 |
Previous Article | Next Article 
The Journal of Neuroscience, May 1, 1999, 19(9):3376-3383
Constitutively Active MuSK Is Clustered in the Absence of Agrin
and Induces Ectopic Postsynaptic-Like Membranes in Skeletal Muscle
Fibers
Graham
Jones,
Chris
Moore,
Said
Hashemolhosseini, and
Hans Rudolf
Brenner
Department of Physiology, University of Basel, CH-4051 Basel,
Switzerland
 |
ABSTRACT |
In skeletal muscle fibers, neural agrin can direct the accumulation
of acetylcholine receptors (AChR) and transcription of AChR subunit
genes from the subsynaptic nuclei. Although the receptor tyrosine
kinase MuSK is required for AChR clustering, it is less clear whether
MuSK regulates gene transcription. To elucidate the role of MuSK in
these processes, we constructed a constitutively active MuSK receptor,
MuSKneuTMuSK, taking advantage of the spontaneous homodimerization of
the transmembrane domain of neuT, an oncogenic variant of the neu/erbB2
receptor. In the extrasynaptic region of innervated muscle fibers,
MuSKneuTMuSK formed highly concentrated aggregates that colocalized
with AChR clusters. Associated with MuSK-induced AChR clusters was a
normal complement of synaptic proteins. Moreover, transcription of the
AChR- subunit gene was increased, albeit via an indirect mechanism
by MuSK-induced aggregation of erbB receptors and neuregulin. Although
neural agrin was not required, the activity of MuSKneuTMuSK was
nevertheless potentiated by ectopic expression of a muscle agrin
isoform inactive in AChR clustering. To define the role of the kinase
domain in the formation of a postsynaptic-like membrane, a second
fusion receptor, neuneuTMuSK, which included the MuSK kinase but
not the MuSK extracellular domain, was expressed. Significantly,
neuneuTMuSK induced AChR clusters that colocalized with aggregates
of endogenous MuSK. Taken together, it was concluded that the MuSK
kinase domain is sufficient to initiate the recruitment of additional
MuSK receptors, which then develop into highly concentrated aggregates
by means of a positive feedback loop to induce a postsynaptic membrane in the absence of neural agrin.
Key words:
agrin; muscle; MuSK; gene transcription; neuromuscular
junction; rat
 |
INTRODUCTION |
The formation of the developing
neuromuscular junction (NMJ) involves the nerve-induced transcription
of acetylcholine receptor (AChR) subunit genes in the subsynaptic
nuclei of the muscle fiber and the aggregation of their gene products,
the AChRs, at the subsynaptic membrane. Synapse formation is thought to
be initiated by the release of agrin from the nerve terminal (McMahan,
1990 ). Agrin is expressed in several isoforms (Ruegg and Bixby, 1998 ). Isoforms expressed by neurons, but not those by other tissues, cluster
AChRs expressed on the surface of cultured myotubes (Ruegg et al.,
1992 ; Ferns et al., 1993 ) by the activation of the receptor tyrosine
kinase MuSK (Glass et al., 1996 ). Because AChR clusters are induced
independently of agrin in cultured myotubes by the addition of
anti-MuSK antibodies (Xie et al., 1997 ; Hopf and Hoch, 1998 ), MuSK is
likely to be part of an agrin receptor complex. However, it remains
unclear whether MuSK can activate AChR gene transcription.
Synapse-specific transcription of AChR genes is thought to be induced
by neuregulins (NRGs) activating erbB receptor tyrosine kinases, both
of which are localized at the neuromuscular junction (for review, see
Fischbach and Rosen, 1997 ). However, the agrin- and NRG-activated
pathways may converge, because ectopic agrin can induce AChR gene
transcription in nonsynaptic muscle regions (Jones et al., 1997 ), where
it also aggregates muscle-derived NRGs and erbB receptors (Meier et
al., 1997 , 1998a ; Rimer et al., 1998 ). Furthermore, AChR gene
transcription in cultured myotubes induced by full-length agrin is
dependent on the erbB-receptor pathway (Meier et al., 1998a ).
Despite the evidence equating the biological activity of neural agrin
with MuSK activation in subsynaptic differentiation, several
inconsistencies remain unresolved. One question is how in extrasynaptic
regions of innervated muscle fibers where MuSK is reported to be absent
(Valenzuela et al., 1995 ), subsynaptic differentiation is initiated by
agrin, and which pathways induce MuSK aggregation at mature ectopic
postsynaptic-like membranes (Meier et al., 1997 ). Second, in cultured
myotubes, activation of MuSK by neural agrin added in soluble form
induces AChR clustering only but not AChR gene transcription (Jones et
al., 1996 ). Rather, the stable attachment of agrin to a laminin
substrate is required for gene transcription, consistent with the idea
that agrin may have roles beyond MuSK activation. For example,
signaling by agrin appears to involve integrins (Martin and Sanes,
1997 ). Finally, the role of an agrin-induced NRG/erbB receptor pathway
via activation of MuSK is unclear, because localization of erbB
receptors is absent in both rapsyn- and MuSK-deficient muscle, but
localized transcription appears to be absent from the latter only
(Gautam et al., 1995 ; Moscoso et al., 1995 ; DeChiara et al., 1996 ).
These problems were addressed by expressing in muscle fibers
constitutively active chimeric constructs comprising combinations of
the extra- and intracellular domains of MuSK and erbB2/neu separated by
the transmembrane domain of neuT, an oncogenic variant of the erbB2/neu
receptor (Bargmann et al., 1986 ). In this way, the roles of MuSK in
various aspects of agrin-induced differentiation of the postsynaptic
muscle membrane could be examined directly.
 |
MATERIALS AND METHODS |
Construction of MuSK and erbB2/neu fusion receptors.
MuSK cDNA was amplified by RT-PCR from primary rat myotube
poly(A+) RNA, and full-length cDNA was subcloned
into the EcoRI and XbaI sites of p_myc, a
pcDNA1 (Invitrogen, Carlsbad, CA)-based vector that includes five
copies of the myc epitope (Meier et al., 1998b ) to create pMuSK_myc.
