 |
Previous Article | Next Article 
The Journal of Neuroscience, March 1, 1999, 19(5):1844-1854
Differential Expression of the mRNA for the Vanilloid Receptor
Subtype 1 in Cells of the Adult Rat Dorsal Root and Nodose Ganglia and
Its Downregulation by Axotomy
Gregory J.
Michael and
John V.
Priestley
Neuroscience Section, Division of Biomedical Sciences, Queen Mary
and Westfield College, London E1 4NS, United Kingdom
 |
ABSTRACT |
Sensitivity to the pungent vanilloid, capsaicin, defines a
subpopulation of primary sensory neurons that are mainly polymodal nociceptors. The recently cloned vanilloid receptor subtype 1 (VR1) is
activated by capsaicin and noxious heat. Using combined in
situ hybridization and histochemical methods, we have
characterized in sensory ganglia the expression of VR1 mRNA. We show
that this receptor is almost exclusively expressed by
neurofilament-negative small- and medium-sized dorsal root ganglion
cells. Within this population, VR1 mRNA is detected at widely varying
levels in both the NGF receptor (trkA)-positive, peptide-producing
cells that elicit neurogenic inflammation and the functionally less
characterized glial cell line-derived neurotrophic
factor-responsive cells that bind lectin Griffonia
simplicifolia isolectin B4 (IB4). Cells without detectable
levels of VR1 mRNA are found in both classes. A subpopulation of the
IB4-binding cells that produce somatostatin has relatively low levels
of VR1 mRNA. A previously uncharacterized population of very small
cells that express the receptor tyrosine kinase (RET) and that
do not label for trkA or IB4-binding has the highest relative levels of
VR1 mRNA. The majority of small visceral sensory neurons of the nodose
ganglion also express VR1 mRNA, in conjunction with the BDNF receptor
trkB but not trkA. Axotomy results in the downregulation of VR1 mRNA in
dorsal root ganglion cells.
Our data emphasize the heterogeneity of VR1 mRNA expression by
subclasses of small sensory neurons, and this may result in their
differential sensitivity to chemical and noxious heat stimuli. Our
results also indicate that peripherally derived trophic factors may
regulate levels of VR1 mRNA.
Key words:
axotomy; capsaicin; immunocytochemistry; in
situ hybridization; nociception; sensory neuron subpopulations; vanilloid receptor; VR1
 |
INTRODUCTION |
Capsaicin, the main "hot"
ingredient in chilli peppers, excites subpopulations of somatic and
visceral sensory afferents (Holzer, 1991 ; Szolcsányi, 1993 ).
Activation of these sensory neurons by capsaicin produces sensations of
burning pain or irritation and activates protective reflexes and
autonomic responses (Lundberg, 1993 ). In addition, a subset of
capsaicin-activated sensory neurons release neuropeptides from their
peripheral terminals, thereby eliciting neurogenic inflammation at the
site of stimulation (Holzer, 1988 ; Holzer and Maggi, 1998 ). With high
doses or prolonged exposure to capsaicin, neurons are functionally
desensitized, exhibiting long-lasting loss of responsiveness to
capsaicin and other stimuli (Szolcsányi, 1993 ; Winter et al.,
1995 ). Such desensitization forms the basis for the use of capsaicin as
an analgesic agent in the treatment of chronic pain conditions (Winter
et al., 1995 ; Szallasi and Blumberg, 1996 ).
Recently, Caterina et al. (1997) reported the cloning of the vanilloid
receptor subtype 1 (VR1), which binds capsaicin and other vanilloids.
This receptor was described as a nonselective cation channel, with high
Ca2+ permeability and sensitivity to noxious heat.
Further characterization of its properties suggests that it is directly
gated by heat and that its sensitivity is dramatically modulated by
protons such that it is activated at room temperature under even
moderately acidic conditions (Tominaga et al., 1998 ).
Physiological studies indicate that capsaicin-sensitive neurons are
broadly defined as small cells with unmyelinated (C) or thinly
myelinated (A ) nerve fibers. Of these afferents, most capsaicin-sensitive neurons are polymodal nociceptors,
chemonociceptors, or warmth receptors. C- and A -fiber
mechanoreceptors, D-hair receptors, and cold receptors are not
sensitive (for review, see Holzer, 1991 ; Szolcsányi, 1993 ). Small
DRG cells are heterogeneous in their neurochemical phenotype, central
projections, and neurophysiological characteristics (Hunt et al.,
1992 ), and no subclassification matches the characteristics of the
capsaicin-sensitive population (Holzer, 1991 ). Both major classes of
small cells, the peptidergic class responsive to NGF and the
Griffonia simplicifolia isolectin B4 (IB4)-binding class
responsive to glial cell line-derived neurotrophic factor (GDNF)
(Bennett et al., 1998 ; Snider and McMahon, 1998 ), contain
capsaicin-sensitive (Nagy et al., 1981 ; Jancsó, 1992 ) and
VR1-immunoreactive (Tominaga et al., 1998 ) cells. Furthermore, capsaicin-sensitive afferents have been shown to vary in sensitivity (Seno and Dray, 1991 , 1993 ; Stucky et al., 1998 ). Semiquantitative analysis of in situ hybridization allows relative levels of
mRNA in cells to be compared between treatment groups or cell
populations (Priestley et al., 1991 ; Chesselet and Weiss-Wunder, 1994 ).
We have analyzed VR1 expression in histochemically identified DRG subpopulations to determine whether there is differential expression of
VR1 that might reflect varied sensitivities to capsaicin.
NGF has been shown previously to regulate the sensitivity of a
subpopulation of cultured DRG cells to capsaicin (Winter et al., 1988 ,
1993 ; Aguayo and White, 1992 ). We have therefore examined whether
axotomy, which disturbs the supply of peripheral neurotrophic factors,
affects VR1 expression. Because conflicting results have been reported
for the expression of VR1 in nodose ganglion (Caterina et al., 1997 ;
Helliwell et al., 1998 ; Tominaga et al., 1998 ), we have also examined
this issue in more detail and particularly the coexpression of VR1 with
neurotrophin receptors.
 |
MATERIALS AND METHODS |
Animals and surgical methods. A total of 16 adult
male Wistar rats (150-250 gm body weight) were used for this study.
Six of these animals underwent unilateral sciatic nerve sections, and
four other animals had lumbar spinal nerve sections. Surgery was
performed under pentobarbitone anesthesia (40 mg/kg, Sagatal; Rhône Mérieux Ltd., Hertfordshire, UK). For sciatic
nerve sections, the nerve was exposed and ligated 20 mm distal to the
obturator tendon before cutting it further distally. Spinal nerve
sections were performed at the level of the L5-L6 vertebrae. The
spinal nerve was cut 2-3 mm distal to the ganglion. All animals were anesthetized with sodium pentobarbital and perfused through the ascending aorta with saline, followed by fresh 4% paraformaldehyde in
0.1 M phosphate buffer, pH 7.4. Animals that had sciatic
nerve sections were perfused 4, 7, and 14 d (n = 4) after surgery. Animals that had spinal nerve section were perfused
after 14 d.
Tissue preparation. All tissues were prepared using
histochemical methods described previously in detail (Michael and
Priestley, 1996 ; Michael et al., 1997 ). Lumbar dorsal root,
sympathetic, and nodose ganglia were removed, post-fixed for 2 hr in
the same fixative, and cryoprotected overnight in 15% sucrose in
phosphate buffer. Tissues were frozen in OCT mounting medium (BDH
Chemicals, Poole, UK) and sectioned on a cryostat at a thickness of 6 µm. The sections were thaw-mounted onto Superfrost Plus slides (BDH Chemicals).
