 |
Previous Article | Next Article 
The Journal of Neuroscience, March 15, 1999, 19(6):2037-2050
GABA- and Glutamate-Activated Channels in Green Fluorescent
Protein-Tagged Gonadotropin-Releasing Hormone Neurons in Transgenic
Mice
Daniel J.
Spergel,
Ulrich
Krüth,
Daniel F.
Hanley,
Rolf
Sprengel, and
Peter H.
Seeburg
Department of Molecular Neuroscience, Max-Planck-Institute for
Medical Research, 69120 Heidelberg, Germany
 |
ABSTRACT |
Mice were generated expressing green fluorescent protein (GFP)
under the control of the gonadotropin-releasing hormone (GnRH) promoter. Green fluorescence was observed in, and restricted to, GnRH-immunopositive neuronal somata in the olfactory bulb, ganglion terminale, septal nuclei, diagonal band of Broca (DBB), preoptic area
(POA), and caudal hypothalamus, as well as GnRH neuronal dendrites and
axons, including axon terminals in the median eminence and organum
vasculosum of the lamina terminalis (OVLT). Whole-cell recordings from
GFP-expressing GnRH neurons in the OVLT-POA-DBB region revealed a
firing pattern among GFP-expressing GnRH neurons distinct from that of
nonfluorescent neurons. Nucleated patches of GFP-expressing GnRH
neurons exhibited pronounced responses to fast application of
GABA and smaller responses to L-glutamate and AMPA.
One-fifth of the nucleated patches responded to NMDA. The GABA-A, AMPA,
and NMDA receptor channels on GnRH neurons mediating these responses
may play a role in the modulation of GnRH secretory oscillations.
Key words:
diagonal band of Broca; GABA; GFP; glutamate; GnRH; hypothalamus; median eminence; organum vasculosum of the lamina
terminalis; preoptic area; transgenic mice
 |
INTRODUCTION |
Gonadotropin-releasing hormone
(GnRH) neurons are a small and scattered group of primarily
hypothalamic neurosecretory cells that synthesize the decapeptide GnRH
and play a critical role in mammalian sexual development and
reproduction (for review, see Lopez et al., 1998 ). During late
embryogenesis, GnRH neurons migrate from the olfactory placode to the
hypothalamus (Schwanzel-Fukuda and Pfaff, 1989 ; Wray et al., 1989 ).
From embryonic day 17 onward in rodents, the cell bodies of GnRH
neurons form a loose network extending from the olfactory bulb to the
septal nuclei to the diagonal band of Broca (DBB), preoptic area (POA),
and caudal hypothalamus (Wray and Hoffman, 1986 ; Wu et al., 1997 ).
Beginning with puberty, GnRH neurons projecting to the median eminence
release GnRH at a rate of ~1-2 pulses/hr into the
hypothalamo-hypophyseal portal circulation (Levine and Ramirez, 1982 ).
GnRH subsequently binds to receptors on pituitary gonadotrophs and
stimulates the release of luteinizing hormone and
follicular-stimulating hormone into the general circulation (Lopez et
al., 1998 ).
Despite the importance of GnRH neurons, their physiology and
differentiation, as well as the basic mechanisms underlying their pulsatile release of GnRH, remain to be elucidated. Slow progress in
this field primarily reflects the scarcity of GnRH neurons (~800 per
animal; Wray and Hoffman, 1986 ; Wu et al., 1997 ) and the lack of
morphological criteria by which they can be identified in live brain
slice preparations. Previous attempts to tag GnRH neurons by using the
well characterized GnRH promoter (Mason et al., 1986a ,b ; Whyte et al.,
1995 ) either generated immortalized GnRH cell lines expressing simian
virus 40 (SV40) T-antigen (Mellon et al., 1990 ) or used
luciferase as a reporter (Wolfe et al., 1996 ), which cannot be easily
monitored in slice preparations. We have now used this promoter to
express in transgenic mice a gene encoding a red-shifted variant of
jellyfish green fluorescent protein (GFP) (Chalfie et al., 1994 ; Heim
and Tsien, 1996 ). In these mice, detectable GFP expression was confined
to GnRH neurons. Using combined fluorescence and infrared differential
interference contrast (IR-DIC) video microscopy in a brain slice
preparation of GnRH-GFP mice, we obtained physiological recordings of
action potentials and GABA- and L-glutamate-evoked currents
from identified, postembryonic GnRH neurons.
 |
MATERIALS AND METHODS |
Generation of GnRH-GFP transgenic mice. A 3.47 kb
GnRH promoter fragment, along with 23 bp of exon 1 of the mouse GnRH
gene (Mason et al., 1986a ), was inserted together with the humanized GFP expression unit of pTR-UF2 (Zolotukhin et al., 1996 ), which contained an SV40 splice donor-splice acceptor intron and
polyadenylation signal (Fig.
1A), into pLitmus29
(New England Biolabs, Beverly, MA) to create plasmid pmGnGFP. The 4644 bp GnRH-GFP minigene was released from vector sequences, by
AvrII/NsiI digestion, followed by sucrose
gradient purification, and injected into C57Bl6/DBA mice-derived
pronuclei according to the procedure of Suchanek et al. (1997) .
Founders and subsequent generations of GnRH-GFP mice were selected by
PCR analysis of mouse tail DNA (Brusa et al., 1995 ) with primer GnRH 51 (GAAGTACTCAACCTACCAACGGAAG) and antisense primer hGFP1
(GCCATCCAGTTCCACGAGAATTGG), which amplified a 278 bp DNA fragment in
mice transgenic for the GnRH-GFP minigene.

View larger version (58K):
[in this window]
[in a new window]
|
Figure 1.
GFP reporter gene and GFP-expressing neurons in
live 300 µm brain slices from GnRH-GFP transgenic mice.
A, GFP reporter gene used to generate GnRH-GFP
transgenic mice. Restriction sites for cloning (Av,
AvrII; H3, HindIII; X,
XhoI; N, NotI;
Ba, BamHI; Ns, NsiI) and
regulatory elements of the minigene [SV40 SD/SA, SV40
splice donor/splice acceptor intron (Zolotukhin et al., 1996 );
SV40 polyA, SV40 polyadenylation signal] are indicated.
B, GFP-expressing neurons in the POA of a coronal slice
from a postnatal day 25 (P25) male GnRH-GFP mouse. The dark
band in the middle of this image and in
C is the third ventricle (3V).
C, GFP-expressing axon terminals in the median eminence
from the same mouse as in B. D,
GFP-expressing neurons in the DBB of a sagittal slice from a P21 male
GnRH-GFP mouse. E, GFP-expressing neurons in the
ganglion terminale (GT) of a sagittal slice from
a P45 male GnRH-GFP mouse. This mouse and the one from which the images
in Figure 6A were obtained came from a different
GnRH-GFP founder line than the mice from which the other images
presented here were obtained.
|
|
Tissue preparation. Male and female GnRH-GFP-positive mice,
1-week- to 6-month-old, were anesthetized with halothane (Hoechst, Frankfurt, Germany) and then decapitated. Brains were dissected in
ice-cold gassed (95% O2-5% CO2)
Ringer's solution (Biometra, Göttingen, Germany)
containing 125 mM NaCl, 25 mM
NaHCO3, 1.25 mM
NaH2PO4, 2.5 mM KCl, 2 mM CaCl2, 1 mM
MgCl2, and 25 mM glucose, 316 mOsm, pH.
7.4, and cut coronally or sagittally into 300 µm slices with a
vibratome (Vibroslice Tissue Slicer 752 M; Campden Instruments, Loughborough, UK), similar to that described by Sakmann and Stuart (1995) . Slices were transferred using the back end of a
Pasteur pipette to an incubation chamber with Ringer's solution (equilibrated with 95% O2-5% CO2) for
30 min at 33°C and then were stored at room temperature (20-22°C)
in the same chamber until staining or imaging and recording.
GnRH immunostaining. Slices were immunostained for GnRH
using a modification of a procedure described by Ebling et al. (1995) . Briefly, each slice was transferred to an individual well in a 24-well
plate, fixed for 1 hr in 4% paraformaldehyde (PFA)-PBS, washed
twice with PBS, and incubated for 1 hr in 2% (v/v) normal goat serum
(Vector Laboratories, Burlingame, CA) in PBS supplemented with 1%
(w/v) bovine serum albumin (BSA) and 0.3% (v/v) Triton X-100 (referred
to here as day 1 buffer). Slices were then placed overnight in
day 1 buffer containing the polyclonal antiserum LR1, which recognizes
amino acids 6-10 of GnRH in pro-GnRH and GnRH (Silverman et al.,
1990 ), at 1:10,000. The following day, slices were washed twice with
PBS supplemented with 0.3% BSA and 0.1% Triton X-100 (referred to
here as day 2 buffer), incubated for 1 hr in
7-amino-4-methylcoumarin-3-acetic acid-conjugated goat
anti-rabbit IgG (Jackson ImmunoResearch, West Grove, PA) at
1:100 in day 2 buffer, washed twice with day 2 buffer, three times in
PBS followed by H2O, and then mounted on
poly-L-lysine-coated glass slides using an aqueous medium
(Mowiol 4.88; Polysciences, Warrington, PA). Immunostained slices were
viewed using an upright fluorescence microscope (Axioskop; Zeiss,
Göttingen, Germany) outfitted with Zeiss filter set 02, consisting of excitation filter G365, dichroic mirror FT395, and
emission filter LP420.
Fluorescence and infrared imaging. For imaging and
recording, slices were transferred to a 3 ml Plexiglas recording
chamber, fixed in place with a grid, and superfused at a rate of 20 ml/hr with Ringer's solution at room temperature. Slices were viewed with a fluorescence microscope (Axioskop) equipped with
Dodt-Gradient-Contrast (Luigs & Neumann, Ratingen, Germany), first in
bright field with a 5× objective (Plan-Neofluar; Zeiss) and then with
a 20× objective (LD Achroplan; Zeiss).
To visualize GFP, the white light from the bright-field lamp was
blocked by a 780/50 nm bandpass filter (Luigs & Neumann), which was
also used for infrared imaging (see below), and a fluorescent lamp (HBO
100W; Osram, Berlin, Germany) was switched on. The intensity of the
fluorescent lamp was regulated by an AttoArc power supply (Zeiss). GFP
filter set 41017, consisting of excitation filter HQ470/40, dichroic
mirror Q495LP, and emission filter HQ525/50 (Chroma Technology,
Brattleboro, VT), was used. After observing a fluorescent neuron with
the 20× objective, a 60× water-immersion objective (LUMPlanFl;
Olympus, Hamburg, Germany) was used for further imaging and to view
cells for patch-clamp recording. Fluorescence images (16 bit) were
acquired with a back-illuminated, cooled, slow-scan charge-coupled
device (CCD) camera (TEA/CCD-800-PB/VISAR/1; Princeton Instruments,
Trenton, NJ) controlled from an IBM-compatible personal computer (PC)
with MetaMorph 3.0 software (Universal Imaging, West Chester, PA),
displayed on a color monitor, converted to 8 bit with NIH Image 1.61, and processed further with Adobe Photoshop 4.0 software (Adobe Systems,
San Jose, CA) on a Power Macintosh computer.
