived from several rat tissues (Clontech). Poly(A) RNA (1 µg) from
each tissue was reverse-transcribed using Superscript reverse
transcriptase (Life Technologies) using random hexamers as primers in a
total volume of 25 µl. One microliter of each RT reaction was used as template for PCR. Eag2 specific primers were forward
TGTATGCCAACACCAACCG and reverse ACACTCTCTCCAGCATGGTA. Glyceraldehyde
3-phosphate dehydrogenase (GAPDH) primers (forward
ACCACAGTCCATGCCATCAC; reverse TCCACCACCCTGTTGCTGTA) were used as
controls to determine the integrity of the cDNA synthesized in the RT
reaction. The PCR thermocycling protocol was 94° 45 sec.; 55° 45 sec.; 72° 45 sec., 25 cycles.
Northern blot analysis. Olfactory bulb, cerebral cortex, and
testes mRNAs were subjected to electrophoresis in denaturing formaldehyde gels and transferred to Duralon-UV membranes (Stratagene, La Jolla, CA) as previously described (Rudy et al., 1988 ). The Northern
blots were hybridized at 68°C with the
32P-radiolabeled DNA probes under high
stringency using Quickhyb solution (Stratagene), washed at 60°C in
0.1× SSC (Life Technologies) with 0.1% SDS, and exposed to x-ray film
at 70°C for 14 hr.
In situ hybridization histochemistry. In
situ hybridization was performed using the methods described in
Stone et al. (1990) and Weiser et al. (1994) . Briefly, 4- to 6-week-old
male rats were perfused intracardially with 100 ml of cold saline
solution (0.9% NaCl with 0.5% NaNO2 and 1000 U
heparin), followed by 300 ml of cold 4% paraformaldehyde solution in
0.1 M phosphate buffer, pH 7.4. The brains were
carefully removed, cut in blocks, and post-fixed for 1 hr. After
post-fixing, the brains were washed several times in cold, 0.1 M phosphate buffer, pH 7.4, and placed in 30%
sucrose overnight. Slices were obtained on a freezing-microtome at 40 µm thickness and prehybridized at 48-50°C in a solution containing
50% formamide, 2× SSC, 10% dextran sulfate, 4× Denhardt's, 50 mM dithiothreitol, and 0.5 mg/ml sonicated,
denatured salmon sperm DNA. After 2 hr of prehybridization,
heat-denatured, 107 counts of
35S-radiolabeled probe were added, and the
hybridization reaction was allowed to proceed for 17 hr. After
hybridization, the sections were washed in decreasing concentrations of
SSC (2 to 0.1×) buffer at 48°C. After a final wash in 0.05 M phosphate buffer at room temperature, the
sections were hand-mounted on gelatin-coated slides and air-dried. The
slides were exposed to DuPont Microvision-C x-ray film for 7 d.
The slides were then dipped in prewarmed Kodak NTB-2 photographic
emulsion and exposed for 2 weeks at 4°C in the dark. The slides were
developed in Kodak D-19 solution, fixed, and counterstained with a
cresyl violet solution. Data analysis and photography were performed
with a Zeiss Axiophot photomicroscope.
Preparation of in vitro transcribed RNA and expression
in Xenopus oocytes. Recombinant pSGEM plasmids
containing the full-length Eag2 cDNAs were linearized by digestion with
NheI. Templates for in vitro transcription were
prepared from these digests as described in Iverson and Rudy (1990) and
transcribed with T7 RNA polymerase using the Stratagene mCAP
transcription kit (Stratagene) following the supplier's protocols. The
products of the transcription reaction (cRNAs) were diluted in
RNase-free water and stored at 70°C. Expression of the RNAs was
performed by injection of 50 nl of cRNA into defolliculated stage V and
VI oocytes from Xenopus laevis (Iverson and Rudy, 1990 ). The
injected oocytes were incubated for 3-4 d at 18°C in ND96 (96 mM NaCl, 2 mM KCl, 1.8 mM CaCl, 1 mM
MgCl2, 5 mM HEPES, buffer,
pH 7.3-7.4) with 100 U/ml penicillin and 100 µg/ml streptomycin,
filtered through a 0.45 µm membrane).
Electrophysiology. Currents were recorded under
two-electrode voltage clamp with Geneclamp 500 amplifier (Axon
Instruments, Foster City, CA) 1-7 d after RNA injection at room
temperature (20-23°C). Electrodes were filled with 2 M
KCl and had resistance of 0.5-1.0 M . Currents were
low-pass-filtered at 2 kHz. Data were acquired using pClamp 6.0 software (Axon Instruments). Data analysis and curve fitting were
performed using Clampfit and/or Origen 4.0 software (Microcal, Amherst,
MA). The recording chamber was continually perfused with ND96 unless
otherwise noted. Osmolarity was maintained in high K, TEA, or 4-AP
solutions by equimolar replacement of Na with the given cation.
 |
RESULTS |
Cloning and primary structure of rat Eag2
The Eag family of K+ channel
pore-forming subunits was identified after the cloning of the
ether-à-go-go (Eag) gene in Drosophila (Drysdale et
al., 1991 ; Warmke et al., 1991 ; Warmke and Ganetzky, 1994 ). The family
includes three subfamilies known as Eag, Erg, and Elk (Ganetzky et al.,
1999 ). There is presently one known member of the Eag subfamily in
mammals (Eag1), but there are several Erg and Elk genes (Ludwig et al.,
1994 ; Robertson et al., 1996 ; Shi et al., 1997 , 1998 ; Engeland et al.,
1998 ; Frings et al., 1998 ; Trudeau et al., 1995 , 1999 ).
We identified Eag2 in a screen for K+
channel transcripts expressed in the rat thalamocortical system. As
part of this screen, a novel sequence was amplified from thalamic cDNA
in a PCR that used degenerate PCR primers designed to amplify Eag
proteins (see Materials and Methods). The sequence was 77% identical
to rat Eag1 (Ludwig et al., 1994 ) at the amino acid level. RT-PCR and 5' RACE were used to obtain a complete coding sequence (see Materials and Methods). This resulted in a 3374 bp cDNA with a single open reading frame of 2964 bp, predicting a protein of 988 amino acids and
112 kDa (Fig. 1).

View larger version (96K):
[in this window]
[in a new window]
|
Figure 1.
Primary structure of Eag2. The amino acid sequence
of Eag2 is compared with the sequence of rat Eag1 (Ludwig et al.,
1994 ), Drosophila Eag (dEAG) (Warmke et
al., 1991 ), and Eag from C. elegans
(EGL-2) (g4731355). Gaps required to optimize the
alignment are shown as dashes. Identical residues are
shadowed black; similarities are shadowed in
gray. The S1-S6 and P (or H5) domains as well as the
cyclic nucleotide binding domain (cNBD) are
overlined. Triangles indicate putative
PKA-PKG phosphorylation sites in Eag2. Asterisks
indicate putative N-glycosylation sites in Eag2. The leucines in the
unique leucine heptad repeat in the C-terminal area of Eag2 are
indicated with an open square. Putative PKC
phosphorylation consensus sequences in Eag2 are located at amino acids
73-75, 127-129, 142-144, 237-239, 142-144, 237-239, 322-324,
395-397, 478-480, 502-504, 521-523, 773-775, 925-927, 943-945,
952-9254, 981-983.
|
|
Comparison of the amino acid sequence of Eag2 with the sequence of rat
Eag1 and members of the Erg and Elk subfamilies shows that the new
sequence is much more similar to Eag1 (and Drosophila or
Caenorhabditis elegans Eag) than to Erg and Elk proteins
(Table 1). The new sequence is therefore a
member of the Eag subfamily and was named Eag2. Rat Eag2 is very
similar to rat Eag1, with an overall amino acid sequence identity of
74% and a similarity of 82%.
