 |
Previous Article | Next Article 
The Journal of Neuroscience, May 15, 2000, 20(10):3612-3621
IFN Enhances Microglial Reactions to Hippocampal Axonal
Degeneration
Michael B.
Jensen1, 2,
Iørn V.
Hegelund1,
Nina D.
Lomholt1, 2,
Bente
Finsen1, and
Trevor
Owens2
1 Department of Anatomy and Neurobiology, University of
Southern Denmark/Odense University, Odense C, DK 5000 Denmark, and
2 Montreal Neurological Institute, McGill University,
Montreal, Quebec, Canada H3A 2B4
 |
ABSTRACT |
Glial reactivity is implicated in CNS repair and regenerative
responses. Microglia, the cells responding earliest to axonal injury,
produce tumor necrosis factor- (TNF ), a cytokine with both
cytopathic and neuroprotective effects. We have studied activation of
hippocampal microglia to produce TNF in response to transection of
perforant path axons in SJL/J mice. TNF mRNA was produced in
a transient manner, peaking at 2 d and falling again by 5 d after lesioning. This was unlike other markers of glial reactivity, such as Mac-1 upregulation, which were sustained over longer time periods. Message for the immune cytokine interferon- (IFN ) was undetectable, and glial reactivity to axonal lesions occurred as normal
in IFN -deficient mice. Microglial responses to lesion-induced neuronal injury were markedly enhanced in myelin basic protein promoter-driven transgenic mice, in which IFN was endogenously produced in hippocampus. The kinetics of TNF downregulation 5 d
after lesion was not affected by transgenic IFN , indicating that
IFN acts as an amplifier and not an inducer of response. These
results are discussed in the context of a regenerative role for TNF
in the CNS, which is innately regulated and potentiated by IFN .
Key words:
fascia dentata; axonal lesioning; microglia; tumor
necrosis factor- ; transgenic mice; oligodendrocytes
 |
INTRODUCTION |
Microglia and astrocytes react to
CNS injury with cascades of cellular reactivity that include secretion
of soluble mediators, leading to promotion of regeneration and repair.
Frequently, this involves interaction with cells of the immune system
(Wekerle et al., 1986 ; Raivich et al., 1998 ). Intercellular
interactions are mediated at least in part by cytokines, prominent
among which are the immune cytokine interferon- (IFN ) and the
more widely produced tumor necrosis factor- (TNF ). IFN
orchestrates glial reactivity, in particular through induction of
TNF (Renno et al., 1995 ). Stimulation of glial cells in
vitro by IFN induces major histocompatibility complex (MHC) and
adhesion molecule upregulation, proliferation (astrocytes), and
production of cytokines and other soluble mediators, including TNF
(Fontana et al., 1984 ; Frei et al., 1987 ; Hayes et al., 1987 ; Yong et
al., 1991 ; Aloisi et al., 1992a ; Merrill et al., 1993 ; Sebire et al.,
1993 ; Merrill and Benveniste 1996 ). Transgenic overexpression of IFN
can induce demyelinating pathology and gliosis (Corbin et al., 1996 ;
Horwitz et al., 1997 ; Renno et al., 1998 ). However, gliosis is also
inducible in IFN -deficient animals (Rostworowski et al., 1997 ), and
experimental autoimmune encephalomyelitis (EAE) can be induced, with
production of TNF , in mice lacking IFN (Krakowski and Owens,
1996 ). TNF is associated with inflammation and neurotoxicity (Selmaj
and Raine, 1988 ; Rothwell and Luheshi, 1996 ; Barone et al., 1997 ; Korner et al., 1997 ; Probert et al., 1997 ; Taupin et al., 1997 ; Stalder et al., 1998 ). TNF also stimulates the production of growth
factors in astroglial cells (Aloisi et al., 1992a ,b ; Lee et al., 1993 ;
Shafit-Zagardo et al., 1993 ; Brodie, 1996 ) and may play a
neuroprotective role. Ischemic neuronal degeneration was exacerbated in
mice lacking TNF receptors (Bruce et al., 1996 ), direct protective
effects on neurons in culture have been described (Cheng et al., 1994 ),
and in vivo administration of TNF ameliorates EAE (Liu et
al., 1998 ). These observations highlight the need to understand the
relative roles of IFN and TNF .