IR-DIC imaging (Dodt and Ziegelgänsberger, 1990 ; Sakmann and
Stuart, 1995 ) was performed subsequent to fluorescence observation or
imaging to visualize neurons for electrophysiological experiments. After viewing a fluorescent neuron, the magnification was increased by
1.6× using an intermediate phototube (Zeiss) and the light directed to
an infrared camera (C2400-07; Hamamatsu Photonics, Herrsching,
Germany) mounted on the same binocular phototube (Zeiss) as the CCD
camera. The IR-DIC image was displayed on a black and white monitor
(Panasonic WV-BM1400/G), transferred to the hard disk of a PC using an
image frame grabber controlled by MetaMorph, stored as an 8-bit image,
and processed further with Adobe Photoshop. A neuron viewed with
infrared optics was considered to be the same as that viewed with
fluorescence optics when the infrared image and the fluorescent image
of the neuron had the same position and orientation with the two
imaging systems or, alternatively, through the eyepiece of the
microscope (fluorescent image) and with the infrared imaging system
(infrared image).
Whole-cell patch clamp recording. Whole-cell, as well as
nucleated patch (see below), recordings were made from neurons
in the organum vasculosum of the lamina terminalis
(OVLT)-POA-DBB region in coronal and sagittal slices.
Whole-cell recordings were performed as described previously (Sakmann
and Stuart, 1995 ). Recording pipettes made from thick-walled
borosilicate glass (outer diameter of 2 mm, wall thickness of 0.5 mm;
Hilgenberg, Malsfeld, Germany) were pulled using a Flaming/Brown
micropipette puller (P-97; Sutter Instrument Co., Novato, CA) filled
with an intracellular solution, consisting of 140 mM KCl, 2 mM Mg-ATP, 10 mM EGTA, and 10 mM
HEPES, pH adjusted to 7.30 with KOH, 286 mOsm. Pipettes used for
whole-cell recording had resistances of 2.5-3.5 M when filled with
this solution. Pipettes were connected via an Ag-AgCl wire to the
headstage of an EPC-9 patch clamp amplifier (HEKA, Lambrecht, Germany).
The reference electrode was an Ag-AgCl pellet (IVM, Healdsburg, CA)
immersed in bath solution. The EPC-9 amplifier and Pulse 8.09 software
(HEKA) were used to acquire (5 or 100 kHz in current clamp, for long
duration or high temporal resolution, respectively, and 10 kHz in
voltage clamp), filter (1.67 or 33.3 kHz in current clamp and 3.33 kHz
in voltage clamp; Bessel), and analyze patch-clamp data, which was
stored on a Power Macintosh computer. The patch-clamp amplifier was
also used to compensate pipette capacitance, cell capacitance, and
series resistance, and to correct for leak and capacitive currents.
Traces were processed for presentation using Igor 3.03 (Wavemetrics,
Lake Oswego, OR) and Canvas 5.0 (Deneba, Miami, FL) software.
Biocytin labeling. Biocytin labeling, followed by GnRH
immunostaining, was performed to confirm the identity of cells from which recordings were obtained. Biocytin (8 mM final
concentration) was added to the pipette solution used for whole-cell
recording, after which the solution was filtered and sonicated. After
establishing the whole-cell configuration, biocytin diffused into the
cell for the duration of the recording (30-45 min). The pipette was then slowly withdrawn from the cell so that an outside-out patch was
formed and the cell remained intact. The slice was put into a second
slice incubation chamber for 1 hr to allow complete diffusion of
biocytin throughout the cell. Subsequently, the slice was placed in 4%
PFA-PBS, immunostained for GnRH as described above, incubated in 0.5%
(v/v) Texas Red-conjugated avidin (Jackson ImmunoResearch) in PBS,
mounted as described above, and then viewed under the fluorescence
microscope (Axioskop) using filter set XF33 (Omega Optical,
Brattleboro, VT), consisting of excitation filter 535DF35, dichroic
mirror 570DRLPO2, and emission filter 605DF50.
Nucleated patch recording. Nucleated outside-out patches
were formed by establishing the whole-cell recording configuration, applying suction through the patch pipette, and then slowly withdrawing the pipette from the cell as described by Sather et al. (1992) . In our
initial experiments, the intracellular solution was the same as that
used for whole-cell recording, except that KCl was replaced by CsCl. In
subsequent experiments, we used the same intracellular solution as for
whole-cell recording because we found it easier to obtain nucleated
patches with this solution. However, at depolarized holding potentials,
this potassium-based intracellular solution resulted in outward
potassium currents before and during the agonist-evoked outward
current. Pipettes used for nucleated patch recording had resistances of
5-8 M when filled with this solution. Data from nucleated patches
were acquired at 10 kHz and filtered at 3.33 kHz (Bessel).
Fast application of agonists and antagonists. Agonists and
antagonists were applied to nucleated patches via a double-barrelled pipette made from theta glass tubing (outer diameter of 2 mm, inner
diameter of 1.4 mm, septum thickness of 0.22 mm; Hilgenberg), pulled using an L/M-3P-A pipette puller with insert 12, 11, and 5 (List
Electronic, Darmstadt, Germany), and rapidly moved from side to side by
a piezo translator controlled by a high-voltage amplifier (P-275.10;
Physik Instrumente, Waldbronn, Germany) as described by Jonas (1995) .
One barrel of the application pipette was perfused with nominally
Mg2+-free control solution, consisting of 152 mM NaCl, 5.8 mM KCl, 1.9 mM
CaCl2, 5.4 mM HEPES, and 10 µM glycine, pH adjusted to 7.25 with NaOH, 290 mOsm, with
or without antagonists, and the other barrel with control solution
containing agonists with or without antagonists. Perfusion was
performed using a peristaltic pump (IPC-N8; Ismatec, Zurich,
Switzerland). Complete solution exchange was achieved in 5 msec, as
determined by the open-tip response for the application pipette (Jonas,
1995 ).
Statistics. Data are expressed as mean ± SEM except as
indicated. Statistical comparisons were performed using the
Kruskal-Wallis test followed by the Mann-Whitney U test
(Winer, 1971 ). A difference between groups was considered to be
significant if the probability value (p) obtained
from the Mann-Whitney U test was <0.05.
Reagents. The glutamate receptor agonist AMPA, the
AMPA-kainate receptor antagonist
6-nitro-7-sulfamoylbenzo[f]quinoxaline-2,3-dione (NBQX), and the NMDA
receptor antagonist D(-)-2-amino-5-phosphonopentanoic acid
(D-AP-5) were purchased from Tocris (Bristol, UK). Unless indicated otherwise, all other reagents were obtained from
Sigma-Aldrich (Deisenhofen, Germany).
 |
RESULTS |
GFP-expressing GnRH neurons in GnRH-GFP mice
Three independent GnRH-GFP founder lines were obtained by
pronucleus injection of the GnRH-GFP reporter gene. Analysis of live
coronal and sagittal brain slices from all three lines revealed a small
number, 1-150 per 300 µm-thick slice, of green fluorescent cells (a
number that remained constant during the course of an experiment, which
typically lasted 6-12 hr), whereas wild-type litter mates showed no
green fluorescent cells. Green fluorescent cells were confined to areas
in which GnRH neurons are known to be distributed (Fig.
1B-E). These areas include the olfactory bulb,
ganglion terminale, medial and lateral septal nuclei, DBB and POA,
which contained the largest number of green fluorescent cells, and the
following caudal hypothalamic regions: retrochiasmatic area, supraoptic
nucleus retrochiasmatic, lateral hypothalamic area, and arcuate
nucleus. GFP fluorescence was also detected in axons and dendrites in
these areas, as well as in axon terminals in the OVLT and median
eminence. Green fluorescent cells were bright and could be seen easily
through the microscope; however, a CCD camera-based imaging system (see
Materials and Methods) was also used to record images of green
fluorescent cells for subsequent analysis.
To test whether all green fluorescent cells contained GnRH and vice
versa, GFP fluorescence was recorded from slices before and after
fixation. Subsequently, the slices were immunostained for GnRH, and the
images were compared with those of green fluorescence (Fig.
2). All green fluorescent neurons
(n = 556) in the 14 slices from the four GnRH-GFP mice
that were analyzed contained GnRH. We observed green fluorescence in
only 65% of all GnRH neurons, perhaps because the fluorescence in the
remaining GnRH neurons was below detection.

View larger version (80K):
[in this window]
[in a new window]
|
Figure 2.
Comparison of GFP and GnRH expression in GnRH-GFP
transgenic mice. A, GFP-expressing neurons, numbered
1-11, near the DBB-POA border at the level of the OVLT
from the same mouse as in Figure 1A but 300 µm
more rostral. The optic chiasm is missing because it detached from the
rest of the tissue during slicing. B, Same slice as in
A after fixation, which produced additional
fluorescence, and after mounting, which flattened the tissue and
thereby changed the relative positions of the neurons. Scales in
B-D are the same as in A.
C, Same slice as in B after
immunostaining for GnRH. GnRH-immunopositive neurons are
numbered 1-19. The gray levels in this panel and in
Figure 3D have been inverted to aid the reader in
visualizing the GnRH immunostained neurons, which appear as
dark spots. Note that all fluorescent neurons in
B are GnRH-immunopositive in C and that
the number of GnRH-immunopositive neurons is larger than the number of
fluorescent neurons. D, Same slice as in
A after biocytin labeling of neuron
1.
|
|
Action potentials, passive electrical properties, and voltage-gated
currents of GnRH neurons
GFP-expressing GnRH neurons in the OVLT-POA-DBB region,
identified by fluorescence microscopy, were subsequently visualized for
whole-cell patch-clamp recording by IR-DIC imaging. Cells on the IR
video monitor screen, whose coordinates and orientation matched those
of fluorescent cells seen in the microscope, were recorded from. To
further confirm that the fluorescent cells recorded from were GnRH
neurons, the cells were filled with biocytin, fixed, and then
immunostained for GnRH (Figs. 2, 3). As
expected, all biocytin-filled fluorescent neurons (n = 8) contained GnRH. In current-clamp mode, GFP-expressing GnRH neurons
were quiescent or displayed spontaneous low-frequency (up to 4 Hz)
action potentials. Action potentials of a similar distinctive shape,
marked by a long afterhyperpolarization (Fig.
