 |
Previous Article | Next Article 
The Journal of Neuroscience, April 15, 1999, 19(8):2919-2928
A 29 kDa Intracellular Chloride Channel p64H1 Is Associated with
Large Dense-Core Vesicles in Rat Hippocampal Neurons
Jen-Zen
Chuang1,
Teresa
A.
Milner2,
Meicai
Zhu1, and
Ching-Hwa
Sung1, 3
1 Department of Ophthalmology, The Margaret M. Dyson
Vision Research Institute, 2 Department of Neurology and
Neuroscience, Division of Neurobiology, and 3 Department of
Cell Biology and Anatomy, Weill Medical College of Cornell University,
New York, New York 10021
 |
ABSTRACT |
A novel class of intracellular chloride channels, the p64 family,
has been found on several types of vesicles. These channels, acting in
concert with the electrogenic proton pump, regulate the pH of the
vesicle interior, which is critical for vesicular function. Here we
describe the molecular cloning of p64H1, a p64 homolog, from both human
and cow. Northern blot analysis showed that p64H1 is expressed
abundantly in brain and retina, whereas the other members of
this family (e.g., p64 and NCC27) are expressed only at low levels in
these tissues. Immunohistochemical analysis of p64H1 in rat brain,
using an affinity-purified antibody, revealed a high level of
expression in the limbic system the hippocampal formation, the
amygdala, the hypothalamus, and the septum. Immunoelectron microscopic
analysis of p64H1 in hippocampal neurons demonstrated a striking
association between p64H1 and large dense-core vesicles (LDCVs) and
microtubules. In contrast, very low p64H1 labeling was found in
perikarya or associated with small synaptic vesicles (SSVs) in axonal
profiles. Immunoblot analysis confirmed that p64H1 is colocalized with
heavy membrane fractions containing LDCVs rather than the fractions
containing SSVs. These results suggest that p64H1-mediated
Cl permeability may be involved in the maintenance
of low internal pH in LDCVs and in the maturation of LDCVs and the
biogenesis of functional neuropeptides.
Key words:
p64; p64H1; NCC27; intracellular chloride channel; large
dense-core vesicle; neuropeptide; hippocampus; microtubules
 |
INTRODUCTION |
Intracellular chloride channels have
been found on several types of vacuolar organelles, including brain
clathrin-coated vesicles (Xie and Stone, 1988 ; Mulberg et al., 1991 ),
kidney endocytotic vesicles (Bae and Verkman, 1990 ), thyroid
parafollicular cell secretory granules (Barasch et al., 1988 ), and
Golgi membranes (Glickman et al., 1983 ). Chloride conductance may
balance the entry of protons generated by the vacuolar
H+-ATPase and thus facilitate intravesicular
acidification. The resulting acidic vesicle interior is critical for
vesicle loading, enzymatic processing of vesicle contents, and membrane
trafficking (Bradbury and Bridges, 1994 ).
Two types of secretory vesicles coexist in nerve endings: large
dense-core vesicles (LDCVs; 70-100 nm in diameter) and small synaptic
vesicles (SSVs; ~40 nm in diameter). LDCVs, counterparts of endocrine
secretory vesicles, are assembled at the soma and transported via axons
to nerve endings. Neuropeptides and some biogenic amines are sorted
into LDCVs and released extrasynaptically. In contrast, classical
neurotransmitters are released at synapses from SSVs. LDCVs and SSVs
have different regulatory mechanisms for neurotransmitter exocytosis
(De Camilli and Jahn, 1990 ). After their release of vesicle contents,
LDCVs move by retrograde transport to the soma for reloading
(Thureson-Klein and Klein, 1990 ); SSVs are recycled by endocytosis at
the terminal (Winkler, 1997 ). Both types of vesicles contain proton
ATPases (Rudnick, 1986 ). Because the coexistence of proton pumps and
chloride conductance is a universal finding in vacuolar compartments
(Al-Awqati, 1995 ), chloride channels also may be expressed on neuronal
secretory vesicles. However, the identities of the vacuolar chloride
channels on these vesicles are unknown.
The first cloned intracellular chloride channel, p64, originally was
purified from bovine kidney microsomes (Landry et al., 1993 ).
Antibodies to p64 can eliminate chloride conductance on these
microsomes (Redhead et al., 1992 ). Outwardly rectifying anion channel
activity was recorded in a reconstituted planar lipid bilayer fused
with cell membranes from p64 transfected cells (Edwards et al., 1998 ).
Three p64 homologs human nuclear chloride channel (NCC27; Valenzuela et al., 1997 ; Tulk and Edwards,
1998 ), rat p64 homologue 1 (p64H1;
Duncan et al., 1997 ), and chloride intracellular channel 2 (CLIC2; Rogner et al.,
1996 ) have been cloned recently. The sequences of these homologs
predict 25-30 kDa proteins that resemble the C-terminal half of p64.
For NCC27 and p64H1 the outwardly rectifying anion channel activity was recorded on planar lipid bilayers fused with membranes from transfected cells (Valenzuela et al., 1997 ; Duncan et al., 1997 ). CLIC2 activity has not yet been reported. The in vivo distribution and
function of the p64-like channels remain unknown.
In the present report we describe the cloning of human and bovine
p64H1. To seek the function of p64H1, we examined its cellular and
subcellular distributions in those brain regions in which it is highly
expressed. Our findings suggest that p64H1 in brain is associated with
LDCVs, but not SSVs. We propose that p64H1 may regulate intragranular
pH in LDCVs, which is essential for the enzymatic processing and
release of functional peptides from LDCVs.
 |
MATERIALS AND METHODS |
Isolation of p64H1 gene and plasmid constructs.
Partial sequences of bovine p64H1 initially were isolated from the
two-hybrid screening of a bovine retinal cDNA library by using
pDB-Rho39Tr, which contains the C-terminal 39 residues of human
rhodopsin as bait (Chuang and Sung, 1998 ). For antibody production and
purification, constructs encoding glutathione S-transferase
(GST) and maltose binding protein (MBP)-p64H1 fusion proteins were
generated by inserting the BamHI/XhoI fragment
encompassing the coding sequence of the 158 C-terminal residues of
bovine p64H1 to the 3'-end of the open reading frames of GST and MBP in
BamHI/XhoI-digested pGE5X-2 vector (Amersham
Pharmacia Biotech, Arlington Heights, IL) and
BamHI/SalI-digested pMAL-cRI* vector,
respectively. pMAL-cRI* (Chuang et al., 1995 ) is a modified pMAL-cRI
vector (New England Biolabs, Beverly, MA).
Full-length human p64H1 cDNA was obtained by screening a human retinal
gt10 library, using a 32P-radiolabeled fragment of the
bovine sequence as a probe. Library screening was performed at moderate
stringency with standard methods. Full-length human p64H1 cDNA was
PCR-amplified from purified phage clones, using PCR with primers
flanking the insert (forward, 5'-CGCGGATCCAGCAAGTTCAGCCTGGTTAAGT; reverse, 5'- CCGCTCGAGCTTATGAGTATTTCTTCCAGGGT). Then this PCR fragment
was subcloned into pGEX-5X-2, pBluescript II KS (pBS II KS; Stratagene,
La Jolla, CA), and pCIS (Genentech, South San Francisco, CA) for
sequencing, T7 promoter-driven expression, and cytomegalovirus
(CMV) promoter-driven expression, respectively. Multiple clones
were sequenced to verify that no PCR errors were introduced.
Full-length human NCC27 cDNA (accession number AF109197) also was
isolated during the human retinal library screening, using bovine p64H1
cDNA as a probe. Sequencing confirmed that the sequence of NCC27 that
we isolated is identical to that reported by others (Valenzuela et al.,
1997 ). The DNA fragment containing the entire coding region of NCC27
was inserted into pMAL-cRI vector and pBS II KS vector for MBP fusion
protein production and in vitro translation expression, respectively.