We have examined these issues by studying microglial response at a site
of anterograde axonal and terminal degeneration in the CNS. Transection
of perforant path (PP) afferents from the entorhinal cortex induces
degeneration of PP fibers and synaptic terminals in the molecular layer
of the fascia dentata of the hippocampus (Matthews et al., 1976a ). This
induces glial activation (Fagan and Gage,, 1990 , 1994 ; Jensen et al.,
1994 , 1997 , 1999 ) and leads to reactive sprouting and synaptogenesis in
the denervated zones (Matthews et al., 1976b ; Steward and Vinsant,
1983 ; Fagan and Gage, 1990 , 1994 ; Frotscher et al., 1997 ). Glial
reactivity in the PP lesion model is immune-independent (Fagan and
Gage, 1994 ; Finsen et al., 2000 ). We find that reactive microglia
produce TNF with a transient time course that is distinct from
kinetics for other markers of reactivity. Microglial reactivity was
normal in IFN -deficient mice, and IFN expression was not detected
by RT-PCR in hippocampus of normal mice. Nevertheless, microglial reactivity and TNF production were significantly enhanced in transgenic mice that expressed IFN in hippocampus. Our data argue for an innately regulated program of TNF production in the CNS that
is subject to amplification by immune-derived IFN .
 |
MATERIALS AND METHODS |
Mice
The myelin basic protein (MBP)-IFN transgenic mice were
homozygotes of the A519 line, backcrossed for six generations onto the
SJL/J background, as described by Renno et al. (1998) . In these mice
the IFN transgene is constitutively expressed in the CNS under the
control of a 1.3 kb MBP promoter. The transgenic mice develop and breed
normally. Unmanipulated MBP-IFN transgenic mice show no spontaneous
pathology, unlike other MBP promoter-driven IFN transgenic mice
(Corbin et al., 1996 ; Horwitz et al., 1997 ). This has been attributed
to thresholds for effect (Renno et al., 1998 ) and allows us to test the
concomitant roles of IFN and other stimuli. There is expression of
IFN mRNA in the spinal cord, and very low levels of TNF mRNA are
also detectable (Renno et al., 1998 ). BALB/c-backcrossed
IFN -deficient GKO mice (Dalton et al., 1993 ) were originally
obtained from Genentech (San Francisco, CA) and were maintained in our
facility. SJL/J mice were purchased from Harlan Sprague Dawley
(Indianapolis, IN) or Bomholtgaard (Skensved, Denmark). Animal breeding
and experiments were conducted according to National Danish Animal Care
Committee and Canadian Council on Animal Care guidelines, as
administered by the McGill University Animal Care Committee.
Surgical procedures
Mice were subjected to wire knife-lesioning of the perforant
path projection arising from the entorhinal cortex to terminate in the
hippocampus. For lesioning the mice were anesthetized, and the
perforant path was transected with a stereotaxically inserted wire
knife as described by Jensen et al. (1999) . Control mice were either
unoperated or sham-operated, treated the same way as the lesioned
animals except that the wire knife was not inserted into the brain. The
contralateral, unoperated hippocampus also served as a control.
Histology
At survival times of 24 hr, 48 hr, 5 d, and 10 d after
lesion, mice were anesthetized, and their brains were removed and
snap-frozen in CO2 snow and processed
histologically as described by Gregersen et al. (2000) and Jensen et
al. (1999) . Nonradioactive in situ hybridization (ISH) was
used to visualize cellular TNF mRNA expression (Gregersen et al.,
2000 ). Parallel sections were stained with a modification of the
Fink-Heimer silver impregnation method described by Hjorth-Simonsen
(1970) to demonstrate argyrophilic, degenerating axons and terminals,
or they were stained with toluidine blue as a general cell stain.
Immunocytochemical staining for the microglial surface antigen
complement receptor type 3 (Mac-1) (Perry et al., 1985 ) was performed
as described previously (Jensen et al., 1999 ). Mice with inadequate
lesions as shown by Fink-Heimer staining were excluded from further
analysis. ISH for MBP mRNA was performed as described [Jensen et al.
(2000) , and see below]. Between 3 and 10 animals per group (e.g., at
each time point per treatment) were processed, and every tenth section
through the hippocampus was examined for each histological analysis.