4), were observed in all GnRH neurons
analyzed (n = 26) in the three independent lines of
GnRH-GFP mice, regardless of the age or sex of the mouse. In contrast, six other shapes of action potential differing in the degree and time
course of afterhyperpolarization (Fig. 4) were observed among neighboring nonfluorescent neurons (n = 26).

View larger version (97K):
[in this window]
[in a new window]
|
Figure 3.
Post hoc identification of
GFP-expressing neurons used in physiological recordings.
A, High-magnification fluorescence image of
GFP-expressing neurons 1 and 2 in Figure
2A. B, IR-DIC image of
neurons 1, 2, and 12 in
Figure 2C. Scales in B-D are the same as
in A. C, High-magnification fluorescence
image of neuron 1 after biocytin labeling.
D, High-magnification fluorescence image of
neurons 1, 2, and 12 after
GnRH immunostaining. Neurons 1 and 2
fluoresce and contain GnRH, whereas neuron 12 contains
GnRH but does not fluoresce.
|
|

View larger version (30K):
[in this window]
[in a new window]
|
Figure 4.
Comparison of spontaneous action potentials in
GFP-expressing GnRH neurons with those in neighboring nonfluorescent,
non-GnRH hypothalamic neurons. A, Fluorescence
(left) and IR-DIC (right) images of a
GFP-expressing GnRH neuron (1) and a neighboring
nonfluorescent neuron (2) during a whole-cell
patch-clamp recording of action potentials in the GnRH neuron. The
neurons were in the DBB of a sagittal brain slice from a P21 female
GnRH-GFP mouse. B, Spontaneous action potentials with
long afterhyperpolarizations in GFP-expressing GnRH neurons in the POA
of a P44 male GnRH-GFP mouse (left) and in the DBB of a
P19 male GnRH-GFP mouse (right). Calibrations in this
panel and in C are the same. C, Six
shapes of spontaneous action potential in nonfluorescent neurons
neighboring GFP-expressing GnRH neurons. Top left,
Action potentials in a nonfluorescent neuron neighboring the GnRH
neuron whose action potential is shown in the left trace
of B. These action potentials are characterized by a
brief afterhyperpolarization, followed by a slow return to the resting
potential. Action potentials of this shape were observed in 15 of 26, or 58% of, nonfluorescent neurons. Each of the other action potential
shapes shown below was seen in 15% of nonfluorescent
neurons. Top right, Action potentials in a
nonfluorescent neuron neighboring the GnRH neuron whose action
potentials are shown in the right trace of
B. In this case, the brief afterhyperpolarization was
followed by a fast return to the resting membrane potential.
Middle left, Action potentials with a biphasic
afterhyperpolarization in a nonfluorescent neuron in the DBB of a
6-month-old female GnRH-GFP mouse. Middle right, Action
potentials with little or no afterhyperpolarization in a nonfluorescent
neuron in the POA of a P23 female GnRH-GFP mouse. Bottom
left, Action potential with an afterhyperpolarization, followed
by an afterdepolarization, in a nonfluorescent neuron in the POA of a
P42 male GnRH-GFP mouse. Bottom right, Large action
potential, followed by a small action potential and afterdepolarization
but no afterhyperpolarization, in a nonfluorescent neuron in the DBB of
a P15 male GnRH-GFP mouse.
|
|
To illustrate the differences in action potential shape, a comparison
between GnRH neurons (Fig. 4B) and one type of
neighboring nonfluorescent neuron (Fig. 4C, top left
trace) shows that in GnRH neurons the return to resting membrane
potential during the action potential afterhyperpolarization is curved,
whereas in the neighboring nonfluorescent neuron, it is linear. Neurons
that displayed action potentials like those in Figure 4C
(top left trace) comprised 58% of the recorded
nonfluorescent neurons. Because only a small percentage of the neurons
in the OVLT-POA-DBB region are GnRH-immunopositive and only one-third
of these are nonfluorescent, it made little sense to fill the 58% of
nonfluorescent neurons with biocytin and stain for GnRH. The
differences in shape between the action potential
afterhyperpolarizations of GnRH neurons (Fig. 4B) and
those of the other nonfluorescent neurons recorded from (Fig.
4C, all traces, except top left) were
even more marked.
The passive electrical properties and evoked action potentials of
GFP-expressing GnRH neurons were also recorded (Fig.
5A-C) and compared (Table
1) with those of non-GFP-expressing GnRH neurons, as well as with those of adult GnRH neurons identified post hoc (i.e., identified after recording) (Lagrange et
al., 1995 ), with embryonic GnRH neurons in explant culture (Kusano et
al., 1995 ), and with immortalized GnRH neurons in culture (Bosma, 1993 ;
Hales et al., 1994 ). The maximal firing rate of the GFP-expressing GnRH
neurons tended to be regular (i.e., the ratio of the maximal-to-minimal interspike interval was low), whereas that of non-GFP-expressing neurons was regular or irregular depending on the neuron. However, except for the differences in action potential shape noted above (and
in Fig. 4), there were no significant differences
(p > 0.05) between GFP-expressing GnRH neurons
(n = 26) and non-GFP-expressing hypothalamic neurons
(n = 26) in passive electrical properties or action
potential characteristics. These included resting membrane potential,
input resistance, membrane time constant, membrane capacitance,
spontaneous and evoked spike frequencies, spike threshold, amplitude,
duration at half-amplitude, rate of rise or fall,
afterhyperpolarization potential, maximum and minimum interspike
intervals, and the ratio of maximum-to-minimum interspike interval
(Table 1). There were also no differences between the passive
electrical properties of GFP-expressing GnRH neurons and those of adult
GnRH neurons identified post hoc, for which the action
potential characteristics have not been reported. Compared with
embryonic (Kusano et al., 1995 ) and immortalized (Bosma, 1993 ; Hales et
al., 1994 ) GnRH neurons, postembryonic GFP-expressing GnRH neurons in
acute brain slices showed no differences, except for a higher membrane
capacitance, perhaps reflecting their more extensive dendritic and
axonal processes.

View larger version (25K):
[in this window]
[in a new window]
|
Figure 5.
Responses of a GnRH neuron to hyperpolarizing and
depolarizing current and voltage pulses. A, Passive and
active responses to 1 sec current pulses of 50, 40, 30, 20,
10, 0, 10, and 20 pA of a GFP-expressing GnRH neuron in the DBB of
the 6-month-old female GnRH-GFP mouse from which the recording in
Figure 4H was obtained. B, Maximum
firing evoked by a 1 sec depolarizing current pulse of 40 pA in the
GnRH neuron whose responses are shown in A.
C, High-resolution recording of an action potential
evoked by a 20 msec depolarizing current pulse of 40 pA in the same
GnRH neuron. Resting, threshold, peak, half-amplitude, and
afterhyperpolarization potentials are indicated. D,
Voltage-gated currents in the same GnRH neuron in response to 10 msec
voltage pulses from a Vh of 60 mV
to test potentials of 140, 120, 100, 80, 60, 40, 20, 0, 20, 40, 60, and 80 mV.
|
|
In voltage-clamp mode under imperfect space-clamp conditions,
GFP-expressing GnRH neurons displayed little or no current in response
to hyperpolarizing voltage pulses but exhibited inward sodium current,
as well as transient and sustained outward potassium current in
response to 10 (Fig. 5D) and 300 msec (data not shown) depolarizing voltage steps (n = 39). These currents
were similar to those in embryonic (Kusano et al., 1995 ) and
immortalized (Bosma, 1993 ; Hales et al., 1994 ) GnRH neurons and may
contribute to the shape of the action potentials in GnRH neurons.
GABA- and glutamate-activated channels of GnRH neurons
To determine whether GnRH neurons express functional receptors for
the neurotransmitters GABA and L-glutamate, and which
receptor subtypes, these transmitters were applied for 50 msec periods at various holding potentials (Vh)
to nucleated patches of GFP-expressing GnRH neurons of male and female
mice ranging in age from 1 week to 6 months. All patches responded to
GABA and glutamate, and neither the GABA nor the glutamate response
depended on the age or sex of the mouse. The patches, which were
fluorescent (Fig. 6A),
responded to 1 mM GABA in a voltage-dependent manner with a
fast current spike to a peak level, followed by a slow decline to a
plateau within the 50 msec of application, indicating slow receptor
desensitization (Fig. 6B). At
Vh of 100 mV, for example, the peak current
(Ipeak) was 374 ± 36 pA, and this
was followed by a decline to a plateau within the 50 msec of GABA
application of 179 ± 21 pA (n = 25). With
similar chloride concentrations in the patch pipette and bath
solutions, the current-voltage relationship for the peak response was
nearly linear, with a reversal potential close to 0 mV (Fig.
6C). The peak responses to GABA at Vh
of 100 mV were inhibited by 89 ± 2 (n = 5)
(Fig. 6D, bottom traces) and 100%
(n = 3) (Fig. 6D, top
traces) in the presence of 50 and 100 µM GABA-A
antagonist (-)-bicuculline methobromide, respectively, indicating that
the current was mediated entirely by GABA-A receptors.

View larger version (46K):
[in this window]
[in a new window]
|
Figure 6.
GABA-activated currents in GnRH neurons.
A, Fluorescence (left) and IR-DIC
(right) images of a nucleated patch of a GFP-expressing
GnRH neuron from the DBB of a P47 male GnRH-GFP mouse.
B, GABA-evoked currents in a nucleated patch of a
GFP-expressing GnRH neuron in the POA of a 6-month-old female GnRH-GFP
mouse. GABA (1 mM) was applied every 5 sec for 50 msec at
Vh values of 100, 80, 60, 40, 20,
0, 20, 40, 60, and 80 mV. In this and subsequent traces,
patches were initially held at 60 mV and then stepped to a new
Vh before agonist and/or antagonist
application. Stepping to depolarized test potentials resulted in the
outward voltage-gated currents seen before the agonist and/or
antagonist response. The voltage-gated currents usually decayed to a
steady state by the time of agonist and/or antagonist application.
