 |
Previous Article | Next Article 
The Journal of Neuroscience, February 1, 1999, 19(3):900-905
Ca2+-Induced Deprotonation of Peptide Hormones Inside
Secretory Vesicles in Preparation for Release
Weiping
Han,
Danqing
Li,
Amy K.
Stout,
Koichi
Takimoto, and
Edwin S.
Levitan
Department of Pharmacology, University of Pittsburgh, Pittsburgh,
Pennsylvania 15261
 |
ABSTRACT |
The acidic environment inside secretory vesicles ensures that
neuropeptides and peptide hormones are packaged in a concentrated condensed form. Although this is optimal for storage, decondensation limits release. Thus, it would be advantageous to alter the physical state of peptides in preparation for exocytosis. Here, we report that
depolarization of the plasma membrane rapidly increases enhanced green
fluorescent protein (EGFP)-tagged hormone fluorescence inside secretory
vesicles. This effect requires Ca2+ influx and
persists when exocytosis is inhibited by
N-ethylmaleimide. Peptide deprotonation appears
to produce this response, because it is not seen when the vesicle pH
gradient is collapsed or when a pH-insensitive GFP variant is used.
These data demonstrate that Ca2+ evokes
alkalinization of the inside of secretory vesicles before exocytosis.
Thus, Ca2+ influx into the cytoplasm alters the
physical state of intravesicular contents in preparation for release.
Key words:
GFP; peptide hormone; exocytosis; alkalinization; secretory vesicle; Ca2+
 |
INTRODUCTION |
Neurons and endocrine cells store
peptides in aggregate or even crystalline forms inside secretory
vesicles (Palade, 1975 ; Arrandale and Dannies, 1994 ). Peptide
condensation is promoted by the acidic environment inside secretory
vesicles. For example, chromogranin A (CgA) and chromogranin B (CgB),
two of the major proteins inside secretory vesicles, aggregate because
of pH- and Ca2+-dependent conformational changes
(Yoo and Lewis, 1996 ). Similar conditions, an acidic pH environment and
millimolar concentrations of Ca2+, are required to
obtain optimal aggregation of the peptide hormone atrial natriuretic
factor (ANF) (Canaff et al., 1996 ). Under these same conditions,
granule content proteins from pituitary and chromaffin cells
spontaneously aggregate (Colomer et al., 1996 ). Moreover, insulin is
believed to exist as an insoluble Zn2+-bound hexamer
inside acidic secretory vesicles of cells, and release is promoted
by alkalinization (see below) (Aspinwall et al., 1997 ). Thus, under
normal resting conditions, a low intravesicular pH is important in
maintaining peptides in an aggregate or solid state.
Although such a physical state inside secretory vesicles is
advantageous for packaging and storage, it may hinder peptides from
readily escaping the vesicles during exocytosis. For highly condensed
hormones to be released, it is apparent that they must decondense and
dissolve. For neurotransmitters, solubilization has been proposed to
occur after vesicle fusion with the plasma membrane as a consequence of
exposure to extracellular medium (for review, see Rahamimoff and
Fernandez, 1997 ). In contrast, studies in peptidergic systems have
revealed that drug-induced alkalinization of secretory vesicles
promotes peptide solubilization before exocytosis. For example, vesicle
matrix proteins (including CgA and CgB) bind to the vesicle membrane at
resting intravesicular pH but become freed from vesicle membrane when
intravesicular pH was raised toward physiological pH (Yoo, 1993 ). More
recently, amperometric detection of insulin secretion showed that
chemically alkalinizing vesicles speeds the kinetics of individual
quantal responses and induces the appearance of amperometric "feet"
(Aspinwall et al., 1997 ). This latter effect is usually interpreted as
flux through the fusion pore (for review, see Artalejo et al., 1998 ). These results suggest that a physiological alkalinization of secretory vesicles before exocytosis could promote peptide decondensation and
thus alter the kinetics of peptidergic neurotransmission.
To date, it has not been possible to monitor whether such an
alkalinization occurs specifically in peptidergic secretory vesicles in
live cells. However, the fluorescence from green fluorescent protein
(GFP)-tagged peptides inside secretory vesicles can be assayed in live
neuroendocrine cells (Burke et al., 1997 ; Lang et al., 1997 ). For
example, we have engineered a cDNA construct using a human
codon-optimized enhanced GFP variant (EGFP) and rat proANF. The
expressed fusion protein is localized to secretory vesicles and
undergoes regulated release after expression in nerve growth factor
(NGF)-treated rat PC12 pheochromocytoma cells (Burke et al., 1997 ).