In situ hybridization
Probes. TNF mRNA was detected with a probe mixture
composed of two alkaline phosphate (AP)-labeled probes (probe I:
5'-CTTCTCATCCCTTTGGGGACCGATCACC-3'; probe II: 5'-C GTA GTC GGG GCA GCC
TTG TCC CTT GAA-3') complementary to bases 305-332 and 570-597 of
murine TNF cDNA, respectively (Pennica et al., 1985 ). MBP mRNA was
detected with an AP-labeled probe
(5'-XTCT- CTGGGGCAGGGAGCCATAATGGGTAG T-3') complementary to bases
56-85 of murine MBP cDNA (Takahashi et al., 1985 ). A probe
specific for the "house-keeping" gene
glyceraldehyde-3-phosphatedehydrogenase (GAPDH)
(5'-XCCTGCTTCACCACCTTCTTGATGATGTCA-3') complementary to bases
808-833 of murine GAPDH cDNA (Sabath et al., 1990 ) was used as
positive control. All probes were purchased from DNA Technology (Aarhus, Denmark).
ISH procedure. Cryostat sections (16 µm thick) mounted on
RNase-free glass slides were immersed in 96% ethanol for 18-24 hr and
subsequently left to air dry for 20 min. Five picomoles of the probe
were dissolved in 1 ml hybridization buffer consisting of 50%
formamide, 20% 20× SSC, 2.5% 40× Denhardt's solution, 10% dextran, and 1% single-stranded DNA and hybridized overnight at 37°C. For posthybridization the sections were rinsed in 1× SSC, 3 × 30 min at 55°C, then transferred to Tris-HCl, pH 9.5, for 2 × 10 min at room temperature. Thereafter the sections were
rinsed for 2 × 15 min in Tris-HCl, pH 9.5, and subjected to AP
development. Substrates for the color reaction were nitro-blue
tetrazolium (Sigma, Poole, UK) and 5-bromo-4-chloro-3-indoyl phosphate
(Sigma). Development was performed in the dark at room temperature for up to 50 hr and arrested by immersing the sections in water. The sections were coverslipped with Aquamount (Merck, Darmstadt, Germany) and stored in the dark. Some sections were counterstained with hematoxylin before coverslipping.
Double labeling for TNF mRNA and astroglial glial fibrillary acidic
protein (GFAP) was performed as described by Gregersen et al. (2000) .
Control reactions. Sections hybridized with TNF probe I
or II alone displayed identical but weaker hybridization signal
compared with sections hybridized with the TNF probe mixture. For
additional controls, sections were incubated with the hybridization
buffer alone, an excess (×100) of unlabeled TNF probe mixture, or
hybridized subsequent to treatment with ribonuclease A (50 µg/ml;
Pharmacia). None of these controls displayed specific hybridization
signal (see Fig. 2G). Sections hybridized with the MBP or
GAPDH probe showed a distinctly different hybridization signal.
Specificity of MBP ISH was confirmed similarly.
RT-PCR analysis. Mice (10-13 per group) were transcardially
perfused with ice-cold PBS, the brains were removed, and the hippocampi were dissected out under a dissecting microscope. The hippocampi were
immediately snap-frozen in liquid nitrogen and stored at 80°C until
further processing. Total RNA was purified from the dissected
hippocampi using Trizol RNA isolation reagent (Life Technologies,
Burlington, Ontario, Canada) according to the manufacturer's protocol. For PCR analysis, equivalent amounts of total hippocampal RNA
were subjected to an RT protocol. Briefly, 3 µg mRNA was added to a
tube containing 400 U Moloney murine leukemia virus-RT (Life Technologies), 10 mM of each dNTP (Pharmacia Biotech,
Montreal, Quebec, Canada), 50 pmol random hexamer primer (Boehringer
Mannheim, Laval, QC, Canada), 23 U RNA guard RNase inhibitor (Pharmacia Biotech), and a 5× first-strand buffer containing 250 mM
Tris-HCl, pH 8.3, 375 mM KCl, and 15 mM
MgCl2 (Life Technologies).