Capacitive currents at the beginning and end of the test pulse are also
shown. Scales for these traces and the bottom
traces of D are the same. C,
Current-voltage relationship of the peak responses in
B. D, Partial inhibition by bicuculline
(Bic) of the response to 1 mM GABA
(bottom traces) and full inhibition by bicuculline of
the response to 10 µM GABA (top traces) at
Vh of 100 mV. The patch whose responses
are displayed in the bottom traces was from a GnRH
neuron in the DBB of a 2-month-old female GnRH-GFP mouse. The patch
whose responses are shown in the top traces was from a
GnRH neuron in the DBB of a P17 female GnRH-GFP mouse. Capacitive
current traces have been blanked.
|
|
The same nucleated patches of GFP-expressing GnRH neurons that
exhibited large responses to 1 mM GABA displayed small
responses to 1 mM L-glutamate
(Ipeak of 28 ± 3 pA; n = 25) in the presence of 10 µM glycine and the nominal
absence of Mg2+ (Fig.
7A). Also, in contrast to the
GABA responses, the peak current elicited by glutamate was followed by
a decline to baseline or to a level near the baseline, indicating
complete receptor desensitization within the first 30 msec of the 50 msec application. As with the GABA responses, the current-voltage
relationship for the peak current responses to glutamate was linear,
with a reversal potential near 0 mV (Fig. 7A). The fast,
desensitizing glutamate-evoked responses were concentration-dependent,
with an EC50 in the 100 µM to 1 mM range (Fig. 7B).

View larger version (39K):
[in this window]
[in a new window]
|
Figure 7.
Glutamate-activated currents in GnRH neurons.
A, Current responses and current-voltage relationship
of the peak responses to 1 mM glutamate
(Glu). Arrow points to the responses. The
patch is the same as that whose responses to 1 mM GABA are
shown in Figure 6B. B, Responses
to increasing concentrations of glutamate at
Vh of 100 mV. Note the difference in scale
compared with that in A. The patch was from a GnRH
neuron in the DBB of the same mouse whose responses are shown in
A. Scale is the same in this panel and in
C and D. C, Inhibition of
the fast desensitizing component of the glutamate response by NBQX
(top traces) and responses to AMPA (middle
trace) and kainate (KA; bottom
trace), all at Vh of 100 mV. The
NBQX-sensitive glutamate responses were from a GnRH neuron in the DBB
of a P17 female GnRH-GFP mouse. The AMPA and kainate responses were
from a GnRH neuron in the DBB of a 6-month-old female GnRH-GFP mouse.
D, Nondesensitizing single-channel responses to
glutamate in the absence (top left) and presence
(top right) of a cocktail of NBQX and AP-5 at
Vh values of 60, 80, and 100 mV;
current-voltage relationship of the single-channel responses
(bottom left); and a response to NMDA at
Vh of 100 mV (bottom
right). The slope of the current-voltage relationship of the
single-channel events (bottom left), which is equivalent
to the single-channel conductance ( ), was estimated to be ~70 pS.
The single-channel responses to glutamate (top left and
right) were from a GnRH neuron neighboring the GnRH
neuron whose NBQX-sensitive responses are shown in C.
Response to NMDA and inhibition by AP-5 (bottom right
traces) in a patch from a GnRH neuron in the DBB of a
2-month-old male GnRH-GFP mouse.
|
|
The fast desensitizing response to glutamate (1 mM) was
inhibited (n = 4) by the AMPA-kainate antagonist NBQX
(5 µM) (Fig. 7C, top traces) and
was mimicked (n = 4) by AMPA (100 µM)
(Fig. 7C, middle trace). Kainate (100 µM) evoked (n = 4) a nondesensitizing response (Fig. 7C, bottom trace), indicating
activation of AMPA receptors as in other neurons (Patneau and Mayer,
1991 ). In 5 of 28 patches, the response to glutamate also included a
nondesensitizing, slowly deactivating component (Fig. 7D,
top left traces), with clearly discernible single-channel
events between 100 and 60 mV. These properties and the large
single-channel conductance (~70 pS) (Fig. 7D, bottom
left) suggest the signature of NMDA receptors. Indeed, NMDA (1 mM) evoked single-channel events (Fig. 7D,
bottom right trace) in two of four patches sensitive to
glutamate. AP-5 at a concentration of 50 µM did not
inhibit (Fig. 7D, top right traces), whereas AP-5 at 500 µM did inhibit (Fig. 7D, bottom right
traces) the channel. Hence, the NMDA channel activity might be
mediated by NR1/NR2D receptors, which have low affinity for AP-5
(Buller and Monaghan, 1997 ).
For comparison, we recorded GABA and glutamate responses from nucleated
patches of neighboring nonfluorescent neurons. These patches also
exhibited larger responses to GABA (Fig.
8A) than to glutamate
(Fig. 8B). At Vh of 100 mV, for
example, the peak GABA and glutamate responses in nonfluorescent
neurons were 1569 ± 402 and 270 ± 51 pA, respectively
(n = 8). Both responses were larger
(p < 0.05) than those in GnRH neurons and
desensitized only partially. Similar to the GnRH neurons, the
current-voltage relationships for the GABA and glutamate responses in
nonfluorescent neurons were linear, with reversal potentials near 0 mV
(Fig. 8C). The GABA response was bicuculline-sensitive (Fig.
8D). The glutamate (1 mM) response was
blocked completely by a cocktail of NBQX (5 µM) and AP-5
(50 µM) (Fig. 8E). The desensitizing
component of the glutamate response was blocked by NBQX (5 µM) alone (Fig. 8F, top
traces), and the nondesensitizing component was blocked by AP-5
(50 µM) alone (Fig. 8F, bottom
traces).

View larger version (26K):
[in this window]
[in a new window]
|
Figure 8.
GABA- and glutamate-activated channels in
nucleated patches of nonfluorescent, non-GnRH hypothalamic neurons.
A, GABA (1 mM)evoked currents in a
nucleated patch from a nonfluorescent hypothalamic neuron neighboring
the GFP-expressing neuron from which the nucleated patch responses in
Figure 6A were obtained. Scales are the same in
A and B. B, Responses to 1 mM glutamate of the neuron whose GABA responses are shown
in A. C, Current-voltage relationships
for the peak responses to GABA and glutamate in A and
B. D, Partial inhibition by 50 µM bicuculline of the response to 1 mM GABA
(bottom traces) and complete inhibition by 100 µM bicuculline of the response to 10 µM
GABA (top traces) at Vh of
100 mV. The patches were from neurons neighboring the GFP-expressing
GnRH neurons whose bicuculline-sensitive GABA responses are shown in
Figure 6D. E, Complete inhibition
by a cocktail of NBQX and AP-5 of the glutamate response at
Vh of 100 mV. The patch was from the same
neuron whose responses are illustrated in the bottom
traces of D. F, Inhibition by
NBQX of the fast desensitizing component (top traces)
and by AP-5 of the nondesensitizing component (bottom
traces) of the glutamate response. The patch was from a
nonfluorescent neuron in the POA of the same mouse from which the
responses of a GnRH neuron (Fig. 7C, top
traces) were obtained.
|
|
 |
DISCUSSION |
We have generated three transgenic mouse lines in which the GFP
gene is expressed in a reproducible pattern from the mouse GnRH
promoter (Mason et al., 1986a ,b ). In all three lines, GFP fluorescence
in the brain, as detected by microscope or CCD camera-based imaging, is
limited to GnRH neuronal somata in the olfactory bulb, ganglion
terminale, medial and lateral septal nuclei, DBB, POA, retrochiasmatic
area, supraoptic nucleus retrochiasmatic, lateral hypothalamic area,
and arcuate nucleus, as well as in their processes in these areas and
in the OVLT and median eminence. The number and spatial distribution of
GFP-expressing GnRH neurons matches that of GnRH neuronal populations
described previously (Wray and Hoffman, 1986 ; Wu et al., 1997 ), whose
pulsatile secretion of GnRH is critical for mammalian reproduction. We
cannot exclude that more sensitive fluorescence detection might reveal
GFP expression in additional cells in the brain, either reflecting
ectopic transgene expression or tracing weak GnRH gene activity in
the absence of documented GnRH immunoreactivity. It remains to be seen
whether in GnRH-GFP mice GFP is also expressed in other tissues in
which GnRH has been found, such as pituitary, testis, prostate, ovary, placenta, mammary gland, and lymphoid organs (Dong et al., 1993 ; Jacobson et al., 1998 ).
Combined fluorescence and IR-DIC imaging in brain slices of GnRH-GFP
mice permitted recordings from identified live GnRH neurons. Our
measurements revealed that these neurons are quiescent or spike at low
frequencies. The shape of the spontaneous action potentials in
GFP-expressing GnRH neurons, which is similar to that of embryonic GnRH
neurons (Kusano et al., 1995 ), appears to be characteristic of GnRH
neurons. Perhaps each type of hypothalamic neuron exhibits a
distinctive action potential shape attributable to its
expression of voltage and/or calcium-dependent potassium channels,
which shape the amplitude and duration of the action potential
afterhyperpolarization (Hille, 1992 ). Other hypothalamic neurons also
exhibit distinctive action potentials. For example, warm-sensitive neurons in the POA display action potentials very similar in shape to those of the non-GFP/non-GnRH hypothalamic neurons
in Figure 4C (top left panel), and these
are different from those of cold-sensitive neurons (Curras et al.,
1991 ) and GnRH neurons (Fig. 4B). Three types of
action potentials are observed in the paraventricular nucleus of the
hypothalamus, which correspond to magnocellular neurons, parvocellular
neurons, and interneurons (Tasker and Dudek, 1991 ), and which are also
distinct from those of GnRH neurons.
Whereas the shape of the action potential afterhyperpolarization
appears to be characteristic of GnRH neurons, the parameters listed in
Table 1 are not. Various aspects of the spontaneous action potentials
of GFP-expressing GnRH neurons (threshold, amplitude, duration at
half-amplitude, etc.), as well as their passive electrical properties
and evoked electrical activity, were similar to those of
non-GFP-expressing hypothalamic neurons (our observations), to adult
GnRH neurons (Lagrange et al., 1995 ; M. J. Kelly, personal communication), which could only be identified post
hoc, to embryonic GnRH neurons in explant culture (Kusano et al.,
1995 ), and to immortalized GnRH neurons in culture (Hales et al.,
1994 ). However, we have so far not observed oscillatory bursts of
action potentials (Bosma, 1993 ) or action potentials with prolonged
periods of depolarization (Hales et al., 1994 ) as have been reported
for immortalized GnRH neurons.