Rat neuT cDNA was isolated from the vector pSVneuT (Bargmann et al.,
1986 ). The nomenclature adopted for this paper divides the receptor
cDNA into extracellular, transmembrane, and
intracellular/kinase domains. To construct pMuSKneuTneu, a region of
the extracellular domain of MuSK between nucleotides 1416 and 1596 was
amplified using the following PCR primers: MuSK1416_s, 5'-ggagtgcagcaagcttcccagc-3', which includes the HindIII
site at position 1426, and MuSK1596_asNdeI
5'-ccgggcacatatgcaggcgagacggcgaaggaagacgtgga-3' (Microsynth, Balgach, Switzerland), which introduces an NdeI
site (underlined) encoding a linker peptide AYV between the
MuSK extracellular domain and the neuT transmembrane domain in the
completed fusion receptor. The transmembrane domain and part of the
intracellular domain of neuT was amplified using the following
oligonucleotides: neuT1985_sNdeI
5'-ccggggcatatgtgacattcatcattgcaactgtagagggcgtc-3', which
introduces an NdeI site and neuT2406_as
5'-gatgtcaggcagatgccc-3'. The resulting PCR product was digested with
NdeI and XbaI (at nucleotide 2332) and subcloned
with the HindIII- and NdeI-digested MuSK PCR
product into pMuSK_myc digested with HindIII and
XbaI. This fragment was then excised by digestion with
EcoRI and XbaI and ligated with the intracellular
region of neuT by digesting pSVneuT with XbaI and
XhoI and subcloning into pCDNAI digested with
EcoRI and XhoI. To construct pMuSKneuTMuSK_myc,
the following PCR amplifications were performed: pMuSKneuTneu was
amplified using MuSK1416_s and MuSKneuT_as
5'-cctccttcggcagcaatagattaggattccaacgacc-3', which included
MuSK intracellular domain (underlined) and neuT transmembrane
sequences; intracellular domains of MuSK were amplified using MuSK1663_s 5'-tattgctgccgaaggagg-3', which includes the same
region as underlined in MuSKneuT_as and MuSK2727_as. The two PCR
products were diluted, mixed, and reamplified using the flanking
primers MuSK1416_s and MuSK2727_as. The resulting product was isolated
and digested with HindIII and BlpI (at position
1812) and subcloned into pMuSK_myc digested with HindIII and
BlpI. To construct pneuneuTMuSK, a fragment of neuT
extending from the extracellular domain into the neuT
transmembrane domain was amplified using the primers neu1886_s,
5'-gaggagggcatatgccag-3' and neuTM.Glu_as, 5'-ggacgccctctacagttgc-3';
the neuT transmembrane domain into the MuSK intracellular domain was
amplified using the primers neuTM.Glu_s, 5'-gcaactgtagagggcgtcc-3', and
MuSK1921_as, 5'-cctccttcagcatcttcacagccacc-3'. The resulting PCR
products were diluted, mixed, and reamplified using neu1886_s and
MuSK_as. The resulting PCR product was digested with the
restriction endonucleases NdeI and BlpI and
combined with pMuSK_myc digested with HindIII and
BlpI and an neuT extracellular fragment
HindIII/NdeI. The resulting constructs were then
sequenced, and equivalent expression of MuSKneuTMuSK, MuSKneuTneu, and
neuneuTMuSK was confirmed by immunoprecipitation and Western blot
analysis of transfected Cos-1 cells.
Construction of pGFP-S6. To identify transfected myoblasts
and injected muscle fibers, we constructed a green fluorescent protein
(GFP) (Clontech, Palo Alto, CA) that was targeted into the nucleus. To
do this, three nuclear localization signals (NLSs) present at the C
terminus of the S6 protein (Schmidt et al., 1995 ) were fused to the C
terminus of humanized GFP. An EcoRI restriction endonuclease
site was introduced via PCR at the 3' end of cDNA encoding humanized
GFP, which was then cloned 5' HindIII-EcoRI 3'
into the vector pCMX-pI2 (Umesono et al., 1991 ). A 251 bp fragment of
the cDNA encoding the three NLSs of protein S6 was
amplified using the following primers: S6F 5'-
aaagaattcaagaaacctaggaccaaagca-3', S6R
5'-tcaggatccctatttctgactggattcaga-3'. S6F includes the
first NLS of S6, and S6R includes a stop codon. The resulting
PCR product was digested with EcoRI and
BamHI (underlined in S6F and S6R) and subcloned into the
EcoRI-BamHI sites of pCMX-pI2/GFP to generate pGFP-S6.
Transfection of C2C12 myoblasts. For analysis of
transcriptional activity of the -216 subunit gene promoter (Jones et
al., 1996 ), 1 × 105 C2C12 cells were passaged
onto six-well plates that had been coated with either laminin alone or
laminin with agrin as described (Meier et al., 1998a ). Myoblasts were
transfected with 800 ng of reporter plasmid DNA, 200 ng of the
appropriate receptor plasmid, and 200 ng of pCH110 (Pharmacia BioTech
Europe) using 5 µl FuGENE 6 (Roche Diagnostics Boehringer Mannheim,
Mannheim, Germany) according to the manufacturer's instructions.
Myotubes were analyzed 5 d after transfection. Results are
averages of three dishes each from at least three independent
transfections. For immunoprecipitation experiments, C2C12 myoblasts
were transfected with 1 µg of the appropriate plasmid expression
vector and allowed to differentiate for 5 d. Cells were lysed, and
membrane proteins were immunoprecipitated as described (Meier et al.,
1998a ).
Injection of muscle fibers and immunohistochemistry. Single
rat soleus fibers were injected as described previously (Jones et al.,
1997 ; Meier et al., 1997 ) with 80 ng/µl pGFP-S6, 100 ng/µl pMuSKneuTMuSK_myc or pneuneuTMuSK_myc, and where applicable, 100 ng/µl pcAgrin7A0B0. Rats were killed 4 weeks
later. For immunohistochemistry, muscles were frozen in prechilled
isopentane and cut into 12 µm cross sections. Immunohistochemistry of
unfixed cross sections was performed using antibodies and methods as
described (Meier et al., 1997 ).
Quantitative TaqMan fluorescent real time PCR analysis of
AChR- subunit RNA in injected muscles. Expression of GFP-S6
allowed direct visualization of injected fibers, the borders of which were marked before freezing. The injected and noninjected regions were
then excised, and total RNA was extracted using the Qiagen RNeasy RNA
extraction kit (Qiagen AG, Basel, Switzerland). First-strand cDNA was
synthesized from 2 µg of total RNA primed with 250 ng of random
hexamers (Roche Diagnostics Boehringer Mannheim) using Superscript
reverse transcriptase (Life Technologies, Gaithersburg, MD).
First-strand cDNA was purified using the High Pure PCR Product Purification Kit (Roche Diagnostics Boehringer Mannheim).
The primers -actin sense 5'-ttcaacaccccagccatgt-3',
anti-sense 5'-gtggtacgaccagaggcataca-3', AChR- subunit sense
5'-ccaacgactcacgccacat-3', and anti-sense 5'-ggcgcggcagtagctcta-3' were
synthesized and flanked the TaqMan oligonucleotide probes -actin,
5'-(FAM)cgtagccatccaggctgtgttgtcc(TAMRA)-3' and AChR- ,
5'-(FAM)ccctcggctgcgccagatttt(TAMRA)-3'. TaqMan PCR was performed using
the TaqMan PCR Core Reagent Kit as described by the manufacturer
(Perkin-Elmer Applied Biosystems), with the exception that
MgCl2 was increased to 5 mM.
AChR- subunit mRNA was quantitated relative to -actin mRNA using
the comparative CT method.
CT (threshold cycle) is defined as the cycle
number at which the amount of amplified target passes a fixed threshold above baseline. CT is the difference in
threshold cycles between AChR- and -actin, calculated for RNA
isolated from either injected or noninjected regions. Subtracting the
CT of the noninjected region from the
CT of the injected region gives the value
 CT, which when applied in the
formula 2  CT, gives the amount of AChR-
subunit RNA in injected muscle fibers, normalized to -actin, and
relative to the noninjected region. To ensure that the
 CT calculation was valid, the efficiency with which both genes were amplified was examined and found to be the same.
 |
RESULTS |
Constitutive activation of MuSK induces ectopic AChR clusters
To examine the biological activity of MuSK independently of
activation by agrin, we designed an activated MuSK receptor construct. This was performed by exploiting the neuT oncogene, in which a single
point mutation in the transmembrane domain results in the spontaneous
formation of active neuT homodimers. It is now apparent that although
the transmembrane domain of the receptor tyrosine kinases is required
for activity, correct biological signaling also involves dimerization
of the extracellular and kinase domains (Siegel and Muller, 1996 ; Burke
et al., 1997 ; Tzahar et al., 1997 ). On the basis of these findings, we
reasoned that a MuSK receptor fusion construct, MuSKneuTMuSK, in which
the MuSK extracellular and kinase domains were separated by a neuT
transmembrane domain (for the nomenclature of the fusion constructs,
see Fig. 1), would homodimerize yet
retain MuSK biological activity.

View larger version (26K):
[in this window]
[in a new window]
|
Figure 1.
