 |
Previous Article | Next Article 
The Journal of Neuroscience, December 15, 1999, 19(24):10856-10868
Involvement of Cajal-Retzius Neurons in Spontaneous Correlated
Activity of Embryonic and Postnatal Layer 1 from Wild-Type and Reeler
Mice
Agustí
Aguiló1, 2,
Theodore H.
Schwartz1,
Vikram S.
Kumar1,
Zita A.
Peterlin1,
Areti
Tsiola1,
Eduardo
Soriano2, and
Rafael
Yuste1
1 Department of Biological Sciences, Columbia
University, New York, New York 10027, and 2 Department of
Animal and Plant Cell Biology, Faculty of Biology, University of
Barcelona, Barcelona 08028, Spain
 |
ABSTRACT |
Cajal-Retzius (CR) cells are a transient population of neurons in
developing cortical layer 1 that secrete reelin, a protein necessary
for cortical lamination. Combining calcium imaging of cortical
hemispheres and cross-correlation analysis, we previously found
spontaneous correlated activity among non-CR neurons in postnatal rat
layer 1. This correlated activity was blocked by GABAergic and
glutamatergic antagonists, and we postulated that it was controlled by
CR cells. We now investigate the correlated activity of embryonic and
postnatal layer 1 in wild-type and reeler mice, mutant in the
production of reelin. We find that mouse layer 1 also sustains
patterned spontaneous activity and that CR cells participate in
correlated networks. These networks are present in embryonic marginal
zone and are blocked by GABAergic and glutamatergic antagonists.
Surprisingly, network activity in reeler mice displays similar
characteristics and pharmacological profile as in wild-type mice,
although small differences are detected. Our results demonstrate that
the embryonic marginal zone has correlated spontaneous activity that
could serve as the scaffold for the development of intracortical connections. Our data also suggest that reelin does not have a major
impact in the development of specific synaptic circuits in layer 1.
Key words:
reelin; marginal; neocortex; fura-2; imaging; networks
 |
INTRODUCTION |
After completing their radial
migration (Rakic, 1974 ), developing pyramidal neurons make synaptic
connections in the marginal zone (Marín-Padilla and
Marín-Padilla, 1982 ), a relatively cell-sparse region populated
by Cajal-Retzius (CR) cells (Ramón y Cajal, 1904 ). As the cortex
develops, the marginal zone becomes layer 1 and CR cells disappear, by
either apoptosis or differentiation into nonpyramidal cells
(Marín-Padilla, 1972 ; Parnavelas and Edmunds, 1983 ; Derer and
Derer, 1990 ; Del Río et al., 1995 ). CR cells and their
equivalents in hippocampus produce an extracellular matrix protein
called reelin, defective or absent in mouse reeler mutants
(D'Arcangelo et al., 1995 ; Hirotsune et al., 1995 ; Ogawa et al.,
1995 ), which shows altered neuronal migration in neocortex, hippocampus, and cerebellum (Caviness and Sidman, 1973 ). Reelin is also
involved in the axonal growth and synaptogenesis of entorhinal projections to the hippocampus (Del Río et al., 1995 ; Borrell et al., 1999 ). These findings indicate that layer 1 is likely to play a
major role in cortical development.
Besides CR (horizontal) neurons, two other cell types are found in
developing layer 1: vertical cells with descending axons and
neurogliaform cells (Ramón y Cajal, 1904 ; Marín-Padilla, 1984 ; Hestrin and Armstrong, 1996 ; Zhou and Hablitz, 1996 ). These non-Cajal-Retzius (NCR) cells also receive synaptic inputs (Hestrin and
Armstrong, 1996 ; Zhou and Hablitz, 1996 ) and are GABAergic (Gabbott and
Somogyi, 1986 ), whereas CR cells react with antibodies against
glutamate, cholinesterase, calretinin, calbindin D-28K, and parvalbumin
(Del Río et al., 1995 ; Huntley and Jones, 1990 ; Meyer et al.
1998 ).
Because of the resilience of orientation maps in visual cortex to
manipulations of cortical inputs during development, it has been
proposed recently that the activity of the marginal zone could generate
a "protomap" of clustered horizontal connections (Galuske and
Singer, 1996 ; Schmidt et al., 1999 ). This idea and the key role that
spontaneous correlated activity has in CNS development (Shatz, 1990 ;
Katz and Shatz, 1996 ) make it important to establish whether the
marginal zone, which with the subplate are the earliest generated
cortical layers, has spontaneous correlated activity.
In a previous study of postnatal marginal zone in hemisphere
preparations, we discovered that NCR neurons had correlated increases in their intracellular free calcium concentration
([Ca2+]i),
indicative of coordinated spontaneous activity (Schwartz et al., 1998 ).
These NCR networks were sensitive to synaptic blockers, and we
postulated that they were controlled by CR neurons. To further
investigate these networks and inquire whether the embryonic marginal
zone also has correlated spontaneous activity, we have now performed
similar experiments in isolated hemispheres from embryonic and
postnatal wild-type (wt) and reeler mice. We find that, in mice,
this correlated activity is already present in embryonic marginal zone
and that CR neurons form part of these networks. Surprisingly, we do
not find any major differences in correlated networks between wild-type
and reeler mice, indicating that the layer 1 circuit is basically
functional in reeler mice.
 |
MATERIALS AND METHODS |
Strains and establishment of reeler phenotype. Animal
handling and experimentation was performed in accordance with the
National Institutes of Health Guide for the Care and Use of
Laboratory Animals (National Institutes of Health publication
number 86-23, revised 1987). We used Balb/C wild-type mice ranging
from embryonic day 17 (E17) to postnatal day 10 (P10). C7
mice were also used for wild-type E15 experiments. Reeler mice of the
Orleans (rl-Orl) strain were used from E15 to P6 and had a Balb/C
genetic background. The reeler phenotype was identified in postnatal
mice using parasagittal slices of the cerebellum to detect abnormal
gyri and lamination and transverse slices of hippocampus to detect
whether the pyramidal CA1 layer was intact. In embryonic animals and in
some postnatal animals, we used PCR to detect the transposable element
in tail extracts. Genomic DNA was used in a PCR reaction with primers to amplify the wild-type reelin gene (CGACTGCTCTGTCTTCAGTCACGAG) sequence only expressed in wt reeler gene, the (CTCGAGTGAGGTCCAGTGGCTT) sequence expressed both in wt and mutated reelin gene, and the transposable element (GGATGGACCTGGAGAGCATCATCC) as marker of the mutant gene.
Animal dissection. Mice were anesthetized by hypothermia,
and their brains were removed and placed in oxygenated artificial CSF (ACSF) (in mM: NaCl 120, KCl 3, D-glucose 10, NaHCO3 26, NaH2PO4 2.25, CaCl2 2, and MgSO4 2, pH
7.4, oxygenated with 95% O2-5% CO2). For embryonic experiments, pregnant mice
were anesthetized with ketamine-xylazine, and pups were surgically
removed and placed in ice-cold ACSF. Brains were dissected by splitting
the hemispheres with a razor blade and gluing them to the bottom of a
Petri dish filled with ACSF. The pia was carefully removed under a
dissecting microscope.