The PCR conditions that were used were previously optimized for linear
amplification to allow direct comparison between samples. Equal amounts
of cDNA were amplified using 2.5 U Taq DNA polymerase (Life
Technologies), 10 mM of each dNTP (Pharmacia
Biotech), 50 pmol of each primer, and a 10× PCR buffer mixture
containing 500 mM KCl, 100 mM Tris-HCl, pH 8.3, 15 mM
MgCl, and 0.1% gelatin (Life Technologies). The primers that were used
were as described by Renno et al. (1995) , except for
IFN : IFN sense primer 5'-ACACTGCATCTTGGCTTTGC-3', IFN
antisense primer 5'-CGACTCCTTTTCCGCTTCCT-3', TNF sense primer 5'-AGCACAGAAAGCATGATCCG-3', TNF antisense primer
5'-CAGAGCAATGACTCCAAAGT-3'. The primers for -actin as an internal
control were sense 5'-TGGGTCAGAAGGACTCCTATC-3' and antisense
5'-CAGGCAGCTCATAGCTCTTCT-3' (Renno et al., 1995 ). PCR was
performed in a Programmable Thermal Controller-100 (MJ Research)
for 28 cycles (IFN ) (denaturation 1 min at 94°C, annealing 1 min
at 60°C, extension 1 min at 72°C) or 34 cycles (TNF )
(denaturation 1 min at 95°C, annealing 1 min at 60°C, extension 1 min at 72°C). Fifty microliters per sample of PCR amplification
products (450 bp for IFN , 289 bp for TNF , 650 bp for -actin)
were run in 1.5% agarose gels in Tris-acetate-EDTA buffer and
visualized by ethidium bromide or SYBR Green (Molecular Probes, Eugene,
OR) staining. For quantitation, gels were visualized by Fluorimager (Molecular Dynamics, Sunnyvale, CA) and subsequently analyzed using
ImageQuant v. 1.1 for Apple Macintosh. After background correction, the
signals for IFN mRNA and TNF mRNA were normalized against
-actin mRNA, from the same PCR run. Results are presented as ratios
between ipsilateral (lesioned) and contralateral (control, unlesioned)
RNA levels from the same mouse.
Densitometry and cell counting. TNF mRNA-expressing cells
in the molecular layer of the dorsotemporal part of the fascia dentata
in SJL/J mice that were PP-lesioned 2 d previously were counted
systematically using a 100× oil objective and the Cast-Grid microscope
system (Olympus). Counting was performed in parallel ISH, blinded
sections (n 8 per animal) with an intersectional distance of 160 µm. Counting was performed in the entire molecular layer because it was impossible to make a clear distinction between the
PP-denervated perforant path zones and the inner nondenervated commissural-associational zone in ISH sections. The counting unit was
a small, oval to elongated microglial-like nucleus, surrounded by ISH
product (see Fig. 2C). Recounts showed <10% variability. An estimate of the cell density was obtained by dividing the total number of counted cells by the total sampling area. Density estimates (cells per millimeters squared) were plotted against the corresponding Fink-Heimer values measured in parallel sections, obtained as outlined
by Jensen et al. (1999) . For quantitative measurements of the level of
microglial Mac-1 immunoreactivity and the extent and size of lesion,
Mac-1-stained sections and corresponding Fink-Heimer-stained, blinded
sections (n 6 for each animal) were analyzed as
described by Jensen et al. (1999) .
Statistical analysis. Wilcoxon matched pairs signed rank sum
test was used to determine whether the Mac-1 and Fink-Heimer values for
the medial perforant path (MPP) zone were different from the values for
the lateral perforant path (LPP) zone. The relation between the
Mac-1 and Fink-Heimer values was thereafter described by linear
regression, as was the relation between the density of TNF
mRNA-expressing cells and Fink-Heimer values, and the slopes of the two
Mac-1 regression lines were compared by Student's t test.
Comparison of IFN transgene expression at days 2 and 5, and
comparison of TNF levels in transgenic and nontransgenic mice at day
2, was performed by the Wilcoxon-Mann-Whitney test for comparison of
unpaired samples.
 |
RESULTS |
Stereotactic lesioning of perforant path axons in SJL/J mice
results in zonally defined axonal and terminal degeneration in the
hippocampus (Fig.
1A,B).
This is accompanied by glial reactivity 2 d after lesion in the
perforant path zones of the fascia dentata (Jensen et al., 1999 ).