RT-PCR was used to obtain the p64 coding sequence (accession number
AF109199). Bovine retinal poly(A+) RNA was first
reverse-transcribed (Superscript II kit, Life Technologies,
Gaithersburg, MD) and then PCR-amplified with a pair of primers
(forward, 5'-CGGGATCCAGACCTACTCGGGTCTGCTTGC;
reverse, 5'-CGGAATTCAGGATCGGCTGAGGCGCTTG) that flank
the coding sequence of bovine p64. PCR products were digested with
BamHI/EcoRI and then inserted into
BamHI/EcoRI-digested pGEX-5X-2 for both sequence confirmation and GST fusion protein production. Full-length p64 cDNA
also was inserted into pBS II KS for in vitro translation.
Production and affinity purification of the p64H1 antibodies.
All GST (Amersham Pharmacia Biotech) and MBP (New England Biolabs) fusion proteins were produced and purified according to the
manufacturer's instructions. Purified GST-p64H1 fusion protein was
used as an immunogen for the production of rabbit antiserum (Cocalico,
Reamstown, PA). To remove cross-reactivities, we passed the
immunized serum sequentially through three CNBr-activated Sepharose
CL-4B columns conjugated with Escherichia coli DH5
lysate, GST protein, and MBP protein. The final flow-through was
affinity-purified on a MBP-p64H1 Sepharose column, eluted with 0.1 M glycine, pH 2.8, and neutralized with Tris-Cl, pH 9.5. The resulting affinity-purified antiserum is referred to as CUMC29. To
remove any further cross-reactivity against p64 and NCC27, we passed
CUMC29 over two Sepharose columns, the first conjugated with GST-p64
and the second with MBP-NCC27. The flow-through is referred to as
p64H1 antibody in this report (see Results for antibody specificity).
In vitro translation and immunoprecipitation. Bovine
p64, human NCC27, and human p64H1 were transcribed and translated
individually in reticulocyte lysates in the presence of
35S-methionine (NEN, Boston, MA) according to the
manufacturer's instructions (TNT T7 Quick coupled
transcription/translation system, Promega, Madison, WI). The translated
products were examined first by SDS-PAGE analysis. Equivalent amounts
of 35S-labeled p64H1, NCC27, and p64 translated products
were mixed, diluted in 1% Triton X-100 and 0.5% bovine serum albumin
(BSA) containing STE buffer (50 mM Tris, pH 7.5, 150 mM NaCl, and 2 mM EDTA), and immunoprecipitated
by protein A-Sepharose conjugated with either CUMC29 or p64H1 antibody
for 4 hr at 4°C. Then the beads were washed with Triton X-100
containing STE buffer once, STE buffer without Triton X-100
once, and eluted with Laemmli sample buffer before SDS-PAGE
analysis and autography.
Northern blotting. Twenty micrograms of total RNA isolated
from various bovine tissues (RNAzol, TEL-TEST, Friendswood, TX) were
electrophoresed on 1% formaldehyde agarose gel, transferred, cross-linked to nylon membrane, and incubated in prehybridization buffer (5× SSC, 30% formamide, 2% SDS, 200 µg/ml denatured herring sperm DNA, and 5× Denhart's) at 42°C for 2 hr before the
[ -32P]-dCTP-labeled (NEN) bovine p64H1 probe
(containing the C-terminal 158 residues and the entire 3'-untranslated
region) was added for an additional overnight incubation at 42°C. The
blot was washed three times at room temperature with 1× SSC and 0.1%
SDS before autoradiography. After exposure, the blot was stripped
(0.05× SSC, 10 mM EDTA, and 0.1% SDS at 80°C for 30 min
twice, followed by 0.01× SSC for 15 min at room temperature) and
reprobed, first with 32P-labeled full-length p64 cDNA and
subsequently with NCC27 cDNA.
Light microscopic immunocytochemistry. All
immunocytochemical methods were approved by the Weill Medical College
of Cornell University Institutional Care and Use Committee. Six Sprague
Dawley rats (Taconic, Germantown, NY) were used in the light microscopy immunocytochemical experiments. All rats were anesthetized with Nembutal (150 mg/kg, i.p.) and sequentially perfused through the ascending aorta with (1) normal saline (0.9%) containing 1000 U/ml of
heparin (10-15 ml); (2) 50 ml of 3.75% acrolein (Polysciences, Warrington, PA) and 2% paraformaldehyde (PFA) in 0.1 M
phosphate buffer (PB), pH 7.4; and (3) 200 ml of 2% PFA in PB. The
brains were removed, and coronal blocks (5 mm thick) were cut and
stored in 2% PFA for an additional 30 min. Sections (40 µm thick)
were cut on a vibratome, collected in PB, and then placed in 1% sodium borohydride in PB for 30 min to remove excess aldehydes (Veznedaroglu and Milner, 1992 ). Immunocytochemistry was performed as described previously (Hsu et al., 1981 ). In brief, the sections were incubated with p64H1 antibody (1:6000 in the presence of 0.25% Triton X-100 and
0.1% BSA) overnight at room temperature and then for 24 hr at 4°C.
Sections were rinsed and incubated with biotinylated goat anti-rabbit
IgG for 30 min, followed by peroxidase-avidin complex (Vector
Laboratories, Burlingame, CA) for 30 min before the diaminobenzidine substrate color development. To demonstrate the specificity of the
antibody, we preadsorbed the immunoreactivity by incubating diluted
primary antibody (1: 2000) with 10 µg of MBP-p64H1 fusion protein
overnight at 4°C. The supernatant, collected after centrifuging the
sample at 12,000 rpm for 15 min, was used for immunostaining as
described above. The stained sections were mounted on acid-cleaned slides previously coated with 1% gelatin. They were air-dried, dehydrated, and coverslipped with DPX (Aldrich Chemical, Milwaukee, WI).
Electron microscopic immunocytochemistry. For electron
microscopy, sections through the hippocampal formation of two rats were
prepared for immunoperoxidase labeling as described above, except that
0.035% Triton X-100 was used in the primary antibody diluent.
Additionally, sections through the hippocampal formation of three rats
were prepared for the immunogold method. For this, the rats were
pretreated with a zinc chelator (sodium diethyldithiocarbamate; Fluka,
Ronkonkoma, NY) to diminish silver background labeling (Veznedaroglu
and Milner, 1992 ) before perfusion with fixative. The sections were
processed by the "freeze-thaw" technique and then incubated in
p64H1 antibody (1:250 dilution) for one overnight incubation at room
temperature and an additional 24 hr at 4°C. After several washes the
sections were incubated with goat anti-rabbit IgG conjugated to 1 nm
gold particles (1:50 dilution; AuroProbe One, Amersham Pharmacia
Biotech) in 0.1% gelatin and 0.8% BSA in PBS for 2 hr at room
temperature. Sections were rinsed with PBS, post-fixed in 1.25%
glutaraldehyde in PBS for 10 min, and rinsed once in PBS, followed by
0.2 M sodium citrate buffer, pH 7.4. The conjugated gold
particles then were enhanced by treatment with silver solution
(IntenSE, Amersham Pharmacia Biotech) for 6-8 min (Chan et al., 1990 ).
The sections were fixed with 2% osmium tetroxide for 1 hr, dehydrated,
and embedded in Epon 812. As described previously (Milner and
Veznedaroglu, 1992 ), ultrathin sections (50 nm thick) then were
prepared and counterstained before examination on a Philips CM10
electron microscope. Sections containing the hippocampal formation
regions obtained from three different rat brains were analyzed electron
microscopically. The nomenclatures used in this study are according to
Peters et al. (1991) .