Hydropathy analysis predicts that Eag2 has six membrane spanning
domains (data not shown). The protein shares the overall structure of
other proteins of the Eag family (Fig. 1). Like other K+ channel proteins of the S4 superfamily,
Eag proteins contain a core membrane region consisting of six putative
membrane-spanning domains designated S1 to S6 flanked by amino and
carboxyl domains of variable lengths that are thought to be
intracellular (Pongs, 1992 ; Chandy and Gutman, 1995 ; Jan and Jan, 1997 ;
Coetzee et al., 1999 ). Domains S1-S3 and S5-S6 are hydrophobic and
thought to span the membrane as helices. The S4 domain, a critical
component of the voltage sensor, is amphipathic and characterized by
the repetition of a motif consisting of a charged residue (R or K) and
two hydrophobic or neutral amino acids. The motif is repeated five
times in Eag2 as in other Eag proteins (Fig. 1) (Pongs, 1992 ; Sigworth,
1994 ; Caterall, 1995; Jan and Jan, 1997 ; Ganetzky, 1999 ).
Eag2 also contains the characteristic pore (P or H5) domain, present
between the fifth and the sixth membrane spanning domains. This is
highly conserved among distinct K+ channel
pore-forming subunits and is believed to contribute to the formation of
the channel's K+ selective pore
(MacKinnon and Yellen, 1990 ; Hartmann et al., 1991 ; Yool and Schwarz,
1991 ; Pongs, 1992 ; Chandy and Gutman, 1995 ; Jan and Jan, 1997 ; Doyle et
al., 1998 ). As in other members of the Eag family (as well as some
members of the inward rectifying and two-pore family of
K+ channel subunits), the signature
sequence GYG is replaced by GFG in Eag2 (Warmke and Ganetzky,
1994 ; Ganetzky et al., 1999 ). As in all other members of the Eag family
(including Ergs and Elks), the Eag2 protein contains a sequence of
unknown function (labeled as cNBD in Fig. 1) similar to the cyclic
nucleotide binding domain found in cyclic nucleotide-gated and
pacemaker channel families (Broillet and Firestein, 1999 ; Santoro and
Tibbs, 1999 ).
The putative intracellular amino terminal sequence, the
membrane-spanning, and cyclic nucleotide domains of Eag2 and other Eag
proteins are very well conserved. Divergence from the Eag1 protein
sequence is concentrated to the C-terminal region following the
putative cyclic nucleotide binding domain (residues 720-842). Interestingly, this area has been implicated in Eag1 as the association site for interaction with an associated ( ) subunit KCR1 (Hoshi et
al., 1998 ). A leucine-zipper motif (residues 913-960) is present in
Eag2 and contains four leucines repeated every seven residues. The same
area in Eag1 is only 42% identical and contains only two leucines in
heptat repeat (Fig. 1). Mutational analysis of this area in
Eag1 has recently implicated it as a site for multimerization and
subunit interactions (Ludwig et al., 1997 ). Sequence divergence found
within these two regions may have interesting functional consequences
for Eag2 and/or its association with other family members and/or
accessory subunits.
Unlike in the Kv family, the primary sequence of all members of the Eag
family, now including Eag2, shares a region of high similarity at the N
terminus of the protein. Recently this domain (residues 1-134),
referred to as the "Eag domain," was crystallized from human Erg
(HERG) (Morais Cabral et al., 1998 ). The crystal structure revealed the
Eag domain as a member of the PAS domain family. These domains
have been previously found in proteins involved in the circadian rhythm
as well as in prokaryotic proteins that have light and redox sensors
(Ponting and Aravind, 1997 ; Zhulin et al., 1997 ; Morais Cabral et al.,
1998 ; Reppert, 1998 ; Sassone-Corsi, 1998 ). PAS domains are thought to
be involved in ligand as well as in protein-protein interactions (Hahn
et al., 1997 ). The structural data of the PAS domain in human Erg,
combined with mutational analysis of this domain in Erg and Eag1, have
provided strong evidence that this N-terminal domain interacts with the
body of the channel, perhaps with residues in the S4-S5 linker,
affecting many aspects of channel gating, inactivation, and voltage
sensitivity (Terlau et al., 1997 ; Morais Cabral et al., 1998 ; Chen et
al., 1999 )
Primary sequence analysis reveals that Eag2 shares with Eag1 a putative
cAMP-cGMP-dependent protein kinase (PKA-PKG) phosphorylation site at
amino acid position 677-680. It also contains a second, unique PKA-PKG
site in the N terminus (residues 21-24) (Fig. 1). Eag1 also has
multiple putative PKC sites. Eag2 shares many of these but also has
three additional putative PKC phosphorylation sites located in the
extreme C terminus that are not present in Eag1 (Fig. 1, see legend).
Eag2 is expressed at low levels in brain and testes but not in
other tissues
RT-PCR was used to investigate the tissue distribution of Eag2
mRNA transcripts. (Fig.
2A). Strong signals were
obtained from poly(A) RNA prepared from the cerebral cortex, brain, and
testes. No signal was detected in heart, skeletal muscle, spleen,
kidney, lung, or liver. A second RT-PCR of the testes cDNA, using
another pair of Eag2-specific primers, confirmed the presence of Eag2 mRNA in this tissue (data not shown).

View larger version (63K):
[in this window]
[in a new window]
|
Figure 2.
Tissue expression of Eag2. A,
RT-PCR of rat mRNA prepared from various tissues using Eag2-specific
primers (top) or GAPDH primers (middle).
+ Control (positive control) PCR from Eag2 cDNA. The
reaction was analyzed on a 2% agarose gel stained with EtBr. A single
PCR product was detected in the Cerebral Cortex,
Total Brain, and Testes lanes only. A
Southern blot using an Eag2 -specific probe (fragment B) confirmed the
amplification of Eag2 in cerebral cortex, total brain, and testes
(bottom). B, Northern blot of rat poly(A)
RNA obtained from the olfactory bulb, cerebral cortex, or testes (2 µg per lane) hybridized with Eag2 fragment B probe.
|
|
In situ hybridization of brain tissue suggests that Eag2
expression in brain is highly localized (see below). Consistent with the results from in situ hybridization, hybridization of a
Northern blot prepared from mRNA derived from brain areas enriched in
Eag2 transcripts (neocortex and olfactory bulb) identified a strong single ~12 kb transcript with higher levels found in cortex than in
olfactory bulb. Signals from total brain were very weak (data not
shown). A Northern blot prepared from testes poly(A) RNA, however,
identified a much smaller ~3 kb transcript, suggesting the
possibility of an alternatively processed Eag2 transcript (Fig.
2B).
Eag2 is selectively expressed in a few neuronal populations in the
brain and shows a unique laminar expression pattern in the cerebral
cortex
The original RT-PCR that lead to the identification of Eag2 used
mRNA derived from rat thalamus, indicating expression of Eag2
transcripts in this brain area. In situ hybridization
histochemistry, using a probe from the C terminus (fragment B), was
used to analyze the pattern of expression of Eag2 in adult rat and
mouse brain. These experiments revealed that Eag2 is expressed in a few
selected brain areas (Fig. 3). Strong signals
were seen in the cerebral cortex, olfactory bulb, and primary olfactory
cortex. Moderate to weak expression was seen in many dorsal thalamic
nuclei, medial hypothalamic structures, superior and inferior
colliculus, lateral lemniscus, pontine nuclei, and the Islands of
Calleja. Overall, Eag2 expression was significantly different from that
of Eag1, which outside the CNS is also found in skeletal muscle (Ludwig et al., 1994 ; Bijlenga et al., 1998 ). Within the CNS, Eag1 expression is much more widespread, located most abundantly in cerebellum and
hippocampus and at lower levels in the caudate/putamen, hypothalamus, and cerebral cortex (Ludwig et al., 1994 ; Saganich and Rudy,
unpublished observations). Contrary to Eag1, no significant Eag2
expression was observed in the hippocampus, cerebellum, or
caudate/putamen.