Microglial reactivity can be visualized as morphological changes,
increased Mac-1 staining (Fig. 1C) (Jensen et al., 1999 ),
and cellular proliferation, and these cells also upregulate MHC I and
CD45 in the rat (Jensen et al., 1997 ). Astroglial and
oligodendroglial reactivity are detectable as hypertrophy and increased
GFAP staining (Jensen et al., 1994 ) and increased oligodendroglial MBP
gene expression (Jensen et al. 2000 ), with slightly delayed time
profile, in the same region. There is a statistically significant
linear correlation between the immunohistochemically quantitated
microglial Mac-1 reactivity and the extent of neurodegeneration (measured as Fink-Heimer staining) (Jensen et al., 1999 ). Neuronal, microglial, and oligodendroglial development, morphology, and distribution in fascia dentata and adjacent regions in MBP-IFN transgenic mice were identical to those in nontransgenic SJL/J mice
(Renno et al., 1998 ) (data not shown). Neurodegenerative pathology
after lesioning in transgenic hippocampus was indistinguishable from
that in SJL/J mice, and Nissl and Fink-Heimer staining showed the same
pattern and zonal restriction of changes.

View larger version (83K):
[in this window]
[in a new window]
|
Figure 1.
Neurodegeneration and microglial reactivity in the
perforant path lesion model. A-C,
Perforant path-lesioned SJL/J mouse, 5 d after lesioning.
A, Nissl staining of hippocampus from a lesioned SJL/J
mouse. B, Fink-Heimer-stained degenerating fibers and
terminals in the perforant path (pp) zone of the
molecular layer of the fascia dentata, the molecular layer of CA3
(m), and stratum lacunosum-moleculare of CA1
(lm) of hippocampus. Same mouse as shown in
A but section from a more ventral level.
C, Mac-1-stained reactive microglia in the PP zone of
dentate molecular layer and denervated zones in CA3 and CA1. Section
parallel to that shown in A.
D-F, Perforant path-lesioned GKO
IFN -deficient mouse, 5 d after lesioning. D,
Fink-Heimer staining of an incompletely lesioned mouse.
E, F, Mac-1 staining of parallel
section showing ipsilateral (E) and
contralateral (F) fascia dentata.
Arrows in A and B indicate
the wire knife transection site. The large arrow in
D indicates MPP; the small arrow
indicates LPP. FD, Fascia dentata; g,
granule cell layer; p, pyramidal cells;
pp, perforant path zones of molecular layer;
ipsi, ipsilateral; con,
contralateral. Scale bar: A, B,
500 µm; C, 350 µm; D, 400 µm;
E, F, 250 µm.
|
|
Transient induction of TNF mRNA in microglia in
PP-lesioned hippocampus
We first characterized the time course and regional and cellular
expression of TNF mRNA in SJL/J mice, using ISH. We found that
TNF was induced transiently in the denervated zones at day 2 (Fig.
2A,E)
but was expressed at undetectable levels at both earlier and later time
points (Fig. 2D,F). The
hybridization signal was located in the perinuclear region of the cells
and occasionally radiated out in process-like extensions (Fig.
2B,C), reminiscent of the activated
microglial cells observed in parallel sections, as shown in later
figures. ISH-positive cells were occasionally seen as closely apposed
doublets, suggestive of recent cell division (Fig. 2C).
In double-labeling experiments, no GFAP+
cells were ISH positive (Fig.
3A), confirming that microglia were the major source of TNF . The density of TNF mRNA-expressing cells in the denervated zones showed a statistically significant correlation to the extent of neurodegeneration [Y = 7.90 + 8.90 ×, residual SD, Sres = 1.30 (p < 0.05)] (Fig. 3B). TNF
mRNA was not detected around the retrogradely degenerating neurons in
the entorhinal cortex or around the transection site where the wire knife entered (data not shown). TNF mRNA-positive cells were not
detected in the contralateral hippocampus (data not shown) or in
unlesioned or control tissue (data not shown, and Fig. 2G).

View larger version (105K):
[in this window]
[in a new window]
|
Figure 2.
Time course and cellular distribution of TNF
mRNA expression in PP-lesioned hippocampus. In situ
hybridization was used to show induction of TNF mRNA in fascia
dentata at various times after PP lesioning.
A-G, SJL/J;
H-J, A519 MBP-IFN transgenic.
A, Low-power photomicrograph showing induction of TNF
mRNA in scattered cells (arrows) in the denervated
molecular layer. B, C, Higher-power
photomicrographs from the same section as shown in A.
The TNF mRNA-expressing cells (arrows in
B) have small, round to oval microglia-like nuclei and
occasionally elaborate process-like extensions.