Loading of fura-2 and pharmacology. Fura-2 AM (Molecular
Probes, Eugene, OR) was dissolved in DMSO with 0.001% Pluronic
acid (Molecular Probes). Following Schwartz et al. (1998) , we used a
two-step incubation protocol. First, we incubated the hemisphere with
2-5 µl of the 5 mM fura-2 AM for 1-2 min.
Then, we performed a second incubation with 3-5 ml of oxygenated ACSF
with 5-10 µM fura-2 AM. The second incubation
took at least 20 min and was performed in the dark at room temperature
(~25 C°). AP-5 (50 µM), CNQX (20 µM), bicuculline (30 µM), and TTX (1 µM)
were dissolved in ACSF and bath applied. All drugs were obtained from
Sigma (St. Louis, MO).
Imaging. After dye incubation, the hemisphere was placed
under a fluorescent microscope (BX50WI; Olympus Opticals, Tokyo, Japan)
equipped with 380 and 340 nm excitation filters and differential interface contrast (DIC) optics. For imaging, we used a
silicon-intensified tube camera (Hamamatsu C2400-08) and a
frame grabber (LG-3; Scion Corp., Frederick, MD), connected to a
Macintosh computer (Apple Computers, Cupertino, CA). Fluorescent images
were taken at 380 nm excitation using time-lapse imaging (15 averaged
frames, every 4 sec) for periods of up to 40 min. Images were acquired
and processed by NIH Image. To prevent photobleaching, we used a
shutter controlled by custom-written macros. The sample was perfused
with standard (3 mM KCl) or high-potassium ACSF
(in mM: NaCl 77, KCl 50, D-glucose 10, NaHCO3 26, NaH2PO4 2.25, CaCl2 2, and MgSO4 2).
Spontaneous activity was imaged using 20, 40, and 60× objectives.
Single cell reconstruction. Neurons were filled with
a patch pipette containing 1% biocytin injected with depolarizing
current pulses (0.3 nA, 10 Hz) for 30 min. After fixation in 4%
paraformaldehyde, slices were rinsed three times in PBS and incubated
in 10% methanol-3% H2O2 for 30 min. Slices
were rinsed in PBS and incubated in a horseradish
peroxidase-conjugated avidin-biotin complex (Peroxidase Elite
ABC Kit; Vector Laboratories, Burlingame, CA) prepared in 0.75% Triton
X-100 for 3 hr at room temperature. Slices were then rinsed and reacted
with a 2.5 mg/ml diaminobenzidine (DAB) solution in Tris buffer for 20 min. Biocytin-injected neurons were revealed by the DAB precipitate.
Before final dehydration through an ethanol series, slices were stained
with Nuclear yellow for demarcation of cortical layers.
Analysis. Changes in fluorescence in multiple cells were
analyzed with a program written in interactive data language
(Research Systems, Inc., Boulder, CO). We defined the fluorescence
change over time as F/F = (F0 F1)/F0.
The onset of each calcium transient for every cell was determined using
an algorithm that defined the onset as the frame after which the
F/F change was larger than a given set
threshold, typically a 3-5 pixel value units change per frame. This
threshold algorithm was very sensitive but produced false positives in
some cells in which noisy baseline values were scored as transients, as
determined by visual inspection. Calcium transients detected by the
program were carefully inspected, and spurious events were removed
before displaying the onset times on a raster plot. These raster plots
were used to calculate the matrix of asymmetric correlation
coefficients between all cell pairs, i.e., the proportion of times that
a cell becomes active when another cell is also active. We then used
contingency tables and 2 tests to
detect which correlation coefficients were significantly greater than
expected. Significant correlation coefficients were then used to
generate a correlation map in which lines link neurons whose asymmetric
correlation coefficient are significant (p < 0.05) and in which the thickness of a line connecting any two cells
represents the magnitude of the greater asymmetric correlation coefficient between the cells.
To test whether transients showed associations between neurons, we
measured the number of simultaneous activations in a recording and used
it as a test statistic. To determine its p value, we computed the distribution of the statistic under the null hypothesis of
independent transients. To do this, we used Monte Carlo simulations with 1000 replications. The p value was then calculated as
the proportion of the 1000 replications in which the test statistic exceeded the test statistic computed from real data. To simulate independent realizations of the transients, the number of transients in
each train was preserved, but the times of the transients were chosen
randomly. This approach is equivalent to assuming that the
distributions of the transients behave as Poisson processes with
varying underlying rates. We tested this assumption with control
computation of p values using randomized starting times for
each train and wrapping around the ends, without finding any different results.
We also performed two additional tests on each data set. The first
detected cells that activated simultaneously and treated the number of
coactive groups over the entire recording as the test statistic. The
second test detected groups of cells that activated simultaneously more
than once and used that number as the test statistic. Monte Carlo
simulations were again used to estimate the significance of these two
test statistics. Nonparametric tests were used to compare measurements.
Comparison among p values was not attempted because
of differences in sizes from the original populations.
 |
RESULTS |
Fura-2 AM loads CR and NCR neurons in developing mouse layer 1
To characterize the spontaneous activity pattern present
in developing layer 1 in wild-type mice, we imaged hemispheres from 51 embryonic and postnatal animals (E15 to P10). Isolated hemisphere preparations, when maintained under adequate oxygenated solution, can
be used for several hours for physiological studies of developing layer
1 (Schwartz et al., 1998 ). After removal of the pia, layer 1 is the
most superficial cell layer and can be clearly distinguished because of
the distinct horizontal dendritic profiles of CR neurons (Fig.
1). To assess morphologically which types
of neurons were loaded with fura-2, we used DIC from layer 1 slices to
identify whether labeled neurons were CR or NCR (Fig.
1A). To identify CR neurons, we applied the criteria
that CR cells under DIC have one main dendritic process, oriented
parallel to the pial in apparently random directions (Schwartz et al.,
1998 ). We confirmed this criteria for the mouse layer 1 using
whole-cell recording of neurons that had a horizontal process under DIC
to fill them with Lucifer yellow or biocytin. Camera lucida
reconstructions of biocytin filled neurons demonstrated their clear CR
morphologies and processes (Fig. 1C). In layer 1 slices, we
found that CR and NCR neurons labeled equally with fura-2 AM and, in
hemispheres, we clearly detected in the fluorescent cells with
horizontal processes, indicative of CR neurons, as well as other
neurons without clearly visible processes, presumably NCR cells. In
addition CR cells were usually larger than NCR cells. We concluded that
fura-2 AM incubations loaded both types of layer 1 neurons in both
slices and hemisphere preparations from developing mice.

View larger version (75K):
[in this window]
[in a new window]
|
Figure 1.
Fura-2 loading of CR and non-CR neurons in mouse
layer 1. A, DIC image of a tangential brain slice from a
P1 mouse cortex. The slice is viewed from its pial surface after the
pia has been removed. Several CR neurons (numbers) can
be distinguished by their long dendritic process. Putative non-CR cells
(letters) lack any major process. Scale bar, 20 µm.
B, Fluorescence image of the same region after staining
with fura-2 AM. Note how both CR and putative NCR neurons are labeled
by the indicator. C, Photomicrograph of a processed
coronal slice containing a biocytin-filled CR cell. The major
horizontal process can be distinguished. Scale bar, 50 µm.
D, Camera lucida reconstruction of neuron shown in
C. The layer 1 border is drawn with a stippled
line. Scale bar, 100 µm.
|
|
Networks of spontaneously coactive neurons in wild-type mouse
layer 1
In hemisphere preparations, spontaneous increases in
[Ca2+]i were
detected in dozens of neurons (Fig. 2).