View larger version (37K):
[in this window]
[in a new window]
|
Figure 3.
Distribution of Eag2 mRNAs in the rat and mouse
brain. A-H, X-ray autoradiograms of coronal sections
taken at different levels of rat brain after hybridization with the
Eag2-specific 35S-labeled probe (fragment B).
I, X-ray autoradiogram of a sagittal section of a mouse
brain after hybridization with the same probe as in
A-H. Note the strong and laminar
hybridization signals in the cerebral cortex (Cx). Other
brain areas exhibiting strong signals include the granule cell layer of
the olfactory bulb (IGr) and the olfactory cortex
(PO). Moderate signals are seen in the Islands of
Calleja (ICj), dorsal thalamic nuclei [as in the
ventral posterior complex (VP), the laterodorsal
nucleus (LD), the lateroposterior (LP),
and posterior thalamic nuclear group (Po), as well as in
the lateral geniculate nucleus (data not shown) and the medial
geniculate (MG)], the habenula (Hb), the
dorsomedial hypothalamic nuclei (DM), the
intermediate gray layer of the superior colliculus
(InG), the inferior colliculus (IC), the
pontine nucleus (Pn), and the lateral lemniscus nuclei
(LL). Weak to no signals are seen in the cerebellum
(Cer) and hippocampus (CA1 area of the hippocampus,
CA1; dentate gyrus, DG).
Th, Thalamus.
|
|
Most intriguing was the pattern of expression of Eag2 in the cerebral
cortex, which is unlike that of Eag1 (Pongs, 1992 ; Chandy and Gutman,
1995 ; Coetzee et al., 1999 ). On x-ray film autoradiograms, the signal
appeared as a dense narrow band located mainly toward the middle layers
of the cortex (Fig. 3). This band was present throughout the anterior
to posterior extent of the cerebral cortex, with the highest levels
located within somatosensory cortex. In general, the signal became
weaker and narrower as sections moved away from the somatosensory
cortex in both the anterior and posterior direction. The band of Eag2
expression was also found throughout the entire dorsoventral extent of
the cerebral cortex, being broadest in somatosensory cortex (see
cover). The expression pattern of Eag2 was confirmed in three separate
experiments with the C-terminal probe. A different, nonoverlapping
probe from the NH2-terminus (fragment G) also
gave identical results (data not shown). Preliminary data suggest that
expression of Eag2 in brain appears to be conserved in both rat and
mouse (Fig. 3I).
To further characterize the pattern of expression of Eag2 in the
cerebral cortex, the S35-hybridized
sections were dipped in photographic emulsion, developed, and
counterstained with a Nissl stain. Dark-field images confirmed our
observations with x-ray autoradiograms. Signals were concentrated toward the middle lamina of the cortex, with little signal in deeper or
more superficial layers (Fig.
4A). Bright-field
microscopy of the Nissl-counterstained sections revealed that the
greatest accumulation of silver grains was seen over layer IV (Fig.
4B-D). Observations at high magnification
showed that most neurons in layer IV had accumulated a large number of
silver grains averaging 47.2 ± 2.7 grains per cell (Fig.
4D) in contrast to layers II-III, which had an
average of 8.7 ± 1.9 grains per cell [a value similar to
background (Fig. 4E)]. The number of heavily labeled
cells decreases dramatically as one moves away from layer IV. This
laminar-specific expression of Eag2 in the cerebral cortex is unlike
that of any other potassium channel described to date and suggests that
this protein may be particularly important for the function of neurons concentrated in layer IV (see Discussion).

View larger version (137K):
[in this window]
[in a new window]
|
Figure 4.
Expression of Eag2 in layer IV of the cerebral
cortex. A, Dark-field image of a Nissl-stained coronal
section through the rat neocortex hybridized with
35S-labeled Eag2 probe (fragment B) and dipped in
photographic emulsion. Note the laminar hybridization signal toward the
middle of the cortex. The hybridization band is thicker in
frontoparietal (somatosensory) cortex. Strong hybridization is also
seen in the olfactory cortex and the islands of Calleja.
B, Bright-field image of a portion of the section shown
in A, illustrating the different cortical layers. Silver
grains are difficult to distinguish at this amplification.
C, Amplification of layer IV (boxed
section in B). Note the increased concentration
of silver grains over cells in layer IV. D,
E, High magnification of cortical layers IV
(D) and II-III (E). Note
the large accumulation of silver grains over most cells in layer IV. In
layer II-III the number of grains over cells is similar to background.
Scale bar: A, 0.225 cm; B, 0.372 mm;
C, 75 µm; D, E, 50 µm.
|
|
Eag2 expresses subthreshold-activating, non-inactivating,
voltage-dependent potassium currents in Xenopus
oocytes
Most K+ channel pore-forming subunits
of the S4 superfamily produce tetrameric
K+ channels with specific characteristics
when expressed in Xenopus oocytes and other heterologous
expression systems (Pongs, 1992 ; Chandy and Gutman, 1995 ; Jan and Jan,
1997 ; Coetzee et al., 1999 ). Injection of Eag2 cRNA in
Xenopus oocytes resulted in large voltage-dependent outward
currents, which were absent in uninjected or water-injected oocytes.
The currents activated with membrane depolarization and exhibited no
significant inactivation. The activation kinetics was complex,
displaying both fast and slow components, and there was little
sigmoidicity. Long (several seconds) depolarizations were required for
the currents to approach steady-state values (Fig.
5A,B).
Eag2 currents resembled most closely the currents expressed by Eag1
(Ludwig et al., 1994 ; Robertson et al., 1996 ; Terlau et al., 1996 ;
Bijlenga et al., 1998 ; Frings et al., 1998 ), in accordance with their
molecular relatedness.

View larger version (29K):
[in this window]
[in a new window]
|
Figure 5.
Eag2 expresses non-inactivating,
subthreshold-activating K+ currents in
Xenopus oocytes. Expression of Eag2 currents by
two-electrode voltage clamp. A, B, An
oocyte injected with Eag2 cRNA was held at 90 mV, and a family of
currents was measured using test potentials ranging from 120 to +40
mV. The duration of the test potentials was 214 msec in
A and 7.4 sec in B. Bath contained ND96
in both experiments. C-E, Current-voltage relationship
and K+ permeability of Eag2 currents.
Current-voltage (I-V)
relationships of representative currents in an Eag2 cRNA-injected
oocyte (C) or an uninjected oocyte
(D) recorded in 2 mM
(squares), 25 mM (circles),
50 mM (triangles), and 96 mM
(inverted triangles) extracellular
K+. The currents were measured by two-electrode
voltage clamp, with a holding potential of 90 mV and a voltage
command series from 120 to +40 mV in 10 mV increments.
E, Average reversal potentials ± SEM
(n = 4) of Eag2 currents, determined from
experiments such as in C, plotted as a function of the
log of the [Ko]. A linear fit produced a line with a
slope factor of 55.5 mV/decade. F, The resting
potential of the oocytes was determined under current-clamp mode in
different concentrations of extracellular K+, and
the average ± SEM resting potentials (n = 5)
of Eag2-injected (circles) and uninjected
(squares) oocytes was plotted as a function of log
[Ko] and fit to straight lines. The slope factor for
Eag2-injected and uninjected oocytes was 49.2 and 20.3 mV/decade,
respectively. G, H, Eag2 currents evoked
by slow voltage ramps. G, An Eag2-injected oocyte was
held at 30 mV and then clamped to a slow (1.6 sec) hyperpolarizing
ramp to 140 mV (see inset) in ND96 alone or in the
presence of 5 mM BaCl2. H,
Ba2+-sensitive current in G obtained
by digital subtraction of the current after Ba2+
from the control current.
|
|
Most interesting was the observation that outward currents were visible
at very negative voltages (Fig.