Isolation and fractionation of synaptosomal vesicles.
Synaptosomal vesicles were isolated from rat cerebral cortices
(including the hippocampal formation) and fractionated exactly as
described (Huttner et al., 1983 ). Briefly, isolated crude synaptosomes
were lysed hypotonically, and the postmitochondrial membranes were pelleted by centrifugation (165,000 × g for 2 hr). The
resulting pellet (LP2) was resuspended in a total of 1.7 ml of 40 mM sucrose. The suspension was subjected to 10 up-and-down
strokes in a glass Teflon homogenizer spun at 1200 rpm and then passed
through a 25-gauge needle five times. The LP2 pellet suspension was
layered on top of a 10.3 ml continuous 50-800 mM sucrose
gradient and then centrifuged for 5 hr at 65,000 × g
in an SW41 rotor (Beckman Instruments, Palo Alto, CA). The gradient,
except for the pellet, was collected in 1 ml fractions from the bottom
of the tube. The density of each fraction was measured by
refractometry. Of each fraction, 0.5 ml was precipitated with 10%
(v/v) trichloroacetic acid (14,000 × g for 15 min at
4°C), followed by two washes of ice-cold acetone. The collected
pellets were resuspended in 40 µl of Laemmli buffer. Aliquots were
loaded on 4-20% gradient SDS-PAGE (Novex, San Diego, CA) for
immunoblotting assays. Blots were probed with p64H1 antibody (1:500),
calcium-dependent activator protein for secretion (CAPS)
antibody (1:500; Berwin et al., 1998 ), or anti-synaptophysin p38
monoclonal antibody (1:2000; Jahn et al., 1985 ).
Immunoblotting. Human embryonic kidney 293s cells were
transfected by using calcium phosphate methods as previously described (Sung et al., 1991 ). 293s cells transfected for 1 d were
homogenized and lysed in STE buffer containing 1% Triton X-100 and
protease inhibitor cocktail (1 mM PMSF, 2 µg/ml
aprotinin, 2 µg/ml leupeptin, and 0.7 µg/ml pepstatin). The
supernatant was centrifuged at 14,000 × g for 15 min,
separated by 4-20% gradient SDS-PAGE, and transferred to
nitrocellulose membrane for immunoblotting. Immunodetection was
performed with either the Proto-Blot system (Promega) or the chemiluminescent method (Pierce Chemical, Rockford, IL).
 |
RESULTS |
Cloning of the bovine and human p64H1
In a yeast two-hybrid screen for proteins interacting with the C
terminus of rhodopsin, several positive clones were isolated from a
bovine retinal library. A GenBank search using BLAST revealed that some
of these positive clones contained sequences similar to members of the
p64 family. Although the interactions between these isolates and the C
terminus of rhodopsin were specific, the physiological relevance of
these interactions is not the scope of this study and will be presented elsewhere.
To obtain a full-length cDNA sequence of this p64-like protein, we
screened a human retinal cDNA library. The longest cDNA clones that
were isolated contained an open reading frame encoding a protein of 253 amino acids with a predicted molecular weight of 28.6 kDa and a
predicted pI of 5.3 (Fig.
1A; accession number AF109196). The reading frame was flanked by 78 bp of 5'-untranslated sequence and a 1796 bp 3'-untranslated region. The sequence around the
first ATG conformed with the Kozak sequence for translation initiation
sites (Kozak, 1991 ). The deduced amino acid sequence of these human
cDNAs shared highest overall identity (~95%) to rat p64H1 (accession
number AF104119), which also encodes for a 253 residue peptide. Our
cDNA clones also shared high similarity to human NCC27 (64% identity;
accession numbers U93205 and AF109197), human CLIC2 (62% identity;
accession O15247; data not shown), and the C-terminal half of bovine
p64 (72% identity; accession numbers L16547 and AF109199) (Fig.
1B). Although the bovine cDNA (accession number
AF109198) initially isolated from the two-hybrid screening was not
full-length, its deduced amino acid sequence was 94 and 95% identical
to the corresponding regions of human and rat p64H1, respectively, and
was much less similar to NCC27 and p64 (Fig. 1B). The
high degree of conservation between our human and bovine clones and rat
p64H1 unambiguously identified our clones as the bovine and human
orthologs of rat p64H1.

View larger version (45K):
[in this window]
[in a new window]
|
Figure 1.
Sequence and alignment of the human p64H1.
A, Nucleotide sequence of human p64H1 cDNA clone,
including the full deduced amino acid coding sequence. The putative
transmembrane domains are underlined. The potential
tyrosine phosphorylation site is circled.
B, Alignment of partial bovine p64H1 amino acid sequence with
full-length human (H) p64H1, rat
(R) p64H1, human NCC27, and bovine
(B) p64, using the Jotun-Hein algorithm.
Identical amino acids are indicated in the boxed
regions. Note that the N-terminal sequences of bovine p64 were
omitted for the sequence alignment.
|
|
Hydropathy analysis suggested that p64H1, like p64, may have one or two
putative transmembrane domains (Fig. 1A,
underlining). The existence of the second transmembrane helix is
questionable; although its hydrophobicity and length are characteristic
of a transmembrane domain, the presence of several charged residues in
this region may disqualify it. Further analysis will be required to
confirm the topology of p64H1. In agreement with Duncan et al. (1997) ,
the four potential protein kinase C and one protein kinase A consensus
sites found in rat p64H1 also were found in human p64H1. However, we
noted an additional consensus sequence for tyrosine phosphorylation:
tyrosine 244 was flanked by an acidic residue at its 3 position and
an alkaline residue at its 6 position (Hunter, 1982 ; Patschinsky et
al., 1982 ). Interestingly, although this putative tyrosine
phosphorylation site was conserved evolutionarily among rat, bovine,
and human p64H1, it was not present in either p64 or NCC27. Similar to
rat p64H1, no obvious signal peptide sequence or N-glycosylation site
was found in human p64H1.
Generation and specificity of the p64H1 antibody
A GST fusion protein containing the C-terminal 158 residues of
bovine p64H1 was used to immunize rabbits for the production of
antibody against p64H1. The immunized serum was affinity-purified against MBP fused with the antigenic epitope of p64H1, and the resulting serum was referred to as CUMC29. CUMC29 recognizes
bacterially expressed recombinant GST-p64H1 fusion, but not GST alone
(data not shown). To remove potential cross-reactivity, we passed
CUMC29 sequentially through Sepharose columns conjugated with GST-p64 and MBP-NCC27 fusion proteins. The flow-through activity will be
referred to as p64H1 antibody. We predict that CLIC2 cross-reactivity, if any, should be removed by this immunodepletion also, because 96% of
the identical amino acid residues shared by p64H1 and CLIC2 in the
epitope region are also present in both p64 and NCC27. Furthermore, the
nonidentical residues of CLIC2 and p64H1 in this region share less
similarity than the other two proteins.
The p64H1 antibody recognized a single band with an apparent molecular
weight of ~29 kDa in rat brain (Fig.
2A, lane 1) on immunoblots. This protein band comigrated with the recombinant human
p64H1 protein overexpressed in 293s cells (lane 2) as well as with in vitro-translated p64H1 (lane 3). The
identical molecular masses of endogenous and recombinant p64H1
indicated that our isolated cDNA clones contained the entire open
reading frame. Although the predicted molecular masses of NCC27 and
p64H1 are very similar, in vitro-translated NCC27 migrated
slightly but detectably more slowly than p64H1 on the same SDS-PAGE
(lane 4). This was consistent with a previous
observation that NCC27 had an aberrantly slower mobility on SDS-PAGE
(Tulk and Edwards, 1998 ). Thus, the signal recognized by p64H1 antibody
was clearly not NCC27.