Here, we use this live cell system to demonstrate that
Ca2+ influx into the cytoplasm rapidly alkalinizes
the contents of peptidergic secretory vesicles. This finding suggests
for the first time that the physical state of neuropeptides is changed in preparation for release.
 |
MATERIALS AND METHODS |
Plasmids, cell culture, and transfection. The
proANF-Sapphire construct was made by subcloning the
AgeI-NotI fragment of the PCR product of
pGFPsph-b[R] (Packard Instrument Company, Meriden, CT) into the
corresponding site of proANF-EGFP construct (Burke et al., 1997 ). The
following primers were used to introduce the AgeI and
NotI sites: TCCACCGGTCGCCACCATGGTGAGCAAG on the
5' side and CGGGCGGCCGCCCCGACTCTAGTCGA on the 3' side. PC12
cells were maintained in DMEM supplemented with 10% fetal
bovine serum (FBS) at 37°C in a 5% CO2 incubator.
Cells were transfected 1 d after plating on poly-lysine-coated
coverslips with the above vectors using Tfx-50 (Promega, Madison, WI)
in serum-free DMEM. Two hours later, the medium was replaced with 10%
FBS-supplemented DMEM plus NGF (2.5 S NGF, 50 ng/ml; Life Technologies,
Gaithersburg, MD). All experiments were performed 2-5 d after transfection.
When inhibition of exocytosis was required, cells were pretreated with
0.2 mM N-ethylmaleimide (NEM) on ice for 15 min,
rinsed, and then incubated with 1 mM dithiothreitol (DTT)
on ice for 15 min to quench residual NEM (Chavez et al., 1996 ). For
altering the pH inside vesicles, cells were fixed and permeabilized
with PBS containing 4% paraformaldehyde and 0.1% Triton X-100
for 15 min at 4°C. The above solution was then removed and replaced
with buffered solutions.
Microfluorimetry and electrophysiological recording.
Microfluorimetry was performed on an Olympus Opticals (Tokyo,
Japan) inverted microscope using either a 40× (NA 1.3) or 100×
(NA 1.3) oil immersion objective. Cells were bathed in normal saline
[containing (in mM): 140 NaCl, 5.4 KCl, 0.8 MgCl2, 5 CaCl2, 10 Na-HEPES, and 10 glucose, pH 7.4] and illuminated with light from an attenuated mercury arc lamp passing through a standard wide band FITC optic cube.
Emitted light was collected by a photomultiplier tube powered by a dual
channel ratio fluorimeter (Biomedical Instrumentation Group, University
of Pennsylvania, Philadelphia, PA). The signal was then displayed and
stored using the X-chart module of the PULSE program (HEKA Electronik,
Lambrecht/Pfalz, Germany) on a Power Macintosh computer. Standard
whole-cell voltage-clamp recording (Hamill et al., 1981 ) was performed
with an EPC-9 patch-clamp amplifier (HEKA Electronik) using the
PULSE program (HEKA Electronik) on the same computer. Patch pipettes
were filled with a solution containing (in mM): 140 KCl, 1 MgCl2, 10 Na-HEPES, 10 EGTA, and 3 MgATP, pH 7.4. Normal saline was used as bath solution. For K+-induced depolarization, 100 mM NaCl
in the normal saline was substituted with 100 mM KCl. For
Ba2+ experiments, Ba2+ was used
as a substitute for Ca2+ in 100 mM
K+ saline.
Spectral measurements. Coverslips with the fixed and
permeabilized cells were illuminated with a 75 W xenon bulb-based
monochromator (Applied Scientific Instrumentation, Eugene, OR) at
300-512 nm by 2 nm increments was passed through a quartz light guide
and neutral density filters, which attenuated the light by >99%. A 515 nm dichroic mirror reflected light onto the cells through a 40×
(NA 1.3) oil immersion objective. Emitted light was passed through a
bandpass filter (535 ± 12.5 nm) and projected onto an intensified
CCD camera (CCD 72 STX camera fitted with a Gen II Sys image
intensifier; Dage-MTI, Michigan City, IN). Mean intensity levels of
regions of interest were obtained on-line using SIMCA software (Compix
Inc., Cranberry, PA). Cells were initially bathed in normal saline at
pH 7.4 and subsequently switched to normal saline at various pH levels.
Data analysis. Data are presented as mean ± SEM. Only one cell or neurite was assayed per coverslip.
n refers to number of cells or neurite endings measured.