5A,B). In fact, many Eag2-injected
oocytes had small but sustained outward currents when holding at 90
mV, whereas uninjected oocytes have only sustained inward leak currents
at this holding potential. To help visualize the currents at these
hyperpolarized potentials, we increased the extracellular potassium
concentration in the bath (standard external
K+ in ND96 is 2 mM).
Under these conditions we were able to generate measurable inward
currents at potentials more negative than the equilibrium potential for
K+ and were able to test the activity of
the channel at very negative membrane potentials. Current-voltage
relationships for the steady-state currents obtained in various
extracellular K+ concentrations show that
currents, larger than those expected from leak, are already detectable
at potentials between 100 and 90 mV (Fig. 5C). Such
currents were never seen in uninjected oocytes (Fig. 5D). In
all cases the current reversed at values near the reversal potential
for potassium (EK). Reversal
potentials determined from the change of tail current direction in
various extracellular K+ concentrations
were also close to EK (data not
shown). A plot of the reversal potential obtained from
I-V plots as a function of the log of
extracellular potassium concentration resulted in a line with a
slope of 55.5 mV, close to the theoretical value of 58 mV,
indicating that the channels are highly selective for potassium
(Fig. 5E).
Because the current activated at such negative voltages, it was
observed that oocytes expressing significant levels of Eag2 had resting
potentials that were very close to EK
through a range of different extracellular potassium concentrations
down to 2 mM. In contrast, the resting potentials
of uninjected oocytes were much less sensitive to changes in
extracellular potassium (Fig. 5F).
Because the currents do not inactivate, it was possible to obtain
current-voltage relationships for Eag2 currents using slow (1.6 sec)
voltage ramps. As described below, Eag2 currents are blocked by
extracellular Ba2+ (Fig. 5G;
see Table 3). We used this blocker to isolate the current mediated by
Eag2 during depolarizing ramps (Fig. 5H). These
experiments confirmed that Eag2 currents activated at around 100
mV even in low (2 mM) Ko.
To determine the Eag2 conductance-voltage relationship, we measured
instantaneous conductances from tail currents evoked at 150 mV after
a series of voltage prepulses between 150 and 70 mV in 25 mM [K]o (Fig.
6, inset). The values of
instantaneous conductance [g = I/(V VK)]
were obtained from the instantaneous currents measured by fitting a
double exponential function to the tail current (I) traces and
extrapolating to t = 0, and using a reversal potential
of 37 mV. The instantaneous conductance versus voltage plot was
fitted to a Boltzmann function
(G/Gmax = 1/{1 + [exp(Vm V1/2)k]}). From
these fits, we derived a midpoint of activation of 35.5 mV and a
steepness parameter of 29 mV (Fig. 6).

View larger version (18K):
[in this window]
[in a new window]
|
Figure 6.
Normalized conductance-voltage relation for Eag2
channels. Instantaneous conductance [G = I/(V VK)] as a function of voltage was
obtained from measurements of instantaneous current that were obtained
by extrapolating to time 0 the tail currents obtained at 150 mV after
2025 msec test pulses from 150 to +70 mV (see inset)
in cells bathed in ND96 containing 25 mM KCl
(Vholding = 90 mV). The values of
conductance at a given voltage were normalized to the maximum
conductance, and the average values ± SEM from four different
oocytes were plotted as a function of voltage. The smooth curve is the
fit to a Boltzmann function with a midpoint of 35.5 mV and a slope
factor of 29 mV.
|
|
The midpoint of activation of Eag2 currents was considerably more
negative to the previously published values for mouse and human Eag1,
which range from 11 to 4.1 mV (Robertson et al., 1996 ; Bijlenga et
al., 1998 ; Schönherr et al., 1999 ). The considerable differences
in voltage dependence are the most important difference we have
observed so far between Eag1 and Eag2 currents (Table 2).
Activation kinetics
Unlike most voltage-gated K+ channels
of the Kv family, but similar to Eag1, the kinetics of activation of
Eag2 is strongly influenced by the membrane potential before the test
depolarization. For example, when the holding potential was changed
from 90 to 120 mV, the activation kinetics of evoked currents
became much slower and more sigmoidal in shape (Fig.
7A). To further characterize the
effect of prepulse voltage on channel activation, we provided a series
of 1 sec conditioning prepulses to different voltages before a single
test pulse to +40 mV (Fig.
8A). The observed decrease in the speed of activation as the prepulse voltage is moved in the
hyperpolarized direction was similar to that seen with Eag1 (Ludwig et
al., 1994 ; Robertson et al., 1996 ; Terlau et al., 1996 ) and resembles,
but is not identical to, the nonsuperimposable Cole-Moore shift
observed in potassium currents in crayfish axons (Young and Moore,
1981 ). To quantify this effect, the rise times of the currents were
approximated by double exponential functions in several oocytes, and
the average time constants and amplitudes were plotted as a function of
prepulse potential (Fig. 8B,C). It
was concluded that the main effect of prepulse voltage was to change
the relative contributions of the fast and slow components. The time
constant of the fast component also became slightly faster as the
prepulse potential increased, ranging from 25 to 10 msec. The time
constant of the slow component, however, remained relatively constant
at 202 ± 2 msec regardless of the prepulse potential.

View larger version (21K):
[in this window]
[in a new window]
|
Figure 7.
Effect of holding potential and prepulse duration
on Eag2 currents in Xenopus oocytes. A,
Currents in an Eag2-injected oocyte during test depolarizations of 800 msec ranging from 90 to +40 in 10 mV increments from a holding
potential of 90 mV (left) or 120 mV
(right). Bath contained ND96 solution in both
experiments. B, Evoked Eag2 currents during 800 msec
test depolarizations to +40 mV, preceded by prepulses ranging from
130 to 60 mV with various duration (t) (as
indicated above each panel) from 75 to 3000 msec. Holding potential was
80 mV, and bath solution contained ND96.
|
|

View larger version (13K):
[in this window]
[in a new window]
|
Figure 8.
Hyperpolarizing prepulses slow down the activation
of Eag2 currents. A, Currents in an Eag2 cRNA-injected
oocyte during 800 msec test depolarizations to +40 mV, preceded by 1 sec prepulses ranging from 120 to 60 mV (holding potential 80 mV;
bath solution ND96). The time course of the currents in experiments
such as the one shown in A was approximated by the sum
of two exponentials and the average ± SEM (n = 4) time constants and relative amplitudes of the exponentials plotted
as a function of prepulse potential in B and
C, respectively.
|
|
These effects of prepulse potential indicate that the kinetics of Eag2
channel opening in a particular cell could vary depending on previous
changes in the cell membrane potential. To obtain an idea of whether
physiological conditions could influence channel behavior, we
investigated how long a given hyperpolarization had to be to produce
significant effects on Eag2 activation kinetics. For this purpose, we
changed the duration of the conditioning prepulses using the same
voltage protocol as in Figure 8. The results of these experiments
showed that hyperpolarizing prepulses >100 msec are required to obtain
significant changes in kinetics, and maximum effects were obtained with
prepulses of 3-5 sec (Fig. 7B).
We also explored the time required for the channel to recover from a
previous membrane depolarization using a standard two-pulse protocol in
which we changed the time at rest between two identical depolarizing
voltage commands. The results of such experiments demonstrated that
previous channel activity strongly influenced the activation rate of
Eag2 during a second depolarization (Fig. 9).
A previous depolarization increased the rate of activation during the
second pulse. Apparently this increase in activation rate is lost
slowly; intervals at rest of the order of seconds (>8 sec for the
experiment shown in Fig. 9) are required for the channel to fully
recover from the effect of the previous depolarization. This property
may have important physiological implications by providing a form of
short-term plasticity to the cells in which these channels are
expressed.