View larger version (10K):
[in this window]
[in a new window]
|
Figure 2.
Specificity of the p64H1 antibody.
A, Protein extracts from rat brain (lane
1) and 293s cells expressing p64H1 (lane 2) and
also in vitro-translated proteins p64H1 (lane
3), NCC27 (lane 4), and p64 (lane
5) were electrophoresed on a single SDS-PAGE and transferred to
nitrocellulose. One-half of the membrane (lanes 1-2)
was cut and immunoblotted with the p64H1 antibody; the remaining
membrane (lanes 3-5) was visualized by autoradiography.
B, Similar amounts of radiolabeled in
vitro-translated p64H1, NCC27, and p64 were mixed, and a small
aliquot was removed for direct SDS-PAGE analysis (lane
1). The remainder was divided into two fractions and
immunoprecipitated by either protein A-Sepharose conjugated with CUMC29
(lane 2) or p64H1 antibody (lane 3). The
immunocomplex was eluted, separated on SDS-PAGE, and visualized by
autoradiography.
|
|
To be certain that the p64H1 antibody was specific to p64H1 and did not
cross-react with NCC27 and p64, we subjected a mixture of similar
amounts of 35S-labeled in vitro-translated P64,
NCC27, and p64H1 (Fig. 2B, lane 1) to
immunoprecipitation by either p64H1 antibody or CUMC29. The p64H1
antibody precipitated p64H1, but not p64 or NCC27 (Fig. 2B, lane 3). In contrast, the original
affinity-purified CUMC29 precipitated p64H1, p64 to a lesser extent,
and very little NCC27 (Fig. 2B, lane 2). Therefore,
the p64H1 antibody was used in all subsequent experiments.
p64H1 is expressed abundantly in the nervous system
A Northern blot was performed to determine the tissue distribution
of p64H1. The probe was a 32P-labeled DNA fragment encoding
the C-terminal coding region and the 3'-untranslated region of bovine
p64H1. A single ~5 kb transcript was detected in total RNA isolated
from many bovine tissues. High levels of p64H1 messenger were found in
heart, lung, retina, and brain (Fig.
3, top panel).
Equivalent amounts of RNA were loaded as judged by the ethidium
bromide-stained agarose gel before blotting (Fig. 3, inset).
The same RNA blot then was stripped and reprobed with full-length
clones of bovine p64 (Fig. 3, middle panel) and human
NCC27 (Fig. 3, bottom panel). A ~6 kb transcript of
p64 was expressed at high levels in heart and lung, and a ~1.7 kb transcript of NCC27 was expressed at high levels in kidney, lung, and
spleen. The probing of CLIC2 was omitted, because a previous report
showed that CLIC2 was expressed at low levels in some tissues such as
fetal liver and adult skeletal muscle; these signals are only
detectable by RT-PCR, but not by Northern blot assay (Rogner et al.,
1996 ). The unique transcript size of each of these p64 homologs was in
agreement with that reported previously. Minor variability is seen in
the relative expression levels among different tissues. However, p64
and NCC27 consistently were found to be expressed at relatively low
levels in the brain, where p64H1 is in high abundance. The enriched
expression of p64H1 in both brain and retina indicated that p64H1 may
be involved functionally in the CNS.

View larger version (56K):
[in this window]
[in a new window]
|
Figure 3.
Northern blot analysis of p64H, NCC27, and p64.
Total RNA isolated from the indicated different bovine tissues was
electrophoresed and transferred. The same RNA blot was probed
sequentially with radiolabeled cDNA fragments of bovine p64H1
(top panel), bovine p64 (middle
panel), and human NCC27 (bottom
panel). The RNA molecular weight standards are indicated
(in kb; left). Inset, Photograph of
ethidium bromide-stained agarose gel.
|
|
The cellular and subcellular localizations of p64H1 in the
rat brain
To gain insight into the functions of p64H1, we examined the
cellular and subcellular distribution of p64H1 immunoreactivity in rat
brain. Light microscopic examination of the brain revealed intense
p64H1-immunoreactive processes in several "limbic" areas, including
the hippocampal formation (Fig.
4A), the septum (Fig. 4C,D), the amygdala (Fig. 4E,F),
and the hypothalamus (Fig. 4E,G). In addition,
certain areas in the cortex (Fig. 4H) and the
cerebellum (data not shown) were also p64H1-positive. In these regions,
p64H1 immunoreactivity was associated mainly with fibers that had
several different appearances. In the hippocampal formation a dense
plexus of p64H1-immunoreactive processes was detected in the inner
molecular layer of the dentate gyrus. Large, punctate p64H1-labeled
processes were found in the mossy fiber pathway in the hilus of the
dentate gyrus and stratum lucidum of the CA3 region (Fig.
4A). In the central amygdala the p64H1
immunoreactivity was in fibers that formed baskets outlining the somata
(Fig. 4F). On the other hand, p64H1 labeling in the
cortex regions was located mainly on single, large varicose fibers
(Fig. 4H). In addition to processes, p64H1-labeled somata were observed in the lateral septal nuclei (Fig.
4D) and the lateral hypothalamic nuclei (Fig.
4G). All labeling was specific and could be ablated
efficiently by preincubating the antibody with the fusion protein that
was used as antigen; one example taken from the hippocampal formation
region is demonstrated (Fig. 4B).

View larger version (153K):
[in this window]
[in a new window]
|
Figure 4.
Light microscopic localization of p64H1 in several
regions of rat brain. A, In the hippocampal formation,
strong immunoperoxidase activity was detected in the inner molecular
layer (ml) and hilus (h) of
the dentate gyrus and in stratum lucidum (SLu) of the
CA3 region. In contrast, the granule cell layer
(gcl) lacked any p64H1 labeling.
HiF, Hippocampal fissure. B, After
preadsorption of the antibody with fusion protein containing the
antigenic epitope, no p64H1 labeling was observed in any region.
The hippocampal formation region is shown as an example.
C, Strong p64H1 labeling was seen in neurons of the
lateral septal (LS) nuclei region. cc,
Corpus callosum; LV, lateral ventricle.
D, High magnification of the lateral septal nuclei
region shows intense p64H1 immunoreactivity in the somata
(arrowheads) as well as in processes that have a beaded
appearance (arrows). E, The hypothalamus and amygdala also
contain intense p64H1 immunoreactivity in varicose processes.
3V, 3rd ventricle; fx, fornix;
LHA, lateral hypothalamic area. F, High
magnification of the amygdala shows p64H1 immunoreactivity in baskets
of punctate fibers surrounding the somata. G, In the
lateral hypothalamic nuclei area, p64H1 also is associated perikarya
(arrowheads). H, p64H1 immunoreactivity
on single, large varicose fiber was observed in the cerebral cortex.
Scale bars: A-C, G, 100 µm; D, 10 µm; E, 200 µm; F, 50 µm;
H, 5 µm.
|
|
The subcellular localization of p64H1 in the dentate gyrus was examined
further by electron microscopy. Consistent with the light microscopic
analysis, p64H1 immunoreactivity was confined to axonal profiles in
this region. Prominent p64H1 immunoreactivity (as demonstrated by the
immunogold-silver reaction product) was associated primarily with LDCVs
(~70-100 nm, Fig. 5A,B).
Despite the low abundance of LDCVs in most nerve terminals, the
majority of LDCVs in the surveyed fields was labeled with p64H1.
Some immunogold-silver particles representing p64H1 immunoreactivity
were in close contact with the plasma membrane (Fig. 5A).