Staining procedures. When using combined methodologies,
indirect immunofluorescence and Griffonia simplicifolia
isolectin B4 (IB4)-binding histochemistry were performed before
in situ hybridization. The following antisera, the staining
characteristics and specificity of which have been reported previously,
were used in immunohistochemistry: rabbit anti-trkA [1:4000 (Clary et
al., 1994 ; Averill et al., 1995 )]; sheep anti-calcitonin gene-related protein (CGRP) [1:600; Affiniti, Exeter, UK (Averill et al., 1995 )]; mouse monoclonal anti-neurofilament [1:600, clone N52; Sigma, Poole, UK (Bennett et al., 1998 )]; protein gene product 9.5 (PGP9.5) [1:2000; Ultraclone, Willows, UK (Wilson et al., 1988 )]; rabbit anti-RET [1:500; gift from Dr. Q. Yan, Amgen Inc., Thousand
Oaks, CA (Molliver et al., 1997 )]; rabbit anti-somatostatin
(1:1000; gift from Dr. T. Görcs, Semmelweis University, Budapest,
Hungary); and rabbit anti-substance P (1:1000; gift from Dr. T. Görcs). Antibodies were diluted in antibody buffer containing
0.2% Triton X-100, 0.1% sodium azide, 0.5 mM
dithiothreitol, and 100 U/ml RNasin ribonuclease inhibitor (Promega,
Madison, WI) in diethylpyrocarbonate (DEPC)-treated PBS. IB4-binding
histochemistry was performed on sections being stained for trkA by
adding 5 µg/ml biotinyl-IB4 (Sigma) to the primary antibody solution
and supplementing to a final concentration of 0.1 mM with
CaCl2, MnCl2, and
MgCl2. Sections were incubated 40-48 hr at room
temperature in the primary antibody solution, washed three times for 10 min each in DEPC PBS and incubated 4 hr in the appropriate secondary
antibodies linked to tetramethyl rhodamine isothiocyanate (TRITC)
(1:200-1:400; Jackson ImmunoLaboratories, West Grove, PA) diluted in
antibody buffer. IB4 binding was detected by including ExtrAvidin
conjugated fluorescein isothiocyanate (FITC) (1:200; Sigma) in this
incubation. Three final DEPC PBS washes were conducted before
processing of the sections for in situ hybridization.
Our protocol for in situ hybridization of freshly cut or
previously immunostained sections has been described in detail
previously (Michael et al., 1997 ). After acetylation, dehydration, and
delipidation pretreatment, mRNAs in sections were hybridized with
specific oligonucleotide probes (Genosys Biotechnologies, Cambridge,
UK). Two probe sequences were used, which were complimentary to the rat
vanilloid receptor mRNA (Caterina et al., 1997 ) at bases 509-542 (TCCTGTCTCTGGGTCTTTGAACTCGCTGTCAGTC) and 2601-2634
(ACCCAAAGACCCCGCATTGATCCCTGCATAGTGT). BLAST sequence searches of the
GenBank database failed to identify any known rat sequences other than
VR1 to which these probes would be likely to hybridize using our
reaction conditions. Oligonucleotide probes to trkA, trkB, and trkC
were used in the analysis of the nodose ganglia and have been described
previously (Michael et al., 1997 ). Radioactive probes were made by
end-labeling the oligonucleotides with 35S-dATP (NEN,
Hounslow, UK) using terminal deoxynucleotidyl transferase (Promega).
Hybridization was performed overnight at 37°C. After posthybridization washes and dehydration, slides were dipped in autoradiographic emulsion (Amersham, Arlington Heights, IL) and left
for 3-6 weeks before development.
After development, sections that had only been labeled for mRNA were
counterstained for Nissl substance using toluidine blue, dehydrated,
and mounted from Histoclear II using Histomount (National Diagnostics,
Hull, UK). Immunostained sections were mounted in PBS glycerol (1:3;
containing 2.5% 1,4-diazobicyclo-(2,2,2)-octane antifading agent;
Sigma). Silver grains and fluorescence signals were visualized using
epifluorescence microscopy, combined with epipolarized or dark-field illumination.
Controls for specificity of in situ hybridization included
adding a 100-fold excess of unlabeled oligonucleotide to the
hybridization reactions, which effectively competed all specific
binding of radiolabeled probe. The two different oligonucleotide probes
to the VR1 mRNA sequence produced identical patterns of specific labeling in the dorsal root and nodose ganglia. In situ
hybridization to sympathetic ganglion cells of the superior cervical
ganglion, which are not sensitive to capsaicin (for review, see Holzer, 1991 ), was used as a negative control. Hybridization of dorsal root
ganglion sections with the trk probes used in this study produce
specific patterns of labeling (Michael et al., 1997 ) distinct to that
obtained using the VR1 probe.
Imaging and quantitation. Sections were viewed on Leica
(Wetzlar, Germany) epifluorescence microscopes using Y3 (TRITC),
L4 (FITC), and polarization filter blocks and bright-field and/or dark-field illumination. In combined preparations that used a fluorescent stain to identify cell populations, labeling was assessed by switching between the FITC or TRITC filter blocks and epipolarized illumination. Photographs were taken using a Hamamatsu (Herrsching, Germany) C4742-95 digital camera and HiPic software to capture images.
After in situ hybridization, counts of profiles showing VR1
mRNA expression were performed using a criterion whereby profiles were
identified as positively labeled if they had clustered silver grains
over the cell body when visualized using epipolarized illumination. This criterion correlated well, with a criterion of positive labeling being the mean of the background density plus two times the SD of this density. This latter criterion was used for analysis of positively labeled profiles after image analysis, which was conducted using Visilog image analysis software (Noesis, Vélizy, France) as described previously (Michael et al., 1997 ). Using a 25×
magnification objective, images were captured by a Grundig FA87 digital
camera with integrating frame store. The cells of interest were
outlined manually using a computer mouse, and the area occupied by
silver grains within each cell and their average diameters were
calculated. An ANOVA showed differences in relative silver grain
labeling between various cell populations. Subsequently, pairwise
comparisons were conducted with Fisher's LSD test to assess
statistical significance between individual populations.
 |
RESULTS |
Expression of VR1 mRNA is restricted to N52-negative cells in the
dorsal root ganglion
Two oligonucleotide probes, complimentary to different parts of
the VR1 mRNA sequence, were used to examine VR1 expression in lumbar
DRG cells and produced similar results. The more 5'-directed probe
produced significantly less nonspecific background, and therefore,
detailed analyses were conducted using this probe.
Analysis of toluidine blue counterstained sections showed that many DRG
cells possessed VR1 mRNA, as indicated by clusters of silver grains
over the cells (Fig. 1a-d).
Specific labeling above background was seen in 46.7 ± 1.9% of
the total cell profiles. Labeled cells were invariably small- to
medium-sized.

View larger version (207K):
[in this window]
[in a new window]
|
Figure 1.
Expression of VR1 mRNA in the dorsal root ganglion
is confined primarily to small- to medium-sized cells that do not stain
for heavy chain neurofilament. In situ hybridization for
VR1 mRNA (a, b) with counterstaining of
Nissl substance in cells with toluidine blue (c,
d). VR1 mRNA is expressed by only a subset of DRG cells
(a, c, arrows). Higher
magnification photomicrographs (b, d) of
the area indicated show that expression is restricted to small- to
medium-sized cells, with the levels of VR1 mRNA differing considerably
between cells (arrows). Large cells do not express this
mRNA (asterisks). Combined in situ
hybridization for VR1 mRNA (e) and
immunofluorescence for heavy chain neurofilament using antibody N52
(f). Expression of VR1 mRNA is observed in
many cells that are negative for neurofilament immunoreactivity
(e, f, arrows). Almost all
neurofilament-positive cells are devoid of labeling for VR1 mRNA
(e, f, asterisks). Scale
bars: a, c, 100 µm; b,
d-f, 50 µm.
|
|
We used the antibody N52 against the high molecular weight (200 kDa)
neurofilament protein subunit to label the large-diameter DRG cell
population. Very little overlap between expression of this marker and
VR1 mRNA was observed (Fig. 1e,f). Of the
N52-positive profiles, only 3.4 ± 0.8% showed significant
expression of VR1 mRNA. Almost all the profiles that were labeled for
VR1 mRNA were N52-negative (96.5 ± 0.5%). Expression of VR1 mRNA
was found in 83.2 ± 1.8% of N52-negative profiles. Because
54.5 ± 2.6% of total profiles are N52-negative, this would imply
that ~45% of total profiles have VR1 mRNA, in good agreement with
our analysis of toluidine blue counterstained sections.