The voltage-gated currents in GFP-expressing GnRH neurons described
here resembled those in immortalized (Bosma et al., 1993 ; Hales et al.,
1994 ; Spergel et al., 1996 ) and embryonic (Kusano et al., 1995 ) GnRH
neurons. GnRH neurons displayed sodium current, a transient A-type
and/or calcium-activated outward potassium current, and a delayed
rectifier potassium current as in embryonic (Kusano et al., 1995 ) and
immortalized (Bosma, 1993 ; Spergel et al., 1996 ) GnRH neurons. With the
extracellular and intracellular solutions used, inward L- and T-type
calcium currents, which are present in embryonic (Kusano et al., 1995 )
and immortalized (Bosma, 1993 ; Hales et al., 1994 ) GnRH neurons,
would have been masked by the outward potassium currents.
Similarly, the bicuculline-sensitive GABA-evoked currents in
GFP-expressing GnRH neuronal somata were like those reported for
immortalized (Hales et al., 1994 ) and embryonic (Kusano et al., 1995 )
GnRH neurons and indicate that postembryonic GnRH neurons also express
GABA-A receptors. Indeed, the presence of functional somatic GABA-A
receptors in GnRH neurons is consistent with data showing that
GABAergic neurons synapse on GnRH neurons in the POA (Leranth et al.,
1985a ), that at least a fraction of GnRH neurons express GABA-A
receptor subunits (Jung et al., 1998 ), and that GABA can increase or
decrease GnRH secretion depending on the age of the animal (Feleder et
al., 1996 ). Interestingly, immortalized GnRH neurons have been shown
recently to release GABA, suggesting that GABA may influence GnRH
secretion in a paracrine manner (Ahnert-Hilger et al., 1998 ). These
reports, together with those illustrating the excitatory actions of
GABA in immortalized (Hales et al., 1994 ) and embryonic (Kusano et al.,
1995 ) GnRH neurons, indicate that GABA can influence GnRH secretion by
acting directly on GnRH neurons.
Like GABA, glutamate may play an important role in modulating GnRH
secretion. The actions of exogenous glutamate and its various subtype-specific receptor agonists and antagonists suggested that endogenous glutamate increases GnRH and luteinizing hormone release and
that glutamate participates in the induction of puberty, the preovulatory luteinizing hormone surge, and seasonal breeding (for
review, see Brann, 1995 ). However, it was unclear whether these effects
were mediated by direct actions of glutamate on GnRH neurons or by
indirect actions via connecting neurons. Although membrane potential,
calcium, and GnRH secretory responses to glutamate in immortalized
(Mahachoklertwattana et al., 1994 ; Spergel et al., 1994 ) and embryonic
(Kusano et al., 1995 ) GnRH neurons indicated the presence of glutamate
receptors in these cells, double-label immunocytochemical and in
situ hybridization studies of postembryonic GnRH neurons (Abbud
and Smith, 1995 ; Eyigor and Jennes, 1996 ; Gore et al., 1996 ) suggested
that these neurons express few, if any, glutamate receptors. The
glutamate-evoked currents in GnRH neurons presented here provide strong
evidence that postembryonic GnRH neurons indeed express functional
glutamate receptors.
Our observation of a desensitizing glutamate response, which was
inhibited by NBQX, in all of the GnRH neuronal somata we examined, and
of a nondesensitizing response in only one-fifth, suggests that the
glutamate response in GnRH neuronal somata is mediated primarily by
AMPA receptors and to a lesser extent by NMDA receptors. The AMPA
receptors of GnRH neuronal somata appear to contain the GluR-B subunit,
as indicated by the nonrectifying current-voltage relationship of
their desensitizing glutamate response (Burnashev et al., 1992 ). The
nondesensitizing, slowly deactivating response to glutamate with its
large single-channel conductance might be that of the NR1/NR2D subtype
of NMDA receptor, which deactivates more slowly (Monyer et al., 1994 ;
Wyllie et al., 1998 ), is less sensitive to AP-5 than the other NR1/NR2
subtypes (Buller and Monaghan, 1997 ), and is expressed in the DBB
(Buller et al., 1994 ). The paucity of functional NMDA receptor
expression that we detected among GnRH neuronal somata is consistent
with the finding that only one-fifth of GnRH neurons immunostain for the NMDA receptor subunit NR1 (Gore et al., 1996 ). Nevertheless, the
subunit composition and subcellular (synaptic vs somatic) distribution
of the glutamate receptors in GnRH neurons remain to be determined.
The GnRH-GFP transgenic mice will facilitate studies of the cellular
basis of pulsatile and neurotransmitter-modulated GnRH release. They
can be used to investigate synaptic coupling of GnRH neurons to other
GnRH neurons (Leranth et al., 1985b ) and to non-GnRH neurons, which may
be important for pulse generation and its modulation, as well as the
manner in which GnRH neuronal physiology varies with brain region, age,
sex, reproductive state, and environmental factors.
 |
FOOTNOTES |
Received Oct. 19, 1998; revised Dec. 28, 1998; accepted Dec. 28, 1998.
D.J.S. was supported by an Alexander von Humboldt Foundation Research
Fellowship, Deutsche Forschungsgemeinschaft Grant SFB317 and National
Institutes of Health Individual National Research Service Award
F32-NS10085. D.F.H. was supported by an Alexander von Humboldt
Foundation Research Award. This work was funded in part by grants from
the Volkswagen Foundation and the German Chemical Society to P.H.S. We
are grateful to Dr. N. Muzyczka (University of Florida, Gainsville, FL)
for the GFP-containing plasmid pTR-UF2 and to Dr. R. Benoit
(Montréal General Hospital, Montréal, Quebec, Canada) for
the GnRH antiserum LR1. We thank I. Angermann, Y. Cully, S. Grünewald, M. Hauswirth, A. Herold, R. Pfeffer, and F. Zimmermann
for excellent technical assistance, and Dr. F. J. P. Ebling
(University of Cambridge, Cambridge, UK), L. Johnson, Dr. K. Kaiser,
Dr. G. Köhr, and A. Rozov for helpful discussions.
Correspondence should be addressed to Dr. Daniel J. Spergel, Department
of Molecular Neuroscience, Max-Planck-Institute for Medical Research,
Jahnstrasse 29, 69120 Heidelberg, Germany.
Drs. Spergel and Krüth contributed equally to this work.
Dr. Hanley's present address: Department of Neurology, Johns Hopkins
University School of Medicine, Meyer 8-140, 600 North Wolfe Street,
Baltimore, MD 21287-7840.
 |
REFERENCES |
-
Abbud R,
Smith MS
(1995)
Do GnRH neurons express the gene for the NMDA receptor?
Brain Res
690:117-120[Web of Science][Medline].
-
Ahnert-Hilger G,
John M,
Kistner U,
Wiedenmann B,
Jarry H
(1998)
Immortalized gonadotropin-releasing hormone neurons secrete
-aminobutyric acid evidence for an autocrine regulation.
Eur J Neurosci
10:1145-1152[Web of Science][Medline]. -
Bosma MM
(1993)
Ion channel properties and episodic activity in isolated immortalized gonadotropin-releasing hormone neurons.
J Membr Biol
136:85-96[Web of Science][Medline].
-
Brann DW
(1995)
Glutamate: a major excitatory transmitter in neuroendocrine regulation.
Neuroendocrinology
61:213-225[Web of Science][Medline].
-
Brusa R,
Zimmermann F,
Koh D-S,
Feldmeyer D,
Gass P,
Seeburg PH,
Sprengel R
(1995)
Early-onset epilepsy and postnatal lethality associated with an editing-deficient GluR-B allele in mice.
Science
270:1677-1680[Abstract/Free Full Text].
-
Buller AL,
Monaghan DT
(1997)
Pharmacological heterogeneity of NMDA receptors: characterization of NR1a/NR2D heteromers expressed in Xenopus oocytes.
Eur J Pharmacol
320:87-94[Web of Science][Medline].
-
Buller AL,
Larson HC,
Schneider BE,
Beaton JA,
Morrisett RA,
Monaghan DT
(1994)
The molecular basis of NMDA receptor subtypes: native receptor diversity is predicted by subunit composition.
J Neurosci
14:5471-5484[Abstract].
-
Burnashev N,
Monyer H,
Seeburg PH,
Sakmann B
(1992)
Divalent ion permeability of AMPA receptor channels is dominated by the edited form of a single subunit.
Neuron
8:189-198[Web of Science][Medline].
-
Chalfie M,
Tu Y,
Euskirchen G,
Ward WW,
Prasher DC
(1994)
Green fluorescent protein as a marker for gene expression.
Science
263:802-805[Abstract/Free Full Text].
-
Curras MC,
Kelso SR,
Boulant JA
(1991)
Intracellular analysis of inherent and synaptic activity in hypothalamic thermosensitive neurones in the rat.
J Physiol (Lond)
440:257-271[Abstract/Free Full Text].
-
Dodt H-U,
Ziegelgänsberger W
(1990)
Visualizing unstained neurons in living brain slices by infrared DIC-videomicroscopy.
Brain Res
537:333-336[Web of Science][Medline].
-
Dong KW,
Yu KL,
Roberts JL
(1993)
Identification of a major up-stream transcription start site for the human progonadotropin-releasing hormone gene used in reproductive tissues and cell lines.
Mol Endocrinol
7:1654-1666[Abstract/Free Full Text].
-
Ebling FJP,
Alexander IHM,
Urbanski HF,
Hastings MH
(1995)
Effects of N-methyl-D-aspartate (NMDA) on seasonal cycles of reproduction, body weight and pelage colour in the male Siberian hamster.
J Neuroendocrinol
7:555-566[Web of Science][Medline].
-
Eyigor O,
Jennes L
(1996)
Identification of glutamate receptor subtype mRNAs in gonadotropin-releasing hormone neurons in rat brain.
Endocrine
4:133-139.
-
Feleder C,
Jarry H,
Leonhardt S,
Wuttke W,
Moguilevsky JA
(1996)
The GABAergic control of gonadotropin-releasing hormone secretion in male rats during sexual maturation involves effects on hypothalamic excitatory and inhibitory amino acid systems.
Neuroendocrinology
64:305-312[Web of Science][Medline].
-
Gore AC,
Wu TJ,
Rosenberg JJ,
Roberts JL
(1996)
Gonadotropin-releasing hormone and NMDA receptor gene expression and colocalization change during puberty in female rats.
J Neurosci
16:5281-5289[Abstract/Free Full Text].
-
Hales TG,
Sanderson MJ,
Charles AC
(1994)
GABA has excitatory actions on GnRH-secreting immortalized hypothalamic (GT1-7) neurons.
Neuroendocrinology
59:297-308[Web of Science][Medline].
-
Heim R,
Tsien RY
(1996)
Engineering green fluorescent protein for improved brightness, longer wavelengths, and fluorescence energy transfer.