Arrowheads in C indicate a closely
apposed cell "doublet." D-F, Time
course of TNF induction. D-F show
granule cells (left) and molecular layer
(right) from mice lesioned 24 hr, 48 hr, and 5 d
previously. G, Control showing a section equivalent to
that in E but pretreated with RNase A before ISH.
H, Fascia dentata from a PP-lesioned transgenic mouse
(same magnification as A); I and
J show granule cells and molecular layer (as in
D-G) from mice lesioned 48 hr and 5 d previously (same magnifications as
D-G). Arrows indicate
TNF mRNA-expressing cells. g, Granule cell layer;
mol, molecular layer. Scale bars: A, H, 100 µm; B, 125 µm; C, 250 µm; D-G,
I, J, 50 µm.
|
|

View larger version (52K):
[in this window]
[in a new window]
|
Figure 3.
TNF expression by microglia. A
(large panel), Photomicrograph showing induction
of TNF by ISH (dark purple) and GFAP staining
(brown) in the molecular layer of the fascia dentata of
an SJL/J mouse that was lesioned 2 d previously. Two closely
apposed ISH-positive cells are indicated by arrows.
GFAP+ astrocyte is located at bottom
right. The cell body is indicated with a large
arrowhead, and a GFAP+ process with
small arrowheads. GFAP-stained cells did not show ISH
product, neither did ISH-positive cells stain for GFAP. Small
panel, Focal plane emphasizes astrocyte morphology and
processes. Scale bar, 100 µm. B, Graphic illustration
of the relationship between the density of Fink-Heimer-stained
degenerating axons and terminals and the number of TNF -expressing
cells in the fascia dentata 2 d after perforant path lesioning in
six SJL/J mice. A statistically significant linear relation between
microglial TNF expression and degeneration density is evident
(p < 0.05, Student's t
test, one-tailed probability).
|
|
RT-PCR detection of TNF in lesioned hippocampus
Results from ISH analysis showed that TNF expression was
transient. To confirm downregulation after peak expression, we used the
more sensitive RT-PCR analysis. We microdissected hippocampi from
perfused SJL/J mice that had been lesioned 2 and 5 d previously, isolated RNA, and analyzed cytokine mRNA levels by RT-PCR. INF message was undetectable in RNA from any CNS tissue in SJL/J, whether
lesioned or not (Fig.
4A,C).
We confirmed the absence of message by 40-cycle PCRs (data not shown).
Messenger RNA for TNF was weakly detectable by 34-cycle RT-PCR in
unlesioned hippocampi (Fig. 4A). Levels of TNF
message increased significantly by 2 d after lesioning (Fig.
4A,B,D). Because
TNF mRNA was undetectable by ISH in contralateral hippocampus, and
Mac-1 induction resulting from degeneration of the crossed
tempero-ammonic projection is confined to contralateral CA1, we have
previously used the contralateral fascia dentata as a control for
normalization of data (Jensen et al., 1999 ). We confirmed that
RT-PCR-detectable increases in TNF mRNA in unlesioned, contralateral
hippocampi were small relative to whole brain (three- to eightfold at
2 d) compared with those seen in lesioned hippocampi (19- to
31-fold at 2 d) (Fig. 4D). Although it
introduced a slight underrepresentation of the effect, data from a
large number of mice were calculated as ipsilateral/contralateral ratios to normalize the results. Figure 4B shows as
much as five- to sevenfold increases in TNF levels at 2 d after
lesion. Guided by the quantitative data showing highest numbers of TNF
mRNA-expressing cells in the best lesioned animals (Fig. 3B)
and absence of TNF mRNA-expressing microglia at day 5 (Fig.
2F,J), we considered animals
with a fold increase of 2.5 to be suboptimally lesioned (day 2) or
their microglia to have downregulated TNF gene expression. The median
value attained 3.6 for well-lesioned mice (Fig. 4B). TNF levels fell by 5 d after lesion to, or close to, baseline levels (fold increase 2.5) (Fig.
4A,B).

View larger version (30K):
[in this window]
[in a new window]
|
Figure 4.
Cytokine levels in PP-lesioned hippocampus.
A, Ethidium bromide-stained gels showing PCR-amplified
IFN , TNF , and -actin cDNA from hippocampi of individual mice.
IFN message was undetectable in both unlesioned and lesioned SJL/J
mice (A, top gel, lanes 1,
3, 4). IFN message was detected
at roughly equivalent levels in both unlesioned and 2 day-lesioned
MBP-IFN transgenic (Tg) mice (A,
top gel, lanes 2, 5).