Schematic of MuSK and neu/erbB2 receptor fusion
constructs. The nomenclature adopted divides each receptor tyrosine
kinase into extracellular, transmembrane (TM),
and intracellular/kinase domains. Also shown is the C-terminal myc tag.
The plasmid encoding each chimeric receptor is denoted by the prefix
"p" and myc as suffix. Wild-type MuSK
(rMuSK) is indicated as are each of the fusion
receptor products encoded by each plasmid: MuSKneuTMuSK,
MuSKneuTneu, and neuneuTMuSK.
|
|
In response to neural agrin, the MuSK kinase domain is only transiently
phosphorylated over a time course of minutes (Glass et al., 1996 ), and
a similar problem occurs with constitutive activation of the MuSK
kinase domain. Therefore, because only those isoforms of agrin that
induce AChR clustering also phosphorylate MuSK (Glass et al., 1996 ),
AChR clustering in C2C12 myotubes was used to assay MuSKneuTMuSK
activity. C2C12 myoblasts were transfected with pMuSKneuTMuSK_myc and
pGFP-S6, which encodes nuclear-localized GFP. AChR clusters were
induced on 80% of GFP-positive myotubes, which compared favorably with
AChR clustering on myotubes transfected with pGFP-S6 but treated with
neural agrin (94% AChR cluster/GFP colocalization). In contrast, in
myoblasts transfected with pMuSKneuTneu_myc, which consists of the MuSK
extracellular domain but the erbB2/neu kinase domain, only 3% of
GFP-positive myotubes exhibited AChR clustering, the same as that seen
for untreated myotubes transfected with pGFP-S6 alone (data not shown).
We next investigated whether activation of MuSK was sufficient to
induce AChR clusters in the nerve-free region of innervated muscle fibers. To identify injected fibers, pMuSKneuTMuSK_myc was coinjected with pGFP-S6. Overexpression of constitutively active MuSKneuTMuSK induced approximately one AChR cluster per injected
fiber [Fig. 2, MuSKneuTMuSK,
and right panel, cAgrin 7A0B0 (1.2 ± 0.1 AChR clusters/injected fiber; SEM, n = 9 muscles/200 fibers)]; they were similar in number and appearance to those induced
by low levels of neural agrin. Similar findings were obtained with a
chimera lacking a myc tag (data not shown). In contrast, ectopic
expression of wild-type MuSK only rarely induced AChR clusters, which
were small and point-like in appearance (data not shown).

View larger version (71K):
[in this window]
[in a new window]
|
Figure 2.
Constitutive activation of MuSK is sufficient to
induce ectopic, activity-resistant AChR clusters but is enhanced by a
muscle agrin isoform, cAgrin7A0B0. In muscle fibers
injected with pMuSKneuTMuSK_myc, generally one AChR cluster was
recorded per injected fiber (MuSKneuTMuSK, AChR)
and was associated with clusters of GFP-positive nuclei
(GFP). cAgrin7A0B0 secreted from neighboring
fibers increased the number of AChR clusters on
pMuSKneuTMuSK_myc-injected fibers (MuSKneuTMuSK/cAgrin).
In the example shown, three AChR clusters (arrows) are
present in close proximity on the same injected fiber as seen by
colocalization with clusters of GFP-positive nuclei. Analysis of the
average number of AChR clusters per GFP-positive fiber showed that
cAgrin7A0B0 increased the average number of
MuSKneuTMuSK-induced AChR clusters per injected fiber more than twofold
(right panel, +cAgrin 7A0B0; SEM, n = 4 muscles, 100 fibers) over that observed in muscle fibers injected
with pMuSKneuTMuSK_myc alone (right panel, cAgrin
7A0B0; SEM, n = 9 muscles, 200 fibers).
Scale bar, 50 µm.
|
|
It was shown previously that the distribution of endogenous MuSK is
coextensive with that of ectopic agrin deposits, independent of whether
an active or an inactive isoform of agrin was expressed (Meier et al.,
1997 ; D. M. Hauser and M. A. Ruegg, personal
communication). This suggests that agrin may influence AChR
clustering via two mechanisms: (1) by accumulating MuSK and (2) by
phosphorylating MuSK. We were therefore interested to see
whether an inactive muscle isoform of chick agrin influenced the
appearance of MuSKneuTMuSK and/or AChR clusters. To do this, expression
plasmids encoding either MuSKneuTMuSK or chick agrin,
cAgrin7A0B0, were injected into neighboring muscle
fibers. Although the morphology of the resulting AChR clusters remained
similar to those induced by MuSKneuTMuSK alone (Fig. 2,
MuSKneuTMuSK/cAgrin), cAgrin7A0B0 increased the average number of AChR clusters on pMuSKneuTMuSK_myc-injected fibers
more than twofold, such that several AChR clusters were now present on
each injected fiber examined [Fig. 2, right panel, +cAgrin
7A0B0 (2.6 ± 0.3 AChR clusters/injected fiber; SEM,
n = 4 muscles/100 fibers)]. Thus, MuSKneuTMuSK induced
ectopic AChR clusters independently of neural agrin, but this activity
was enhanced by exogenous chick muscle agrin
cAgrin7A0B0.
Activation of the MuSK kinase domain initiates recruitment and
aggregation of additional MuSK receptors
Endogenous MuSK colocalizes with ectopic neural (Meier et al.,
1997 ) and muscle agrin isoforms (Hauser and Ruegg, personal communication), suggesting that agrin may be involved in the
localization of MuSK to the NMJ. To examine the distribution of
MuSKneuTMuSK in the absence of agrin, fibers injected with
pMuSKneuTMuSK_myc were analyzed in frozen cross sections through the
injected region. First, the distribution of MuSKneuTMuSK was
determined by immunohistochemistry using antibodies that recognized the
extracellular domain of MuSK (Meier et al., 1997 ) or the C-terminal myc
tag. Intense myc immunoreactivity colocalized with AChR clusters, with
only faint staining extending throughout the cytoplasm and around the
remainder of the muscle fiber circumference (Fig.
3A, MuSKneuTMuSK,
myc). MuSK immunoreactivity was similarly concentrated at AChR
clusters (Fig. 3A, MuSKneuTMuSK, MuSK). In
muscles injected with pMuSKneuTMuSK_myc and
pcAgrin7A0B0, concentrated aggregates of
MuSKneuTMuSK still colocalized with AChRs (data not shown). The
formation of highly concentrated aggregates of MuSKneuTMuSK coincident
with AChR clusters, both in the presence and absence of
cAgrin7A0B0, thus implies a positive feedback loop, driven by the activation of MuSK itself. Furthermore, because MuSKneuTneu did not induce AChR clustering in injected muscle fibers
(data not shown), the MuSK kinase domain was essential for this
process. To directly test whether activation of the MuSK kinase was
sufficient for the recruitment of MuSK, we constructed pneuneuTMuSK_myc, which includes the erbB2/neu extracellular domain and
the MuSK kinase domain (Fig. 1). In contrast to MuSKneuTMuSK, neuneuTMuSK did not induce AChR clusters in C2C12 myotubes (data not
shown), similar to a trkC/MuSK chimera, which also lacks the MuSK
extracellular domain and is consistent with the idea that the MuSK
extracellular domain is required for AChR clustering (Glass et al.,
1997 ). Surprisingly, however, ectopic expression of neuneuTMuSK in
innervated muscle fibers induced AChR clusters indistinguishable from
those induced by MuSKneuTMuSK (Fig. 3B, neuneuTMuSK, AChR),
suggesting that the MuSK extracellular domain must be supplied by
endogenous MuSK. Indeed, both neuneuTMuSK, identified specifically by
an anti-myc antibody (Fig. 3B, neuneuTMuSK, myc), and
endogenous MuSK, identified by an antibody against the extracellular
domain of MuSK (Fig. 3B, neuneuTMuSK, MuSK) (Meier et
al., 1997 ), colocalized with AChR clusters.