VR1 mRNA is expressed by many cells in both the trkA and IB4
classes and exhibits wide-ranging relative levels
For further analysis of the small DRG cells, we combined in
situ hybridization for VR1 mRNA with trkA immunocytochemistry and
IB4 binding. These triple-labeled preparations permitted us to examine
VR1 expression in both classes, as well as in the minor overlapping
population labeled by both markers. The majority of both trkA and IB4
cells express VR1 mRNA; however, not all cells in either of these
classes were labeled (Fig.
2a-d). Labeling for VR1 mRNA
above threshold levels was seen in 65.2 ± 1.4% of trkA profiles
and 74.9 ± 1.5% of IB4 profiles. In addition, there were
differences in labeling intensity, and these were explored by image
analysis.

View larger version (187K):
[in this window]
[in a new window]
|
Figure 2.
VR1 mRNA is expressed by both the NGF- and
GDNF-responsive small cell populations. In situ
hybridization for VR1 mRNA (a, c,
e) combined with fluorescence histochemistry
(b, d, f).
a, b, trkA. Most small- to medium-sized
trkA-immunoreactive cells express VR1 mRNA (thin
arrows). A few small trkA cells (thick white
arrows) and large-diameter cells (asterisks)
have little or no detectable VR1 mRNA. c,
d, IB4. As with the trkA subpopulation of small- to
medium-sized cells, most IB4-labeled cells express VR1 (thin
arrows). Some IB4 cells, however, do not possess levels of VR1
mRNA above background (thick white arrows). Some very
small-diameter IB4-negative profiles have high levels of VR1 mRNA
(thick black arrows). e,
f, RET. Whereas small RET-positive cells are often
labeled for VR1 mRNA (thin arrows), large RET-positive
cells and other large cells do not express VR1
(asterisks). A very small-diameter RET-positive cell is
shown that has very high levels of VR1 mRNA (double
arrows and insert in f).
Scale bars: a-f, 50 µm; inset, 10 µm.
|
|
Profile size distributions for the trkA and IB4 classes were plotted
against the grain density of cellular labeling for VR1 mRNA (Fig.
3a-c). This method of data
presentation revealed several trends. First, large trkA profiles with
diameters above ~40 µm were not labeled for VR1 mRNA. Second, the
small- and medium-sized trkA or IB4 profiles had wide-ranging relative
levels of the mRNA, with some profiles having high levels and others
having little or none. Although some IB4 profiles showed heavy
labeling, the majority were more lightly labeled. Third, the small but
significant population of cells that label for both trkA and IB4
(representing ~10-25% of trkA or IB4 cells) consistently expressed
at least low relative levels of VR1 mRNA.

View larger version (51K):
[in this window]
[in a new window]
|
Figure 3.
Scatterplot diagrams of VR1
expression in selected populations of dorsal root ganglion cells. In
each graph, individual profiles are plotted according to their diameter
(in micrometers; along the x-axis) and the percentage of
the profile area that is covered by silver grains as a measure of VR1
mRNA expression (along the y-axis). The dashed
lines represent the criteria above which cells are considered
labeled for VR1 mRNA. The symbols on the far
left of each graph represent the mean ± SEM percentage
area for each population. a, TrkA, Large
cells (>40 µm in diameter) do not express VR1 mRNA. Grain density
over smaller profiles varies considerably. b,
IB4, Profiles generally tend to have less VR1 signal
than the trkA identified profiles. Quite a few profiles have little or
no VR1 mRNA. c, Trk/IB4, This
double-labeled population has a characteristic size range (from ~20
to <30 µm) and shows consistent VR1 labeling above threshold.
d, TrkA-neg/IB4 neg, These profiles on
the whole are very small (ranging from 15 to 25 µm) and possess very
high levels of VR1 mRNA. The mean percentage area labeling for this
population was significantly higher than all other populations at
p = 0.01. e,
Somatostatin, This subpopulation of IB4 cells
exhibits characteristically low or beneath threshold levels of VR1 mRNA
signal. The mean percentage area labeling was significantly lower than
the trkA, trkA-negative/IB4-negative (p = 0.01), and trkA/IB4 (p = 0.05)
populations.
|
|
A unique population of very small DRG cells has high relative
levels of VR1 mRNA
In all preparations examined, a few DRG cells had very high levels
of VR1 mRNA. Figure 2 illustrates several examples of cell profiles
covered with high levels of silver grains but not counterstained with
either trkA (a, b) or IB4 (c,
d). Analysis of trkA and IB4 double-counterstained
sections indicated that, although some trkA-positive cells were highly
labeled, most of these heavily labeled profiles do not possess
detectable levels of either marker. From a plot of size versus labeling
density, such profiles can be seen to be among the smallest
VR1-expressing cells (Fig. 3d) and have levels of labeling
that are significantly higher than all the other populations studied
(Fig. 3). These trkA-negative/IB4-negative/VR1-positive profiles are
not frequently found, comprising just over 1% (31 of 2495) of total
profiles. To confirm that this small population of cells are in fact
DRG neurons and not some other cell type, we counterstained sections
with immunofluorescence for the neuron-specific marker PGP9.5. All
cells labeled for VR1 mRNA in the dorsal root ganglion were
counterstained for this marker (data not shown).
To further analyze these unusual cells, we examined expression of RET
because this receptor tyrosine kinase has been shown previously to be
expressed by many small DRG cells (Bennett et al., 1998 ). RET
immunostaining, combined with in situ hybridization for VR1
mRNA, revealed that RET protein is present in many VR1-labeled cells,
including most of the highly labeled cells. One such cell is shown in
Figure 2, e and f. Triple-labeled immunostaining
for RET, trkA, and IB4 confirmed independently the existence of a small
population of RET-positive cells in the lumbar DRG that do not label
for trkA or IB4 (data not shown). VR1 labeling was confined to the
small- and medium-sized RET profiles (Fig.
2e,f). Note that RET is also produced by a
significant number of the large cells that do not express VR1 mRNA.
VR1 mRNA and the expression of neuropeptides
Sections labeled for VR1 mRNA and for peptides expressed by small
DRG cells were analyzed to further characterize VR1 expression. Studies
of coexpression with CGRP (Fig.
4a,b) and substance
P (Fig. 4c,d), whose cell populations overlap
extensively with the trkA population, indicated that most of these
peptidergic neurons express VR1 mRNA. Large CGRP cells were invariably
negative.

View larger version (133K):
[in this window]
[in a new window]
|
Figure 4.
VR1 expression in identified subpopulations of
dorsal root ganglion cells. In situ hybridization for
VR1 mRNA was combined with immunofluorescence for the neuropeptides
CGRP (a, b), substance P
(c, d), and somatostatin
(e, f). Thin white
arrows identify cells that express VR1 mRNA and the particular
neuropeptide. a, b, Small- to
medium-sized CGRP cells express VR1 mRNA, with some cells containing
relatively high levels of the message compared with others.
Asterisks label large CGRP-immunoreactive cells that do
not express VR1 mRNA. c, d, Similar to
CGRP-positive cells, substance P-immunoreactive cells show variable
levels of VR1 mRNA expression. e, f, The
somatostatin cell identified in this photomicrograph expresses only low
levels of VR1 mRNA. Scale bars: a, b, 50 µm; c-f, 20 µm.
|
|
Double-labeling with somatostatin, which is localized exclusively to a
small subset of the IB4-binding DRG cells, showed that many of these
cells expressed VR1 mRNA. However, it was apparent that these cells
were not labeled as heavily for the VR1 mRNA as many surrounding cells
(Fig. 4e,f). This was confirmed by image analysis, which showed that these cells have significantly lower levels
of labeling than most of the other populations (Fig. 3).
The majority of neurons in the nodose ganglion express
VR1 mRNA
In situ hybridization of sections from the nodose
ganglion showed relatively high levels of expression of VR1 mRNA (Fig.
5a-d). Analysis of
emulsion-dipped sections counterstained with toluidine blue indicated
that 81.6 ± 1.0% of the nodose ganglion cell profiles label for
VR1 mRNA. The labeling intensity varied considerably between cells as
it did in the dorsal root ganglia. Unlabeled cells included a few large
cells (Fig. 5c,d), which in double-labeled preparations were N52-immunoreactive (data not shown).

View larger version (189K):
[in this window]
[in a new window]
|
Figure 5.