Both CR and NCR neurons participated in this spontaneous activity (Fig.
2C). These spontaneous calcium transients were slow, with
rise times of 4-20 sec and decay times of 20-50 sec. These time
courses enabled us to follow their occurrence using time lapse imaging
with slow frame rates (1 frame/4 sec) for long periods of time (up to
40 min) (Fig. 2C).

View larger version (80K):
[in this window]
[in a new window]
|
Figure 2.
Spontaneous calcium transients in wild-type layer
1 show complex spatiotemporal patterns. A, Fluorescence
image of a cortical hemisphere from a P3 mouse loaded with fura-2 AM.
Many labeled neurons are visible. Scale bar, 20 µm. B,
Cells chosen for the analysis. Black squares indicate
cells exhibiting transients. Neurons 3, 4, and 8 were identified as
Cajal-Retzius. C, Plots of
 F/F over time measured in four
representative cells during spontaneous activity. Each fluorescence
transient is marked with a time stamp (lines) seen at
bottom of graph (see Materials and Methods). Note that
the program successfully detects all calcium transients. Time axis,
sec;  F/F axis,
 (percent). D, Composite raster plot of all
cells chosen in B indicating the onset of each calcium
transient as displayed in C. Each line
represents a cell, and each tick mark represents the
time of onset of a calcium transient. Note that the spontaneous
activity does not follow any clear pattern, although correlated
activation of two or more cells can be detected. Duration, 600 sec.
|
|
To analyze the optical recordings, we first transformed the
fluorescence intensities over time for each neuron into a raster plot
in which the time of initiation of each calcium transient for each cell
was marked (Fig. 2D). Although from visual inspection of the recordings it was not possible to detect clear spatiotemporal patterns to the activation, in many experiments our analysis showed spontaneous correlated activation of many neurons (Fig.
2D, cells 8-10). To quantify the degree
of correlation present in the data set, we counted the number of times
that any two cells had simultaneous onset activation times (i.e., in
the same frame) and compared that number with the number of
simultaneous activation times present in a distribution of 1000 random
experiments, created with Monte Carlo simulations (Fig.
3A; see Materials and
Methods). This comparison gave us a p value for the real
data set that described the probability that the number of
coactivations present in it was caused by chance and thus characterized
the overall level of coactivation present in the recordings. This
p value changed from preparation to preparation but was
typically similar in recordings taken from the same preparation. It
should be noted that this p value was normalized for the
number of neurons, activation rates, and time resolution of the
recording, because the Monte Carlo simulations were created using the
same number of neurons, activations, and time intervals present
in the real data set (see Materials and Methods). This statistical analysis is only applicable if there are enough activations in a
recording; otherwise, the test statistic (number of coactivations) cannot be computed. Using this analysis, we found that a substantial number of experiments (four of five recordings in standard ACSF and 30 of 51 recordings in high K+ ACSF; see
below) had significant levels of coactivation (p < 0.05). These results show that, like rat developing layer 1 (Schwartz et al., 1998 ), mouse layer 1 can sustain spontaneous
correlated activity.

View larger version (17K):
[in this window]
[in a new window]
|
Figure 3.
Networks of CR and NCR cells in wild-type layer 1. A, Distribution of pairwise correlations ("hits")
found in the real (arrow) and simulated
(line) data set from Figure 2. The number of correlated
events in the real data set is greater than those obtained in 1000 Monte Carlo simulations (bell-shaped curve; see Materials and Methods).
B, Correlation map of cells imaged in Figure 2. Each
black square represents an active cell.
Lines link cells with a statistically significant
correlation coefficients (see Materials and Methods). C,
Raster plot of the experiment showing which neurons fire simultaneously
in groups (dotted lines). D, Correlation
map based on the groups of cells firing simultaneously in
C. Note how the coactive groups cover the same cortical
territory. Note also how CR cells 3, 4, and 8 are correlated with both
CR and NCR cells. Scale bar, 10 µm.
|
|
CR neurons participate in correlated networks in mouse layer 1
To identify the neurons responsible for the correlated
activity, we first plotted the significant asymmetric correlation
coefficients, as assayed with 2
contingency tables, among all neuron pairs (Fig. 3B;
Materials and Methods). This analysis produced maps with many
significant correlations among neurons. Nevertheless, given the large
number of active neurons present in our recordings, we reasoned that some of these putative correlations could be caused by chance coactivations. To further inquire which correlation was likely to be
real, we used additional analysis, aimed at identifying (1) multiple
coactivations of two neurons (two cells, many times) or (2)
coactivation of multiple neurons (many cells, once) (Fig. 3C). Both classes of events are very unlikely to occur
because of chance given the multiplicative effect of low probabilities. Indeed, further Monte Carlo simulations of these groups in most cases
produced p values for the occurrence of multiple
coactivations of either type equal to zero, i.e., multiple coactivation
never occurred in the simulated randomized experiments. This analysis showed that groups of neurons, ranging from two to nine neurons per
group, sustained simultaneous calcium transients, therefore forming
networks of coactive neurons. Using these two types of multiple
coactivation, we then created correlation maps in which lines linked
neurons that participated in multiple coactivation events (Fig.
3D). These maps invariably showed that different networks of
coactive neurons overlapped in the same territories, and, in many
cases, individual neurons participated in more than one network. We
concluded that overlapping networks of coactive neurons exist in mouse
developing layer 1.
In our previous study of the spontaneous activity of rat developing
layer 1, we did not detect instances of CR neurons participating in the
coactive networks. Given the low activation rate that CR neurons had in
our recordings from rat preparations, we reasoned that this negative
result could have been produced because low activation rates made it
unlikely that we record their coactivations with other neurons
(Schwartz et al., 1998 ). In our data from rat layer 1, however, we
noticed that glutamate receptor antagonists blocked the coactivation of
the networks. Given the fact that CR neurons are glutamatergic (Del
Río et al., 1995 ), we proposed that they could control the
coactivation of NCR cells.
In our recordings from mouse layer 1, we indeed found that CR neurons
were part of the correlated networks (cell 4 in Figs. 2,
3D). Analysis of the correlation maps produced with both
multiple coactivation detection methods explained above showed that CR neurons were involved in coactive networks with NCR and other CR cells
(24 of 37 CR cells from 18 of 51 movies).
Development of correlated networks in wild-type layer 1
To study whether there were developmental changes in these
correlated networks, we imaged the spontaneous coactivations of layer 1 hemispheres at different ages, ranging from E15 to P10 (Figs.
4, 5). To
characterize the overall level of correlations, we used the
p value of the simultaneous correlations, calculated as
explained. Neither the proportion of experiments that showed significant p values (p < 0.05) nor
the average p value that resulted from pooling all the
experiments together changed significantly in the ages examined (Fig.
6A). These results
show, for the first time, that correlated spontaneous activity is
present in the marginal zone at embryonic ages, and they also
indicate that the overall level of spontaneous correlations is
relatively constant in the late embryonic and early postnatal layer 1 in wild-type mice. Similarly, there did not appear to be a significant
developmental trend in the average rate of spontaneous activation (Fig.