View larger version (48K):
[in this window]
[in a new window]
|
Figure 3.
A, Distribution of AChRs and
MuSKneuTMuSK in injected fibers. MuSKneuTMuSK was identified using an
antibody that recognized a C-terminal myc epitope (myc)
(bottom panel). Highly concentrated deposits of
MuSKneuTMuSK colocalized with AChR clusters (AChR).
Similarly, by using an antibody that recognized the extracellular
domain of MuSK, MuSK immunoreactivity was restricted to AChR clusters
(MuSK). B, Ectopic expression of neuneuTMuSK,
which includes the MuSK kinase domain but not the MuSK extracellular
domain, recruits endogenous MuSK and induces AChR clusters in
innervated muscle fibers. AChR clusters induced by neuneuTMuSK
(AChR) colocalize with neuneuTMuSK (myc) and
endogenous MuSK (MuSK), resolved using either anti-myc or
anti-MuSK (extracellular domain) antibodies, respectively.
Bottom panel, Summary of receptor recognition by
anti-myc and anti-MuSK antibodies. Scale bar, 50 µm.
|
|
The association of neuneuTMuSK with endogenous MuSK receptors was
confirmed by immunoprecipitation experiments. Extracts from C2C12
myotubes transfected with pneuneuTMuSK_myc were immunoprecipitated with
an anti-myc antibody and analyzed by Western blotting using an
anti-MuSK antibody that does not recognize neuneuTMuSK (Fig. 4, lane 2). A single band of
100 kDa was detected, corresponding to endogenous MuSK. A similar
result is shown for C2C12 myotubes transfected with pMuSKneuTMuSK_myc
(Fig. 4, lane 3). However, in myotubes transfected with
pMuSKneuTneu_myc, no endogenous MuSK was co-immunoprecipitated.
Instead, only MuSKneuTneu (120 kDa) was detected using an anti-MuSK
antibody (Fig. 4, lane 4). Furthermore, because
neither endogenous erbB2 nor erbB3 receptors were co-immunoprecipitated with neuneuTMuSK or MuSKneuTneu (data not shown), the chimeric receptors primarily formed homodimers. Together, these results suggested that activation of the MuSK kinase domain was required for
the aggregation of endogenous MuSK receptors seen at ectopic AChR
clusters.

View larger version (59K):
[in this window]
[in a new window]
|
Figure 4.
neuneuTMuSK interacts with endogenous MuSK
receptors in C2C12 myotubes. Lysates from C2C12 myotubes transfected
with pGFP-S6 alone (lane 1), pneuneuTMuSK_myc
(lane 2), pMuSKneuTMuSK_myc (lane
3), or pMuSKneuTneu_myc (lane 4) were
immunoprecipitated with anti-myc antibody. Immunoprecipitated proteins
were analyzed by Western blotting by incubation with an anti-MuSK
antibody that recognized the extracellular domain of MuSK. Molecular
weight markers indicated in kilodaltons.
|
|
MuSKneuTMuSK induces a postsynaptic membrane that includes a normal
complement of synaptic proteins
Rapsyn, phosphotyrosine, and utrophin each colocalized with AChR
clusters induced by MuSKneuTMuSK (data not shown). MuSKneuTMuSK also
recruited laminin- 2 (Fig. 5,
lam- 2), a synaptic component of the
extracellular matrix potentially important in the differentiation of
the presynaptic nerve terminal (Porter et al., 1995 ; Patton et al.,
1997 ). Also present at ectopic AChR clusters was the postsynaptic membrane protein -dystroglycan (Fig. 5, -DG).
-Dystroglycan binds noncovalently with the extracellular
glycoprotein -dystroglycan, and both are integral components of the
dystrophin-associated protein complex (Tinsley et al., 1994 ). In
addition, both neural and muscle agrin bind -dystroglycan via
domains not required for MuSK activation (Gesemann et al., 1996 ). In
muscle fibers expressing MuSKneuTMuSK, no accumulation of endogenous
muscle agrin was seen at MuSKneuTMuSK-induced AChR clusters (data not shown; see also Meier et al., 1997 ). However, ectopic expression of
chick muscle agrin cAgrin7A0B0 resulted in deposits of
cAgrin7A0B0 at AChR clusters in neighboring
pMuSKneuTMuSK_myc-injected fibers (Fig. 5, cAgrin). Thus,
additional binding sites for agrin are present at MuSKneuTMuSK-induced
AChR clusters.

View larger version (77K):
[in this window]
[in a new window]
|
Figure 5.
MuSKneuTMuSK-induced AChR clusters include a
normal complement of postsynaptic proteins. AChR clusters were
identified (AChR) and examined for the presence of
laminin- 2 (lam- 2), -dystroglycan
( -DG), and NaCh. In muscles injected
with pMuSKneuTMuSK and pcAgrin7A0B0, deposits of
cAgrin7A0B0 at AChR clusters were observed (cAgrin,
arrow). Scale bar, 50 µm.
|
|
We also examined whether voltage-activated
Na+-channels (NaChs) were present. Unlike the AChR
channels, which aggregate early in synapse formation and become
localized to the crests of the postsynaptic folds (Fertuck and
Salpeter, 1976 ), NaChs aggregate late in the maturation of the
postsynaptic membrane (Lupa et al., 1993 ), and they are concentrated in
the troughs of the postsynaptic folds (Boudier et al., 1992 ),
suggesting that the aggregation and localization of NaChs are
regulated differently to the AChRs (Colledge and Froehner, 1998 ).
However, NaChs also colocalized with MuSKneuTMuSK-induced AChR clusters
(Fig. 5, NaCh). Therefore, clustering of NaChs is also
regulated by MuSK.
Activation of MuSK aggregates erbB receptors and NRGs
We next asked whether MuSK, in the absence of neural agrin,
induced the assembly of the erbB/NRG signaling pathway. Indeed, using
an antibody specific for the mammalian AChR- subunit, we found that
AChR clusters were of the adult AChR subtype (Fig. 6, AChR- ) and that such
AChR clusters contained aggregates of NRGs (Fig. 6, NRG),
erbB2 (Fig. 6, erbB2), and erbB3 receptors (data not shown).
To ascertain whether this was reflected in increased gene
transcription, AChR- subunit mRNA from the region of injected muscle
expressing MuSKneuTMuSK was quantified using a real-time RT-PCR assay.
To increase the sensitivity of this assay, we used muscles that had
been co-injected with pMuSKneuTMuSK_myc and pcAgrin7A0B0. Ectopic expression of pcAgrin7A0B0 alone did not
increase AChR- subunit mRNA in the injected region (1.15 ± 0.1, SEM; n = 3 muscles), whereas expression of
pMuSKneuTMuSK_myc and pcAgrin7A0B0 increased AChR-
subunit mRNA by up to fourfold (3.8 ± 0.3, SEM; n = 3 muscles). The close agreement between these results and those from
similar experiments using neural agrin (Jones et al., 1997 ; Meier et
al., 1997 ; Rimer et al., 1998 ) is consistent with the hypothesis that MuSKneuTMuSK activates AChR gene transcription by organizing the erbB/NRG pathway.

View larger version (113K):
[in this window]
[in a new window]
|
Figure 6.