Statistical comparison was done first with ANOVA, followed by
the F test. In cases with only two conditions, the
Student's t test was used.
 |
RESULTS |
It has been shown previously that EGFP-tagged proANF is targeted
to large secretory vesicles and undergoes regulated release (Burke et
al., 1997 ). Furthermore, the release of the fusion protein can be
monitored in real time by measuring peptide fluorescence. It was
expected that fluorescence would begin to decrease immediately after
membrane depolarization (Huang et al., 1995 ). However, the apparent
onset of fluorescent secretory responses by growth cones when cells
were depolarized with high K+ saline appeared to be
preceded by a delay or sometimes by a fluorescence increase (Fig.
1A,B).
This increase occurred within seconds when cells were directly
depolarized via a patch-clamp electrode (Fig. 1C). Because
more labeled peptides could not have been synthesized and packaged into
secretory vesicles on this time scale, an increase in the intrinsic
fluorescence of the fusion protein must have occurred before
release.

View larger version (23K):
[in this window]
[in a new window]
|
Figure 1.
Depolarization-induced proANF-EGFP fusion protein
release is accompanied by an increase in fluorescence. In
A and B, cells were superfused first in
normal saline and then switched to 100 mM
K+ saline (arrows). The fluorescence
decrease, indicative of peptide release, was preceded by either a delay
(A) or an increase (B) in
fluorescence. C, A double-pulse depolarization stimulus
(S, arrow), from a holding potential of
80 to 10 mV for 500 msec with a 5 sec interpulse, was delivered to
the cell via a patch pipette in whole-cell configuration. Note the the
increase in fluorescence was evident immediately after the double
pulse. D, A similar fluorescence increase was observed
in response to the double-pulse stimulus (S,
arrow), without a net fluorescence decrease.
|
|
The rapid increase of peptide fluorescence could be caused by its
exposure to extracellular medium at a postfusion stage (i.e., after
formation of the fusion pore). However, the size of the increase was
not proportional to the size of the secretory response. We even
observed an increase in peptide fluorescence that was not followed by a
net decrease in fluorescence (Fig. 1D). Furthermore, if the fluorescence increase occurred at a postfusion stage, then blocking exocytosis should abolish the response. NEM has been shown to
inhibit secretion in Chinese hamster ovary and AtT20 cells
(Chavez et al., 1996 ). To verify that NEM pretreatment produces a
similar effect in PC12 cells, ANF release from PC12 cells was measured
by radioimmunoassay (Burke et al., 1997 ). NEM was found to reduce
K+-induced peptide release by sixfold (data not
shown). Thus, NEM allowed us to test whether the increase in peptide
fluorescence would be attenuated by inhibiting exocytosis. Contrary to
the postfusion model, optical measurements after exposure to NEM
revealed an uncontaminated increase in fluorescence (Fig.
2A). Thus, the increase
in the peptide signal occurs independently of fusion. Furthermore, as
expected from the data in Figure 1, this effect was much faster
(t1/2 = 38 ± 5 sec;
n = 5) than typical release responses (Burke et al.,
1997 ) (Fig. 1; see also Fig. 6). These kinetics, coupled with the lack
of involvement of exocytosis, imply that the physical state of peptides
inside secretory vesicles changes before fusion.

View larger version (33K):
[in this window]
[in a new window]
|
Figure 2.
The depolarization-induced fluorescence change
does not depend on exocytosis but requires extracellular
Ca2+. Cells were pretreated with 0.2 mM
NEM to block peptide release. A, Cells were superfused
with normal saline and then with 100 mM
K+ saline (bar). Note the apparent
and uncontaminated increase in fluorescence. B, Cells
were superfused with Ca2+-free normal saline, then
with Ca2+-free 100 mM
K+ saline, and finally with 100 mM
K+ saline containing 5 mM
Ca2+. The fluorescence increase induced by 100 mM K+ saline occurred only when
Ca2+ was present. C,
Cd2+ prevented fluorescence increase caused by
Ca2+. Cells were superfused with normal saline
containing 0.2 mM Cd2+ and then with 100 mM K+ saline containing 0.2 mM Cd2+. D,
Ba2+ mimicked Ca2+ in causing the
fluorescence increase. Cells were initially superfused with normal
saline and then with Ca2+-free
Ba2+ containing 100 mM
K+ saline. E, Quantification of
divalent dependence of the effect of depolarization after NEM
treatment. n = 4, 4, 6, and 4 for 0 Ca2+, 5 mM Ca2+, 5 mM Ca2+ plus 0.2 mM
Cd2+, and 5 mM Ba2+,
respectively.
|
|
This finding suggests that a specific signal regulates the environment
inside secretory vesicles. A potential candidate for a mediator of the
effect of depolarization is the rise in cytoplasmic [Ca2+] that occurs after activation of
voltage-gated Ca2+ channels. Consistent with this
hypothesis, depolarization failed to alter peptide fluorescence in the
absence of extracellular Ca2+. Rather, addition of
bath Ca2+ to predepolarized cells produced the
effect (Fig. 2B). Furthermore, blocking
Ca2+ channels with 0.2 mM
Cd2+ prevented depolarization from causing the
fluorescence brightening response (Fig. 2C,E).