6B) or the average number of cells that were
spontaneously active (Fig. 6C). Finally, we found
involvement of CR neurons in the networks at different ages, without
any clear developmental trend (Fig. 6D). We conclude
that these features of the layer 1 networks are preserved without major
changes during embryonic and early postnatal development.

View larger version (73K):
[in this window]
[in a new window]
|
Figure 4.
Imaging spontaneous activity in embryonic layer 1. A, Fluorescence image of a cortical hemisphere from an
E18 mouse loaded with fura-2 AM. Many labeled neurons are visible.
Scale bar, 20 µm. B, Cells analyzed. Neurons 1, 2, 3, 6, and 8 were identified as Cajal-Retzius. C, Plots of
 F/F over time measured in four
representative cells during spontaneous activity. Again, the onset of
each fluorescence transient is marked with a time stamp seen at the
bottom of graph (see Materials and Methods). Time axis,
sec;  F/F axis,
 (percent) for cells 1, 4, and 19; 
(percent) for cell 8. D, Composite raster plot of all
cells chosen in B. Duration, 600 sec.
|
|

View larger version (39K):
[in this window]
[in a new window]
|
Figure 5.
Networks of CR and NCR cells in embryonic layer 1. A, Distribution of pairwise correlations found in the
real (arrow) and simulated data set from Figure 4.
B, Correlation map of cells imaged in Figure 4.
C, Raster plot of the experiment highlighting groups of
coactive neurons (lines). D, Correlation
map based on the groups of cells firing simultaneously in
C. Note how CR cells 1, 2, 3, 6, and 8 are correlated
with both CR and NCR cells. Scale bar, 10 µm.
|
|

View larger version (17K):
[in this window]
[in a new window]
|
Figure 6.
Quantification of the spontaneous activity in
wild-type hemispheres and pharmacological blockade of the networks.
A, Histogram of the degree of correlation (as measured
by the p statistic; see Materials and Methods) as a
function of age. A lower p indicates a high degree of
pairwise correlation. The bars represent the mean p, and
the error bars represent the SE. The fraction represents the
number of experiments that had significant
(p < 0.05) correlations, divided by the
total number of experiments. B, Histogram of the
activation rate (number of transients/cell/104 sec)
as a function of age. The total number of experiments as in
A. C, Histogram of the number of active
cells as a function of age. D, Histogram of the
percentage of the active CR cells that form part of a network,
divided by the total number of CR cells. For each age, the number of
experiments in which active CR were identified is given
below the histogram. E, Pharmacological
effects on the networks. Histogram of the average p
value (as above) under 3 and 50 mM K+
ACSF, AP-5 (50 µM), AP-5-CNQX (50-20 µM),
BMI (30 µM), and TTX (1 µM). White
bars are the mean p value under each test, and
black bars represent control experiments using 50 mM K+ ACSF. The fraction
represents the number of experiments that had significant
(p < 0.05) correlations, divided by the
total number of experiments. Note how AP-5, CNQX-AP-5, BMI, and TTX
increase the average p value (i.e., decorrelate the
networks).
|
|
Coactive networks in wild-type mouse layer 1 are mediated by
glutamate and GABA
To characterize whether these correlated networks were
mediated synaptically, we used bath applications of antagonists of glutamate receptors, GABA-A receptor, and sodium channel and measured their effect on the control p values, calculated from
recordings of the same neurons under identical experimental conditions
(Fig. 6E). The p value was again computed
with a Monte Carlo simulation that generated 1000 random iteration of
the data (see Materials and Methods) to produce a random distribution
of the number of coincident calcium transients. The p value
for the real movie was then calculated directly by comparing its number
of coincident events with this distribution. To ensure that the level
of activation of the neurons was high and thus enhance our detection of
possible effects of these blockers on the correlations, we used
high-potassium (50 mM) ACSF instead of normal (3 mM) ACSF, because, from our previous work in rat
layer 1 and from control experiments in mouse layer 1, both 3 or 50 mM KCl produced significant p values
in most of the recordings (for 3 mM, four of five
recordings with p < 0.05; mean p = 0.058; for 50 mM, 27 of 48 recordings with p < 0.05; mean p = 0.162).
In mouse layer 1, the sodium channel blocker TTX, which blocks axonal
conduction, produced increases in the average p value from
control recordings, indicating that their application reduced the
correlations present (Fig. 6E). These increases in
p value occurred in the absence of significant effects in
the activation rate or in the number of active neurons, suggesting that
the spontaneous calcium transients still occur but become decorrelated
in TTX. Similar results were found with the glutamate receptor
antagonist CNQX and with the GABA-A antagonist bicuculline methiiodide
(BMI) (Fig. 6E). Results from experiments with the
NMDA receptor antagonist AP-5 also produced a decorrelation of the
spontaneous activity. Again, their effects occurred in the absence of
effects on activation rates or number of active cells. Because CR
neurons are glutamatergic and NCR neurons are GABAergic, these results
are consistent with the network correlations being mediated
synaptically by NCR and CR neurons.
Networks of spontaneously coactive neurons in reeler mouse
layer 1
We wondered whether these coactive networks were affected
in reeler mice. Because of disrupted reelin production by CR cells, these mice have profound defects in cortical lamination and in afferent
pathfinding in hippocampal marginal zone (Caviness and Sidman, 1973 ;
D'Arcangelo et al., 1995 ; Hirotsune et al., 1995 ; Ogawa et al., 1995 ;
Del Río et al., 1997 ; Borrell et al. 1999 ). Therefore, we
expected that the connectivity in layer 1 would also be disrupted
because of both migratory or pathfinding defects.
To explore layer 1 networks in reeler, we used animals from the Orleans
reeler strain (rlOrl), a frame-shift mutation
resulting from the insertion of a P1 transposable element within the
coding sequence of reelin gene (Takahara et al., 1996 ; De Bergeyck et al., 1997 ). In hemispheres from reeler mice, we also encountered spontaneous calcium transients in both CR and NCR neurons with a
complicated spatiotemporal pattern (Fig.
7). Statistical analysis of these data
sets computing a global p value for the entire correlation matrix (as above) also produced significant levels of correlated activity in most recordings (in standard ACSF, two of three recordings with p < 0.05; mean p = 0.18; in high
K ACSF, 16 of 33 recordings with p < 0.05; mean
p = 0.151). Further analysis focusing on the occurrence
of either multiple correlations of the same two neurons of single
correlations of multiple neurons also indicated that the correlated
activity was extremely unlikely to be attributable to chance (Fig.
8). This analysis also showed the
presence of networks of correlated neurons superimposed in the same
cortical territories (Fig. 8D). These networks were
composed of both NCR and CR (cell 12 in Figs. 7, 8) neurons.
Thus, we concluded that the reeler phenotype did not disrupt the
appearance of the correlated networks in developing layer 1 and that CR
neurons are also part of these networks.

View larger version (64K):
[in this window]
[in a new window]
|
Figure 7.
Spontaneous calcium transients in reeler layer 1. A, Fluorescence image of a cortical hemisphere from a P3
reeler mouse loaded with fura-2 AM. Scale bar, 20 µm.
B, Cells chosen for the analysis. Cell 12 was identified
as a CR. C, Plots of
 F/F over time measured in four
representative cells during spontaneous activity. Time axis,
sec;  F/F axis,
 (percent). D, Composite raster plot of all
cells chosen. Note that the spontaneous activity also does not follow
any clear pattern, although correlated activation of two or more cells
can be detected. Duration, 1200 sec.
|
|

View larger version (28K):
[in this window]
[in a new window]
|
Figure 8.