View larger version (18K):
[in this window]
[in a new window]
|
Figure 9.
Slow recovery of the changes in activation
kinetics of Eag2 currents produced by a previous depolarization.
Superimposed currents evoked by the second test potential of a
two-pulse protocol with increasing interpulse intervals. The voltage
protocol (see inset) included two square pulses of 210 msec duration to +40 mV separated by interpulse periods at 100 mV of
0.3, 0.5, 1, 2, 4, 8, and 10 sec. Holding potential: 100 mV.
|
|
Inactivation
In contrast to most delayed rectifier-type
K+ channels, but similar to Eag1, Eag2
currents did not inactivate during long depolarizations. As shown in
Figure 5B, no inactivation was seen during depolarizations lasting 7 sec. In fact, little if any inactivation was seen when the
cell was tonically depolarized by increasing extracellular potassium
levels for >5 min or the cell membrane was clamped to 30 mV for 5 min (data not shown).
Pharmacological properties
A property shared by the members of the Eag family is their
relatively low sensitivity to the commonly used
K+ channel blockers 4-AP and TEA (Coetzee
et al., 1999 ; Ganetzky et al., 1999 ). Eag2, like Eag1, is relatively
insensitive to 4-AP, a potent blocker of Kv potassium channel family
members (Ludwig et al., 1994 ). In Eag2-injected oocytes, replacement of
20 mM 4-AP for NaCl in the extracellular perfusion had no
measurable effect on the macroscopic currents (Table
3).
Eag2 was also weakly sensitive to TEA as compared with other
K+ channels. Eag2 was partially blocked by
high concentrations of TEA (~75% at 96 mM), and the
block was voltage dependent. Dose-response curves for TEA at two
different test potentials ( 20 and 40 mV) gave
IC50 values of 12.5 and 19 mM,
respectively (Table 3).
Eag2 currents were also blocked by extracellular
Ba2+ (Fig. 5G) and
Cs+ ions. Eag2 was much more sensitive to
Ba2+ than Cs+. The blockade
for both was voltage dependent (Table 3). Application of 5 mM Ba2+ to the
extracellular solution blocked >98% Eag2 currents regardless of
voltage (Table 3; also see Fig. 5G). Eag2 was insensitive to
1 µM of the antiarrhythmic drug E4031, which is
a known blocker of the related Erg members (Shi et al., 1997 ). Eag1 and
the members of the Elk subfamily are also insensitive to this compound
(Engeland et al., 1998 ; Shi et al., 1998 ; Trudeau et al., 1999 ).
Modulation
Primary sequence analysis revealed that Eag2 contained many
putative phosphorylation sites, including a PKA-PKG site and a cluster
of PKC sites at the C terminus of the protein not found in Eag1 (Fig.
1). Interestingly, phorbol 12-myristate 13-acetate (PMA), an activator
of PKC, produced a potent dose-dependent block of Eag2 currents.
Equivalent concentrations of the weak PKC activator 4 -phorbol 12, 13-didecanoate (4 PDD), however, had little effect (Fig.
10). This suggests that PKC may play a role
in the modulation of Eag2 currents.

View larger version (23K):
[in this window]
[in a new window]
|
Figure 10.
Phorbol esters inhibit Eag2 currents. Currents in
an Eag2-injected oocyte in ND96 alone (A) or 30 min after application of 100 nM PMA to the extracellular
perfusion (B) during step depolarizations from
120 to +40 mV in 10 mV increments from a holding potential of 90
mV. C, Eag2 currents during test depolarizations to +40
mV from a holding potential of 90 mV at the indicated times after the
application of 5 nM PMA to the extracellular solution.
D, Time course of inhibition of Eag2 steady-state
currents from experiments such as the one illustrated in
C after application of 100 nM
(triangles), 5 nM (squares),
0.5 nM (inverted triangles) PMA or 0.5 nM of the less active isomer 4 PDD
(circles) to the extracellular solution.
|
|
 |
DISCUSSION |
This paper describes the cloning and primary structure of Eag2, a
new member of the Eag family of K+ channel
pore-forming subunits in mammals. The protein is most similar (74%
amino acid identity) to Eag1, the one known member of the Eag subfamily
within the mammalian Eag family. Eag2 shares with Eag1, and other
members of the Eag family, the same overall structure (Ganetzky et al.,
1999 ). There is strong conservation of the transmembrane core region,
of a PAS domain (Morais Cabral et al., 1998 ) present in the putative
intracellular amino end of the protein, and of a cyclic nucleotide
binding domain in the putative intracellular carboxyl end following the
membrane portion of the protein. Cyclic nucleotides do not affect the
function of Eag2 (data not shown) or other mammalian Eag family
proteins (Ludwig et al., 1994 ; Robertson et al., 1996 ; Frings et al.,
1998 ; Ganetzky et al., 1999 ). Therefore, if there is a function for this domain in these K+ channel subunits,
it remains to be discovered. The strongest sequence divergence between
Eag1 and Eag2 is found in the C-terminal area after the cyclic
nucleotide binding domain.
Eag2 channels expressed in Xenopus oocytes share several
unusual properties with Eag1 in this and other heterologous expression systems (Ludwig et al., 1994 ; Robertson et al., 1996 ; Terlau et al.,
1996 ; Bijlenga et al., 1998 ; Frings et al., 1998 ). If the properties of
native neuronal channels containing these proteins are similar to those
seen in heterologous expression systems, they could be of considerable
physiological significance. These include a characteristic gating
behavior with fast and slow components whose contribution to the
activation kinetics of the channel depends strongly on the membrane
potential before membrane depolarization. Hyperpolarizing prepulse
potentials slow down channel opening by increasing the contribution of
the slow component, whereas depolarizations decrease this contribution
and accelerate the activation kinetics during a subsequent
depolarization. The strong dependence of channel activation on prepulse
voltage suggests that the kinetics of these channels includes remote
closed states that are only occupied significantly at hyperpolarized
potentials (Ludwig et al., 1994 ; Robertson et al., 1996 ; Terlau et al.,
1996 ). The entry and exit from these states appears to be slow. Thus at
rest, after a depolarization, the equilibrium between closed states is
reestablished slowly, such that the kinetics of activation of the
channels is faster during a second depolarization unless the membrane
is maintained at the repolarizing potential for several seconds. The
dependence of gating behavior of Eag channels on prepulse potential may
contribute a short-term plasticity to the electrical response of
neurons expressing these channels.
Both Eag1 and Eag2 channels are also characterized by the lack of
inactivation during long depolarizations. Therefore, they can produce
steady currents at membrane potentials throughout the voltage range in
which the channels activate. The most significant difference between
Eag2 and Eag1 currents observed so far is their macroscopic voltage
dependence of activation. The midpoints of the conductance-voltage
curves of Eag1 and Eag2 differ by ~25-30 mV, and observable opening
of Eag2 channels occurs at voltages 40-50 mV more negative (Robertson
et al., 1996 ; Bijlenga et al., 1998 ). Although both Eag1 and Eag2
currents could limit neuronal excitability, Eag2 will have a greater
effect in modulating the resting potential and level of excitability in
neurons having resting potentials in the 70 to 90 mV range. Eag2
channels could thus have subthreshold effects on excitability down to
the most negative membrane potentials known in neurons.
In this regard, Eag2 currents resemble the M currents (Brown and
Adams, 1980 ; Brown, 1988 ). Although the activation and deactivation kinetics of Eag2 channels are faster than that of the channels mediating the M current, both show no inactivation and have significant activation at subthreshold voltages. M channels have a midpoint of
activation around 35 mV and show significant activation between 60
and 70 mV (Brown, 1988 ; Wang et al., 1998 ). Like the channels mediating M currents, Eag2 channels are likely to contribute to the
resting potential and the resting membrane conductance and to provide a
strong break to membrane potential depolarizing changes, including
influencing action potential threshold (Adams and Galvan, 1986 ; Brown,
1988 ; Yamada et al., 1989 ). These effects can be considerable because
few conductances are active in the subthreshold voltage range. If Eag2
channels are present in postsynaptic sites, they could influence
synaptic responses. In addition, given the fast phase of activation of
Eag2 currents, they are even more likely than M currents to be
activated significantly during action potentials and to affect their
configuration and repetitive firing characteristics.