MuSKneuTMuSK-induced AChR clusters include the
AChR- subunit and colocalize with the erbB2 receptor tyrosine kinase
and NRGs. AChR clusters were identified (AChR) and examined
for the presence of the AChR- subunit (AChR- ),
NRGs (NRG), or erbB2 (erbB2). Scale bar,
50 µm.
|
|
We next sought to test this hypothesis further in cultured C2C12
myotubes, which have proved to be a convenient and reliable model for
examining the regulation of AChR gene transcription by agrin (Jones et
al., 1996 ; Meier et al., 1998a ). Initially, we compared the
transcriptional activation imparted by activation of either the MuSK or
erbB2/neu kinase domains. For this purpose, an AChR- subunit
promoter reporter plasmid, pLCF216 (Jones et al., 1996 ), was
cotransfected with either pMuSKneuTneu_myc or pMuSKneuTMuSK_myc.
Surprisingly, unlike in innervated muscle fibers, no significant
increase in luciferase activity was induced by MuSKneuTMuSK (Fig.
7, MuSK). In contrast,
MuSKneuTneu clearly activated transcription, with luciferase activity
increased approximately fivefold over that seen for MuSKneuTMuSK or in
control cultures (Fig. 7, neu).

View larger version (22K):
[in this window]
[in a new window]
|
Figure 7.
MuSK does not directly increase transcription of
the AChR- subunit gene in C2C12 myotubes. The transcriptional
activity of the MuSK and erbB2/neu kinase domains was directly compared
by culturing C2C12 myoblasts on a laminin substrate. Myoblasts were
transfected with either pLCF216 (control: con)
or pLCF216 with pMuSKneuTMuSK_myc (MuSK)
or pMuSKneuTneu_myc (neu), a chimeric receptor that
included the erbB2/neu kinase domain. The role of MuSK in AChR
transcription was investigated further by culturing C2C12 myoblasts on
a substrate of neural mini-agrin cN257C21B8
adhered to laminin (B8). The requirement for
erbB2/neu was tested by cotransfecting a dominant-negative erbB2/neu
mutant into myoblasts similarly cultured on a
laminin/cN257C21B8 substrate
(B8, neu KM). Mini-agrin
cN257C21B0 (B0), which
does not phosphorylate MuSK or induce AChR clustering, did not increase
transcription. Also shown is the transcriptional activity of a
saturating amount of soluble NRG (NRG).
|
|
The role of MuSK in neural agrin-induced AChR transcription in cultured
C2C12 myotubes was therefore reexamined using a truncated form of
neural agrin, mini-agrin cN257C21B8. In
cN257C21B8, the N-terminal
laminin-binding domain of agrin is linked to a minimal C-terminal 21 kDa fragment that is sufficient for MuSK phosphorylation, AChR
clustering, and binding of the putative agrin receptor (Gesemann et
al., 1995 , 1996 ; Meier et al., 1998b ). In innervated muscle fibers,
cN257C21B8 induces AChR- subunit gene
transcription as well as aggregation of NRG and erbB2 (Meier et al.,
1998b ). Importantly, in contrast to full-length neural agrin, the
truncated mini-agrin lacks the N-terminal heparan sulfate
glycosaminoglycan (GAG) side chains that are required for binding of
NRG (Meier et al., 1998a ), thus excluding transcriptional activation
independent of MuSK activation via GAG-attached NRGs.
As with full-length agrin (Jones et al., 1997 ), mini-agrin
cN257C21B8 bound to a laminin substrate (Fig.
7, B8), but not when added directly to the
culture supernatant (data not shown), increased AChR- subunit
promoter activity in a quantitatively similar manner to MuSKneuTneu
(Fig. 7, neu) or saturating NRG (Fig. 7, NRG). The induction of transcription by mini-agrin
cN257C21B8 was abolished by the expression of a
dominant negative erbB2/neu receptor (Fig. 7, B8
neu KM), which inhibits NRG-dependent activation of
intracellular pathways (Wallasch et al., 1995 ). In contrast, an
inactive mini-agrin isoform, cN257C21B0,
which does not induce AChR clustering, failed to increase AChR-
subunit gene transcription (Fig. 7, B0). Thus, in C2C12 myotubes, activated MuSK was not sufficient by itself to
activate AChR gene transcription directly. Instead, transcription activated by MuSK required the NRG/erbB pathway, dependent on interaction with substrate-bound agrin or a related molecule, a
condition that in innervated muscle fibers may be met by a native basal
lamina component.
 |
DISCUSSION |
MuSK kinase domain activation recruits additional
MuSK receptors
It is thought that a prerequisite for the assembly of the
postsynaptic muscle membrane is the formation of a MuSK scaffold (Apel
et al., 1997 ; Glass and Yancopoulos, 1997 ). The observation that
MuSKneuTMuSK was not distributed evenly around the circumference of the
muscle fiber, but instead was concentrated at AChR clusters independently of agrin, showed that the formation of such a MuSK scaffold is an activity intrinsic to active MuSK. Previous reports have
shown that the MuSK ectodomain interacts with rapsyn (Apel et al.,
1997 ), whereas the kinase domain is required for phosphorylation of the
AChR- subunit (Glass et al., 1997 ), and that both domains are
required for AChR clustering. In results presented here, a chimeric
receptor lacking the MuSK ectodomain, neuneuTMuSK, induced ectopic AChR
clusters by recruiting endogenous MuSK receptors. Therefore, the
primary event in the recruitment of MuSK to a developing scaffold is
the activation of the kinase domain, which, given that these
experiments were done in the extra-synaptic region of innervated muscle
fibers, precedes the formation of AChR clusters. The recruitment of
MuSK via a positive feedback loop might be particularly important for
the induction by neural agrin of ectopic AChR clusters in the
extra-synaptic region of innervated muscles fibers, where MuSK
expression is low but not absent (C. Moore and H. R. Brenner,
unpublished observations).
The reasons for the failure of neuneuTMuSK to induce AChR clusters in
C2C12 myotubes remain unclear. One possible reason is that the
extracellular matrix differs between cultured C2C12 myotubes and
innervated muscle fibers. In addition, it should also be remembered that direct injection of plasmid DNA is an extremely efficient method
of transfecting muscle fibers. This might be important in achieving a
concentrated point source of neuneuTMuSK, thereby facilitating the
recruitment of endogenous MuSK receptors and the formation of AChR clusters.
The ligand-independent activation of MuSK described here is similar to
the formation of active MuSK homodimers by activating antibodies (Xie
et al., 1997 ; Hopf and Hoch, 1998 ). It could also explain the
occasional small AChR clusters on a low number of myofibers in mice
deficient for agrin (Gautam et al., 1996 ), arising through spontaneous
association of MuSK homodimers that in the absence of agrin would occur
only with low frequency. The formation of such foci of endogenous MuSK
could be promoted by the elevated level of MuSK expression in fetal and
neonatal myotubes (Valenzuela et al., 1995 ; Bowen et al., 1998 ). It is
possible that in denervated muscle, the formation of dense patches of
AChR clusters (Ko et al., 1977 ) is attributable to increased levels of
MuSK, which leads to the ligand-independent formation of active homodimers.
Activation of MuSK in injected muscle fibers was sufficient to induce
localized deposits of laminin- 2. Interestingly, no accompanying
accumulation of endogenous muscle agrin was observed. Thus, because
laminin present in the muscle basal lamina binds agrin (Denzer et al.,
1997 ), this indicates that laminin- 2 is aggregated at the NMJ
independently of its binding to agrin. In the context of laminin 11 ( 5 2 1), laminin- 2 is a stop signal for motor neurons at the
NMJ (Patton et al., 1997 ). This would explain why, in agrin-deficient
mice, innervating neurons do sometimes stop and differentiate at sites
opposing agrin-independent AChR clusters (Gautam et al., 1996 ), whereas
in MuSK-deficient mice neither AChR clusters nor examples of an
arborized innervating motor neuron are observed (DeChiara et al.,
1996 ). However, laminin- 2 is unlikely to be the only MuSK-induced
retrograde signal. The differentiation of the presynaptic nerve
terminal is also affected in rapsyn-deficient mice (Gautam et al.,
1995 ), despite the presence in the synaptic basal lamina of
laminin- 2 and agrin, which is also a stop signal for motor neurons
(Campagna et al., 1995 ).