Ba2+, which is permeable through membrane
Ca2+ channels, mimicked the effect of
Ca2+ in causing the fluorescence increase (Fig.
2D,E). Therefore, it is likely that
Ca2+ enters the cytoplasm via voltage-gated channels
and acts on secretory vesicles to alter peptide fluorescence.
How could cytoplasmic Ca2+ change the fluorescence
of peptides inside secretory vesicles? It is known that the lumen of
secretory vesicles is acidic, with a pH of ~5.5. Furthermore, the
fluorescence of wild-type GFP and EGFP has been shown to be sensitive
to pH (Terry et al., 1995 ; Patterson et al., 1997 ). We found that the fluorescence of the fusion protein also varies with pH. Figure 3A shows the excitation
spectra of proANF-EGFP at two different pH values. An increase in
fluorescence without any spectral shift was observed when the pH was
increased from 5.5 to 7.4. The pH response was rapid and reversible
(Fig. 3B), with an apparent pK of ~5.7 (Fig.
3C). This is similar to the value obtained with pure EGFP
protein in solution (Patterson et al., 1997 ). Therefore, it seemed
possible that the fluorescence increase was caused by Ca2+-induced alkalinization of secretory vesicles in
stimulated cells.

View larger version (16K):
[in this window]
[in a new window]
|
Figure 3.
Fluorescence of EGFP-tagged peptide hormone is
sensitive to pH. A, Fluorescence excitation spectra of
proANF-EGFP fusion protein at two different pH values.
B, Microfluorimetric recordings of the responses of
proANF-EGFP fusion protein expressed in cells to solutions at various
pH levels. The response of the fluorescence of proANF-EGFP to changing
pH was quick and reversible. C, Titration curve for the
relative fluorescence of proANF-EGFP.
|
|
If alkalinization of secretory vesicles is responsible for the
fluorescence increase, collapsing the pH gradient across the vesicle
membrane should first increase peptide fluorescence and then prevent
any further fluorescence increase by depolarization. Three
membrane-permeant pH-collapsing agents, monensin (1 µM), nigericin (1 µM), and carbonyl cyanide
p-(tri-fluoromethoxy) phenylhydrazone (FCCP) (1 µM), each increased vesicle fluorescence. Furthermore, after treatment with any of these agents, 100 mM
K+ saline-induced depolarization failed to cause a
further brightening of peptide fluorescence (Fig.
4A-C). Moreover, these
agents eliminated the apparent delay in secretory responses (Fig.
4D). Thus, these pH-collapsing agents mimic and
occlude the brightening effect of depolarization-induced
Ca2+ influx.

View larger version (24K):
[in this window]
[in a new window]
|
Figure 4.
The depolarization-induced increase in
intravesicular fluorescence requires a pH gradient. Cells were
initially superfused with normal saline containing a pH-collapsing
agent [1 µm monensin (A), 1 µm nigericin
(B), or 1 µm FCCP (C)]
and then with 100 mM K+ saline
containing the same pH-collapsing agent. Note that fluorescence
decrease occurred almost immediately after 100 mM
K+ application. D, Comparison of
delay from the application of 100 mM K+
to the onset of fluorescence decrease in cells without pretreatment
(C) and those pretreated with monensin
(M), nigericin (N),
or FCCP (F). n = 11, 8, 5, and 5 for control, monensin, nigericin, and FCCP, respectively.
*p < 0.01 versus control.
|
|
The hypothesis that the Ca2+-dependent fluorescence
increase is caused by intravesicular alkalinization would also predict
that the apparent delay or the fluorescence increase should no longer be observed if a pH-insensitive GFP variant is used in place of EGFP.
The proANF-Sapphire fusion protein has a similar spectrum with Sapphire
GFP (data not shown). However, in contrast to proANF-EGFP, proANF-Sapphire fluorescence is not sensitive to pH changes (Figs. 5A-C).