The molecular basis for the differences in voltage dependence of Eag1
and Eag2 channels remains to be investigated. Point mutations in and
around the S4 domain produce large changes in the voltage dependence of
Eag and Kv channels (Papazian et al., 1991 ; Perozo et al., 1994 ;
Schönherr et al., 1999 ). Another area of interest is the PAS
domain. Mutations in this region in Eag1 and HERG (Terlau et al., 1997 ;
Morais Cabral et al., 1998 ; Chen et al., 1999 ) have also been shown to
produce large changes in voltage dependence. There are several
differences between Eag1 and Eag2 in the S3-S5 and PAS domains that
might be a potential source for the dramatic shift in voltage
dependence observed in Eag2 currents.
Physiological significance
The pattern of expression of Eag2 in brain is also very
interesting. We have not yet detected Eag2 outside the nervous system (other than the testes), and in the brain its pattern of expression is
among the most selective found for K+
channels so far (Pongs, 1992 ; Chandy and Gutman, 1995 ; Coetzee et al.,
1999 ). The expression in the cerebral cortex is particularly interesting and could be of physiological importance. Our data with
emulsion autoradiograms clearly show that Eag2 is predominantly expressed in neurons in cortical layer IV. X-ray autoradiograms show a
laminar expression that thickens in areas (granular cortex) where layer
IV is more prominent, consistent with this conclusion.
Several types of neurons are in cortical layer IV. These include
excitatory local interneurons, including the spiny stellate cells, and
the small pyramids or star-pyramids, and inhibitory GABAergic
interneurons including multipolar and bipolar cells, which have
somewhat larger somatic sizes than the excitatory interneurons. The
excitatory interneurons constitute the overwhelming majority of layer
IV neurons, outnumbering GABAergic cells approximately 5 or even 10 to
1. There are also a few scattered projecting pyramidal cells such as
those that exist in other cortical layers (Jones, 1975 ; Fairén et
al., 1984 ; Simons and Woolsey, 1984 ; Keller, 1995 ). We found through
analysis at high magnification of emulsion autoradiograms of sections
hybridized to Eag2 probes that a large proportion of the neurons in
layer IV are heavily labeled (Fig. 4D). Because spiny
stellates and star-pyramids represent the overwhelming majority of
layer IV neurons, we hypothesize that Eag2 mRNAs are present in these
neurons. If Eag2 were expressed only in the GABAergic cells,
a minority of the cells (1 of 5-10) would have a large density of
silver grains, contrary to what we see with Eag2 (Fig. 4D). Also, we would not expect to see a uniform band
in dark-field images (Fig. 4A) but instead scattered
signals as seen for Kv3.1 and Kv3.2 K+
channel transcripts (Weiser et al., 1994 ). Moreover, spiny stellate and
star-pyramid neurons occur predominantly in layer IV, unlike known
types of GABAergic interneurons (Jones, 1975 ; Fairén et al.,
1984 ; Simons and Woolsey, 1984 ). Specific expression of Eag2 in these
specialized excitatory interneurons would explain the laminar staining
observed in the cortex. However, higher resolution methods, such as
immunohistochemistry with Eag2-specific antibodies, will be required to
determine with certainty which populations of cortical layer IV neurons
express Eag2.
Layer IV cortical neurons are the main recipients of thalamocortical
input (Jones, 1985 ; Steriade et al., 1990 ). This input brings to the
cortex almost all sensory information. Thalamocortical transmission of
sensory inputs is highly regulated depending on the states of vigilance
and perhaps other behavioral states of the animal (Steriade et al.,
1990 , 1993 ; McCormick, 1992 ). Modulations at the level of the
thalamocortical neuron, mediated by neurotransmitter systems arriving
from the brainstem, have been studied extensively (Steriade et al.,
1990 , 1993 ; McCormick, 1992 ). The concentration of Eag2 mRNAs in layer
IV neurons and the properties of Eag2 channels in Xenopus
oocytes, including their modulation by phorbol esters, suggest the
intriguing hypothesis that neurotransmitter systems acting on the
cortex, including glutamate from the thalamocortical inputs themselves
acting on metabotropic receptors, could regulate the transmission of
sensory information at the level of the postsynaptic cell.
 |
FOOTNOTES |
Received June 15, 1999; revised Sept. 27, 1999; accepted Oct. 7, 1999.
This research was supported by National Institutes of Health Grants
NS30989 and NS35215 to B.R. We thank Alan Chow and other members of the
Rudy and Coetzee laboratories for their contribution to this work. We
thank Asaf Keller for discussions and assistance in identifying
neuronal populations.
The nucleotide sequence reported in the paper has been submitted to
GenBank with accession number AF185637.
Correspondence should be addressed to Dr. B. Rudy, Department of
Physiology and Neuroscience, New York University School of Medicine,
550 First Avenue, New York, New York 10016. E-mail: Rudyb01{at}mcrcr6.med.nyu.edu.
 |
REFERENCES |
-
Adams PR,
Galvan M
(1986)
Voltage-dependent currents of vertebrate neurons and their role in membrane excitability.
Adv Neurol
44:137-170[Medline].
-
Bauer CK,
Engeland B,
Wulfsen I,
Ludwig J,
Pongs O,
Schwarz JR
(1998)
RERG is a molecular correlate of the inward-rectifying K current in clonal rat pituitary cells.
Receptors Channels
6:19-29[Web of Science][Medline].
-
Baxter DA,
Byrne JH
(1991)
Ionic conductance mechanisms contributing to the electrophysiological properties of neurons.
Curr Opin Neurobiol
1:105-112[Medline].
-
Bijlenga P,
Occhiodoro T,
Liu JH,
Bader CR,
Bernheim L,
Fischer-Lougheed J
(1998)
An ether-a-go-go K+ current, Ih-eag, contributes to the hyperpolarization of human fusion-competent myoblasts.
J Physiol (Lond)
512:317-323[Abstract/Free Full Text].
-
Broillet M-C,
Firestein S
(1999)
Cyclic nucleotide-gated channels.
Ann NY Acad Sci
868:730-740[Web of Science][Medline].
-
Brown DA
(1988)
M currents.
In: Ion channels (Narahashi ET,
ed), pp 55-94. New York: Plenum.
-
Brown DA,
Adams PR
(1980)
Muscarinic suppression of a novel voltage-sensitive K+ current in a vertebrate neurone.
Nature
283:673-676[Medline].
-
Chandy KG,
Gutman GA
(1995)
Voltage gated channels.
In: Handbook of receptors and channels: ligand-gated and voltage-gated ion channels (North AP,
ed), pp 1-71. Boca Raton, FL: CRC.
-
Chen J,
Zou A,
Splawski I,
Keating MT,
Sanguinetti MC
(1999)
Long QT syndrome-associated mutations in the Per-Arnt-Sim (PAS) domain of HERG potassium channels accelerate channel deactivation.
J Biol Chem
274:10113-10118[Abstract/Free Full Text].
-
Chomczynski P,
Sacchi N
(1987)
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:156-159[Web of Science][Medline].
-
Coetzee W,
Amarillo Y,
Chiu J,
Chow A,
Lau D,
McCormack T,
Moreno H,
Nadal MS,
Ozaita A,
Pountney D,
Saganich M,
Vega-Saenz de Miera E,
Rudy B
(1999)
Molecular diversity of K+ channels.