Networks of CR and NCR cells in reeler layer 1. A, Distribution of pairwise correlations found in the
real (arrow) and simulated data set from Figure 7. The
number of correlated events in the real data set is higher than the
tail of the gaussian distribution obtained with 1000 Monte Carlo
simulations (see Materials and Methods). B, Correlation
map of cells imaged in Figure 7. C, Raster plot of an
experiment marking groups of cells that fire simultaneously
(dotted lines). D, Correlation map based
on the groups of cells firing simultaneously in C. Note
how CR cell 12 is correlated with NCR cells. Scale bar, 10 µm.
|
|
Quantitative differences in correlated activity in
reeler hemispheres
Although the networks found in reeler hemispheres
resembled those found in wild-type mice, we wondered whether there
could be significant differences in them when compared during their development. We therefore performed a developmental study of the networks in reeler mice (Fig. 9) using
the same ages that we had used previously for our wild-type study (Fig.
6). In this comparison, we noticed a developmental trend in reeler
hemispheres to be more decorrelated with age, as revealed by both a
decrease in the number of hemispheres with significant correlations
(p < 0.05) and an increase the average
p value for the correlation present in all the experiments
(Fig. 9A). Compared with wild type, reeler hemispheres had
lower rates of activation (Fig. 9B) and increased number of active cells, a small effect that was statistically significant at P1
and P4 (Fig. 9C, asterisks). Finally, the
participation of CR neurons in the networks of both reeler and
wild-type hemispheres was similar (Fig. 9D). These results
suggested that, although reeler hemispheres had more active neurons,
their rate of activation was slightly lower than those found in
wild-type mice. Also, the reeler networks appeared to become
increasingly decorrelated with age.

View larger version (15K):
[in this window]
[in a new window]
|
Figure 9.
Quantification of the spontaneous activity in
reeler and pharmacological blockade of the networks. Same convention as
in Figure 4. A, Histogram of the degree of correlation
as a function of age. Note how the networks become more decorrelated
with increasing age. B, Histogram of the activation rate
as a function of age. C, Histogram of the number of
active cells as a function of age. Asterisks mark ages
that are statistically significantly larger
(p > 0.05) than wild-type hemisphere (see
Fig. 6C). D, Percentage of the active CR
cells that form part of a network. E, Pharmacological
effects on the reeler networks. Histogram of the average
p value (as above) under 3 mM
K+ ACSF, AP-5 (50 µM), BMI (30 µM), and TTX (1 µM). White
bars are the mean p value under each test, and
black bars represent control experiments using 50 mM K+ ACSF. Note how, in reeler layer 1, AP-5, BMI, and TTX also increase the average p value
(i.e., decorrelate the networks).
|
|
Coactive networks in reeler layer 1 are blocked by glutamatergic
and GABAergic antagonists
We finally investigated whether the mechanisms underlying
the networks correlations was different in reeler hemispheres. For this
purpose, we repeated with reeler (Fig. 9E) the same
pharmacological experiments used in wild type (Fig.
6E). As opposed to wild-type hemispheres, in reeler
the addition of 50 mM KCl ACSF produced a
significant increase in the total correlations, as measured with our
global p value. Like in wild-type mice, the sodium channel blocker TTX, the glutamate blocker APV, and the GABA-A receptor blocker
BMI produced a significant increase in the correlations, indicating
that these networks were also synaptically mediated and that
glutamatergic and GABAergic pathways were also involved.
 |
DISCUSSION |
Synaptic control of spontaneous correlated calcium transients
For this study, our rationale was to use calcium imaging
from populations of neurons to detect their activity patterns and then
apply correlation analysis to the spatiotemporal activity patterns to
identify which neurons had correlated activity which were statistically
significance difference from chance. Although calcium is a second
messenger, the availability of sensitive calcium indicators that can be
bulk-loaded using AM esters (Tsien, 1981 ; Yuste, 1999 ), and the tight
correlation between neuronal activity and increases in intracellular
free calcium concentration
([Ca2+]i) make it
possible to use calcium imaging to indirectly monitor neuronal activity
from populations of neurons (Yuste and Katz, 1991 ; O'Donovan et al.,
1993 ; Wong et al., 1993 ; Smetters et al., 1999 ).
We focused in characterizing the patterns of spontaneous calcium
transients present in layer 1 from hemispheres from wild-type and
reeler embryonic and early postnatal mice. The cellular mechanisms that
cause these calcium transients are still unclear. Because they are not
blocked by TTX, they cannot be directly produced by sodium action
potentials. Because of their slow kinetics and high amplitudes, these
transients are likely caused by the release of calcium from internal
stores (Berridge, 1998 ). In fact, in both cultured pyramidal neurons
(Jacobs and Meyer, 1997 ) and pyramidal neurons in neocortical slices
(A. Tashiro and R. Yuste, unpublished observations),
release of calcium from internal stores has been demonstrated.
Regardless of the cellular mechanism, in this study we use the
spontaneous calcium transient as an assay to characterize the activity
of the network. Like in our previous study in rat layer 1 (Schwartz et
al., 1998 ), we find that these calcium transients are statistically
correlated among groups of neurons and that application of TTX,
GABAergic, and glutamatergic blockers block the correlations, without
affecting the rate of occurrence of the transients. This
pharmacological sensitivity confirms that these correlations are not an
artifact of our statistical analysis and indicates that the time of
occurrence of a calcium transient is under synaptic control, perhaps
mediated by calcium-induced calcium release.
Distributed circuits in layer 1 and possible roles of
network activity
We interpret our results as evidence of specific synaptic
networks in developing layer 1. These microcircuits are superimposed in
the same territories, and we have encountered many cases in which a
particular neuron can be part of different coactivation events.
Therefore, our results are in principle consistent with a distributed
network (Hopfield, 1982 ; Douglas and Martin, 1998 ) present in layer 1.
What is the role of these coactive networks in developing layer 1? We
can imagine two major functions: a developmental one or a computational
one. Like in the developing visual system (Shatz, 1990 ; Katz and
Shatz, 1996 ), coordinated activity in developing layer 1 could be
implicated in activity-dependent developmental rules. Coactivation of
layer 1 networks could have consequences for the formation of intrinsic
connections within layer 1. Also, because of the importance of CR
neurons in controlling neuronal migration (Caviness and Sidman, 1973 ;
D'Arcangelo et al., 1995 ; Hirotsune et al., 1995 ; Ogawa et al., 1995 ;
Soriano et al., 1997 ) and pathfinding (Del Río et al., 1997 ;
Borrell et al., 1999 ) and perhaps even pyramidal neuron development
(Marín-Padilla and Marín-Padilla, 1982 ), network
activity of layer 1 could influence the formation of connections in
other cortical layers, particularly because migrating neuroblasts and
apical dendrites from most pyramidal neurons establish synaptic
contacts in layer 1 (Marín-Padilla and Marín-Padilla,
1982 ). Indeed, because of the resilience of orientation maps in
neocortex to manipulations of cortical inputs during development, it
has been suggested that spatially modulated activity of the marginal
zone could generate a protomap of intrinsic cortical connections
(Schmidt et al., 1999 ). In fact, the long-range projections of CR
neurons could be related to the clustered horizontal connections
(Galuske and Singer, 1996 ), which are also present in rodents (Lohmann
and Roerig, 1994 ). Further experiments, either correlating the
projections from CR neurons or the networks we describe with
orientation maps or clustered horizontal projections, could be used to
test this hypothesis.