Expression of VR1 mRNA in the nodose ganglion.
a, b, Moderate to high levels of VR1 mRNA
were localized to most neurons of the nodose ganglion.
c, d, At high magnification, labeled
cells (arrows) show differing levels of the mRNA. Some
cells are not labeled (asterisks). e,
f, The mRNA for trkB is detected in most nodose ganglion
cells. Arrows point to labeled cell profiles.
Asterisks mark an unlabeled cell. g,
h, VR1 mRNA is not detected in most nodose ganglion
cells that express trkA protein (asterisks). Scale bars:
a, b, 100 µm; c-h, 50 µm.
|
|
Semi-adjacent sections of nodose ganglia were processed for in
situ hybridization of trk family receptors to compare their distributions with that of VR1. Signals for both trkA and trkC were
only observed in small numbers of nodose ganglion cells; however, trkB
mRNA was detected in the majority of cells (Fig. 5e,f), indicating that many VR1
cells must express trkB. In contrast, combined VR1 in situ
hybridization and trkA immunocytochemistry indicated that the few
trkA-positive cells in the nodose ganglia have little or no detectable
VR1 mRNA (Fig. 5g,h).
VR1 levels in sensory neurons are decreased after axotomy
To examine the regulation of VR1 mRNA in sensory neurons, in
situ hybridization was performed on L4 ganglia after sciatic nerve
section. Preliminary studies indicated that a reduction in the amount
of VR1 mRNA occurs between 4 and 7 d after axotomy, and levels
remain low at 2 weeks after lesion. Two weeks after axotomy, phenotypic
changes in the small cell populations, including decreased expression
of CGRP, trkA, and IB4 binding, are evident. The downregulation of CGRP
after axotomy has been well characterized previously. Therefore, we
examined more closely VR1 regulation in sections counterstained for
this marker (Fig. 6a-d).
After sciatic nerve section, the number of CGRP-immunoreactive profiles in L4 ganglia was reduced from 35.7 ± 3.8% of total on the
contralateral uninjured side to 11.8 ± 2.4% of total on the
axotomized side. VR1 mRNA profiles were similarly decreased from
46.8 ± 2.2 to 15.7 ± 2.3% of total. As in the uninjured
ganglia, the VR1 mRNA-positive profiles that remained after axotomy are
often CGRP-positive. The number of VR1 profiles in the uninjured
contralateral L4 that were labeled for CGRP was 58.7 ± 2.3%
compared with 51.1 ± 4.5% of VR1 profiles on the axotomized
ganglia.

View larger version (185K):
[in this window]
[in a new window]
|
Figure 6.
Expression of VR1 mRNA decreases in the DRG after
axotomy. Combined in situ hybridization for VR1 mRNA and
CGRP immunofluorescence was performed on sections from the
contralateral control (a, b), ipsilateral
sciatic nerve-axotomized (c, d), and
spinal nerve-axotomized (e, f)
dorsal root ganglia. In the control DRG, there is robust labeling for
both VR1 mRNA and CGRP. Many cells coexpress both products
(a, b, arrows).
Ipsilateral to the sciatic nerve axotomy, there is a dramatic reduction
in the number of cells labeled for VR1 or CGRP. Many of the remaining
VR1-labeled cells are CGRP-immunoreactive. Arrows in
c and d point to one example. After
spinal nerve axotomy, both VR1 mRNA and CGRP expression is reduced
throughout the ganglion. Scale bars, 50 µm.
|
|
Spinal nerve section produced an almost complete loss of VR1 mRNA
labeling in the axotomized ganglia, which was similar to the extent of
loss found for CGRP, trkA, and IB4 binding. A comparison of in
situ hybridization for VR1 mRNA and CGRP immunocytochemical counterstaining after spinal nerve section is shown in Figure 6e,f.
 |
DISCUSSION |
In this study, we show that expression of VR1 mRNA in DRG cells is
restricted to neurofilament-negative cells but is present in both the
peptide and nonpeptide subclasses. In addition, we show that there is
considerable heterogeneity in the levels of VR1 mRNA expression, with a
small subgroup of RET-immunoreactive DRG cells showing extremely high
levels. In contrast, the level of VR1 expression in somatostatin cells
is consistently low. Also, we show that VR1 is expressed by trkB, but
not trkA, nodose ganglion cells and demonstrate that VR1 mRNA is
downregulated in DRG cells after axotomy. These results, which are all
novel, will be discussed in turn.
VR1 expression in subpopulations of DRG cells
VR1 mRNA has been shown previously to be present predominantly in
small- and medium-sized cells (Caterina et al., 1997 ; Helliwell et al.,
1998 ), but size alone is not adequate for classifying DRG cells
(Lawson, 1992 ). Neurofilament expression has therefore become widely
used as a DRG marker because it reliably distinguishes between cells
with myelinated (neurofilament-positive) and unmyelinated (neurofilament-negative) axons (Lawson, 1992 ). Our results
strikingly show that VR1-expressing neurons are almost all N52-negative
and hence belong to the small dark (B-type) population of DRG cells that give rise to unmyelinated C fibers. A few
neurofilament-positive cells were seen to express VR1 and probably
represent a population of capsaicin-sensitive A nociceptors. This
result is consistent with functional studies showing that capsaicin
destroys primarily, but not exclusively, unmyelinated axons (Nagy et
al., 1983 ).
To further classify VR1 expression in the B-type population, we have
used markers that distinguish the two major subgroups that it comprises
(Snider and McMahon, 1998 ). The majority of cells in both the
trkA/peptide-expressing group and the IB4/fluoride resistant acid
phosphatase group expressed VR1 but with a different proportion
of cells in each group. Some trkA cells are medium- or
large-sized and are neurofilament-immunoreactive (18-28% of all trkA
profiles), so the expression of VR1 in trkA cells with unmyelinated
axons will be higher than the 65% indicated by our total trkA counts
and probably closer to 80-90%. In contrast, the IB4 counts
include trkA/IB4 double-labeled cells, and this subgroup expresses VR1.
The expression of VR1 in the remaining "pure" IB4 cells will
therefore be lower than the observed 75% and probably closer to 60%
(~25% of IB4 cells express trkA in this analysis). VR1 mRNA thus
appears to be expressed by proportionally more trkA/peptide cells than
IB4 cells. VR1 protein has been shown recently (Tominaga et al., 1998 )
to be expressed by 60-80% of IB4 cells and by most cells that contain
substance P, a peptide that is present in many small trkA/peptide cells
(Lawson, 1992 ). Our results complement this study, showing that VR1
expression by unmyelinated trkA/peptide cells is a general
characteristic of this group and not a particular feature of substance
P cells.
Using image analysis, we were able to compare levels of VR1 expression
by various DRG subgroups, and this revealed interesting differences.
Small CGRP, substance P, and somatostatin cells all express VR1, but
not all at high levels. Somatostatin cells had invariably low or below
threshold levels of VR1 expression. This is consistent with data
indicating that somatostatin cells are less sensitive to capsaicin than
other DRG cells. Systemic capsaicin reduces levels of mRNA for
substance P and CGRP by 50 and 30%, respectively, but has no effect on
somatostatin expression (Kashiba et al., 1997 ). In complete contrast to
the somatostatin cells, we observed a few small DRG cells with very
high levels of VR1 expression and unusual histochemical features.
Negative for trkA or IB4 binding, these cells may be GDNF-sensitive
because they express RET protein (Bennett et al., 1998 ). Although they
comprise only a small number of cells, their very high levels of VR1
expression indicate that they are likely to have a unique sensory role.
The functional significance of the division of small DRG cells into two
main subpopulations is unknown but has been the subject of much
discussion (Hunt et al., 1992 ; Lynn, 1997 ; Snider and McMahon, 1998 ).