MuSK-induced AChR clustering potentiated by muscle agrin
Ectopic expression of a chick muscle cAgrin7A0B0
isoform facilitated, but was not essential for, AChR clusters induced
by MuSKneuTMuSK. Because agrin does not directly interact with MuSK (Glass et al., 1996 ), the modulation of MuSK activity by muscle cAgrin7A0B0 must require an additional protein. This
protein is probably distinct from the putative agrin receptor, which is
not recognized by isoforms of agrin lacking amino acid inserts at the B
slice site (i.e., B0) (Gesemann et al., 1996 ). A
strong candidate for this role is -dystroglycan, which binds to both neural and muscle agrin (Bowe et al., 1994 ; Gee et al., 1994 ; Gesemann
et al., 1996 ). In addition, agrin binding to -dystroglycan potentiates agrin-induced AChR clustering (Jacobson et al., 1998 ). Furthermore, -dystroglycan, which associates with -dystroglycan and is central to the dystrophin-associated protein complex, was concentrated at MuSKneuTMuSK-induced AChR clusters (Fig. 5), as it is
at the NMJ (Ervasti and Campbell, 1993 ).
The requirement of MuSK for synaptic gene transcription
Drawing together results obtained from innervated muscle fibers
and cultured myotubes, it was concluded that AChR- subunit gene
transcription, which at the NMJ occurs only from the subsynaptic nuclei
in response to innervation (Brenner et al., 1990 ; Witzemann et al.,
1991 ), was increased indirectly by MuSK via activation of the erbB/NRG
pathway. This conclusion contrasts with data from neonatal rapsyn
knock-out mice, in which MuSK remains accumulated and transcripts
encoding AChR - and -subunits are elevated, despite the absence
of erbB receptors from the postsynaptic membrane (Gautam et al., 1995 ;
Moscoso et al., 1995 ). However, high resolution in situ
hybridization in neonatal rat muscle with AChR -subunit mRNA-specific probes shows that in developing endplate regions, the
high level of -subunit mRNA, unlike -subunit mRNA, may originate from unfused myoblasts (Brenner et al., 1990 ).
In summary, we have shown that activation of the MuSK kinase domain
initiates a positive feedback loop whereby additional MuSK receptors
are recruited, resulting in concentrated foci of MuSK that then induce
AChR clusters. Although this process did not require neural agrin,
inactive muscle agrin facilitated the activity of MuSKneuTMuSK. Because
this agrin isoform does not bind the putative agrin receptor, different
domains within agrin can independently modulate the activity of MuSK.
Furthermore, MuSK is likely to be important in the differentiation of
the innervating motor neuron (laminin- 2) and later events in the
maturation of the postsynaptic membrane (NaChs). Finally, MuSK
indirectly activates synaptic gene transcription at the NMJ by assembly
of the NRG/erbB pathway.
 |
FOOTNOTES |
Received Dec. 18, 1998; revised Feb. 16, 1999; accepted Feb. 19, 1999.
This work was supported by grants from the Ott-Fonds of the Swiss
Academy of Medical Sciences (G.J.), the Swiss National Science Foundation, the Helmut Horten Stiftung, and the Sandoz Stiftung (H.R.B.). We thank Dr. M. A. Ruegg for agrin expression constructs and comments on this manuscript, and D. Hauser for the anti-Nsk2/MuSK antibody.
Correspondence should be addressed to Dr. H. R. Brenner,
Department of Physiology, University of Basel, Vesalgasse 1, CH-4051 Basel, Switzerland.
 |
REFERENCES |
-
Apel ED,
Glass DJ,
Moscoso LM,
Yancopoulos GD,
Sanes JR
(1997)
Rapsyn is required for MuSK signaling and recruits synaptic components to a MuSK-containing scaffold.
Neuron
18:623-635[Web of Science][Medline].
-
Bargmann CI,
Hung M-C,
Weinberg R
(1986)
Multiple independent activations of the neu oncogene by a point mutation altering the transmembrane domain of p185.
Cell
45:649-657[Web of Science][Medline].
-
Boudier J-L,
Treut TL,
Jover E
(1992)
Autoradiographic localization of voltage-dependent sodium channels on the mouse neuromuscular junction using I125-
scorpion toxin. II. Sodium channel distribution on postsynaptic membranes.
J Neurosci
12:454-466[Abstract]. -
Bowe MA,
Deyst KA,
Leszyk JD,
Fallon JR
(1994)
Identification and purification of an agrin receptor from Torpedo postsynaptic membranes: a heteromeric complex related to the dystroglycans.
Neuron
12:1173-1180[Web of Science][Medline].
-
Bowen DC,
Park JS,
Bodine S,
Stark JL,
Valenzuela DM,
Stitt TN,
Yancopoulos GD,
Lindsay RM,
Glass DJ,
DiStefano PS
(1998)
Localization and regulation of MuSK at the neuromuscular junction.
Dev Biol
199:309-319[Web of Science][Medline].
-
Brenner HR,
Witzemann V,
Sakmann B
(1990)
Imprinting of acetylcholine receptor message RNA accumulation in mammalian neuromuscular synapses.
Nature
344:544-547[Medline].
-
Burke CL,
Lemmon MA,
Coren BA,
Engelman DM,
Stern DF
(1997)
Dimerization of the p185neu transmembrane domain is necessary but not sufficient for transformation.
Oncogene
14:687-696[Web of Science][Medline].
-
Campagna JA,
Ruegg MA,
Bixby JL
(1995)
Agrin is a differentiation-inducing "stop-signal" for motorneurons in vitro.
Neuron
15:1365-1374[Web of Science][Medline].
-
Colledge M,
Froehner SC
(1998)
Signals mediating ion channel clustering at the neuromuscular junction.
Curr Opin Neurobiol
8:357-363[Web of Science][Medline].
-
DeChiara TM,
Bowen DC,
Valenzuela DM,
Simmons MV,
Poueymirou WT,
Thomas S,
Kinetz E,
Compton DL,
Rojas E,
Park JS,
Smith C,
DiStefano PS,
Glass DJ,
Burden SJ,
Yancopoulos GD
(1996)
The receptor tyrosine kinase MuSK is required for neuromuscular junction formation in vivo.
Cell
85:501-512[Web of Science][Medline].
-
Denzer AJ,
Brandenberger R,
Gesemann M,
Chiquet M,
Ruegg MA
(1997)
Agrin binds to the nerve-muscle basal lamina via laminin.
J Cell Biol
137:671-683[Abstract/Free Full Text].
-
Ervasti JM,
Campbell KP
(1993)
Dystrophin and the membrane skeleton.
Curr Opin Cell Biol
5:82-86[Medline].
-
Ferns MJ,
Campanelli JT,
Hoch W,
Scheller R,
Hall Z
(1993)
The ability of agrin to cluster AChRs depends on alternative splicing and on cell surface proteoglycans.
Neuron
11:491-502[Web of Science][Medline].
-
Fertuck HC,
Salpeter MM
(1976)
Quantitation of junctional and extrajunctional acetylcholine receptors by electron microscope autoradiography after 125I-alpha bungarotoxin binding at the mouse neuromuscular junction.
J Cell Biol
69:144-158[Abstract/Free Full Text].