Curr Biol
6:178-182[Web of Science][Medline].
-
Hille B
(1992)
In: Ionic channels of excitable membranes. Sunderland, MA: Sinauer.
-
Jacobson JD,
Crofford LJ,
Sun L,
Wilder RL
(1998)
Cyclical expression of GnRH and GnRH receptor mRNA in lymphoid organs.
Neuroendocrinology
67:117-125[Web of Science][Medline].
-
Jonas P
(1995)
Fast application of agonists to isolated membrane patches.
In: Single-channel recording (Sakmann B,
Neher E,
eds), pp 231-243. New York: Plenum.
-
Jung H,
Shannon EM,
Fritschy J-M,
Ojeda SR
(1998)
Several GABAA receptor subunits are expressed in LHRH neurons of juvenile female rats.
Brain Res
780:218-229[Web of Science][Medline].
-
Kusano K,
Fueshko S,
Gainer H,
Wray S
(1995)
Electrical and synaptic properties of embryonic luteinizing hormone-releasing hormone neurons in explant cultures.
Proc Natl Acad Sci USA
92:3918-3922[Abstract/Free Full Text].
-
Lagrange AH,
Ronnekleiv OK,
Kelly MJ
(1995)
Estradiol-17
and µ-opioid peptides rapidly hyperpolarize GnRH neurons: a cellular mechanism of negative feedback?
Endocrinology
136:2341-2344[Abstract]. -
Leranth C,
MacLusky NJ,
Sakamoto H,
Shanabrough M,
Naftolin F
(1985a)
Glutamic acid decarboxylase-containing axons synapse on LHRH neurons in the rat medial preoptic area.
Neuroendocrinology
40:535-589.
-
Leranth CS,
Serguram LMG,
Palkovits M,
MacLusky NJ,
Shanabrough M,
Naftolin F
(1985b)
The LHRH containing neuronal network in the preoptic area of the rat: demonstration of LHRH containing nerve terminals in synaptic contact with LHRH neurons.
Brain Res
345:332-336[Medline].
-
Levine JE,
Ramirez VD
(1982)
Luteinizing hormone-releasing hormone release during the rat estrous cycle and after ovariectomy, as estimated with push-pull cannulae.
Endocrinology
111:1439-1448[Abstract/Free Full Text].
-
Lopez FJ,
Merchenthaler IJ,
Moretto M,
Negro-Vilar A
(1998)
Modulating mechanisms of neuroendocrine cell activity
the LHRH pulse generator.
Cell Mol Neurobiol
18:125-146. -
Mahachoklertwattana P,
Sanchez J,
Kaplan SL,
Grumbach MM
(1994)
N-methyl-D-aspartate receptors mediate the release of gonadotropin-releasing hormone (GnRH) by NMDA in a hypothalamic GnRH neuronal cell line (GT1-1).
Endocrinology
134:1023-1030[Abstract/Free Full Text].
-
Mason AJ,
Hayflick JS,
Zoeller T,
Young WS,
Phillips HS,
Nikolics K,
Seeburg PH
(1986a)
A deletion truncating the gonadotropin-releasing hormone gene is responsible for hypogonadism in the hpg mouse.
Science
234:1366-1371[Abstract/Free Full Text].
-
Mason AJ,
Pitts SL,
Nikolics K,
Szonyi E,
Wilcox JN,
Seeburg PH,
Stewart TA
(1986b)
The hypogonadal mouse: reproductive functions restored by gene therapy.
Science
234:1372-1378[Abstract/Free Full Text].
-
Mellon PL,
Windle JJ,
Goldsmith PC,
Padula CA,
Roberts JL,
Weiner RI
(1990)
Immortalization of hypothalamic GnRH neurons by genetically targeted tumorigenesis.
Neuron
5:1-10[Web of Science][Medline].
-
Monyer H,
Burnashev N,
Laurie DJ,
Sakmann B,
Seeburg PH
(1994)
Developmental and regional expression in the rat brain and functional properties of four NMDA receptors.
Neuron
12:529-540[Web of Science][Medline].
-
Patneau DK,
Mayer ML
(1991)
Kinetic analysis of interactions between kainate and AMPA: evidence for activation of a single receptor in mouse hippocampal neurons.
Neuron
6:785-798[Web of Science][Medline].
-
Sakmann B,
Stuart G
(1995)
Patch-pipette recordings from the soma, dendrites, and axon of neurons in brain slices.
In: Single-channel recording (Sakmann B,
Neher E,
eds), pp 199-211. New York: Plenum.
-
Sather W,
Dieudonné S,
MacDonald JF,
Ascher P
(1992)
Activation and desensitization of N-methyl-D-aspartate receptors in nucleated outside-out patches from mouse neurones.
J Physiol (Lond)
450:643-672[Abstract/Free Full Text].
-
Schwanzel-Fukuda M,
Pfaff DW
(1989)
Origin of luteinizing hormone-releasing hormone neurons.
Nature
338:161-164[Medline].
-
Silverman A-J,
Witkin JW,
Millar RP
(1990)
Light and electron microscopic immunocytochemical analysis of antibodies directed against GnRH and its precursor in hypothalamic neurons.
J Histochem Cytochem
38:803-813[Abstract].
-
Spergel DJ,
Krsmanovic LZ,
Stojilkovic SS,
Catt KJ
(1994)
Glutamate modulates [Ca2+]i and gonadotropin-releasing hormone secretion in immortalized hypothalamic GT1-7 neurons.
Neuroendocrinology
59:309-317[Web of Science][Medline].
-
Spergel DJ,
Catt KJ,
Rojas E
(1996)
Immortalized GnRH neurons express large-conductance calcium-activated potassium channels.
Neuroendocrinology
63:101-111[Web of Science][Medline].
-
Suchanek B,
Seeburg PH,
Sprengel R
(1997)
Tissue specific control regions of the N-methyl-D-aspartate receptor subunit NR2C promoter.
Biol Chem
378:929-934[Web of Science][Medline].
-
Tasker JG,
Dudek FE
(1991)
Electrophysiological properties of neurones in the region of the paraventricular nucleus in slices of rat hypothalamus.
J Physiol (Lond)
434:271-293[Abstract/Free Full Text].
-
Whyte DB,
Lawson MA,
Belsham DD,
Eraly SA,
Bond CT,
Adelman JP,
Mellon PL
(1995)
A neuron-specific enhancer targets expression of the gonadotropin-releasing hormone gene to hypothalamic neurosecretory neurons.
Mol Endocrinol
9:467-477[Abstract/Free Full Text].
-
Winer BJ
(1971)
In: Statistical principles in experimental design. New York: McGraw-Hill.
-
Wolfe AM,
Wray S,
Westphal H,
Radovick S
(1996)
Cell-specific expression of the human gonadotropin-releasing hormone gene in transgenic animals.
J Biol Chem
271:20018-20023[Abstract/Free Full Text].
-
Wray S,
Hoffman G
(1986)
A developmental study of the quantitative distribution of LHRH neurons within the central nervous system of postnatal male and female rats.
J Comp Neurol
252:522-531[Web of Science][Medline].
-
Wray S,
Grant P,
Gainer H
(1989)
Evidence that cells expressing luteinizing-releasing hormone mRNA are derived from progenitor cells in the olfactory placode.
Proc Natl Acad Sci USA
86:8132-8136[Abstract/Free Full Text].
-
Wu TJ,
Gibson MJ,
Rogers MC,
Silverman AJ
(1997)
New observations on the development of the gonadotropin-releasing hormone system in the mouse.
J Neurobiol
33:938-998.
-
Wyllie DJA,
Béhé P,
Colquhoun D
(1998)
Single-channel activations and concentration jumps: comparison of recombinant NR1a/NR2A and NR1a/NR2D NMDA receptors.
J Physiol (Lond)
510:1-18[Abstract/Free Full Text].
-
Zolotukhin S,
Potter M,
Hauswirth WW,
Guy J,
Muzyczka N
(1996)
A "humanized" green fluorescent protein cDNA adapted for high-level expression in mammalian cells.
J Virol
70:4646-4654[Abstract].