Immunogold-silver particles also were associated with tubular membranes
(Fig. 5B) that may represent the axonal reticulum, a
membranous structure often found to be positive for LDCV markers
(Quatacker et al., 1992 ; Annaert et al., 1994 ). Despite the high
abundance of SSVs within synaptic profiles, immunogold-silver particles
rarely were found to be affiliated with SSVs (Fig.
5A,B).

View larger version (141K):
[in this window]
[in a new window]
|
Figure 5.
Electron micrographic localization of p64H1 in the
inner molecular layer of the dentate gyrus. A, p64H1
immunoreactivity (as demonstrated by immunogold-silver particles)
primarily associated with LDCVs (open arrows).
Immunogold-silver particles occasionally were affiliated with the
plasma membrane (arrowheads). Very little p64H1 labeling
was associated with SSVs in most synaptic profiles. B,
p64H1 sometimes was found on tubular membrane profiles (solid
arrow). Scale bars, 0.5 µm.
|
|
In axons, immunogold-silver particles representing p64H1 labeling often
were affiliated with microtubular bundles (Fig.
6A,B). In some cases
the microtubule-associated p64H1 labeling extended over a distance of
~8 µm. In some planes of section this labeling was affiliated with
LDCVs within axonal profiles (large arrows in Fig.
6C).

View larger version (184K):
[in this window]
[in a new window]
|
Figure 6.
p64H1 immunoreactivity was associated with
microtubules in axons. A, B, A
low-magnification photomicrograph showed that p64H1 immunoreactivity
(as demonstrated by immunogold-silver particles) was arrayed remarkably
along a longitudinal section of microtubule bundles (small
arrows). C, A high-magnification photomicrograph
revealed that p64H1 was associated with LDCVs (large
arrows) that were in direct contact with microtubules. Scale
bars, 0.5 µm.
|
|
p64H1 is found primarily in higher density membrane fractions
To support our immunohistochemical observation that p64H1 is
associated predominantly with LDCVs, we examined the localization of
p64H1 in vesicles derived from brain synaptosomes by immunoblotting analysis. As shown in Figure 7, p64H1
antibody recognized a single band of 29 kDa in fractions of high
density (1.07-1.09 gm/ml), with a peak in 0.6-0.7 M
sucrose fractions that was consistent with a previously reported
density of LDCVs isolated by a similar method (Coyle and Kuhar, 1974 ).
A LDCV marker, CAPS (Berwin et al., 1998 ), showed a largely overlapped
colocalization with p64H1 in these fractions. In contrast, the SSV
marker synaptophysin was highly enriched with a peak in the 0.2-0.3
M sucrose fractions (with density from 1.02 to 1.04 gm/ml).
This result is in agreement with previous reports of SSV density
(Huttner et al., 1983 ; Jahn et al., 1985 ).

View larger version (24K):
[in this window]
[in a new window]
|
Figure 7.
Distribution of p64H1, the LDCV marker CAPS, and
the SSV marker synaptophysin in synaptosomal vesicle fractions.
Fractionation was performed on a continuous sucrose density gradient
(see Materials and Methods). An aliquot of each fraction was
TCA-precipitated and subjected to SDS-PAGE (a 200 µl equivalent of
each fraction for p64H1, a 20 µl equivalent for CAPS, and a 1 µl
equivalent for synaptophysin). Then the protein gels were transferred
and probed with p64H1 antibody, CAPS antibody, or anti-synaptophysin
p38 antibody. The sucrose concentration is indicated. Note that CAPS,
which has been dissociated from LDCV, was distributed in the loading
zone of the gradient.
|
|
 |
DISCUSSION |
Intracellular chloride channels are heterogeneous
Chloride channels exhibit marked diversity in conductance,
current-voltage relationship, and regulation. Three members of the
p64-like intracellular chloride channel family (i.e., p64, p64H1, and
NCC27) have their own unique transcript size and tissue expression
pattern (Landry et al., 1993 ; Duncan et al., 1997 ; Tulk and Edwards,
1998 ; this study). Northern blot analysis revealed that p64H1 is
expressed abundantly in both the retina and the brain, where p64 and
NCC27 have relatively low levels of expression. On the other hand, some
tissues express more than one p64-like protein. For example, p64H1,
p64, and NCC27 are highly expressed in the lung. The distinct tissue
distributions of the p64 homologs suggest that the expression of each
of these molecules is regulated specifically and might be tailored for
their respective functional roles in different cell types.
Vacuolar H+-ATPase is composed of several subunits.
Although the same H+-ATPase gene products are
expressed universally on many vacuolar compartments, the measured
proton pump activity is variable in different organelles (for review,
see Al-Awqati, 1986 ; Finbow and Harrison, 1997 ). It is conceivable that
the various vacuolar chloride channels differentially modulate
proton pump activity and therefore the degree of acidification. This
hypothesis is in agreement with the finding that different organelles
show markedly different Cl requirements for
acidification and their subsequent physiological functions (Rudnick,
1986 ). Ion transport is a highly regulated cellular function. One
probable mechanism is via the phosphorylation of channel proteins.
Putative protein kinase C, protein kinase A, and tyrosine
phosphorylation consensus sites of p64H1 are conserved across species.
In vitro studies have demonstrated that translated rat p64H1
is phosphorylated by protein kinase C (Duncan et al., 1997 ).
Nevertheless, whether or not phosphorylation regulates the expression
and/or physiological behavior of p64H1 in vivo remains to be determined.
Selective distribution of p64H1 in rat brain
Immunoreactivity for p64H1 was evident in many regions that
comprise the "limbic" system (i.e., hippocampal formation,
amygdala, and lateral septum). In these regions, p64H1 labeling
primarily was confined to fibers and varicose processes. Our
electron microscopic analysis of the hippocampal formation demonstrated
that most of these labeled varicosities were axons and axon terminals.
However, prominent perikaryal labeling of p64H1 was evident in the
lateral septal and lateral hypothalamic regions. Previously, p64H1 had been localized to endoplasmic reticulum-like membranes surrounding the
nucleus in transiently transfected fibroblasts (Duncan et al., 1997 ).
Whether the p64H1-positive structure observed in these fibroblasts is
similar to the perikaryal labeling observed in the present study
remains to be examined.
The proposed function of p64H1 in maintaining the low internal pH of
LDCVs and neuropeptide biogenesis (see below) is supported by its high
level of expression in the hypothalamus, a region in which peptidergic
neurons are in high abundance. Moreover, the cellular and subcellular
expression pattern of p64H1 is strikingly similar to that of calcitonin
gene-related peptide in rats treated with chemical-injected insult
(Bulloch et al., 1996 ). This correlated expression pattern suggests
that p64H1 could be involved in the biosynthesis of this or a related peptide.
p64H1 in enriched in LDCVs
Immunoelectron microscopic analysis of the hippocampal formation
and the immunoblotting of fractionated synaptosomal vesicles clearly
revealed that p64H1 was associated predominantly with LDCVs. These
results suggest that p64H1 is involved in functions associated with
LDCVs. LDCVs are formed at exit sites of the trans-Golgi network (TGN)
as immature secretory vesicles and transported to the release sites,
during which maturation takes place. At the Golgi apparatus LDCVs are
packaged with neuropeptide precursors, processing enzymes, and members
of the secretogranin family (for review, see Burgess and Kelly, 1987 ;
Tooze and Burke, 1987 ). Low pH and high calcium concentration in the
TGN promote protein condensation that selectively excludes other
proteins not destined for LDCVs as one mechanism of sorting (Gerdes et
al., 1989 ). After leaving the Golgi apparatus, the electron dense-core
continues to mature by progressive aggregation of the vesicle contents,
a process that also is promoted by low pH (Tooze and Stinchcombe,
1992 ). More importantly, to produce functionally active peptide, the neuropeptide precursor has to be cleaved by endo/exoproteases that
generally have acidic pH optima (for review, see Gainer et al., 1985 ).