Ann NY Acad Sci
868:233-285[Web of Science][Medline].
-
Curran ME,
Splawski I,
Timothy KW,
Vincent GM,
Green ED,
Keating MT
(1995)
A molecular basis for cardiac arrhythmia: HERG mutations cause long QT syndrome.
Cell
80:795-803[Web of Science][Medline].
-
Doyle DA,
Morais Cabral J,
Pfuetzner RA,
Kuo A,
Gulbis JM,
Cohen SL,
Chait BT,
MacKinnon R
(1998)
The structure of the potassium channel: molecular basis of K+ conduction and selectivity.
Science
280:69-77[Abstract/Free Full Text].
-
Drysdale R,
Warmke J,
Kreber R,
Ganetzky B
(1991)
Molecular characterization of eag: a gene affecting potassium channels in Drosophila melanogaster.
Genetics
127:497-505[Abstract].
-
Engeland B,
Neu A,
Ludwig J,
Roeper J,
Pongs O
(1998)
Cloning and functional expression of rat ether-a-go-go-like K+ channel genes.
J Physiol (Lond)
513:647-654[Abstract/Free Full Text].
-
Fairén A,
DeFilipe J,
Regidor J
(1984)
Non-pyramidal neurons: general account.
In: Cerebral cortex (Peters A,
Jones EG,
eds), pp 201-254. New York: Plenum.
-
Frings S,
Brull N,
Dzeja C,
Angele A,
Hagen V,
Kaupp UB,
Baumann A
(1998)
Characterization of ether-a-go-go channels present in photoreceptors reveals similarity to IKx, a K+ current in rod inner segments.
J Gen Physiol
111:583-599[Abstract/Free Full Text].
-
Ganetzky B,
Robertson AG,
Wilson FG,
Trudeau MC,
Titus SA
(1999)
The eag family of K+ channels in Drosophila and mammals.
Ann NY Acad Sci
868:356-369[Web of Science][Medline].
-
Hahn ME,
Karchner SI,
Shapiro MA,
Perera SA
(1997)
Molecular evolution of two vertebrate aryl hydrocarbon (dioxin) receptors (AHR1 and AHR2) and the PAS family.
Proc Natl Acad Sci USA
94:13743-13748[Abstract/Free Full Text].
-
Hartmann HA,
Kirsch GE,
Drewe JA,
Taglialatela M,
Joho RH,
Brown AM
(1991)
Exchange of conduction pathways between two related K+ channels.
Science
251:942-944[Abstract/Free Full Text].
-
Hille B
(1992)
In: Ionic channels of excitable membranes. Sunderland, MA: Sinauer.
-
Hoshi N,
Takahashi H,
Shahidullah M,
Yokoyama S,
Higashida H
(1998)
KCR1, a membrane protein that facilitates functional expression of non-inactivating K+ currents associates with rat EAG voltage-dependent K+ channels.
J Biol Chem
273:23080-23085[Abstract/Free Full Text].
-
Iverson LE,
Rudy B
(1990)
The role of the divergent amino and carboxyl domains on the inactivation properties of potassium channels derived from the Shaker gene of Drosophila.
J Neurosci
10:2903-2916[Abstract].
-
Jan LY,
Jan YN
(1997)
Cloned potassium channels from eukaryotes and prokaryotes.
Annu Rev Neurosci
20:91-123[Web of Science][Medline].
-
Jones EG
(1975)
Varieties and distribution of non-pyramidal cells in the somatic sensory cortex of the squirrel monkey.
J Comp Neurol
160:205-267[Web of Science][Medline].
-
Jones EG
(1985)
In: The thalamus. New York: Plenum.
-
Kaczmareck KL,
Levitan IB
(1987)
In: Neuromodulation: the biochemical control of neuronal excitability. New York: Oxford UP.
-
Keller A
(1995)
Synaptic organization of the barrel cortex.
In: Cerebral cortex (Jones E,
Diamond IT,
eds), pp 221-262. New York: Plenum.
-
Klein M,
Camardo J,
Kandel ER
(1982)
Serotonin modulates a specific potassium current in the sensory neurons that show presynaptic facilitation in Aplysia.
Proc Natl Acad Sci USA
79:5713-5717[Abstract/Free Full Text].
-
Latorre R,
Oberhauser A,
Labarca P,
Alvarez O
(1989)
Varieties of calcium-activated potassium channels.
Annu Rev Physiol
51:385-399[Web of Science][Medline].
-
Levitan IB
(1988)
Modulation of ion channels in neurons and other cells.
Annu Rev Neurosci
11:119-136[Web of Science][Medline].
-
Liman ER,
Tytgat J,
Hess P
(1992)
Subunit stoichiometry of a mammalian K+ channel determined by construction of multimeric cDNAs.
Neuron
9:861-871[Web of Science][Medline].
-
Llinas RR
(1988)
The intrinsic electrophysiological properties of mammalian neurons: insights into central nervous system function.
Science
242:1654-1664[Abstract/Free Full Text].
-
Ludwig J,
Terlau H,
Wunder F,
Bruggemann A,
Pardo LA,
Marquardt A,
Stuhmer W,
Pongs O
(1994)
Functional expression of a rat homologue of the voltage gated ether a go-go potassium channel reveals differences in selectivity and activation kinetics between the Drosophila channel and its mammalian counterpart.
EMBO J
13:4451-4458[Web of Science][Medline].
-
Ludwig J,
Owen D,
Pongs O
(1997)
Carboxy-terminal domain mediates assembly of the voltage-gated rat ether-a-go-go potassium channel.
EMBO J
16:6337-6345[Web of Science][Medline].
-
MacKinnon R,
Yellen G
(1990)
Mutations affecting TEA blockade and ion permeation in voltage- activated K+ channels.
Science
250:276-279[Abstract/Free Full Text].
-
McCormick DA
(1990)
Membrane properties and neurotransmitter actions.
In: The synaptic organization of the brain (Shepherd GM,
ed), pp 32-66. New York: Oxford UP.
-
McCormick DA
(1992)
Neurotransmitter actions in the thalamus and cerebral cortex and their role in neuromodulation of thalamocortical activity.
Prog Neurobiol
39:337-388[Web of Science][Medline].
-
Morais Cabral JH,
Lee A,
Cohen SL,
Chait BT,
Li M,
Mackinnon R
(1998)
Crystal structure and functional analysis of the HERG potassium channel N terminus: a eukaryotic PAS domain.
Cell
95:649-655[Web of Science][Medline].
-
North RA
(1989)
Drug receptors and the inhibition of nerve cells.
Br J Pharmacol
98:13-28[Web of Science][Medline].
-
Papazian DM,
Timpe LC,
Jan YN,
Jan LY
(1991)
Alteration of voltage-dependence of Shaker potassium channel by mutations in the S4 sequence.
Nature
349:305-310[Medline].
-
Perozo E,
Santacruz-Toloza L,
Stefani E,
Bezanilla F,
Papazian DM
(1994)
S4 mutations alter gating currents of Shaker K channels.
Biophys J
66:345-354[Web of Science][Medline].
-
Pongs O
(1992)
Molecular biology of voltage-dependent potassium channels.
Physiol Rev
72:S69-88.
-
Ponting CP,
Aravind L
(1997)
PAS: a multifunctional domain family comes to light.
Curr Biol
7:R674-677[Web of Science][Medline].
-
Reppert SM
(1998)
A clockwork explosion!
Neuron
21:1-4[Web of Science][Medline].
-
Robertson GA,
Warmke JM,
Ganetzky B
(1996)
Potassium currents expressed from Drosophila and mouse eag cDNAs in Xenopus oocytes.
Neuropharmacology
35:841-850[Web of Science][Medline].
-
Rudy B
(1988)
Diversity and ubiquity of K channels.
Neuroscience
25:729-749[Web of Science][Medline].