Another possible role of these coactive networks could relate
to the information processing performed by layer 1, both during the
developing and adult circuit. Both anatomical (Rockland and Virga,
1989 ) and physiological (Cauller and Kulics, 1991 ) data suggest that
layer 1 is a specialized recipient of feedback information coming from
higher cortical areas, so these layer 1 networks could be involved in
the gating or control of feedback to the cortical circuit.
It seems to us that a direct way to test the putative developmental or
functional role of layer 1 networks is the local infusion of TTX, which
decouples the networks. In one study, TTX infusion in the superficial
layers of late postnatal kitten cortex blocked ocular dominance
plasticity, without any gross disturbance to the cortical architecture
(Reiter et al., 1986 ). A similar type of experiments with local TTX
infusion in layer 1 at embryonic or early postnatal ages could be
useful to evaluate the importance of layer 1 activity during development.
Role of CR in coordinating layer 1 network activity in
wild-type and reeler mice
We draw three main conclusions from our results: (1) CR
neurons participate in the correlated networks in mouse layer 1, (2) these networks exist in embryonic marginal zone, and (3) there are
small differences in these networks between wild-type and reeler mice.
In our previous study in rat developing layer 1, CR neurons did not
participate in the networks, although this could have been caused by
the low activation rates. In the mouse, most CR neurons that are active
are part of a correlated network. This indicates that CR neurons, which
have prominent axonal and dendritic arborization in layer 1, synapse
and receive synapses, respectively, from particular groups of non-CR
neurons, thus forming neuronal microcircuits in developing layer 1.
Also, in our previous work, we never explored embryonic ages. Together
with evidence showing synaptic contacts at the subplate (Hermann et
al., 1994 ), our data show that the earliest generated cortical neurons
can sustain spontaneous correlated activity. The presence of this
spontaneous correlated activity during the earliest phase of cortical
development could have a major effect in the fate and connectivity of
later generated neurons.
Given the devastating effect of the reeler phenotype in the cortical
architecture, we find it surprising that we cannot detect larger
differences in layer 1 networks between wild-type and reeler mice. We
have confidence that our statistical approach is valid, because it can
be affected specifically with pharmacological blockers and also because
the multiple correlations tests detect correlations in both wild-type
and reeler that are extremely difficult to explain by chance (Figs.
3C, 8C). It remains possible that other assays of
the circuit may show more pronounced differences, but at this point our
conclusion is that the layer 1 circuits in wild-type and reeler mice
are basically similar.
Nevertheless, in our study, small differences were found between
wild-type and reeler. The reeler hemispheres appear to have more
correlated activity early in their development (Fig. 9A). Also, neurons in reeler hemispheres show a smaller rate of activation, albeit the number of active cells is slightly higher (Fig.
9B). It is possible that the increased thalamic innervation
found in reeler layer 1 (Molnar et al., 1998 ) could help synchronize
better these marginal zone networks.
Development of circuits in reeler: implications for pathfinding
mechanisms in neocortex
Why are the layer 1 networks relatively intact in reeler
mice? One possibility is that the intrinsic circuitry in layer 1 is
normal in reeler mice. Thus, although reelin has major effects in
regulating neuronal migration (Caviness and Sidman, 1973 ) and axonal
growth (Del Río et al., 1997 ), the neurons located in layer 1 themselves would somehow be "immune" to the lack of reelin. Further
experiments characterizing in detail the anatomical connectivity present in reeler layer 1 could address this interesting scenario.
An alternative possibility, which we favor, is that layer 1 is actually
disrupted in reeler but that the axonal pathfinding mechanisms
responsible for setting up the microcircuitry in layer 1 and between
layer 1 and other cortical layers can overcome the disruption of the
cortical architecture. This idea is consistent with previous functional
studies of reeler cortex. For example, retinotopy, thalamocortical, and
cortico-cortical projections and receptive fields of transcallosal
neurons in reeler are indistinguishable from that of normal mice
(Simmons and Pearlman, 1982 , 1983 ; Simmons et al., 1982 ). Given the
highly specific connectivity that is thought to underlie the building
of receptive fields in the cortex, it seems to us that the precise
axonal pathfinding mechanisms and/or synaptic rearrangements that
occurs in wild-type animals are basically intact in reeler neocortex.
This would imply that gradient information is not essential for
intracortical axonal pathfinding and the mechanisms responsible for
this precise connectivity are so robust that the axons can still find
their correct targets despite their abnormal positions.
 |
FOOTNOTES |
Received July 27, 1999; revised Sept. 3, 1999; accepted Oct. 4, 1999.
R.Y. is supported by the EJLB Foundation, the Arnold and Mabel
Beckman Foundation, and National Eye Institute Grant EY 111787. E.S. is
supported by CICYT Grant SAF-98/106/SAF97-1429-E, The Marató de TV3 Foundation, and the Ramón Areces Foundation.
A.A. holds a Formación Personal Investigador (Ministerio de
Educacion y Ciencia, Spain) fellowship. R.Y. and E.S. are supported by
the Human Frontier Science Program. We thank Carla Shatz for advice, members of both laboratories for comments and help, and Ferran Burgaya
for help genotyping mice.
Correspondence should be addressed to Rafael Yuste, Department of
Biological Sciences, Columbia University, 1212 Amsterdam Avenue, Box
2435, New York, NY 10027. E-mail: rafa{at}cubsps.bio.columbia.edu.
 |
REFERENCES |
-
Berridge MJ
(1998)
Neuronal calcium signaling.
Neuron
21:13-26[Web of Science][Medline].
-
Borrell V,
Del Río JA,
Alcantara S,
Derer M,
Martinez A,
D'Arcangelo G,
Nakajima K,
Mikoshiba K,
Derer P,
Curran T,
Soriano E
(1999)
Reelin regulates the development and synaptogenesis of the layer-specific entorhino-hippocampal connections.
J Neurosci
19:1345-1358[Abstract/Free Full Text].
-
Cauller LJ,
Kulics AT
(1991)
The neural basis of the behaviourally relevant N1 component of the somatosensory-evoked potentials of S1 cortex of awake monkeys: evidence that backward cortical projection signals conscius touch sensation.
Exp Brain Res
84:607-619[Web of Science][Medline].
-
Caviness VSJ,
Sidman RL
(1973)
Time of origin of corresponding cell classes in the cerebral cortex of normal and mutant reeler mice: an autoradiographic analysis.
J Comp Neurol
148:141-151[Web of Science][Medline].
-
D'Arcangelo G,
Miao GG,
Chen S-C,
Soarse HD,
Morgan JI,
Curran T
(1995)
A protein related to extracellular matrix proteins deleted in the mouse mutant reeler.
Nature
374:719-723[Medline].
-
De Bergeyck V,
Nakajima K,
Lambert de Rouvroit C,
Naerhuyzen B,
Goffinet A,
Miyata T,
Ogawa M,
Mikoshiba K
(1997)
A truncated Reelin protein is produced but not secreted in the "Orleans" reeler mutation (Reln[rl-Orl]).