Similarly, although neuropeptides such as substance P have been
traditionally regarded as associated with nociceptors, their exact role
and possible correlation with physiological subclasses is still poorly
understood (Lynn, 1997 ). Our study, together with the recently detailed
functional characterization of VR1 (Caterina et al., 1997 ; Tominaga et
al., 1998 ), allows us to draw some tentative correlations between
neurochemical and physiological subclasses. Thus, the patterns of VR1
expression indicate that most unmyelinated trkA cells and a
subpopulation of IB4 cells are likely to mediate responses to noxious
heat. Non-nociceptive C fibers, such as cooling and mechanoreceptive
afferents, may be accounted for by the remaining IB4 cells. A striking
feature of IB4 cells is that many selectively express the
P2X3 ATP receptor (Bradbury et al., 1998 ; Vulchanova et al., 1998 ), a receptor which may be activated by ATP released after
tissue damage (Cook et al., 1997 ). VR1 activation has also been
proposed to be increased after tissue damage as a result of
modulatory effects of protons (Tominaga et al., 1998 ). It is not known
to what extent the P2X3-expressing IB4 cells overlap with
the VR1-expressing ones, but coexpression of P2X3 and VR1 is likely to endow IB4 cells with a unique signaling role after tissue injury.
Expression of VR1 in small substance P and CGRP cells is consistent
with many studies showing that these peptides are likely to be present
in nociceptors (Lawson, 1992 ). However, the low VR1 expression seen in
somatostatin cells is surprising in the light of studies showing that
noxious heat selectively releases somatostatin (Kuraishi et al., 1985 ;
Morton et al., 1989 ). Our results may indicate that somatostatin cells
express another type of thermoreceptor.
VR1 expression in the nodose ganglion
We show that VR1 mRNA is expressed by most cells of the nodose
ganglia, confirming a recent result reported by Helliwell and colleagues (1998) . Caterina et al. (1997) were unable to detect VR1
expression in the nodose, but this might have been because of a lack of
sensitivity. Capsaicin-sensitive visceral afferents have been well
characterized (Holzer, 1991 ), and systemic capsaicin causes
degeneration of many thin-diameter nodose afferents (Ritter and Dinh,
1988 ). Capsaicin-sensitive visceral and somatic afferents appear
similar in that both transmit primarily chemical and nociceptive signals and are primarily C fibers (Holzer, 1991 ). Our results show
that nodose cells that lack VR1 include large
neurofilament-immunoreactive cells. This is consistent with studies
showing that low threshold tracheal A mechanoreceptors originating
in the nodose ganglia are neurofilament-positive and
capsaicin-insensitive (Riccio et al., 1996 ).
Recently, Winter (1998) has shown that brain-derived neurotrophic
factor (BDNF), but not NGF, regulates the capsaicin sensitivity of
adult nodose ganglion cells in culture. There have been conflicting reports as to whether nodose cells express trkB (Wetmore and Olson, 1995 ; Zhuo and Helke, 1996 ). Our finding that most adult nodose ganglion cells express trkB confirms the work of Wetmore and Olson (1995) , and because most of these cells coexpress VR1, it is possible that BDNF may regulate the capsaicin sensitivity of these neurons in vivo. The lack of coexpression of trkA with VR1 explains
why NGF is unable to regulate capsaicin sensitivity in the nodose and
contrasts with its effects on DRG cells.
Axotomy downregulates VR1 expression
Spinal nerve section, which axotomizes all cells in the
contributing dorsal root ganglion, led to a complete loss of both CGRP
and VR1 expression. In contrast, sciatic section, which leaves some
cells intact, produced only a partial loss. It is therefore most likely
that the downregulation in VR1 expression is a direct response by DRG
cells to axotomy. This may represent a cellular reaction to the injury
and/or be a response to changed availability of trophic factors
(Aldskogius et al., 1992 ). Further experiments are required to
distinguish between these possibilities. However, we have shown that
VR1-expressing cells possess receptors for NGF (trkA) and/or GDNF
(RET). It has been shown previously that IB4 cells selectively express
GDNF receptors and that the axotomy-induced downregulation of various
substances present in IB4 and trkA cells can be prevented by the
appropriate exogenous factor (i.e., GDNF or NGF) (Bennett et al.,
1998 ). The loss of VR1 expression after axotomy may therefore reflect
loss of local or target-derived NGF or GDNF. Consistent with this
interpretation, DRG cells cultured in the absence of NGF display a loss
in capsaicin sensitivity, which can be reversed by NGF (Winter et al.,
1988 , 1993 ). Somewhat in contrast with our results, nerve section has
been reported to not significantly affect DRG binding of the vanilloid
analog resiniferatoxin (RTX) (Farkas-Szallasi et al., 1996 ). This may indicate the presence of another subtype of vanilloid receptor, because
Acs and colleagues (1996 , 1997 ) have proposed that resiniferatoxin may
act at a distinct RTX-selective vanilloid receptor. Whether another VR
subtype is expressed concomitantly with VR1 and how vanilloid receptor
expression is regulated in physiology and pathology deserve further
investigation. One specific question that can be addressed is whether
the thermal hyperalgesia associated with inflammation and increased
tissue NGF levels is partly caused by an NGF-mediated increase in VR1
expression. Control of vanilloid receptor expression in conditions of
inflammation or other chronic pain states could provide a powerful new
approach to pain treatment.
 |
FOOTNOTES |
Received Aug. 26, 1998; revised Dec. 10, 1998; accepted Dec. 15, 1998.
This work was funded by the Medical Research Council of Great Britain.
We thank Drs. D. O. Clary, T. Görcs, and Q. Yan for the
provision of trkA, substance P, and RET antisera, respectively. We also
thank Drs. S. B. McMahon for helpful suggestions
concerning the project, P. J. Shortland for performing the spinal
nerve sections, and V. R. King for help with statistical analyses.
Correspondence should be addressed to Dr. G. J. Michael,
Neuroscience Section, Division of Biomedical Sciences, Queen Mary and
Westfield College, Mile End Road, London E1 4NS, United Kingdom.
 |
REFERENCES |
-
Acs G,
Biro T,
Acs P,
Modarres S,
Blumberg PM
(1997)
Differential activation and desensitization of sensory neurons by resiniferatoxin.
J Neurosci
17:5622-5628[Abstract/Free Full Text].
-
Acs G,
Lee J,
Marquez VE,
Blumberg PM
(1996)
Distinct structure-activity relations for stimulation of 45Ca uptake and for high-affinity binding in cultured rat dorsal root ganglion neurons and dorsal root ganglion membranes.
Mol Brain Res
35:173-182[Medline].
-
Aguayo LG,
White G
(1992)
Effects of nerve growth factor on TTX-sensitivity and capsaicin-sensitivity in adult rat sensory neurons.
Brain Res
570:61-67[Web of Science][Medline].
-
Aldskogius H,
Arvidsson J,
Grant G
(1992)
Axotomy-induced changes in primary sensory neurons.
In: Sensory neurons. Diversity, development, and plasticity (Scott SA,
ed), pp 363-383. New York: Oxford UP.
-
Averill S,
McMahon SB,
Clary DO,
Reichardt LF,
Priestley JV
(1995)
Immunocytochemical localization of trkA receptors in chemically identified subgroups of adult rat sensory neurons.
Eur J Neurosci
7:1484-1494[Web of Science][Medline].
-
Bennett DLH,
Michael GJ,
Ramachandran N,
Munson JB,
Averill S,
Yan Q,
McMahon SB,
Priestley JV
(1998)
A distinct subgroup of small DRG cells express GDNF receptor components and GDNF is protective for these neurons after nerve injury.
J Neurosci
18:3059-3072[Abstract/Free Full Text].
-
Bradbury EJ,
Burnstock G,
McMahon SB
(1998)
The expression of P2X3 purinoreceptors in sensory neurons: effects of axotomy and glial-derived neurotrophic factor.
Mol Cell Neurosci
12:256-268[Web of Science][Medline].
-
Caterina MJ,
Schumacher MA,
Tominaga M,
Rosen TA,
Levine JD,
Julius D
(1997)
The capsaicin receptor: a heat-activated ion channel in the pain pathway.
Nature
389:816-824[Web of Science][Medline].
-
Chesselet M-F,
Weiss-Wunder LT
(1994)
Quantification of in situ hybridization histochemistry.
In: In situ hybridization in neurobiology (Eberwine JH,
Valentino KL,
Barchas JD,
eds), pp 114-123. New York: Oxford UP.
-
Clary DO,
Weskamp G,
Austin LR,
Reichardt LF
(1994)
TrkA cross-linking mimics neuronal responses to nerve growth factor.