Copyright © 1999 Society for Neuroscience 0270-6474/99/1962037-14$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
R. E. Campbell, G. Gaidamaka, S.-K. Han, and A. E. Herbison
Dendro-dendritic bundling and shared synapses between gonadotropin-releasing hormone neurons
PNAS,
June 30, 2009;
106(26):
10835 - 10840.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Ducret, G. M. Anderson, and A. E. Herbison
RFamide-Related Peptide-3, a Mammalian Gonadotropin-Inhibitory Hormone Ortholog, Regulates Gonadotropin-Releasing Hormone Neuron Firing in the Mouse
Endocrinology,
June 1, 2009;
150(6):
2799 - 2804.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. H. Quennell, A. C. Mulligan, A. Tups, X. Liu, S. J. Phipps, C. J. Kemp, A. E. Herbison, D. R. Grattan, and G. M. Anderson
Leptin Indirectly Regulates Gonadotropin-Releasing Hormone Neuronal Function
Endocrinology,
June 1, 2009;
150(6):
2805 - 2812.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. A. Christian, J. Pielecka-Fortuna, and S. M. Moenter
Estradiol Suppresses Glutamatergic Transmission to Gonadotropin-Releasing Hormone Neurons in a Model of Negative Feedback in Mice
Biol Reprod,
June 1, 2009;
80(6):
1128 - 1135.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Zhang, M. A. Bosch, O. K. Ronnekleiv, and M. J. Kelly
{gamma}-Aminobutyric Acid B Receptor Mediated Inhibition of Gonadotropin-Releasing Hormone Neurons Is Suppressed by Kisspeptin-G Protein-Coupled Receptor 54 Signaling
Endocrinology,
May 1, 2009;
150(5):
2388 - 2394.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Wu, I. Dumalska, E. Morozova, A. N. van den Pol, and M. Alreja
Gonadotropin inhibitory hormone inhibits basal forebrain vGluT2-gonadotropin-releasing hormone neurons via a direct postsynaptic mechanism
J. Physiol.,
April 1, 2009;
587(7):
1401 - 1411.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. B. Roberts and K. J. Suter
Emerging methodologies for the study of hypothalamic gonadotropin-releasing-hormone (GnRH) neurons
Integr. Comp. Biol.,
November 1, 2008;
48(5):
548 - 559.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Liu, K. Lee, and A. E. Herbison
Kisspeptin Excites Gonadotropin-Releasing Hormone Neurons through a Phospholipase C/Calcium-Dependent Pathway Regulating Multiple Ion Channels
Endocrinology,
September 1, 2008;
149(9):
4605 - 4614.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Dumalska, M. Wu, E. Morozova, R. Liu, A. van den Pol, and M. Alreja
Excitatory Effects of the Puberty-Initiating Peptide Kisspeptin and Group I Metabotropic Glutamate Receptor Agonists Differentiate Two Distinct Subpopulations of Gonadotropin-Releasing Hormone Neurons
J. Neurosci.,
August 6, 2008;
28(32):
8003 - 8013.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Constantin and S. Wray
Gonadotropin-Releasing Hormone-1 Neuronal Activity Is Independent of Hyperpolarization-Activated Cyclic Nucleotide-Modulated Channels but Is Sensitive to Protein Kinase A-Dependent Phosphorylation
Endocrinology,
July 1, 2008;
149(7):
3500 - 3511.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Liu and A. E. Herbison
Small-Conductance Calcium-Activated Potassium Channels Control Excitability and Firing Dynamics in Gonadotropin-Releasing Hormone (GnRH) Neurons
Endocrinology,
July 1, 2008;
149(7):
3598 - 3604.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. B. Roberts, R. E. Campbell, A. E. Herbison, and K. J. Suter
Dendritic Action Potential Initiation in Hypothalamic Gonadotropin-Releasing Hormone Neurons
Endocrinology,
July 1, 2008;
149(7):
3355 - 3360.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. J. Suter and L. O'Farrell
Impaired episodic LH secretion in female mice with GFP in GnRH neurons
Am J Physiol Endocrinol Metab,
July 1, 2008;
295(1):
E130 - E136.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Zhang, T. A. Roepke, M. J. Kelly, and O. K. Ronnekleiv
Kisspeptin Depolarizes Gonadotropin-Releasing Hormone Neurons through Activation of TRPC-Like Cationic Channels
J. Neurosci.,
April 23, 2008;
28(17):
4423 - 4434.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Clasadonte, P. Poulain, J.-C. Beauvillain, and V. Prevot
Activation of Neuronal Nitric Oxide Release Inhibits Spontaneous Firing in Adult Gonadotropin-Releasing Hormone Neurons: A Possible Local Synchronizing Signal
Endocrinology,
February 1, 2008;
149(2):
587 - 596.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Prange-Kiel, H. Jarry, M. Schoen, P. Kohlmann, C. Lohse, L. Zhou, and G. M. Rune
Gonadotropin-releasing hormone regulates spine density via its regulatory role in hippocampal estrogen synthesis
J. Cell Biol.,
January 28, 2008;
180(2):
417 - 426.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. R. Grattan, C. L. Jasoni, X. Liu, G. M. Anderson, and A. E. Herbison
Prolactin Regulation of Gonadotropin-Releasing Hormone Neurons to Suppress Luteinizing Hormone Secretion in Mice
Endocrinology,
September 1, 2007;
148(9):
4344 - 4351.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Yin, J. M. Mendenhall, S. B. Bratton, T. Oung, W. G. M. Janssen, J. H. Morrison, and A. C. Gore
Novel Localization of NMDA Receptors Within Neuroendocrine Gonadotropin-Releasing Hormone Terminals
Experimental Biology and Medicine,
May 1, 2007;
232(5):
662 - 673.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. J. Spergel
Calcium and Small-Conductance Calcium-Activated Potassium Channels in Gonadotropin-Releasing Hormone Neurons before, during, and after Puberty
Endocrinology,
May 1, 2007;
148(5):
2383 - 2390.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. L. Jasoni, M. G. Todman, M. M. Strumia, and A. E. Herbison
Cell Type-Specific Expression of a Genetically Encoded Calcium Indicator Reveals Intrinsic Calcium Oscillations in Adult Gonadotropin-Releasing Hormone Neurons
J. Neurosci.,
January 24, 2007;
27(4):
860 - 867.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Clarkson and A. E. Herbison
Postnatal Development of Kisspeptin Neurons in Mouse Hypothalamus; Sexual Dimorphism and Projections to Gonadotropin-Releasing Hormone Neurons
Endocrinology,
December 1, 2006;
147(12):
5817 - 5825.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Chu and S. M. Moenter
Physiologic Regulation of a Tetrodotoxin-Sensitive Sodium Influx That Mediates a Slow Afterdepolarization Potential in Gonadotropin-Releasing Hormone Neurons: Possible Implications for the Central Regulation of Fertility.
J. Neurosci.,
November 15, 2006;
26(46):
11961 - 11973.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Terasawa
Postnatal remodeling of gonadotropin-releasing hormone I neurons: toward understanding the mechanism of the onset of puberty.
Endocrinology,
August 1, 2006;
147(8):
3650 - 3651.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. C. Cottrell, R. E. Campbell, S.-K. Han, and A. E. Herbison
Postnatal Remodeling of Dendritic Structure and Spine Density in Gonadotropin-Releasing Hormone Neurons
Endocrinology,
August 1, 2006;
147(8):
3652 - 3661.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. L. Jones, P. J. Whiting, and L. P. Henderson
Mechanisms of anabolic androgenic steroid inhibition of mammalian {varepsilon}-subunit-containing GABAA receptors
J. Physiol.,
June 15, 2006;
573(3):
571 - 593.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. B. Schwartz and J. E. Levine
Ontogeny of gonadotropin-releasing hormone neurons: fishing for clues in medaka.
Endocrinology,
March 1, 2006;
147(3):
1074 - 1075.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Okubo, F. Sakai, E. L. Lau, G. Yoshizaki, Y. Takeuchi, K. Naruse, K. Aida, and Y. Nagahama
Forebrain Gonadotropin-Releasing Hormone Neuronal Development: Insights from Transgenic Medaka and the Relevance to X-Linked Kallmann Syndrome
Endocrinology,
March 1, 2006;
147(3):
1076 - 1084.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. B. Roberts, J. A. Best, and K. J. Suter
Dendritic Processing of Excitatory Synaptic Input in Hypothalamic Gonadotropin Releasing-Hormone Neurons
Endocrinology,
March 1, 2006;
147(3):
1545 - 1555.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. M. Plant, S. Ramaswamy, and M. J. DiPietro
Repetitive Activation of Hypothalamic G Protein-Coupled Receptor 54 with Intravenous Pulses of Kisspeptin in the Juvenile Monkey (Macaca mulatta) Elicits a Sustained Train of Gonadotropin-Releasing Hormone Discharges
Endocrinology,
February 1, 2006;
147(2):
1007 - 1013.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. R. Shimshek, T. Bus, V. Grinevich, F. N. Single, V. Mack, R. Sprengel, D. J. Spergel, and P. H. Seeburg
Impaired Reproductive Behavior by Lack of GluR-B Containing AMPA Receptors But Not of NMDA Receptors in Hypothalamic and Septal Neurons
Mol. Endocrinol.,
January 1, 2006;
20(1):
219 - 231.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Wada, L. Hu, N. Mores, C. E. Navarro, H. Fuda, L. Z. Krsmanovic, and K. J. Catt
Serotonin (5-HT) Receptor Subtypes Mediate Specific Modes of 5-HT-Induced Signaling and Regulation of Neurosecretion in Gonadotropin-Releasing Hormone Neurons
Mol. Endocrinol.,
January 1, 2006;
20(1):
125 - 135.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-K. Han, M. L. Gottsch, K. J. Lee, S. M. Popa, J. T. Smith, S. K. Jakawich, D. K. Clifton, R. A. Steiner, and A. E. Herbison
Activation of Gonadotropin-Releasing Hormone Neurons by Kisspeptin as a Neuroendocrine Switch for the Onset of Puberty
J. Neurosci.,
December 7, 2005;
25(49):
11349 - 11356.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Moenter and R. A. DeFazio
Endogenous {gamma}-Aminobutyric Acid Can Excite Gonadotropin-Releasing Hormone Neurons
Endocrinology,
December 1, 2005;
146(12):
5374 - 5379.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Chu and S. M. Moenter
Endogenous Activation of Metabotropic Glutamate Receptors Modulates GABAergic Transmission to Gonadotropin-Releasing Hormone Neurons and Alters Their Firing Rate: A Possible Local Feedback Circuit
J. Neurosci.,
June 15, 2005;
25(24):
5740 - 5749.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Matagne, M.-C. Lebrethon, A. Gerard, and J.-P. Bourguignon
Kainate/Estrogen Receptor Involvement in Rapid Estradiol Effects in Vitro and Intracellular Signaling Pathways
Endocrinology,
May 1, 2005;
146(5):
2313 - 2323.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. E. Campbell, S.-K. Han, and A. E. Herbison
Biocytin Filling of Adult Gonadotropin-Releasing Hormone Neurons in Situ Reveals Extensive, Spiny, Dendritic Processes
Endocrinology,
March 1, 2005;
146(3):
1163 - 1169.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Ueta, H. Fujihara, R. Serino, G. Dayanithi, H. Ozawa, K.-i. Matsuda, M. Kawata, J. Yamada, S. Ueno, A. Fukuda, et al.