-
Fischbach GD,
Rosen KM
(1997)
ARIA: a neuromuscular junction neuregulin.
Annu Rev Neurosci
20:429-458[Web of Science][Medline].
-
Gautam M,
Noakes PG,
Mudd J,
Nichol M,
Chu GC,
Sanes JR,
Merlie JP
(1995)
Failure of postsynaptic specialization to develop at neuromuscular junctions of rapsyn-deficient mice.
Nature
377:232-236[Medline].
-
Gautam M,
Noakes PG,
Moscoso L,
Rupp F,
Scheller RH,
Merlie JP,
Sanes JR
(1996)
Defective neuromuscular synaptogenesis in agrin-deficient mutant mice.
Cell
85:525-535[Web of Science][Medline].
-
Gee SH,
Montanaro F,
Lindenbaum MH,
Carbonetto S
(1994)
Dystroglycan-
, a dystrophin-associated glycoprotein, is a functional agrin receptor.
Cell
77:675-686[Web of Science][Medline]. -
Gesemann M,
Denzer AJ,
Ruegg MA
(1995)
Acetylcholine receptor-aggregating activity of agrin isoforms and mapping of the active site.
J Cell Biol
128:625-636[Abstract/Free Full Text].
-
Gesemann M,
Cavalli V,
Denzer AJ,
Brancaccio A,
Schumacher B,
Ruegg MA
(1996)
Alternative splicing of agrin alters its binding to heparin, dystroglycan, and the putative agrin receptor.
Neuron
16:755-767[Web of Science][Medline].
-
Glass DJ,
Yancopoulos GD
(1997)
Sequential roles of agrin, MuSK and rapsyn during neuromuscular junction formation.
Curr Biol
7:379-384.
-
Glass DJ,
Bowen DC,
Stitt TN,
Radziejewski C,
Bruno J,
Ryan TE,
Gies DR,
Shah S,
Mattsson K,
Burden SJ,
DiStefano PS,
Valenzeula DM,
DeChiara TM,
Yancopoulos GD
(1996)
Agrin acts via a MuSK receptor complex.
Cell
85:513-523[Web of Science][Medline].
-
Glass DJ,
Apel ED,
Shah S,
Bowen DC,
DeChiara TM,
Stitt TN,
Sanes JR,
Yancopoulos GD
(1997)
Kinase domain of the muscle-specific receptor tyrosine kinase (MuSK) is sufficient for phosphorylation but not clustering of acetylcholine receptors: required role for the MuSK ectodomain?
Proc Natl Acad Sci USA
94:8848-8853[Abstract/Free Full Text].
-
Hopf C,
Hoch W
(1998)
Dimerization of the muscle-specific kinase induces tyrosine phosphorylation of acetylcholine receptors and their aggregation on the surface of myotubes.
J Biol Chem
273:6467-6473[Abstract/Free Full Text].
-
Jacobson C,
Montanaro F,
Lindenbaum M,
Carbonetto S,
Ferns M
(1998)
-Dystroglycan functions in acetylcholine receptor aggregation but is not a coreceptor for agrin-MuSK signaling.
J Neurosci
18:6340-6348[Abstract/Free Full Text]. -
Jones G,
Herczeg A,
Ruegg MA,
Lichtsteiner M,
Kroger S,
Brenner HR
(1996)
Substrate-bound agrin induces expression of acetylcholine receptor
-subunit gene in cultured mammalian muscle cells.
Proc Natl Acad Sci USA
93:5985-5990[Abstract/Free Full Text]. -
Jones G,
Meier T,
Lichtsteiner M,
Witzemann V,
Sakmann B,
Brenner HR
(1997)
Induction by agrin of ectopic and functional postsynaptic-like membrane in innervated muscle.
Proc Natl Acad Sci USA
94:2654-2659[Abstract/Free Full Text].
-
Ko PK,
Anderson MJ,
Cohen MW
(1977)
Denervated skeletal muscle fibres develop discrete patches of high acetylcholine receptor density.
Science
196:540-542[Abstract/Free Full Text].
-
Lupa MT,
Krzemien DM,
Schaller KL,
Caldwell JH
(1993)
Aggregation of sodium channels during development and maturation of the neuromuscular junction.
J Neurosci
13:1326-1336[Abstract].
-
Martin PT,
Sanes JR
(1997)
Integrins mediate adhesion to agrin and modulate agrin signalling.
Development
124:3909-3917[Abstract].
-
McMahan UJ
(1990)
The agrin hypothesis.
Cold Spring Harb Symp Quant Biol
55:407-418[Abstract/Free Full Text].
-
Meier T,
Hauser DM,
Chiquet M,
Landmann L,
Ruegg MA,
Brenner HR
(1997)
Neural agrin induces ectopic postsynaptic specializations in innervated muscle fibers.
J Neurosci
17:6534-6544[Abstract/Free Full Text].
-
Meier T,
Masciulli F,
Moore C,
Schoumacher F,
Eppenberger U,
Denzer AJ,
Jones G,
Brenner HR
(1998a)
Agrin can mediate AChR gene expression in muscle by aggregation of muscle-derived neuregulins.
J Cell Biol
141:715-726[Abstract/Free Full Text].
-
Meier T,
Marangi PA,
Moll J,
Hauser DM,
Brenner H-R,
Ruegg MA
(1998b)
A minigene of neural agrin encoding the laminin-binding and acetylcholine receptor-aggregating domains is sufficient to induce postsynaptic differentiation in muscle fibres.
Eur J Neurosci
10:3141-3152[Web of Science][Medline].
-
Moscoso LM,
Chu GC,
Gautam M,
Noakes PG,
Merlie JP,
Sanes JR
(1995)
Synapse-associated expression of an acetylcholine receptor-inducing protein, ARIA/heregulin and its putative receptors, ErbB2 and ErbB3, in developing mammalian muscle.
Dev Biol
172:158-169[Web of Science][Medline].
-
Patton BL,
Miner JH,
Chiu AY,
Sanes JR
(1997)
Distribution and function of laminins in the neuromuscular system of developing, adult, and mutant mice.
J Cell Biol
139:1507-1521[Abstract/Free Full Text].
-
Porter BE,
Weis J,
Sanes JR
(1995)
A motorneuron-selective stop signal in the synaptic protein S-laminin.
Neuron
14:549-559[Web of Science][Medline].
-
Rimer M,
Cohen I,
Lømo T,
Burden SJ,
McMahan UJ
(1998)
Neuregulins and erbB receptors at neuromuscular junctions and at agrin-induced postsynaptic-like apparatus in skeletal muscle.
Mol Cell Neurosci
12:1-15[Web of Science][Medline].
-
Ruegg MA,
Bixby JL
(1998)
Agrin orchestrates synaptic differentiation at the vertebrate neuromuscular junction.
Trends Neurosci
21:22-27[Web of Science][Medline].
-
Ruegg MA,
Tsim KWK,
Horton SE,
Kroger S,
Escher G,
Gensch EM,
McMahan UJ
(1992)
The agrin gene codes for a family of basal lamina proteins that differ in function and distribution.
Neuron
8:691-699[Web of Science][Medline].
-
Schmidt C,
Lipsius E,
Kruppa J
(1995)
Nuclear and nucleolar targeting of human ribosomal protein S6.
Mol Biol Cell
6:1875-1885[Abstract].
-
Siegel PM,
Muller WJ
(1996)
Mutations affecting conserved cysteine residues within the extracellular domain of neu promote receptor dimerization and activation.
Proc Natl Acad Sci USA
93:687-696.
-
Tinsley JM,
Blake DJ,
Zuellig RA,
Davies KE
(1994)
Increasing complexity of the dystrophin-associated complex.