Mol Biol Cell
5:549-563[Abstract].
-
Cook SP,
Vulchanova L,
Hargreaves KM,
Elde R,
McCleskey EW
(1997)
Distinct ATP receptors on pain-sensing and stretch-sensing neurons.
Nature
387:505-508[Medline].
-
Farkas-Szallasi T,
Bennett GJ,
Blumberg PM,
Hökfelt T,
Lundberg JM,
Szallasi A
(1996)
Vanilloid receptor loss is independent of the messenger plasticity that follows systemic resiniferatoxin administration.
Brain Res
719:213-218[Web of Science][Medline].
-
Helliwell RJA,
McLatchie LM,
Clarke M,
Winter J,
Bevan S,
McIntyre P
(1998)
Capsaicin sensitivity is associated with the expression of the vanilloid (capsaicin) receptor (VR1) mRNA in adult rat sensory ganglia.
Neurosci Lett
250:177-180[Web of Science][Medline].
-
Holzer P
(1988)
Local effector functions of capsaicin-sensitive sensory nerve endings: involvement of tachykinins, calcitonin gene-related peptide and other neuropeptides.
Neuroscience
24:739-768[Web of Science][Medline].
-
Holzer P
(1991)
Capsaicin: cellular targets, mechanisms of action, and selectivity for thin sensory neurons.
Pharmacol Rev
43:143-201[Web of Science][Medline].
-
Holzer P,
Maggi CA
(1998)
Dissociation of dorsal root ganglion neurons into afferent and efferent-like neurons.
Neuroscience
86:389-398[Web of Science][Medline].
-
Hunt SP,
Mantyh PW,
Priestley JV
(1992)
The organization of biochemically characterized sensory neurons.
In: Sensory neurons. Diversity, development, and plasticity (Scott SA,
ed), pp 60-76. New York: Oxford UP.
-
Jancsó G
(1992)
Pathobiological reactions of C-fibre primary sensory neurons to peripheral nerve injury.
Exp Physiol
77:405-431[Abstract].
-
Kashiba H,
Ueda Y,
Senba E
(1997)
Systemic capsaicin in the adult rat differentially affects gene expression for neuropeptides and neurotrophin receptors in primary sensory neurons.
Neuroscience
76:299-312[Web of Science][Medline].
-
Kuraishi Y,
Hirota N,
Sato Y,
Hino Y,
Satoh M,
Takagi H
(1985)
Evidence that substance P and somatostatin transmit separate information related to pain in the spinal dorsal horn.
Brain Res
325:294-298[Web of Science][Medline].
-
Lawson SN
(1992)
Morphological and biochemical cell types of sensory neurons.
In: Sensory neurons. Diversity, development, and plasticity (Scott SA,
ed), pp 27-59. New York: Oxford UP.
-
Lundberg JM
(1993)
Capsaicin-sensitive sensory nerves in the airways
implications for protective reflexes and disease.
In: Capsaicin in the study of pain (Wood JN,
ed), pp 219-237. London: Academic. -
Lynn B
(1997)
Substance P and nociceptive afferent neurones.
J Physiol (Lond)
505:1[Free Full Text].
-
Michael GJ,
Priestley JV
(1996)
Combined immunocytochemistry and in situ hybridization.
In: In situ hybridization techniques for the brain (Henderson Z,
ed), pp 111-118. New York: Wiley.
-
Michael GJ,
Averill S,
Nitkunan A,
Rattray M,
Bennett DLH,
Yan Q,
Priestley JV
(1997)
Nerve growth factor treatment increases brain-derived neurotrophic factor selectively in trkA-expressing dorsal root ganglion cells and in their central terminations within the spinal cord.
J Neurosci
17:8476-8490[Abstract/Free Full Text].
-
Molliver DC,
Wright DE,
Leitner ML,
Parsadanian AS,
Doster K,
Wen D,
Yan Q,
Snider WD
(1997)
IB4-binding DRG neurons switch from NGF to GDNF dependence in early postnatal life.
Neuron
19:849-861[Web of Science][Medline].
-
Morton CR,
Hutchison WD,
Hendry IA,
Duggan AW
(1989)
Somatostatin
evidence for a role in thermal nociception.
Brain Res
488:89-96[Web of Science][Medline]. -
Nagy JI,
Hunt SP,
Iversen LL,
Emson PC
(1981)
Biochemical and anatomical observations on the degeneration of peptide-containing primary afferent neurons after neonatal capsaicin.
Neuroscience
6:1923-1934[Web of Science][Medline].
-
Nagy JI,
Iversen LL,
Goedert M,
Chapman D,
Hunt SP
(1983)
Dose-dependant effect of capsaisin on primary sensory neurons in the neonatal rat.
J Neurosci
3:399-406[Abstract].
-
Priestley JV,
Réthelyi M,
Lund PK
(1991)
Semi-quantitative analysis of somatostatin mRNA distribution in the rat central nervous system using in situ hybridization.
J Chem Neuroanat
4:131-153[Web of Science][Medline].
-
Riccio MM,
Kummer W,
Biglari B,
Myers AC,
Undem BJ
(1996)
Interganglionic segregation of distinct vagal afferent fiber phenotypes in guinea-pig airways.
J Physiol (Lond)
496:521-530[Abstract/Free Full Text].
-
Ritter S,
Dinh TT
(1988)
Capsaicin-induced neuronal degeneration: silver impregnation of cell bodies, axons, and terminals in the central nervous system of the adult rat.
J Comp Neurol
271:79-90[Web of Science][Medline].
-
Seno N,
Dray A
(1991)
Selective activation by capsaicin of polymodal nociceptors in the rat hind paw skin saphenous nerve in vitro and antagonism by capsazepine.
J Physiol (Lond)
438:P120[Web of Science].
-
Seno N,
Dray A
(1993)
Capsaicin-induced activation of fine afferent fibers from rat skin in vitro.
Neuroscience
55:563-569[Web of Science][Medline].
-
Snider WD,
McMahon SB
(1998)
Tackling pain at the source: new ideas about nociceptors.
Neuron
20:629-632[Web of Science][Medline].
-
Stucky CL,
Abrahams LG,
Seybold VS
(1998)
Bradykinin increases the proportion of neonatal rat dorsal root ganglion neurons that respond to capsaicin and protons.
Neuroscience
84:1257-1265[Web of Science][Medline].
-
Szallasi A,
Blumberg PM
(1996)
Vanilloid receptors: new insights enhance potential as a therapeutic target.
Pain
68:195-208[Web of Science][Medline].
-
Szolcsányi J
(1993)
Actions of capsaicin on sensory receptors.
In: Capsaicin in the study of pain (Wood JN,
ed), pp 1-26. London: Academic.
-
Tominaga M,
Caterina MJ,
Malmberg AB,
Rosen TA,
Gilbert H,
Skinner K,
Raumann BE,
Basbaum AI,
Julius D
(1998)
The cloned capsaicin receptor integrates multiple pain-producing stimuli.
Neuron
21:531-543[Web of Science][Medline].
-
Vulchanova L,
Riedl MS,
Shuster SJ,
Stone LS,
Hargreaves KM,
Buell G,
Surprenant A,
North RA,
Elde R
(1998)
P2X3 is expressed by DRG neurons that terminate in inner lamina II.
Eur J Neurosci
10:3470-3478[Web of Science][Medline].
-
Wetmore C,
Olson L
(1995)
Neuronal and nonneuronal expression of neurotrophins and their receptors in sensory and sympathetic ganglia suggest new intercellular trophic interactions.
J Comp Neurol
353:143-159[Web of Science][Medline].
-
Wilson PO,
Barber PC,
Hamid QA,
Power BF,
Dhillon AP,
Rode J,
Day IN,
Thompson RJ,
Polak JM
(1988)
The immunolocalization of protein gene product 9.5 using rabbit polyclonal and mouse monoclonal antibodies.
Br J Exp Pathol
69:91-104[Web of Science][Medline].
-
Winter J
(1998)
Brain-derived neurotrophic factor, but not nerve growth factor, regulates capsaicin sensitivity of rat vagal ganglion neurones.
Neurosci Lett
241:21-24[Web of Science][Medline].