Transgenic Expression of Enhanced Green Fluorescent Protein Enables Direct Visualization for Physiological Studies of Vasopressin Neurons and Isolated Nerve Terminals of the Rat
Endocrinology,
January 1, 2005;
146(1):
406 - 413.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. D. Sullivan and S. M. Moenter
GABAergic Integration of Progesterone and Androgen Feedback to Gonadotropin-Releasing Hormone Neurons
Biol Reprod,
January 1, 2005;
72(1):
33 - 41.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. N. Ottem, J. G. Godwin, S. Krishnan, and S. L. Petersen
Dual-Phenotype GABA/Glutamate Neurons in Adult Preoptic Area: Sexual Dimorphism and Function
J. Neurosci.,
September 15, 2004;
24(37):
8097 - 8105.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. C. Gore
Gonadotropin-Releasing Hormone Neurons: Multiple Inputs, Multiple Outputs
Endocrinology,
September 1, 2004;
145(9):
4016 - 4017.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. K. Greenwood and R. D. Fernald
Social Regulation of the Electrical Properties of Gonadotropin-Releasing Hormone Neurons in a Cichlid Fish (Astatotilapia burtoni)
Biol Reprod,
September 1, 2004;
71(3):
909 - 918.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. J. Martinez-Fuentes, L. Hu, L. Z. Krsmanovic, and K. J. Catt
Gonadotropin-Releasing Hormone (GnRH) Receptor Expression and Membrane Signaling in Early Embryonic GnRH Neurons: Role in Pulsatile Neurosecretion
Mol. Endocrinol.,
July 1, 2004;
18(7):
1808 - 1817.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. D. Sullivan and S. M. Moenter
Prenatal androgens alter GABAergic drive to gonadotropin-releasing hormone neurons: Implications for a common fertility disorder
PNAS,
May 4, 2004;
101(18):
7129 - 7134.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Watanabe, Y. Sakuma, and M. Kato
High Expression of the R-Type Voltage-Gated Ca2+ Channel and Its Involvement in Ca2+-Dependent Gonadotropin-Releasing Hormone Release in GT1-7 Cells
Endocrinology,
May 1, 2004;
145(5):
2375 - 2383.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Fernandez-Solari, C. Scorticati, C. Mohn, A. De Laurentiis, S. Billi, A. Franchi, S. M. McCann, and V. Rettori
Alcohol inhibits luteinizing hormone-releasing hormone release by activating the endocannabinoid system
PNAS,
March 2, 2004;
101(9):
3264 - 3268.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Xu, X.-Z. Xu, C. S. Nunemaker, and S. M. Moenter
Dose-Dependent Switch in Response of Gonadotropin-Releasing Hormone (GnRH) Neurons to GnRH Mediated through the Type I GnRH Receptor
Endocrinology,
February 1, 2004;
145(2):
728 - 735.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-K. Han, M. G. Todman, and A. E. Herbison
Endogenous GABA Release Inhibits the Firing of Adult Gonadotropin-Releasing Hormone Neurons
Endocrinology,
February 1, 2004;
145(2):
495 - 499.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. A. Tobet, H. J. Walker, M. L. Seney, and K. W. Yu
Viewing Cell Movements in the Developing Neuroendocrine Brain
Integr. Comp. Biol.,
December 1, 2003;
43(6):
794 - 801.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Kato, K. Ui-Tei, M. Watanabe, and Y. Sakuma
Characterization of Voltage-Gated Calcium Currents in Gonadotropin-Releasing Hormone Neurons Tagged with Green Fluorescent Protein in Rats
Endocrinology,
November 1, 2003;
144(11):
5118 - 5125.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. D. Sullivan and S. M. Moenter
Neurosteroids Alter {gamma}-Aminobutyric Acid Postsynaptic Currents in Gonadotropin-Releasing Hormone Neurons: A Possible Mechanism for Direct Steroidal Control
Endocrinology,
October 1, 2003;
144(10):
4366 - 4375.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Leupen, S. A. Tobet, W. F. Crowley Jr., and K. Kaila
Heterogeneous Expression of the Potassium-Chloride Cotransporter KCC2 in Gonadotropin-Releasing Hormone Neurons of the Adult Mouse
Endocrinology,
July 1, 2003;
144(7):
3031 - 3036.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Heger, M. Seney, E. Bless, G. A. Schwarting, M. Bilger, A. Mungenast, S. R. Ojeda, and S. A. Tobet
Overexpression of Glutamic Acid Decarboxylase-67 (GAD-67) in Gonadotropin-Releasing Hormone Neurons Disrupts Migratory Fate and Female Reproductive Function in Mice
Endocrinology,
June 1, 2003;
144(6):
2566 - 2579.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Balthasar, P.-F. Mery, C. B. Magoulas, K. E. Mathers, A. Martin, P. Mollard, and I. C. A. F. Robinson
Growth Hormone-Releasing Hormone (GHRH) Neurons in GHRH-Enhanced Green Fluorescent Protein Transgenic Mice: A Ventral Hypothalamic Network
Endocrinology,
June 1, 2003;
144(6):
2728 - 2740.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Z. Krsmanovic, N. Mores, C. E. Navarro, K. K. Arora, and K. J. Catt
An agonist-induced switch in G protein coupling of the gonadotropin-releasing hormone receptor regulates pulsatile neuropeptide secretion
PNAS,
March 4, 2003;
100(5):
2969 - 2974.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. S. Nunemaker, M. Straume, R. A. DeFazio, and S. M. Moenter
Gonadotropin-Releasing Hormone Neurons Generate Interacting Rhythms in Multiple Time Domains
Endocrinology,
March 1, 2003;
144(3):
823 - 831.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. N. Ottem, J. G. Godwin, and S. L. Petersen
Glutamatergic Signaling through the N-Methyl-D-Aspartate Receptor Directly Activates Medial Subpopulations of Luteinizing Hormone-Releasing Hormone (LHRH) Neurons, But Does Not Appear to Mediate the Effects of Estradiol on LHRH Gene Expression
Endocrinology,
December 1, 2002;
143(12):
4837 - 4845.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. A. DeFazio, S. Heger, S. R. Ojeda, and S. M. Moenter
Activation of A-Type {gamma}-Aminobutyric Acid Receptors Excites Gonadotropin-Releasing Hormone Neurons
Mol. Endocrinol.,
December 1, 2002;
16(12):
2872 - 2891.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. A. DeFazio and S. M. Moenter
Estradiol Feedback Alters Potassium Currents and Firing Properties of Gonadotropin-Releasing Hormone Neurons
Mol. Endocrinol.,
October 1, 2002;
16(10):
2255 - 2265.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. S. Nunemaker, R. A. DeFazio, and S. M. Moenter
Estradiol-Sensitive Afferents Modulate Long-Term Episodic Firing Patterns of GnRH Neurons
Endocrinology,
June 1, 2002;
143(6):
2284 - 2292.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. L. Jackson and D. Kuehl
The GABAB Antagonist CGP 52432 Attenuates the Stimulatory Effect of the GABAB Agonist SKF 97541 on Luteinizing Hormone Secretion in the Male Sheep
Experimental Biology and Medicine,
May 1, 2002;
227(5):
315 - 320.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Lawson, L. A. Macconell, J. Kim, B. T. Powl, S. B. Nelson, and P. L. Mellon
Neuron-Specific Expression in Vivo by Defined Transcription Regulatory Elements of the GnRH Gene
Endocrinology,
April 1, 2002;
143(4):
1404 - 1412.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-K. Han, I. M. Abraham, and A. E. Herbison
Effect of GABA on GnRH Neurons Switches from Depolarization to Hyperpolarization at Puberty in the Female Mouse
Endocrinology,
April 1, 2002;
143(4):
1459 - 1466.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. C. Kuehl-Kovarik, W. A. Pouliot, G. L. Halterman, R. J. Handa, F. E. Dudek, and K. M. Partin
Episodic Bursting Activity and Response to Excitatory Amino Acids in Acutely Dissociated Gonadotropin-Releasing Hormone Neurons Genetically Targeted with Green Fluorescent Protein
J. Neurosci.,
March 15, 2002;
22(6):
2313 - 2322.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B.-J. Zhang, K. Kusano, P. Zerfas, A. Iacangelo, W. S. Young III, and H. Gainer
Targeting of Green Fluorescent Protein to Secretory Granules in Oxytocin Magnocellular Neurons and Its Secretion from Neurohypophysial Nerve Terminals in Transgenic Mice
Endocrinology,
March 1, 2002;
143(3):
1036 - 1046.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Sim, M. J. Skynner, and A. E. Herbison
Direct Regulation of Postnatal GnRH Neurons by the Progesterone Derivative Allopregnanolone in the Mouse
Endocrinology,
October 1, 2001;
142(10):
4448 - 4453.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. S. Nunemaker, R. A. DeFazio, M. E. Geusz, E. D. Herzog, G. R. Pitts, and S. M. Moenter
Long-Term Recordings of Networks of Immortalized GnRH Neurons Reveal Episodic Patterns of Electrical Activity
J Neurophysiol,
July 1, 2001;
86(1):
86 - 93.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. R. Pitts, C. S. Nunemaker, and S. M. Moenter
Cycles of Transcription and Translation Do Not Comprise the Gonadotropin-Releasing Hormone Pulse Generator in GT1 Cells
Endocrinology,
May 1, 2001;
142(5):
1858 - 1864.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
M. Bilger, S. Heger, D. W. Brann, A. Paredes, and S. R. Ojeda
A Conditional Tetracycline-Regulated Increase in Gamma Amino Butyric Acid Production near Luteinizing Hormone-Releasing Hormone Nerve Terminals Disrupts Estrous Cyclicity in the Rat
Endocrinology,
May 1, 2001;
142(5):
2102 - 2114.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
H. E. Krestel, M. Mayford, P. H. Seeburg, and R. Sprengel
A GFP-equipped bidirectional expression module well suited for monitoring tetracycline-regulated gene expression in mouse
Nucleic Acids Res.,
April 1, 2001;
29(7):
e39 - e39.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Sim, M. J. Skynner, and A. E. Herbison
Heterogeneity in the Basic Membrane Properties of Postnatal Gonadotropin-Releasing Hormone Neurons in the Mouse
J. Neurosci.,
February 1, 2001;
21(3):
1067 - 1075.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. P. LeBeau, F. Van Goor, S. S. Stojilkovic, and A. Sherman
Modeling of Membrane Excitability in Gonadotropin-Releasing Hormone-Secreting Hypothalamic Neurons Regulated by Ca2+-Mobilizing and Adenylyl Cyclase-Coupled Receptors
J. Neurosci.,
December 15, 2000;
20(24):
9290 - 9297.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Magoulas, L. McGuinness, N. Balthasar, D. F. Carmignac, A. K. Sesay, K. E. Mathers, H. Christian, L. Candeil, X. Bonnefont, P. Mollard, et al.
A Secreted Fluorescent Reporter Targeted to Pituitary Growth Hormone Cells in Transgenic Mice
Endocrinology,
December 1, 2000;
141(12):
4681 - 4689.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. J. Suter, J.-P. Wuarin, B. N. Smith, F. E. Dudek, and S. M. Moenter
Whole-Cell Recordings from Preoptic/Hypothalamic Slices Reveal Burst Firing in Gonadotropin-Releasing Hormone Neurons Identified with Green Fluorescent Protein in Transgenic Mice
Endocrinology,
October 1, 2000;
141(10):
3731 - 3736.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. N. Smith, B. W. Banfield, C. A. Smeraski, C. L. Wilcox, F. E. Dudek, L. W. Enquist, and G. E. Pickard
Pseudorabies virus expressing enhanced green fluorescent protein: A tool for in vitro electrophysiological analysis of transsynaptically labeled neurons in identified central nervous system circuits
PNAS,
August 1, 2000;
97(16):
9264 - 9269.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. J. Suter, W. J. Song, T. L. Sampson, J.-P. Wuarin, J. T. Saunders, F. E. Dudek, and S. M. Moenter
Genetic Targeting of Green Fluorescent Protein to Gonadotropin-Releasing Hormone Neurons: Characterization of Whole-Cell Electrophysiological Properties and Morphology
Endocrinology,
January 1, 2000;
141(1):
412 - 419.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|