In live cells, proANF-Sapphire fluorescence did not increase when
NEM-pretreated cells were subjected to monensin (see
below) or 100 mM K+
saline (percent of change after 100 mM
K+, 0.001 ± 0.004; n = 7).
Furthermore, the apparent delay after high K+
application was no longer evident when proANF-Sapphire was used in
place of proANF-EGFP (Fig. 6). These results indicate that the
fluorescence increase of proANF-EGFP was reporting a
Ca2+-induced alkalinization of the inside of
secretory vesicles.

View larger version (18K):
[in this window]
[in a new window]
|
Figure 5.
Fluorescence of proANF-Sapphire fusion protein is
insensitive to pH. A, Fluorescence excitation spectra of
proANF-Sapphire GFP fusion protein at two different pH values.
B, Microfluorimetric recordings of the responses of
proANF-Sapphire fusion protein to bath superfusion of normal saline at
various pH levels. C, Titration curve for the relative
fluorescence of Sapphire-tagged proANF.
|
|

View larger version (11K):
[in this window]
[in a new window]
|
Figure 6.
The apparent delay after application of 100 mM K+ saline is no longer observed when
using proANF-Sapphire. A, A cell was initially
superfused with normal saline and then with 100 mM
K+ saline. Note that fluorescence decrease occurred
almost immediately after 100 mM K+
application. Also, no increase in fluorescence was observed with
proANF-Sapphire. B, Comparison of delay from the
application of 100 mM K+ saline to the
onset of fluorescence decrease in cells transfected with proANF-EGFP
(EGFP) and those transfected with proANF-Sapphire
(Sph). n = 11 and 12 for proANF-EGFP
and proANF-Sapphire, respectively. *p < 0.01 versus EGFP.
|
|

View larger version (20K):
[in this window]
[in a new window]
|
Figure 7.
NEM increases fluorescence in cells that are
transfected with proANF-EGFP but not those with proANF-Sapphire.
A, A cell expressing proANF-EGFP was initially
superfused with normal saline, then with normal saline containing 0.2 mM NEM, and finally with normal saline containing 1 µM monensin. Note that fluorescence increased gradually
after the start of NEM superfusion and that fluorescence increased very
quickly when superfusion was switched to monensin
(M). B, A cell expressing
proANF-Sapphire was initially superfused with normal saline and then
with normal saline containing 0.2 mM NEM. NEM did not have
any effect on fluorescence of proANF-Sapphire. C, A
proANF-Sapphire-expressing cell was pretreated with NEM and DTT. After
initial superfusion with normal saline, the solution was switched to
normal saline containing 1 µM monensin.
|
|
NEM is known to block vesicular proton pumps and thus is expected to
raise intravesicular pH (Flatmark et al., 1982 ). A rise of
intravesicular pH should then cause a brightening of proANF-EGFP. Consistent with this prediction, NEM caused a gradual increase in
proANF-EGFP fluorescence (Fig. 7A). However, NEM did not
appear to neutralize intravesicular pH after 15 min of treatment (i.e., the same amount of time used in exocytosis inhibition procedures), because addition of monensin caused a much quicker and stronger increase in proANF-EGFP fluorescence (Fig. 7A). When similar
treatments were used on cells that were transfected with pH-insensitive
proANF-Sapphire, no increase in fluorescence was observed (Fig.
7B,C). Therefore, a brief treatment
with NEM causes only limited intravesicular alkalinization. This
suggests that secretory vesicle pH is highly buffered and/or that
resting H+-flux is low in the absence of elevated
cytoplasmic Ca2+ levels.
 |
DISCUSSION |
In the present report, we describe for the first time a
depolarization-induced physical change of peptides inside
secretory vesicles. It was found that intravesicular peptides are
deprotonated before exocytosis after depolarization-induced
Ca2+-influx. Ca2+-induced
deprotonation caused by a rise in the pH inside vesicles may
facilitate solubilization of peptides and perhaps their release, as
well. Therefore, these changes may represent a novel role of Ca2+ in regulating exocytosis.
Possible mechanisms for Ca2+-dependent
vesicular alkalinization
Our findings indicate that there must be a mechanism by which
cytoplasmic Ca2+ induces secretory vesicle
alkalinization. Because patch-clamp experiments revealed that this
effect is very rapid and because secretory vesicle pH is thought to be
highly buffered by ATP, slow proton transport mechanisms are not likely
to be involved. Therefore, it is unlikely that cytoplasmic
Ca2+ acted on synporters or antiporters. An action
on the proton pump is also excluded by the persistence of the effect
after treatment with NEM, a known inhibitor of the vesicular proton
pump (Flatmark et al., 1982 ). Rather, it is more likely that a channel
was activated that either changed vesicle membrane potential to
indirectly promote proton flux or directly supported proton movement.