-
Winter J,
Forbes CA,
Sternberg J,
Lindsay RM
(1988)
Nerve growth factor (NGF) regulates adult rat cultured dorsal root ganglion neuron responses to the excitotoxin capsaicin.
Neuron
1:973-981[Web of Science][Medline].
-
Winter J,
Walpole CSJ,
Bevan S,
James IF
(1993)
Characterization of resiniferatoxin binding sites on sensory neurons: co-regulation of resiniferatoxin binding and capsaicin sensitivity in adult rat dorsal root ganglia.
Neuroscience
57:747-757[Web of Science][Medline].
-
Winter J,
Bevan S,
Campbell EA
(1995)
Capsaicin and pain mechanisms.
Br J Anaesth
75:157-168[Free Full Text].
-
Zhuo H,
Helke CJ
(1996)
Presence and localization of neurotrophin receptor tyrosine kinase (TrkA, TrkB, TrkC) messenger RNAs in visceral afferent neurons of the nodose and petrosal ganglia.
Mol Brain Res
38:63-70[Medline].
Copyright © 1999 Society for Neuroscience 0270-6474/99/1951844-11$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
H. Sun, D.-P. Li, S.-R. Chen, W. N. Hittelman, and H.-L. Pan
Sensing of Blood Pressure Increase by Transient Receptor Potential Vanilloid 1 Receptors on Baroreceptors
J. Pharmacol. Exp. Ther.,
December 1, 2009;
331(3):
851 - 859.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. J. Lever, M. Robinson, M. Cibelli, C. Paule, P. Santha, L. Yee, S. P. Hunt, B. F. Cravatt, M. R. Elphick, I. Nagy, et al.
Localization of the Endocannabinoid-Degrading Enzyme Fatty Acid Amide Hydrolase in Rat Dorsal Root Ganglion Cells and Its Regulation after Peripheral Nerve Injury
J. Neurosci.,
March 25, 2009;
29(12):
3766 - 3780.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Zhang, R.-L. Lin, M. Wiggers, D. M. Snow, and L.-Y. Lee
Altered expression of TRPV1 and sensitivity to capsaicin in pulmonary myelinated afferents following chronic airway inflammation in the rat
J. Physiol.,
December 1, 2008;
586(23):
5771 - 5786.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Larsson and J. Broman
Translocation of GluR1-Containing AMPA Receptors to a Spinal Nociceptive Synapse during Acute Noxious Stimulation
J. Neurosci.,
July 9, 2008;
28(28):
7084 - 7090.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Williams, S. A. Smith, D. E. O'Brien, J. H. Mitchell, and M. G. Garry
The group IV afferent neuron expresses multiple receptor alterations in cardiomyopathyic rats: evidence at the cannabinoid CB1 receptor
J. Physiol.,
February 1, 2008;
586(3):
835 - 845.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Sugiura, K. Bielefeldt, and G. F. Gebhart
Mouse colon sensory neurons detect extracellular acidosis via TRPV1
Am J Physiol Cell Physiol,
May 1, 2007;
292(5):
C1768 - C1774.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. K. Rau, N. Jiang, R. D. Johnson, and B. Y. Cooper
Heat Sensitization in Skin and Muscle Nociceptors Expressing Distinct Combinations of TRPV1 and TRPV2 Protein
J Neurophysiol,
April 1, 2007;
97(4):
2651 - 2662.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. A. Malin, D. C. Molliver, H. R. Koerber, P. Cornuet, R. Frye, K. M. Albers, and B. M. Davis
Glial Cell Line-Derived Neurotrophic Factor Family Members Sensitize Nociceptors In Vitro and Produce Thermal Hyperalgesia In Vivo.
J. Neurosci.,
August 15, 2006;
26(33):
8588 - 8599.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Covasa
CCK- and leptin-induced vagal afferent activation: a model for organ-specific endocrine modulation of visceral sensory information
Am J Physiol Regulatory Integrative Comp Physiol,
June 1, 2006;
290(6):
R1542 - R1543.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Larsson and J. Broman
Pathway-specific bidirectional regulation of Ca2+/calmodulin-dependent protein kinase II at spinal nociceptive synapses after acute noxious stimulation.
J. Neurosci.,
April 19, 2006;
26(16):
4198 - 4205.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Gendron, A. L. Lucido, F. Mennicken, D. O'Donnell, J.-P. Vincent, T. Stroh, and A. Beaudet
Morphine and Pain-Related Stimuli Enhance Cell Surface Availability of Somatic {delta}-Opioid Receptors in Rat Dorsal Root Ganglia
J. Neurosci.,
January 18, 2006;
26(3):
953 - 962.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Pertin, R.-R. Ji, T. Berta, A. J. Powell, L. Karchewski, S. N. Tate, L. L. Isom, C. J. Woolf, N. Gilliard, D. R. Spahn, et al.
Upregulation of the Voltage-Gated Sodium Channel {beta}2 Subunit in Neuropathic Pain Models: Characterization of Expression in Injured and Non-Injured Primary Sensory Neurons
J. Neurosci.,
November 23, 2005;
25(47):
10970 - 10980.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Zhu, Y. Wang, and D. H. Wang
Diuresis and Natriuresis Caused by Activation of VR1-Positive Sensory Nerves in Renal Pelvis of Rats
Hypertension,
October 1, 2005;
46(4):
992 - 997.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Honore, C. T. Wismer, J. Mikusa, C. Z. Zhu, C. Zhong, D. M. Gauvin, A. Gomtsyan, R. El Kouhen, C.-H. Lee, K. Marsh, et al.
A-425619 [1-Isoquinolin-5-yl-3-(4-trifluoromethyl-benzyl)-urea], a Novel Transient Receptor Potential Type V1 Receptor Antagonist, Relieves Pathophysiological Pain Associated with Inflammation and Tissue Injury in Rats
J. Pharmacol. Exp. Ther.,
July 1, 2005;
314(1):
410 - 421.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z.-Z. Wu, S.-R. Chen, and H.-L. Pan
Transient Receptor Potential Vanilloid Type 1 Activation Down-regulates Voltage-gated Calcium Channels through Calcium-dependent Calcineurin in Sensory Neurons
J. Biol. Chem.,
May 6, 2005;
280(18):
18142 - 18151.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Kwong and L.-Y. Lee
Prostaglandin E2 potentiates a TTX-resistant sodium current in rat capsaicin-sensitive vagal pulmonary sensory neurones
J. Physiol.,
April 15, 2005;
564(2):
437 - 450.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. R. Ghilardi, H. Rohrich, T. H. Lindsay, M. A. Sevcik, M. J. Schwei, K. Kubota, K. G. Halvorson, J. Poblete, S. R. Chaplan, A. E. Dubin, et al.