Brain Res Mol Brain Res
50:85-90[Medline].
-
Del Río JA,
Martinez A,
Fonseca M,
Auladell C,
Soriano E
(1995)
Glutamate-like immunoreactivity and fate of Cajal-Retzius cells in the murine cortex as identified with calretinin antibody.
Cereb Cortex
1:13-21.
-
Del Río JA,
Heimrich B,
Borrell V,
Förster E,
Drakew A,
Alcántara S,
Nakajima K,
Miyata T,
Ogawa M,
Mikoshiba K,
Derer P,
Frotscher M,
Soriano E
(1997)
A role for Cajal-Retzius cells and reelin in the development of hippocampal connections.
Nature
285:70-74.
-
Derer P,
Derer M
(1990)
Cajal-Retzius ontogenesis and death in mouse brain visualized with horseradish peroxidase and electron microscopy.
Neuroscience
36:839-856[Web of Science][Medline].
-
Douglas RJ,
Martin KAC
(1998)
Neocortex.
In: The synaptic organization of the brain (Shepherd GM,
ed), pp 459-511. Oxford: Oxford UP.
-
Gabbott PL,
Somogyi P
(1986)
Quantitative distribution of GABA-immunoreactive neurons in the visual cortex (area 17) of the cat.
Exp Brain Res
61:323-331[Web of Science][Medline].
-
Galuske RA,
Singer W
(1996)
The origin and topography of long-range intrinsic projections in cat visual cortex: a developmental study.
Cereb Cortex
6:417-430[Abstract/Free Full Text].
-
Herrmann K,
Antonini A,
Shatz CJ
(1994)
Ultrastructural evidence for synaptic interactions between thalamocortical axons and subplate neurons.
Eur J Neurosci
6:1729-1742[Web of Science][Medline].
-
Hestrin S,
Armstrong WE
(1996)
Morphology and physiology of cortical neurons in layer I.
J Neurosci
16:5290-5300[Abstract/Free Full Text].
-
Hirotsune S,
Takahara T,
Sasaki N,
Hirose K,
Yoshiki A,
Ohashi T,
Kusakabe M,
Murakami Y,
Muramatsu M,
Watanabe S,
Nakao K,
Katsuki M,
Hayashizaki Y
(1995)
The reeler gene encodes a protein with an EGF-like motif expressed by pioneer neurons.
Nat Genet
10:77-83[Web of Science][Medline].
-
Hopfield JJ
(1982)
Neural networks and physical systems with emergent collective computational abilities.
Proc Natl Acad Sci USA
79:2554-2558[Abstract/Free Full Text].
-
Huntley GW,
Jones EG
(1990)
Cajal-Retzius cells in developing monkey neocortex show immunoreactivity for calcium-binding proteins.
J Neurocytol
19:200-212[Web of Science][Medline].
-
Jacobs JM,
Meyer T
(1997)
Control of action potential-induced Ca2+ signaling in the soma of hippocampal neurons by Ca2+ release from intracellular stores.
J Neurosci
17:4129-4135[Abstract/Free Full Text].
-
Katz LC,
Shatz CJ
(1996)
Synaptic activity and the construction of cortical circuits.
Science
274:1133-1138[Abstract/Free Full Text].
-
Lohmann H,
Rorig B
(1994)
Long-range horizontal connections between supragranular pyramidal cells in the extrastriate visual cortex of the rat.
J Comp Neurol
344:543-558[Web of Science][Medline].
-
Marín-Padilla M
(1972)
Prenatal ontogenetic history of the principal neurons of the neocortex of the cat (Felix Domestica.): a Golgi study. II. Developmental differences and their significances.
Z Anat Entwicklungsgesch
136:125-142[Web of Science][Medline].
-
Marín-Padilla M
(1984)
Neurons of layer I. A developmental analysis.
In: Cerebral cortex, Vol I, Cellular components of the cerebral cortex (Peters A,
Jones EG,
eds), pp 1-30. New York: Plenum.
-
Marín-Padilla M,
Marín-Padilla TM
(1982)
Origin, prenatal development and structural organization of layer 1 of the human cerebral (motor) cortex. A golgi study.
Anat Embryol
164:161-206[Medline].
-
Meyer G,
Soria JM,
Martinez-Galan JR,
Martin-Clemente B,
Fairen A
(1998)
Different origins and developmental histories of transient neurons in the marginal zone of the fetal and neonatal rat cortex.
J Comp Neurol
10:493-518.
-
Molnar Z,
Adams R,
Goffinet AM,
Blakemore C
(1998)
The role of the first postmitotic cortical cells in the development of thalamocortical innervation in the reeler mouse.
J Neurosci
18:5746-5765[Abstract/Free Full Text].
-
O'Donovan MJ,
Ho S,
Sholomenko G,
Yee W
(1993)
Real-time imaging of neurons retrogradely and anterogradely labelled with calcium-sensitive dyes.
J Neurosci Methods
46:91-106[Web of Science][Medline].
-
Ogawa M,
Miyata T,
Nakajima K,
Yagyu K,
Seike M,
Ikenaka K,
Yamamoto H,
Mikoshiba K
(1995)
The reeler gene-associated antigen on Cajal-Retzius neurons is a crucial molecule for laminar organization of cortical neurons.
Neuron
14:899-912[Web of Science][Medline].
-
Parnavelas JG,
Edmunds S
(1983)
Further evidence that Retzius-Cajal cells transform to nonpyramidal neurons in the developing rat visual cortex.
J Neurocytol
12:863-871[Web of Science][Medline].
-
Rakic P
(1974)
Neurons in rhesus monkey visual cortex: systematic relation between time of origin and eventual disposition.
Science
183:425-427[Abstract/Free Full Text].
-
Ramón y Cajal S
(1904)
In: La textura del sistema nerviosa del hombre y los vertebrados. Madrid: Moya.
-
Reiter HO,
Waitzman DM,
Stryker MP
(1986)
Cortical activity blockade prevents ocular dominance plasticity in the kitten visual cortex.
Exp Brain Res
65:182-188[Web of Science][Medline].
-
Rockland KS,
Virga A
(1989)
Terminal arbors of individual "feedback" axons projecting from V2 to V1 in the macaque monkey: a study using immunocytochemistry of anterogradely transported Phaseolus vulgaris leucoagglutinin.
J Comp Neurol
285:54-72[Web of Science][Medline].
-
Schmidt KE,
Galuske RAW,
Singer W
(1999)
Matching the modules: cortical maps and long-range instrinsic connections in visual cortex during development.
J Neurobiol
41:10-17[Web of Science][Medline].
-
Schwartz T,
Rabinowitz D,
Unni VK,
Kumar VS,
Smetters DK,
Tsiola A,
Yuste R
(1998)
Networks of coactive neurons in developing layer 1.
Neuron
20:1271-1283.
-
Shatz CJ
(1990)
Impulse activity and the patterning of connections during CNS development.
Neuron
5:745-756[Web of Science][Medline].
-
Simmons PA,
Pearlman AL
(1982)
Retinotopic organization of the striate cortex (area 17) in the reeler mutant mouse.
Brain Res
256:124-126[Medline].
-
Simmons PA,
Pearlman AL
(1983)
Receptive-field properties of transcallosal visual cortical neurons in the normal and reeler mouse.