In fact, secretory vesicles contain a variety of ion channels
(Woodbury, 1995 ). Perhaps the most relevant of these to this study is a
130 pS channel that is present in peptidergic neurohypophysial granules
(Lee et al., 1992 ). Interestingly, this channel is regulated by
Ca2+ and is permeable to both divalent and
monovalent cations. Therefore, it is possible that
Ca2+ influx through plasma membrane channels opens
these cation channels in the vesicles and causes a quick
H+ loss from the vesicles that produces the increase
of intravesicular pH.
Intravesicular alkalinization and peptide solubilization
As described in the introductory remarks, vesicle alkalinization
promotes peptide decondensation and release. Such an effect could
significantly affect the kinetics of peptidergic neurotransmission and
release with "kiss and run" events (Artalejo et al., 1998 ). Our
results show for the first time that vesicle alkalinization occurs as
part of the normal response to cytoplasmic Ca2+
influx. One potential concern is that the observed fluorescence change
in this study is small, representing ~0.2 U of pH change based on the
proANF-EGFP titration curve of pH of ~5.5. It should be noted
that secretory peptide aggregation steeply changes between pH 5 and 6 (Colomer et al., 1996 ). Therefore, this effect could be significant.
Furthermore, several lines of evidence suggest that our measurements
could underestimate individual vesicle pH changes. First, in live
cells, the fluorescence increase caused by intravesicular
alkalinization is opposed by a fluorescence decrease caused by peptide
release. Thus, release may have minimized the apparent change. Second,
NEM raises intravesicular pH somewhat by inhibiting v-type ATPase in
the vesicles. Finally, the fluorescence change measured in whole growth
cones is an average from all of the secretory vesicles. However,
because this response is dependent on Ca2+, vesicles
near the membrane in which [Ca2+]i is
high may have a bigger increase of pH. This would be optimal, because
peptides would become decondensed only in vesicles that are likely to
undergo exocytosis. Therefore, certain individual vesicles may have a
pH increase great enough to initiate decondensation or dissolution of
intravesicular contents.
Finally, it should be kept in mind that pH refers to proton
concentration in bulk aqueous solutions. However, packaged peptides are
normally in a solid or precipitated state that is only indirectly exposed to the bulk solution. Furthermore, it is possible that the pH
requirements for peptide solubilization in real vesicles that contain a
"smart gel" matrix (Rahamimoff and Fernandez, 1997 ) is quite
different from that found in laboratory test tubes. Thus, even the low
degree of peptide deprotonation detected on average may still have a
significant influence in the unusual environment inside secretory
vesicles. It is also interesting to note that a sustained
alkalinization of the vesicle will promote loss of catecholamines that
are packaged with peptides in large dense core vesicles in PC12 and
some other cells (Sulzer and Rayport, 1990 ). Therefore, a rapid and
moderate alkalinization may be optimal for initiating peptide
decondensation, without major loss of catecholamines.
 |
FOOTNOTES |
Received Oct. 8, 1998; revised Nov. 10, 1998; accepted Nov. 16, 1998.
This study was supported by National Institutes of Health Grant NS32385
and an Established Investigator Award from the American Heart
Association to E.S.L. We thank Dr. Nancy A. Burke for her help with
radioimmunoassay experiments.
Correspondence should be addressed to Dr. Edwin S. Levitan, Department
of Pharmacology, E1351 Biomedical Science Tower, University of
Pittsburgh, Pittsburgh, PA 15261.
 |
REFERENCES |
-
Arrandale JM,
Dannies PS
(1994)
Inhibition of rat prolactin (PRL) storage by coexpression of human PRL.
Mol Endocrinol
8:1083-1089[Abstract/Free Full Text].
-
Artalejo CR,
Elhamdani A,
Palfrey HC
(1998)
Secretion: dense-core granules can kiss-and-run too.
Curr Biol
8:R62-R65[Web of Science][Medline].
-
Aspinwall CA,
Brooks SA,
Kennedy RT,
Lakey JRT
(1997)
Effects of intravesicular H+ and extracellular H+ and Zn2+ on insulin secretion in pancreatic beta cells.
J Biol Chem
272:31308-31314[Abstract/Free Full Text].