The function of LDCVs is consistent with the notion that the internal
pH of LDCVs is acidic, pH 5-6 (Loh et al., 1984 ). The finding that
p64H1 is enriched in LDCVs may suggest that p64H1-mediated chloride
permeability, in action with the proton pump, is involved in the
generation and maintenance of an acidified microenvironment in LDCVs.
Several enzymes (e.g., acetyltransferase and -amidating
enzymes), which further modify neuropeptides after proteolytic
cleavage, show maximal activity at neutral pH and are inhibited at
acidic pH (for review, see Gainer et al., 1985 ). Aggregated proteins also are thought to be solubilized at more neutral pH before release (Tooze and Stinchcombe, 1992 ; Dartsch et al., 1998 ). We speculate that
the expression or the channel activity of p64H1 may be regulated, probably via phosphorylation of the protein or by interactions with
cofactor(s). These changes subsequently affect the intravesicular pH
and, in turn, the activities of neuropeptide processing enzymes.
At the electron microscopic level, p64H1 labeling is seen occasionally
in close apposition to axonal plasmalemma as well as LDCVs. Although
there is the possibility that p64H1 is expressed on the plasmalemma,
p64H1 more likely is expressed on LDCVs in the process of exocytosis.
Previous experiments that used digitonin-permeabilized nerve endings
isolated from neurohypophyses concluded that chloride ions are a
crucial component for a late step in exocytosis and that this step can
be inhibited by a chloride channel antagonist (Dayanithi and Nordmann,
1989 ). Further studies are need to determine whether p64H1 has a role
in exocytosis.
LDCVs are concentrated in the axonal periphery via microtubule-based
anterograde transport along the axon (Tooze and Burke, 1987 ). However,
unlike SSVs, which recycle at the nerve endings, LDCVs also travel back
to the cell body for vesicle reloading once their contents are released
(Thureson-Klein and Klein, 1990 ). The microtubule-mediated
translocation of LDCVs in axons is consistent with our observation that
p64H1 immunoreactivity is associated with microtubules. Both the
anterograde and retrograde transport of LDCVs may account for the
high-density labeling of p64H1 associated with the microtubules in
axonal profiles. Whether p64H1 is involved in this membrane trafficking
needs to be determined.
Perspectives
Complementary approaches often are needed to determine the
specific function of a novel putative channel protein in
vivo. Similarly, although chloride conductance can be recorded on
reconstituted lipid bilayers fused with p64H1-expressing membranes,
channel activity observed in artificial bilayers does not necessarily reflect a true function in vivo. The p64H1 protein may be a
subunit of a chloride channel complex instead of a channel itself, or it may be a channel regulator that activates a channel already present
in the membranes used for recordings. Alternatively, p64H1 may behave
as both a channel and a regulator. The molecular cloning of p64H1
certainly will help us to better define its functional roles. Mutations
found in several chloride channels/channel regulators/transporters are
linked to human disease (Simon et al., 1996 , 1997 ; Thakker, 1997 ). For
example, mutations in CLCNKB, a kidney-specific chloride channel, cause
type III Bartter's syndrome that is characterized by renal failure
(Simon et al., 1997 ). Thus, the isolation of human p64H1 will allow us
to examine its relationship with human pathological conditions in
future studies.
 |
FOOTNOTES |
Received Dec. 1, 1998; revised Jan. 27, 1999; accepted Feb. 1, 1999.
This work was supported by National Institutes of Health (NIH) Grant
EY11307, The Foundation Fighting Blindness, and a Cornell Scholarship
to C.-H.S.; and by NIH Grants MH42834, DA08259, and HL18974 to T.A.M.
We are indebted for the kind gifts of human retinal cDNA library from
Dr. J. Nathans (Johns Hopkins University School of Medicine, Baltimore,
MD), of anti-CAPS antibody from Dr. T. F. Martin (University of
Wisconsin), and of anti-synaptophysin p38 monoclonal antibody from Dr.
P. Greengard (Rockefeller University, NY). We thank Drs. Gustavo Frindt
and Lawrence Palmer for helpful discussion and A. W. Tai, J. Macke, and
Drs. Tim McGraw and J. Wagner for critically reading this manuscript.
Correspondence should be addressed to Dr. Ching-Hwa Sung, The Margaret
M. Dyson Vision Research Institute, Weill Medical College of Cornell
University, 1300 York Avenue, New York, NY 10021.
 |
REFERENCES |
-
Al-Awqati Q
(1986)
Proton-translocating ATPases.
Annu Rev Cell Biol
2:179-199[Web of Science].
-
Al-Awqati Q
(1995)
Chloride channels of intracellular organelles.
Curr Opin Cell Biol
7:504-508[Web of Science][Medline].
-
Annaert WG,
Quatacker J,
Llona I,
De Potter WP
(1994a)
Differences in the distribution of cytochrome b561 and synaptophysin in dog splenic nerve: a biochemical and immunocytochemical study.
J Neurochem
62:265-274[Web of Science][Medline].
-
Bae H,
Verkman AS
(1990)
Protein kinase A regulates chloride conductance in endocytic vesicles from proximal tubule.
Nature
348:637-639[Medline].
-
Barasch J,
Gershon MD,
Nunez EA,
Tamir H,
Al-Awqati Q
(1988)
Thyrotropin induces the acidification of the secretory granules of parafollicular cells by increasing the chloride conductance of the granular membrane.
J Cell Biol
107:2137-2147[Abstract/Free Full Text].
-
Berwin B,
Floor E,
Martin TF
(1998)
CAPS (mammalian UNC-31) protein localizes to membranes involved in dense-core vesicle exocytosis.
Neuron
21:137-145[Web of Science][Medline].
-
Bradbury NA,
Bridges RJ
(1994)
Role of membrane trafficking in plasma membrane solute transport.
Am J Physiol
267:C1-C24[Abstract/Free Full Text].
-
Bulloch K,
Prasad A,
Conrad CD,
McEwen BS,
Milner TA
(1996)
Calcitonin gene-related peptide level in the rat dentate gyrus increases after damage.
NeuroReport
7:1036-1040[Web of Science][Medline].
-
Burgess TL,
Kelly RB
(1987)
Constitutive and regulated secretion of proteins.
Annu Rev Cell Biol
3:243-293[Web of Science].
-
Chan J,
Aoki C,
Pickel VM
(1990)
Optimization of differential immunogold-silver and peroxidase labeling with maintenance of ultrastructure in brain sections before plastic embedding.
J Neurosci Methods
33:113-127[Web of Science][Medline].
-
Chuang J-Z,
Sung C-H
(1998)
The cytoplasmic tail of rhodopsin acts as a novel apical sorting signal in polarized MDCK cells.
J Cell Biol
142:1245-1256[Abstract/Free Full Text].
-
Chuang J-Z,
Lin D,
Lin S
(1995)
Molecular cloning, expression, and mapping of the high affinity actin-capping domain of chicken cardiac tensin.
J Cell Biol
128:1095-1109[Abstract/Free Full Text].
-
Coyle JT,
Kuhar MJ
(1974)
Subcellular localization of dopamine
-hydroxylase and endogenous norepinephrine in the rat hypothalamus.
Brain Res
65:475-487[Web of Science][Medline]. -
Dartsch H,
Kleene R,
Kern HF
(1998)
In vitro condensation sorting of enzyme proteins isolated from rat pancreatic acinar cells.
Eur J Cell Biol
75:211-222[Web of Science][Medline].