Selective Blockade of the Capsaicin Receptor TRPV1 Attenuates Bone Cancer Pain
J. Neurosci.,
March 23, 2005;
25(12):
3126 - 3131.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Sugiura, K. Dang, K. Lamb, K. Bielefeldt, and G. F. Gebhart
Acid-Sensing Properties in Rat Gastric Sensory Neurons from Normal and Ulcerated Stomach
J. Neurosci.,
March 9, 2005;
25(10):
2617 - 2627.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. D. Wilson-Gerwing, M. V. Dmyterko, D. W. Zochodne, J. M. Johnston, and V. M. K. Verge
Neurotrophin-3 Suppresses Thermal Hyperalgesia Associated with Neuropathic Pain and Attenuates Transient Receptor Potential Vanilloid Receptor-1 Expression in Adult Sensory Neurons
J. Neurosci.,
January 19, 2005;
25(3):
758 - 767.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. A. Groneberg, A. Niimi, Q. T. Dinh, B. Cosio, M. Hew, A. Fischer, and K. F. Chung
Increased Expression of Transient Receptor Potential Vanilloid-1 in Airway Nerves of Chronic Cough
Am. J. Respir. Crit. Care Med.,
December 15, 2004;
170(12):
1276 - 1280.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. S. Scotland, S. Chauhan, C. Davis, C. De Felipe, S. Hunt, J. Kabir, P. Kotsonis, U. Oh, and A. Ahluwalia
Vanilloid Receptor TRPV1, Sensory C-Fibers, and Vascular Autoregulation: A Novel Mechanism Involved in Myogenic Constriction
Circ. Res.,
November 12, 2004;
95(10):
1027 - 1034.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Obata, H. Yamanaka, K. Kobayashi, Y. Dai, T. Mizushima, H. Katsura, T. Fukuoka, A. Tokunaga, and K. Noguchi
Role of Mitogen-Activated Protein Kinase Activation in Injured and Intact Primary Afferent Neurons for Mechanical and Heat Hypersensitivity after Spinal Nerve Ligation
J. Neurosci.,
November 10, 2004;
24(45):
10211 - 10222.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Sugiuar, K. Bielefeldt, and G. F. Gebhart
TRPV1 Function in Mouse Colon Sensory Neurons Is Enhanced by Metabotropic 5-Hydroxytryptamine Receptor Activation
J. Neurosci.,
October 27, 2004;
24(43):
9521 - 9530.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Vellani, O. Zachrisson, and P. A McNaughton
Functional bradykinin B1 receptors are expressed in nociceptive neurones and are upregulated by the neurotrophin GDNF
J. Physiol.,
October 15, 2004;
560(2):
391 - 401.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Wang, Y. Ren, X. Zou, L. Fang, W. D. Willis, and Q. Lin
Sympathetic Influence on Capsaicin-Evoked Enhancement of Dorsal Root Reflexes in Rats
J Neurophysiol,
October 1, 2004;
92(4):
2017 - 2026.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B Schmidt, J Hammer, P Holzer, and H F Hammer
Chemical nociception in the jejunum induced by capsaicin
Gut,
August 1, 2004;
53(8):
1109 - 1116.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. J. Woodbury, M. Zwick, S. Wang, J. J. Lawson, M. J. Caterina, M. Koltzenburg, K. M. Albers, H. R. Koerber, and B. M. Davis
Nociceptors Lacking TRPV1 and TRPV2 Have Normal Heat Responses
J. Neurosci.,
July 14, 2004;
24(28):
6410 - 6415.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Zhang, S. Jones, K. Brody, M. Costa, and S. J. H. Brookes
Thermosensitive transient receptor potential channels in vagal afferent neurons of the mouse
Am J Physiol Gastrointest Liver Physiol,
June 1, 2004;
286(6):
G983 - G991.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-H. Jin, T. W. Bailey, B.-y. Li, J. H. Schild, and M. C. Andresen
Purinergic and Vanilloid Receptor Activation Releases Glutamate from Separate Cranial Afferent Terminals in Nucleus Tractus Solitarius
J. Neurosci.,
May 19, 2004;
24(20):
4709 - 4717.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-M. Kang, K. Bielefeldt, and G. F. Gebhart
Sensitization of Mechanosensitive Gastric Vagal Afferent Fibers in the Rat by Thermal and Chemical Stimuli and Gastric Ulcers
J Neurophysiol,
May 1, 2004;
91(5):
1981 - 1989.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. P. Ahern
Activation of TRPV1 by the Satiety Factor Oleoylethanolamide
J. Biol. Chem.,
August 15, 2003;
278(33):
30429 - 30434.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. R. Meyers, R. B. MacDonald, A. Duggan, D. Lenzi, D. G. Standaert, J. T. Corwin, and D. P. Corey
Lighting up the Senses: FM1-43 Loading of Sensory Cells through Nonselective Ion Channels
J. Neurosci.,
May 15, 2003;
23(10):
4054 - 4065.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Obata, H. Yamanaka, Y. Dai, T. Tachibana, T. Fukuoka, A. Tokunaga, H. Yoshikawa, and K. Noguchi
Differential Activation of Extracellular Signal-Regulated Protein Kinase in Primary Afferent Neurons Regulates Brain-Derived Neurotrophic Factor Expression after Peripheral Inflammation and Nerve Injury
J. Neurosci.,
May 15, 2003;
23(10):
4117 - 4126.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Labrakakis, C.-K. Tong, T. Weissman, C. Torsney, and A. B MacDermott
Localization and function of ATP and GABAA receptors expressed by nociceptors and other postnatal sensory neurons in rat
J. Physiol.,
May 15, 2003;
549(1):
131 - 142.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. B. Morris, P. T. Symanowicz, J. E. Olsen, R. S. Thrall, M. M. Cloutier, and A. K. Hubbard
Immediate sensory nerve-mediated respiratory responses to irritants in healthy and allergic airway-diseased mice
J Appl Physiol,
April 1, 2003;
94(4):
1563 - 1571.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Kerzel, G. Path, W. A. Nockher, D. Quarcoo, U. Raap, D. A. Groneberg, Q. T. Dinh, A. Fischer, A. Braun, and H. Renz
Pan-Neurotrophin Receptor p75 Contributes to Neuronal Hyperreactivity and Airway Inflammation in a Murine Model of Experimental Asthma
Am. J. Respir. Cell Mol. Biol.,
February 1, 2003;
28(2):
170 - 178.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Dirajlal, L. E. Pauers, and C. L. Stucky
Differential Response Properties of IB4-Positive and -Negative Unmyelinated Sensory Neurons to Protons and Capsaicin
J Neurophysiol,
January 1, 2003;
89(1):
513 - 524.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L M Mendell
Does NGF binding to p75 and trkA receptors activate independent signalling pathways to sensitize nociceptors?
J. Physiol.,
October 15, 2002;
544(2):
333 - 333.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. R. Watkins and S. F. Maier
Beyond Neurons: Evidence That Immune and Glial Cells Contribute to Pathological Pain States
Physiol Rev,
October 1, 2002;
82(4):
981 - 1011.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Zwick, B. M. Davis, C. J. Woodbury, J. N. Burkett, H. R. Koerber, J. F. Simpson, and K. M. Albers
Glial Cell Line-Derived Neurotrophic Factor is a Survival Factor for Isolectin B4-Positive, but not Vanilloid Receptor 1-Positive, Neurons in the Mouse
J. Neurosci.,
May 15, 2002;
22(10):
4057 - 4065.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Pare, R. Elde, J. E. Mazurkiewicz, A. M. Smith, and F. L. Rice
The Meissner Corpuscle Revised: A Multiafferented Mechanoreceptor with Nociceptor Immunochemical Properties
J. Neurosci.,
September 15, 2001;
21(18):
7236 - 7246.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Magerl, P. N. Fuchs, R. A. Meyer, and R.-D. Treede
Roles of capsaicin-insensitive nociceptors in cutaneous pain and secondary hyperalgesia
Brain,
September 1, 2001;
124(9):
1754 - 1764.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V Vlachova, A Lyfenko, R. Orkand, and L Vyklicky
The effects of capsaicin and acidity on currents generated by noxious heat in cultured neonatal rat dorsal root ganglion neurones
J. Physiol.,
June 15, 2001;
533(3):
717 - 728.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. J. Kirkup, A. M. Brunsden, and D. Grundy
Receptors and Transmission in the Brain-Gut Axis: Potential for Novel Therapies: I. Receptors on visceral afferents
Am J Physiol Gastrointest Liver Physiol,
May 1, 2001;
280(5):
G787 - G794.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Kiso, Y. Nagakura, T. Toya, N. Matsumoto, S. Tamura, H. Ito, M. Okada, and T. Yamaguchi
Neurometer Measurement of Current Stimulus Threshold in Rats
J. Pharmacol. Exp. Ther.,
April 1, 2001;
297(1):
352 - 356.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
D. L. H. Bennett
Neurotrophic Factors: Important Regulators of Nociceptive Function
Neuroscientist,
February 1, 2001;
7(1):
13 - 17.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J Gunthorpe, M. H Harries, R. K Prinjha, J. B Davis, and A. Randall
Voltage- and time-dependent properties of the recombinant rat vanilloid receptor (rVR1)
J. Physiol.,
June 15, 2000;
525(3):
747 - 759.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. J. Woolf and M. W. Salter
Neuronal Plasticity: Increasing the Gain in Pain
Science,
June 9, 2000;
288(5472):
1765 - 1768.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Nagy and H. P. Rang
Similarities and Differences between the Responses of Rat Sensory Neurons to Noxious Heat and Capsaicin
J. Neurosci.,
December 15, 1999;
19(24):
10647 - 10655.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|