-
Burke NV,
Han W,
Li D,
Takimoto K,
Watkins SC,
Levitan ES
(1997)
Neuronal peptide release is limited by secretory granule mobility.
Neuron
19:1095-1102[Web of Science][Medline].
-
Canaff L,
Brechler V,
Reudelhuber TL,
Thibault G
(1996)
Secretory vesicle targeting of atrial natriuretic peptide correlates with its calcium-mediated aggregation.
Proc Natl Acad Sci USA
93:9483-9487[Abstract/Free Full Text].
-
Chavez RA,
Miller SG,
Moore H-P H
(1996)
A biosynthetic regulated secretory pathway in constitutive secretory cells.
J Cell Biol
133:1177-1191[Abstract/Free Full Text].
-
Colomer V,
Kicska GA,
Rindler MJ
(1996)
Secretory granule content proteins and the luminal domains of granule membrane proteins aggregate in vitro at mildly acidic pH.
J Biol Chem
271:48-55[Abstract/Free Full Text].
-
Flatmark T,
Gronberg M,
Husebye Jr E,
Berge SV
(1982)
Inhibition of N-ethylmaleimide of the MgATP-driven proton pump of the chromaffin granules.
FEBS Lett
149:71-74[Web of Science][Medline].
-
Hamill OP,
Marty A,
Neher E,
Sakmann B,
Sigworth F
(1981)
Improved patch-clamp techniques for high resolution current recordings from cells and cell free membrane patches.
Pflügers Arch
391:85-100[Web of Science][Medline].
-
Huang L,
Shen H,
Atkinson MA,
Kennedy RT
(1995)
Detection of exocytosis at individual pancreatic
cells by amperometry at a chemically modified microelectrode.
Proc Natl Acad Sci USA
92:9608-9612[Abstract/Free Full Text]. -
Lang T,
Wacker I,
Steyer J,
Kaether C,
Wunderlich I,
Soldati T,
Gerdes HH,
Almers W
(1997)
Ca2+-triggered peptide secretion in single cells imaged with green fluorescent protein and evanescent-wave microscopy.
Neuron
18:857-863[Web of Science][Medline].
-
Lee CJ,
Dayanithi G,
Nordmann JJ,
Lemos JR
(1992)
Possible role during exocytosis of a Ca2+-activated channel in neurohypophysial granules.
Neuron
8:335-342[Web of Science][Medline].
-
Palade G
(1975)
Intracellular aspects of the process of protein synthesis.
Science
189:347-358[Free Full Text].
-
Patterson GH,
Knobel SM,
Sharif WD,
Kain SR,
Piston DW
(1997)
Use of the green fluorescent protein and its mutants in quantitative fluorescence microscopy.
Biophys J
73:2782-2790[Web of Science][Medline].
-
Rahamimoff R,
Fernandez JM
(1997)
Pre- and postfusion regulation of transmitter release.
Neuron
18:17-27[Web of Science][Medline].
-
Sulzer D,
Rayport S
(1990)
Amphetamine and other psychostimulants reduce pH gradients in midbrain dopaminergic neurons and chromaffin granules: a mechanism of action.
Neuron
5:797-808[Web of Science][Medline].
-
Terry BR,
Matthews EK,
Haseloff J
(1995)
Molecular characterization of recombinant green fluorescent protein by fluorescence correlation microscopy.
Biochem Biophys Res Commun
217:21-27[Web of Science][Medline].
-
Woodbury DJ
(1995)
Evaluation of the evidence for ion channels in synaptic vesicles.
Mol Membr Biol
12:165-171[Web of Science][Medline].
-
Yoo SH
(1993)
pH-dependent binding of chromogranin B and secretory vesicle matrix proteins to the vesicle membrane.
Biochim Biophys Acta
1179:239-246[Medline].
-
Yoo SH,
Lewis MS
(1996)
Effects of pH and Ca2+ on heterodimer and heterotetramer formation by chromogranin A and chromogranin B.
J Biol Chem
271:17041-17046[Abstract/Free Full Text].