-
Dayanithi G,
Nordmann JJ
(1989)
Chloride and magnesium dependence of vasopressin release from rat permeabilized neurohypophysial nerve endings.
Neurosci Lett
106:305-309[Web of Science][Medline].
-
De Camilli P,
Jahn R
(1990)
Pathways to regulated exocytosis in neurons.
Annu Rev Physiol
52:625-645[Web of Science][Medline].
-
Duncan RR,
Westwood PK,
Boyd A,
Ashley RH
(1997)
Rat brain p64H1, expression of a new member of the p64 chloride channel protein family in endoplasmic reticulum.
J Biol Chem
272:23880-23886[Abstract/Free Full Text].
-
Edwards JC,
Tulk B,
Schlesinger PH
(1998)
Functional expression of p64, an intracellular chloride channel protein.
J Membr Biol
163:119-127[Web of Science][Medline].
-
Finbow ME,
Harrison MA
(1997)
The vacuolar H+-ATPase, a universal proton pump of eukaryotes.
Biochem J
324:697-712.
-
Gainer H,
Russell JT,
Loh YP
(1985)
The enzymology and intracellular organization of peptide precursor processing: the secretory vesicle hypothesis.
Neuroendocrinology
40:171-184[Web of Science][Medline].
-
Gerdes HH,
Rosa P,
Phillips E,
Baeuerle PA,
Frank R,
Argos P,
Huttner WB
(1989)
The primary structure of human secretogranin II, a widespread tyrosine-sulfated secretory granule protein that exhibits low pH- and calcium-induced aggregation.
J Biol Chem
264:12009-12015[Abstract/Free Full Text].
-
Glickman J,
Croen K,
Kelly S,
Al-Awqati Q
(1983)
Golgi membranes contain an electrogenic H+ pump in parallel to a chloride conductance.
J Cell Biol
97:1303-1308[Abstract/Free Full Text].
-
Hsu SM,
Raine L,
Fanger H
(1981)
Use of avidin-biotin-peroxidase complex (ABC) in immunoperoxidase techniques: comparison between ABC and unlabeled antibody (PAP) procedures.
J Histochem Cytochem
29:577-580[Abstract].
-
Hunter T
(1982)
Synthetic peptide substrates for a tyrosine protein kinase.
J Biol Chem
257:4843-4848[Abstract/Free Full Text].
-
Huttner WB,
Schiebler W,
Greengard P,
De Camilli P
(1983)
Synapsin I (protein I), a nerve terminal-specific phosphoprotein. III. Its association with synaptic vesicles studied in a highly purified synaptic vesicle preparation.
J Cell Biol
96:1374-1388[Abstract/Free Full Text].
-
Jahn R,
Schiebler W,
Ouimet C,
Greengard P
(1985)
A 38,000-dalton membrane protein (p38) present in synaptic vesicles.
Proc Natl Acad Sci USA
82:4137-4141[Abstract/Free Full Text].
-
Kozak M
(1991)
An analysis of vertebrate mRNA sequences: intimations of translational control.
J Cell Biol
115:887-903[Abstract/Free Full Text].
-
Landry D,
Sullivan S,
Nicolaides M,
Redhead C,
Edelman A,
Field M,
Al-Awqati Q,
Edwards J
(1993)
Molecular cloning and characterization of p64, a chloride channel protein from kidney microsomes.
J Biol Chem
268:14948-14955[Abstract/Free Full Text].
-
Loh YP,
Brownstein MJ,
Gainer H
(1984)
Proteolysis in neuropeptide processing and other neural functions.
Annu Rev Neurosci
7:189-222[Web of Science][Medline].
-
Milner TA,
Veznedaroglu E
(1992)
Ultrastructural localization of neuropeptide Y-like immunoreactivity in the rat hippocampal formation.
Hippocampus
2:107-125[Web of Science][Medline].
-
Mulberg AE,
Tulk BM,
Forgac M
(1991)
Modulation of coated vesicle chloride channel activity and acidification by reversible protein kinase A-dependent phosphorylation.
J Biol Chem
266:20590-20593[Abstract/Free Full Text].
-
Patschinsky T,
Hunter T,
Esch FS,
Cooper JA,
Sefton BM
(1982)
Analysis of the sequence of amino acids surrounding sites of tyrosine phosphorylation.
Proc Natl Acad Sci USA
79:973-977[Abstract/Free Full Text].
-
Peters A,
Palay SL,
Webster HD
(1991)
In: The fine structure of the nervous system, 3rd ed. New York: Oxford UP.
-
Quatacker JR,
Annaert WG,
Miserez BJ,
De Potter WP
(1992)
Immunocytochemical demonstration of dopamine-
-hydroxylase and cytochrome B561 on the axonal reticulum in bovine sympathetic neurons.
J Histochem Cytochem
40:1599-1604[Abstract]. -
Redhead CR,
Edelman AE,
Brown D,
Landry DW,
Al-Awqati Q
(1992)
A ubiquitous 64-kDa protein is a component of a chloride channel of plasma and intracellular membranes.
Proc Natl Acad Sci USA
89:3716-3720[Abstract/Free Full Text].
-
Rogner UC,
Heiss NS,
Kioschis P,
Wiemann S,
Korn B,
Poustka A
(1996)
Transcriptional analysis of the candidate region for incontinentia pigmenti (IP2) in Xq28.
Genome Res
6:922-934[Abstract/Free Full Text].
-
Rudnick G
(1986)
ATP-driven H+ pumping into intracellular organelles.
Annu Rev Physiol
48:403-413[Web of Science][Medline].
-
Simon DB,
Karet FE,
Hamdan JM,
DiPietro A,
Sanjad SA,
Lifton RP
(1996)
Bartter's syndrome, hypokalaemic alkalosis with hypercalciuria, is caused by mutations in the Na-K-2Cl cotransporter NKCC2.
Nat Genet
13:183-188[Web of Science][Medline].
-
Simon DB,
Bindra RS,
Mansfield TA,
Nelson-Williams C,
Mendonca E,
Stone R,
Schurman S,
Nayir A,
Alpay H,
Bakkaloglu A,
Rodriguez-Soriano J,
Morales JM,
Sanjad SA,
Taylor CM,
Pilz D,
Brem A,
Trachtman H,
Griswold W,
Richard GA,
John E,
Lifton RP
(1997)
Mutations in the chloride channel gene, CLCNKB, cause Bartter's syndrome type III.
Nat Genet
17:171-178[Web of Science][Medline].
-
Sung CH,
Schneider BG,
Agarwal N,
Papermaster DS,
Nathans J
(1991)
Functional heterogeneity of mutant rhodopsins responsible for autosomal dominant retinitis pigmentosa.
Proc Natl Acad Sci USA
88:8840-8844[Abstract/Free Full Text].
-
Thakker RV
(1997)
Chloride channels cough up.
Nat Genet
17:125-127[Web of Science][Medline].
-
Thureson-Klein AK,
Klein RL
(1990)
Exocytosis from neuronal large dense-cored vesicles.
Int Rev Cytol
121:67-126[Medline].
-
Tooze J,
Burke B
(1987)
Accumulation of adrenocorticotropin secretory granules in the midbody of telophase AtT20 cells: evidence that secretory granules move anterogradely along microtubules.
J Cell Biol
104:1047-1057[Abstract/Free Full Text].
-
Tooze SA,
Stinchcombe JC
(1992)
Biogenesis of secretory granules.
Semin Cell Biol
3:357-366[Medline].
-
Tulk BM,
Edwards JC
(1998)
NCC27, a homolog of intracellular Cl
channel p64, is expressed in brush border of renal proximal tubule.