Proc Natl Acad Sci USA
91:8703-8313.
-
Tzahar E,
Pinkas-Kramarski R,
Moyer JD,
Klapper LN,
Alroy I,
Levkowitz G,
Shelly M,
Henis S,
Eisenstein M,
Ratzkin BJ,
Sela M,
Andrews GC,
Yarden Y
(1997)
Bivalence of EGF-like ligands drives the ErbB signaling network.
EMBO J
16:4938-4950[Web of Science][Medline].
-
Umesono K,
Murakami KK,
Thompson CC,
Evans RM
(1991)
Direct repeats as selective response elements for the thyroid hormone, retinoic acid, and vitamin D3 receptors.
Cell
65:1255-1266[Web of Science][Medline].
-
Valenzuela DM,
Stitt TN,
DiStefano PS,
Rojas E,
Mattsson K,
Compton DL,
Nunez L,
Park JS,
Stark JL,
Gies DR,
Thomas S,
Beau MML,
Fernald AA,
Copeland NG,
Jenkins NA,
Burden SJ,
Glass DJ,
Yancopoulos GD
(1995)
Receptor tyrosine kinase specific for the skeletal muscle lineage: expression in embryonic muscle, and at the neuromuscular junction, and after injury.
Neuron
15:573-584[Web of Science][Medline].
-
Wallasch C,
Weiss FU,
Niederfellner G,
Jallal B,
Issing W,
Ullrich A
(1995)
Heregulin-dependent regulation of HER2/neu oncogenic signalling by heterodimerization ith HER3.
EMBO J
14:4267-4275[Web of Science][Medline].
-
Witzemann V,
Brenner HR,
Sakmann B
(1991)
Neural factors regulate AChR subunit mRNAs at rat neuromuscular junctions
J Cell Biol
114:125-141[Abstract/Free Full Text].
-
Xie M-H,
Yuan J,
Adams C,
Gurney A
(1997)
Direct demonstration of MuSK involvement in acetylcholine receptor clustering through identification of agonist ScFv.
Nat Biotechnol
15:768-771[Web of Science][Medline].
Copyright © 1999 Society for Neuroscience 0270-6474/99/1993376-08$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
S. Lin, M. Maj, G. Bezakova, J. P. Magyar, H. R. Brenner, and M. A. Ruegg
Muscle-wide secretion of a miniaturized form of neural agrin rescues focal neuromuscular innervation in agrin mutant mice
PNAS,
August 12, 2008;
105(32):
11406 - 11411.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Lin, L. Landmann, M. A. Ruegg, and H. R. Brenner
The Role of Nerve- versus Muscle-Derived Factors in Mammalian Neuromuscular Junction Formation
J. Neurosci.,
March 26, 2008;
28(13):
3333 - 3340.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Lu, H.-S. Je, P. Young, J. Gross, B. Lu, and G. Feng
Regulation of synaptic growth and maturation by a synapse-associated E3 ubiquitin ligase at the neuromuscular junction
J. Cell Biol.,
July 30, 2007;
177(6):
1077 - 1089.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Panzer, Y. Song, and R. J. Balice-Gordon
In Vivo Imaging of Preferential Motor Axon Outgrowth to and Synaptogenesis at Prepatterned Acetylcholine Receptor Clusters in Embryonic Zebrafish Skeletal Muscle
J. Neurosci.,
January 18, 2006;
26(3):
934 - 947.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Jaworski and S. J. Burden
Neuromuscular Synapse Formation in Mice Lacking Motor Neuron- and Skeletal Muscle-Derived Neuregulin-1
J. Neurosci.,
January 11, 2006;
26(2):
655 - 661.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. F. Bentzinger, P. Barzaghi, S. Lin, and M. A. Ruegg
Overexpression of mini-agrin in skeletal muscle increases muscle integrity and regenerative capacity in laminin-{alpha}2-deficient mice
FASEB J,
June 1, 2005;
19(8):
934 - 942.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Strochlic, A. Cartaud, A. Mejat, R. Grailhe, L. Schaeffer, J.-P. Changeux, and J. Cartaud
14-3-3 {gamma} associates with muscle specific kinase and regulates synaptic gene transcription at vertebrate neuromuscular synapse
PNAS,
December 28, 2004;
101(52):
18189 - 18194.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Mittaud, A. A. Camilleri, R. Willmann, S. Erb-Vogtli, S. J. Burden, and C. Fuhrer
A Single Pulse of Agrin Triggers a Pathway That Acts To Cluster Acetylcholine Receptors
Mol. Cell. Biol.,
September 15, 2004;
24(18):
7841 - 7854.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Leu, E. Bellmunt, M. Schwander, I. Farinas, H. R. Brenner, and U. Muller
Erbb2 regulates neuromuscular synapse formation and is essential for muscle spindle development
Development,
June 1, 2003;
130(11):
2291 - 2301.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Lacazette, S. Le Calvez, N. Gajendran, and H. R. Brenner
A novel pathway for MuSK to induce key genes in neuromuscular synapse formation
J. Cell Biol.,
May 26, 2003;
161(4):
727 - 736.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-N. Tseng, L. Zhang, M. Cascio, and Z.-Z. Wang
Calcium Plays a Critical Role in Determining the Acetylcholine Receptor-clustering Activities of Alternatively Spliced Isoforms of Agrin
J. Biol. Chem.,
May 2, 2003;
278(19):
17236 - 17245.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Herbst, E. Avetisova, and S. J. Burden
Restoration of synapse formation in Musk mutant mice expressing a Musk/Trk chimeric receptor
Development,
January 12, 2002;
129(23):
5449 - 5460.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Moore, M. Leu, U. Muller, and H. R. Brenner
Induction of multiple signaling loops by MuSK during neuromuscular synapse formation
PNAS,
November 15, 2001;
(2001)
251291598.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. C. Trinidad, G. D. Fischbach, and J. B. Cohen
The Agrin/MuSK Signaling Pathway Is Spatially Segregated from the Neuregulin/ErbB Receptor Signaling Pathway at the Neuromuscular Junction
J. Neurosci.,
December 1, 2000;
20(23):
8762 - 8770.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Briguet and M. A. Ruegg
The Ets Transcription Factor GABP Is Required for Postsynaptic Differentiation In Vivo
J. Neurosci.,
August 15, 2000;
20(16):
5989 - 5996.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. G. Rossi, A. E. Vazquez, and R. L. Rotundo
Local Control of Acetylcholinesterase Gene Expression in Multinucleated Skeletal Muscle Fibers: Individual Nuclei Respond to Signals from the Overlying Plasma Membrane
J. Neurosci.,
February 1, 2000;
20(3):
919 - 928.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Tanowitz, J. Si, D.-H. Yu, G.-S. Feng, and L. Mei
Regulation of Neuregulin-Mediated Acetylcholine Receptor Synthesis by Protein Tyrosine Phosphatase SHP2
J. Neurosci.,
November 1, 1999;
19(21):
9426 - 9435.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Zhou, D. J. Glass, G. D. Yancopoulos, and J. R. Sanes
Distinct Domains of MuSK Mediate Its Abilities to Induce and to Associate with Postsynaptic Specializations
J. Cell Biol.,
September 6, 1999;
146(5):
1133 - 1146.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Moore, M. Leu, U. Muller, and H. R. Brenner
Induction of multiple signaling loops by MuSK during neuromuscular synapse formation
PNAS,
December 4, 2001;
98(25):
14655 - 14660.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Sander, B. A. Hesser, and V. Witzemann
MuSK induces in vivo acetylcholine receptor clusters in a ligand-independent manner
J. Cell Biol.,
December 24, 2001;
155(7):
1287 - 1296.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|