Copyright © 1999 Society for Neuroscience 0270-6474/99/193900-06$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
J. de Wit, R. F. Toonen, and M. Verhage
Matrix-Dependent Local Retention of Secretory Vesicle Cargo in Cortical Neurons
J. Neurosci.,
January 7, 2009;
29(1):
23 - 37.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Perez-Vilar, R. Mabolo, C. T. McVaugh, C. R. Bertozzi, and R. C. Boucher
Mucin Granule Intraluminal Organization in Living Mucous/Goblet Cells: ROLES OF PROTEIN POST-TRANSLATIONAL MODIFICATIONS AND SECRETION
J. Biol. Chem.,
February 24, 2006;
281(8):
4844 - 4855.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Sanchez-Armass, S. R. Sennoune, D. Maiti, F. Ortega, and R. Martinez-Zaguilan
Spectral imaging microscopy demonstrates cytoplasmic pH oscillations in glial cells
Am J Physiol Cell Physiol,
February 1, 2006;
290(2):
C524 - C538.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Brigadski, M. Hartmann, and V. Lessmann
Differential Vesicular Targeting and Time Course of Synaptic Secretion of the Mammalian Neurotrophins
J. Neurosci.,
August 17, 2005;
25(33):
7601 - 7614.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Silverman, S. Johnson, D. Gurkins, M. Farmer, J. E. Lochner, P. Rosa, and B. A. Scalettar
Mechanisms of Transport and Exocytosis of Dense-Core Granules Containing Tissue Plasminogen Activator in Developing Hippocampal Neurons
J. Neurosci.,
March 23, 2005;
25(12):
3095 - 3106.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Taupenot, K. L. Harper, and D. T. O'Connor
Role of H+-ATPase-mediated Acidification in Sorting and Release of the Regulated Secretory Protein Chromogranin A: EVIDENCE FOR A VESICULOGENIC FUNCTION
J. Biol. Chem.,
February 4, 2005;
280(5):
3885 - 3897.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Taupenot, K. L. Harper, N. R. Mahapatra, R. J. Parmer, S. K. Mahata, and D. T. O'Connor
Identification of a novel sorting determinant for the regulated pathway in the secretory protein chromogranin A
J. Cell Sci.,
March 14, 2003;
115(24):
4827 - 4841.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. W. Taraska, D. Perrais, M. Ohara-Imaizumi, S. Nagamatsu, and W. Almers
Secretory granules are recaptured largely intact after stimulated exocytosis in cultured endocrine cells
PNAS,
February 18, 2003;
100(4):
2070 - 2075.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-K. Ng, X. Lu, and E. S Levitan
Physical mobilization of secretory vesicles facilitates neuropeptide release by nerve growth factor-differentiated PC12 Cells
J. Physiol.,
July 15, 2002;
542(2):
395 - 402.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. N Pothos, E. Mosharov, K.-P. Liu, W. Setlik, M. Haburcak, G. Baldini, M. D Gershon, H. Tamir, and D. Sulzer
Stimulation-dependent regulation of the pH, volume and quantal size of bovine and rodent secretory vesicles
J. Physiol.,
July 15, 2002;
542(2):
453 - 476.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-K. Ng, X. Lu, S. C. Watkins, G. C. R. Ellis-Davies, and E. S. Levitan
Nerve Growth Factor-Induced Differentiation Changes the Cellular Organization of Regulated Peptide Release by PC12 Cells
J. Neurosci.,
May 15, 2002;
22(10):
3890 - 3897.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. G Blackmore, A. Varro, R. Dimaline, L. Bishop, D. V Gallacher, and G. J Dockray
Measurement of secretory vesicle pH reveals intravesicular alkalinization by vesicular monoamine transporter type 2 resulting in inhibition of prohormone cleavage
J. Physiol.,
March 15, 2001;
531(3):
605 - 617.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. El Meskini, L. Jin, R. Marx, A. Bruzzaniti, J. Lee, R. B. Emeson, and R. E. Mains
A Signal Sequence Is Sufficient for Green Fluorescent Protein to Be Routed to Regulated Secretory Granules
Endocrinology,
February 1, 2001;
142(2):
864 - 873.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. L. Mundorf, K. P. Troyer, S. E. Hochstetler, J. A. Near, and R. M. Wightman
Vesicular Ca2+ Participates in the Catalysis of Exocytosis
J. Biol. Chem.,
March 24, 2000;
275(13):
9136 - 9142.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Williams and W. Webb
Single granule pH cycling in antigen-induced mast cell secretion
J. Cell Sci.,
January 11, 2000;
113(21):
3839 - 3850.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Han, Y.-K. Ng, D. Axelrod, and E. S. Levitan
Neuropeptide release by efficient recruitment of diffusing cytoplasmic secretory vesicles
PNAS,
December 7, 1999;
96(25):
14577 - 14582.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. D. Johnson, C. Klausen, H. R. Habibi, and J. P. Chang
Function-specific calcium stores selectively regulate growth hormone secretion, storage, and mRNA level
Am J Physiol Endocrinol Metab,
April 1, 2002;
282(4):
E810 - E819.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|