Am J Physiol
43:F1140-F1149. -
Valenzuela SM,
Martin DK,
Por SB,
Robbins JM,
Wartom K,
Bootcov MR,
Schofield PR,
Campbell TJ,
Breit SN
(1997)
Molecular cloning and expression of a chloride ion channel of cell nuclei.
J Biol Chem
272:12575-12582[Abstract/Free Full Text].
-
Veznedaroglu E,
Milner TA
(1992)
Elimination of artifactual labeling of hippocampal mossy fibers seen following pre-embedding immunogold-silver technique by pretreatment with zinc chelator.
Microsc Res Tech
23:100-101[Web of Science][Medline].
-
Winkler H
(1997)
Membrane composition of adrenergic large and small dense-cored vesicles and of synaptic vesicles: consequences for their biogenesis.
Neurochem Res
22:921-932[Web of Science][Medline].
-
Xie XS,
Stone DK
(1988)
Partial resolution and reconstitution of the subunits of the clathrin-coated vesicle proton ATPase responsible for Ca2+-activated ATP hydrolysis.
J Biol Chem
263:9859-9867[Abstract/Free Full Text].
Copyright © 1999 Society for Neuroscience 0270-6474/99/1982919-10$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
B. Ponsioen, L. van Zeijl, M. Langeslag, M. Berryman, D. Littler, K. Jalink, and W. H. Moolenaar
Spatiotemporal Regulation of Chloride Intracellular Channel Protein CLIC4 by RhoA
Mol. Biol. Cell,
November 15, 2009;
20(22):
4664 - 4672.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Komori, N. Takemori, H. K. Kim, A. Singh, S.-H. Hwang, R. D. Foreman, K. Chung, J. M. Chung, and H. Matsumoto
Proteomics study of neuropathic and nonneuropathic dorsal root ganglia: altered protein regulation following segmental spinal nerve ligation injury
Physiol Genomics,
April 24, 2007;
29(2):
215 - 230.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. S. Suh, J. M. Crutchley, A. Koochek, A. Ryscavage, K. Bhat, T. Tanaka, A. Oshima, P. Fitzgerald, and S. H. Yuspa
Reciprocal Modifications of CLIC4 in Tumor Epithelium and Stroma Mark Malignant Progression of Multiple Human Cancers
Clin. Cancer Res.,
January 1, 2007;
13(1):
121 - 131.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. C. Edwards, C. Cohen, W. Xu, and P. H. Schlesinger
c-Src Control of Chloride Channel Support for Osteoclast HCl Transport and Bone Resorption
J. Biol. Chem.,
September 22, 2006;
281(38):
28011 - 28022.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. A. Scalettar
How Neurosecretory Vesicles Release Their Cargo
Neuroscientist,
April 1, 2006;
12(2):
164 - 176.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Bohman, T. Matsumoto, K. Suh, A. Dimberg, L. Jakobsson, S. Yuspa, and L. Claesson-Welsh
Proteomic Analysis of Vascular Endothelial Growth Factor-induced Endothelial Cell Differentiation Reveals a Role for Chloride Intracellular Channel 4 (CLIC4) in Tubular Morphogenesis
J. Biol. Chem.,
December 23, 2005;
280(51):
42397 - 42404.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Silverman, S. Johnson, D. Gurkins, M. Farmer, J. E. Lochner, P. Rosa, and B. A. Scalettar
Mechanisms of Transport and Exocytosis of Dense-Core Granules Containing Tissue Plasminogen Activator in Developing Hippocampal Neurons
J. Neurosci.,
March 23, 2005;
25(12):
3095 - 3106.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. S. Suh, M. Mutoh, M. Gerdes, J. M. Crutchley, T. Mutoh, L. E. Edwards, R. A. Dumont, P. Sodha, C. Cheng, A. Glick,, et al.
Antisense Suppression of the Chloride Intracellular Channel Family Induces Apoptosis, Enhances Tumor Necrosis Factor {alpha}-Induced Apoptosis, and Inhibits Tumor Growth
Cancer Res.,
January 15, 2005;
65(2):
562 - 571.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. S. Suh, M. Mutoh, K. Nagashima, E. Fernandez-Salas, L. E. Edwards, D. D. Hayes, J. M. Crutchley, K. G. Marin, R. A. Dumont, J. M. Levy, et al.
The Organellular Chloride Channel Protein CLIC4/mtCLIC Translocates to the Nucleus in Response to Cellular Stress and Accelerates Apoptosis
J. Biol. Chem.,
February 6, 2004;
279(6):
4632 - 4641.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Thevenod
Ion channels in secretory granules of the pancreas and their role in exocytosis and release of secretory proteins
Am J Physiol Cell Physiol,
September 1, 2002;
283(3):
C651 - C672.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Ronnov-Jessen, R. Villadsen, J. C. Edwards, and O. W. Petersen
Differential Expression of a Chloride Intracellular Channel Gene, CLIC4, in Transforming Growth Factor-{beta}1-Mediated Conversion of Fibroblasts to Myofibroblasts
Am. J. Pathol.,
August 1, 2002;
161(2):
471 - 480.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Fernandez-Salas, K. S. Suh, V. V. Speransky, W. L. Bowers, J. M. Levy, T. Adams, K. R. Pathak, L. E. Edwards, D. D. Hayes, C. Cheng, et al.
mtCLIC/CLIC4, an Organellular Chloride Channel Protein, Is Increased by DNA Damage and Participates in the Apoptotic Response to p53
Mol. Cell. Biol.,
June 1, 2002;
22(11):
3610 - 3620.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-Z. Chuang, H. Zhou, M. Zhu, S.-H. Li, X.-J. Li, and C.-H. Sung
Characterization of a Brain-enriched Chaperone, MRJ, That Inhibits Huntingtin Aggregation and Toxicity Independently
J. Biol. Chem.,
May 24, 2002;
277(22):
19831 - 19838.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. J. Jentsch, V. Stein, F. Weinreich, and A. A. Zdebik
Molecular Structure and Physiological Function of Chloride Channels
Physiol Rev,
April 1, 2002;
82(2):
503 - 568.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-Z. Chuang, T. A. Milner, and C.-H. Sung
Subunit Heterogeneity of Cytoplasmic Dynein: Differential Expression of 14 kDa Dynein Light Chains in Rat Hippocampus
J. Neurosci.,
August 1, 2001;
21(15):
5501 - 5512.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Berryman and A. Bretscher
Identification of a Novel Member of the Chloride Intracellular Channel Gene Family (CLIC5) That Associates with the Actin Cytoskeleton of Placental Microvilli
Mol. Biol. Cell,
May 1, 2000;
11(5):
1509 - 1521.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
E. Fernandez-Salas, M. Sagar, C. Cheng, S. H. Yuspa, and W. C. Weinberg
p53 and Tumor Necrosis Factor alpha Regulate the Expression of a Mitochondrial Chloride Channel Protein
J. Biol. Chem.,
December 17, 1999;
274(51):
36488 - 36497.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. M. Tulk, P. H. Schlesinger, S. A. Kapadia, and J. C. Edwards
CLIC-1 Functions as a Chloride Channel When Expressed and Purified from Bacteria
J. Biol. Chem.,
August 25, 2000;
275(35):
26986 - 26993.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. J. Harrop, M. Z. DeMaere, W. D. Fairlie, T. Reztsova, S. M. Valenzuela, M. Mazzanti, R. Tonini, M. R. Qiu, L. Jankova, K. Warton, et al.
Crystal Structure of a Soluble Form of the Intracellular Chloride Ion Channel CLIC1 (NCC27) at 1.4-A Resolution
J. Biol. Chem.,
November 21, 2001;
276(48):
44993 - 45000.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|