-
Rudy B,
Hoger JH,
Lester HA,
Davidson N
(1988)
At least two mRNA species contribute to the properties of rat brain A-type potassium channels expressed in Xenopus oocytes.
Neuron
1:649-658[Web of Science][Medline].
-
Rudy B,
Chow A,
Lau D,
Amarillo Y,
Ozaita A,
Saganich M,
Moreno H,
Nadal MS,
Hernandez-Pineda R,
Hernandez-Cruz A,
McIntosh P,
Erisir A,
Leonard C,
Vega-Saenz de Miera E
(1999)
Contributions of Kv3 channels to neuronal excitability.
Ann NY Acad Sci
868:304-343[Web of Science][Medline].
-
Sambrook J,
Fritsch E,
Maniatis T
(1989)
In: Molecular cloning: a laboratory manual, Ed 2. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
-
Sanguinetti MC
(1999)
Dysfunction of delayed rectifier potassium channels in an inherited cardiac arrhythmia.
Ann NY Acad Sci
868:406-411[Web of Science][Medline].
-
Santoro B,
Tibbs GR
(1999)
The HCN gene family: molecular basis of the hyperpolarization-activated pacemaker channels.
Ann NY Acad Sci
868:741-764[Web of Science][Medline].
-
Sassone-Corsi P
(1998)
Molecular clocks: mastering time by gene regulation.
Nature
392:871-874[Medline].
-
Schönherr R,
Hehl S,
Terlau H,
Baumann A,
Heinemann SH
(1999)
Individual subunits contribute independently to slow gating of bovine EAG potassium channels.
J Biol Chem
274:5362-5369[Abstract/Free Full Text].
-
Shi W,
Wymore RS,
Wang HS,
Pan Z,
Cohen IS,
McKinnon D,
Dixon JE
(1997)
Identification of two nervous system-specific members of the erg potassium channel gene family.
J Neurosci
17:9423-9432[Abstract/Free Full Text].
-
Shi W,
Wang HS,
Pan Z,
Wymore RS,
Cohen IS,
McKinnon D,
Dixon JE
(1998)
Cloning of a mammalian elk potassium channel gene and EAG mRNA distribution in rat sympathetic ganglia.
J Physiol (Lond)
511:675-682[Abstract/Free Full Text].
-
Siegelbaum SA,
Camardo JS,
Kandel ER
(1982)
Serotonin and cyclic AMP close single K+ channels in Aplysia sensory neurones.
Nature
299:413-417[Medline].
-
Sigworth FJ
(1994)
Voltage gating of ion channels.
Q Rev Biophys
27:1-40[Web of Science][Medline].
-
Simons DJ,
Woolsey TA
(1984)
Morphology of Golgi-Cox-impregnated barrel neurons in rat SmI cortex.
J Comp Neurol
230:119-132[Web of Science][Medline].
-
Steriade M,
Jones EG,
Llinas RR
(1990)
In: Thalamic oscillations and signaling. New York: Wiley.
-
Steriade M,
McCormick DA,
Sejnowski TJ
(1993)
Thalamocortical oscillations in the sleeping and aroused brain.
Science
262:679-685[Abstract/Free Full Text].
-
Stone DM,
Wessel T,
Joh TH,
Baker H
(1990)
Decrease in tyrosine hydroxylase, but not aromatic L-amino acid decarboxylase, messenger RNA in rat olfactory bulb following neonatal, unilateral odor deprivation.
Brain Res Mol Brain Res
8:291-300[Medline].
-
Terlau H,
Ludwig J,
Steffan R,
Pongs O,
Stuhmer W,
Heinemann SH
(1996)
Extracellular Mg2+ regulates activation of rat eag potassium channel.
Pflügers Arch
432:301-312[Web of Science][Medline].
-
Terlau H,
Heinemann SH,
Stuhmer W,
Pongs O,
Ludwig J
(1997)
Amino terminal-dependent gating of the potassium channel rat eag is compensated by a mutation in the S4 segment.
J Physiol (Lond)
502:537-543[Abstract/Free Full Text].
-
Thomson J,
Higgins D,
Gibson T
(1994)
CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighing, position specific gap penalties, and weight matrix choice.
Nucleic Acids Res
22:4673-4680[Abstract/Free Full Text].
-
Trudeau MC,
Warmke JW,
Ganetzky B,
Robertson GA
(1995)
HERG, a human inward rectifier in the voltage-gated potassium channel family.
Science
269:92-95[Abstract/Free Full Text].
-
Trudeau MC,
Titus SA,
Branchaw JL,
Ganetzky B,
Robertson GA
(1999)
Functional analysis of a mouse brain Elk-type K+ channel.
J Neurosci
19:2906-2618[Abstract/Free Full Text].
-
Wang HS,
Pan Z,
Shi W,
Brown BS,
Wymore RS,
Cohen IS,
Dixon JE,
McKinnon D
(1998)
KCNQ2 and KCNQ3 potassium channel subunits: molecular correlates of the M-channel.
Science
282:1890-1893[Abstract/Free Full Text].
-
Warmke JW,
Ganetzky B
(1994)
A family of potassium channel genes related to eag in Drosophila and mammals.
Proc Natl Acad Sci USA
91:3438-3442[Abstract/Free Full Text].
-
Warmke J,
Drysdale R,
Ganetzky B
(1991)
A distinct potassium channel polypeptide encoded by the Drosophila eag locus.
Science
252:1560-1562[Abstract/Free Full Text].
-
Weiser M,
Vega-Saenz de Miera E,
Kentros C,
Moreno H,
Franzen L,
Hillman D,
Baker H,
Rudy B
(1994)
Differential expression of Shaw-related K+ channels in the rat central nervous system.
J Neurosci
14:949-972[Abstract].
-
Yamada WM,
Koch C,
Adams PR
(1989)
In: Methods in neuronal modeling (Koch C, Segev I, eds), pp 97-133. Cambridge, MA: Bradford.
-
Yool AJ,
Schwarz TL
(1991)
Alteration of ionic selectivity of a K+ channel by mutation of the H5 region.
Nature
349:700-704[Medline].
-
Young SH,
Moore JW
(1981)
Potassium ion currents in the crayfish giant axon. Dynamic characteristics.
Biophys J
36:723-733[Web of Science][Medline].
-
Zhulin IB,
Taylor BL,
Dixon R
(1997)
PAS domain S-boxes in archaea, bacteria and sensors for oxygen and redox.
Trends Biochem Sci
22:331-333[Web of Science][Medline].
Copyright © 1999 Society for Neuroscience 0270-6474/99/192410789-14$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
H. Vacher, D. P. Mohapatra, and J. S. Trimmer
Localization and Targeting of Voltage-Dependent Ion Channels in Mammalian Central Neurons
Physiol Rev,
October 1, 2008;
88(4):
1407 - 1447.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. A. Pardo
Voltage-Gated Potassium Channels in Cell Proliferation
Physiology,
October 1, 2004;
19(5):
285 - 292.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Zou, Z. Lin, M. Humble, C. D. Creech, P. K. Wagoner, D. Krafte, T. J. Jegla, and A. D. Wickenden
Distribution and functional properties of human KCNH8 (Elk1) potassium channels
Am J Physiol Cell Physiol,
December 1, 2003;
285(6):
C1356 - C1366.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. de Jeu, A. Geurtsen, and C. Pennartz
A Ba2+-Sensitive K+ Current Contributes to the Resting Membrane Potential of Neurons in Rat Suprachiasmatic Nucleus
J Neurophysiol,
August 1, 2002;
88(2):
869 - 878.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Saganich, E. Machado, and B. Rudy
Differential Expression of Genes Encoding Subthreshold-Operating Voltage-Gated K+ Channels in Brain
J. Neurosci.,
July 1, 2001;
21(13):
4609 - 4624.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|