J Neurophysiol
50:838-848[Abstract/Free Full Text].
-
Simmons PA,
Lemmon V,
Pearlman AL
(1982)
Afferent and efferent connections of the striate and extrastriate visual cortex of the normal and reeler mouse.
J Comp Neurol
211:295-308[Web of Science][Medline].
-
Smetters DK,
Majewska A,
Yuste R
(1999)
Detecting action potentials in neuronal populations with calcium imaging.
Methods
18:215-221[Web of Science][Medline].
-
Soriano E,
Alvarado-Mallart RM,
Dumesnil N,
Del Río JA,
Sotelo C
(1997)
Cajal-Retzius cells regulate the radial glia phenotype in the adult and developing cerebellum and alter granule cell migration.
Neuron
18:563-577[Web of Science][Medline].
-
Takahara T,
Ohsumi T,
Kuromitsu J,
Shibata K,
Sasaki N,
Okazaki Y,
Shibata H,
Sato S,
Yoshiki A,
Kusakabe M,
Muramatsu M,
Ueki M,
Okuda K,
Hayashizaki Y
(1996)
Dysfunction of the Orleans reeler gene arising from exon skipping due to transposition of a full-length copy of an active L1 sequence into the skipped exon.
Hum Mol Genet
5:989-993[Abstract/Free Full Text].
-
Tsien RY
(1981)
A non-disruptive technique for loading calcium buffers and indicators into cells.
Nature
290:527-528[Medline].
-
Wong ROL,
Meister M,
Shatz CJ
(1993)
Transient period of correlated bursting activity during the development of the mammalian retina.
Neuron
11:923-938[Web of Science][Medline].
-
Yuste R
(1999)
Loading populations neurons in slices with AM calcium indicators.
In: Imaging neurons: a laboratory manual, Chap 34 (Yuste R,
Lanni F,
Konnerth A,
eds), pp 1-9. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
-
Yuste R,
Katz LC
(1991)
Control of postsynaptic Ca2+ influx in developing neocortex by excitatory and inhibitory neurotransmitters.
Neuron
6:333-344[Web of Science][Medline].
-
Zhou F-M,
Hablitz JJ
(1996)
Postnatal development of membrane properties of layer I neurons in rat neocortex.
J Neurosci
16:1131-1139[Abstract/Free Full Text].
Copyright © 1999 Society for Neuroscience 0270-6474/99/192410856-13$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
C. K. Pfeffer, V. Stein, D. J. Keating, H. Maier, I. Rinke, Y. Rudhard, M. Hentschke, G. M. Rune, T. J. Jentsch, and C. A. Hubner
NKCC1-Dependent GABAergic Excitation Drives Synaptic Network Maturation during Early Hippocampal Development
J. Neurosci.,
March 18, 2009;
29(11):
3419 - 3430.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Rheims, M. Minlebaev, A. Ivanov, A. Represa, R. Khazipov, G. L. Holmes, Y. Ben-Ari, and Y. Zilberter
Excitatory GABA in Rodent Developing Neocortex In Vitro
J Neurophysiol,
August 1, 2008;
100(2):
609 - 619.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Kirmse, A. Dvorzhak, R. Grantyn, and S. Kirischuk
Developmental Downregulation of Excitatory GABAergic Transmission in Neocortical Layer I via Presynaptic Adenosine A1 Receptors
Cereb Cortex,
February 1, 2008;
18(2):
424 - 432.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Kirmse, A. Dvorzhak, C. Henneberger, R. Grantyn, and S. Kirischuk
Cajal Retzius cells in the mouse neocortex receive two types of pre- and postsynaptically distinct GABAergic inputs
J. Physiol.,
December 15, 2007;
585(3):
881 - 895.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Heck, W. Kilb, P. Reiprich, H. Kubota, T. Furukawa, A. Fukuda, and H. J. Luhmann
GABA-A Receptors Regulate Neocortical Neuronal Migration In Vitro and In Vivo
Cereb Cortex,
January 1, 2007;
17(1):
138 - 148.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Kirmse and S. Kirischuk
Ambient GABA constrains the strength of GABAergic synapses at Cajal-Retzius cells in the developing visual cortex.
J. Neurosci.,
April 19, 2006;
26(16):
4216 - 4227.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Carmona, E. Pozas, A. Martinez, J. F. Espinosa-Parrilla, E. Soriano, and F. Aguado
Age-dependent Spontaneous Hyperexcitability and Impairment of GABAergic Function in the Hippocampus of Mice Lacking trkB
Cereb Cortex,
January 1, 2006;
16(1):
47 - 63.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. J. Moody and M. M. Bosma
Ion Channel Development, Spontaneous Activity, and Activity-Dependent Development in Nerve and Muscle Cells
Physiol Rev,
July 1, 2005;
85(3):
883 - 941.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Soda, R. Nakashima, D. Watanabe, K. Nakajima, I. Pastan, and S. Nakanishi
Segregation and Coactivation of Developing Neocortical Layer 1 Neurons
J. Neurosci.,
July 16, 2003;
23(15):
6272 - 6279.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Aguado, M. A. Carmona, E. Pozas, A. Aguilo, F. J. Martinez-Guijarro, S. Alcantara, V. Borrell, R. Yuste, C. F. Ibanez, and E. Soriano
BDNF regulates spontaneous correlated activity at early developmental stages by increasing synaptogenesis and expression of the K+/Cl- co-transporter KCC2
Development,
April 1, 2003;
130(7):
1267 - 1280.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Aguado, J. F. Espinosa-Parrilla, M. A. Carmona, and E. Soriano
Neuronal Activity Regulates Correlated Network Properties of Spontaneous Calcium Transients in Astrocytes In Situ
J. Neurosci.,
November 1, 2002;
22(21):
9430 - 9444.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Radnikow, D. Feldmeyer, and J. Lubke
Axonal Projection, Input and Output Synapses, and Synaptic Physiology of Cajal-Retzius Cells in the Developing Rat Neocortex
J. Neurosci.,
August 15, 2002;
22(16):
6908 - 6919.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Leinekugel, R. Khazipov, R. Cannon, H. Hirase, Y. Ben-Ari, and G. Buzsaki
Correlated Bursts of Activity in the Neonatal Hippocampus in Vivo
Science,
June 14, 2002;
296(5575):
2049 - 2052.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Chen, R. A. Bender, M. Frotscher, and T. Z. Baram
Novel and Transient Populations of Corticotropin-Releasing Hormone-Expressing Neurons in Developing Hippocampus Suggest Unique Functional Roles: A Quantitative Spatiotemporal Analysis
J. Neurosci.,
September 15, 2001;
21(18):
7171 - 7181.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. H. Eriksson, M. Thom, J. Heffernan, W. R. Lin, B. N. Harding, M. V. Squier, and S. M. Sisodiya
Persistent reelin-expressing Cajal-Retzius cells in polymicrogyria
Brain,
July 1, 2001;
124(7):
1350 - 1361.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Barallobre, J. Del Rio, S Alcantara, V Borrell, F Aguado, M Ruiz, M. Carmona, M Martin, M Fabre, R Yuste, et al.
Aberrant development of hippocampal circuits and altered neural activity in netrin 1-deficient mice
Development,
January 11, 2000;
127(22):
4797 - 4810.
[Abstract]
[PDF]
|
 |
|
|

|