TNF mRNA was induced transiently in nontransgenic and MBP-IFN
transgenic mice at day 2 (A, middle gel,
lanes 3, 5). -actin mRNA levels
(bottom gel) were equivalent in all samples,
indicating equal RNA input. B, C,
Fluorimager quantitation of data from these and other experiments is
shown as fold increase relative to unlesioned contralateral hippocampi
for each mouse. Each point represents the relative
cytokine level, normalized to -actin, for one mouse. Data for IFN
in C include samples independently analyzed for TNF
in B. Values for fold increase 2.5 are considered to
be at or below baseline level, indicating either suboptimal lesioning
(day 2) or downregulation to baseline levels (day 5). Medians for
well-lesioned day 2 mice are indicated by a horizontal
line. Wilcoxon-Mann-Whitney test shows induction of higher
TNF levels in Tg than nTg mice at day 2 (p < 0.5, one-tailed probability). Wilcoxon-Mann-Whitney test also reveals
a statistically significant increase in IFN levels from day 2 to day
5 after lesion in transgenic mice (p < 0.001, one-tailed probability), although some of the animals in the day
5 group appear to be suboptimally lesioned. The horizontal
lines indicate median values. ND, None detected.
D, Fluorimager image of a gel stained with SYBR Green,
showing TNF and -actin amplimers after 30-cycle RT-PCR of
RNA from paired ipsilateral (lesioned, I) and
contralateral (unlesioned, C) hippocampi from three
different SJL/J mice, 2 d after surgery. RNA from unlesioned brain
was analyzed as a control (B).
|
|
Effect of IFN on TNF expression
We then examined the induction and progression of the TNF
response in SJL/J-backcrossed MBP-IFN transgenic mice. Expression of IFN in the unlesioned hippocampus of transgenic mice was
confirmed by RT-PCR (Fig. 4A). The time course of
appearance and the cellular source of TNF mRNA in hippocampus of
lesioned MBP-IFN transgenic mice was determined by nonradioactive
ISH and identical to SJL/J mice (Fig. 2, compare
H--J, D-F). At
2 d after lesion, mRNA-expressing cells were morphologically
identifiable as microglia in transgenic mice, similar to SJL/J (Fig. 2
compare B, C; shown for SJL/J only). TNF mRNA
became undetectable at 5 d in both types of mice (Fig. 2F,J).
RT-PCR-detectable TNF mRNA levels were marginally higher in the
hippocampus of transgenic mice than in nontransgenic mice, consistent
with the original description of these mice (Fig.
4A). This difference was slight and did not
constitute a significant bias to lesion effects. Two days after axonal
lesioning, an up to 10-fold or greater increase in TNF mRNA was
measured in the denervated hippocampus, levels that were never attained
in nontransgenics (Fig. 4B). Wilcoxon-Mann-Whitney
test on well-lesioned mice [fold increase >2.5; median of 7.3 for
transgenics (n = 7) and of 3.6 for nontransgenic mice
(n = 7), showed statistically higher TNF levels in
transgenic than nontransgenic mice (p < 0.05, one-tailed probability)]. The elevated TNF production at 2 d
was transient and by 5 d levels had declined to, or close to,
baseline levels (Fig. 4A,B). This
decrease agreed with the ISH data in Figure 2, which showed that TNF
mRNA was induced transiently in microglial cells in the denervated
areas in transgenic mice at day 2, becoming undetectable at day 5. Expression of IFN in the hippocampus therefore promoted a striking
elevation of microglial TNF production in response to anterograde
axonal and terminal degeneration, but the transient nature of this
TNF production was unaffected by IFN .
Enhanced IFN expression in lesioned hippocampus of MBP-IFN
transgenic mice
IFN was readily detectable by RT-PCR from uninjured hippocampi
of transgenic mice (Fig. 4A). Levels of expression
increased after PP lesion (Fig.
4A,C). Strikingly, the kinetics of
IFN upregulation were distinct from those for TNF . IFN mRNA
levels, in RNA samples for which elevated TNF levels are shown in
Figure 4B, barely increased over control at 2 d
(median of 1.2, maximum of 1.95), but increased up to 9.7-fold in well
lesioned mice at 5 d after the lesion (Fig. 4C)
(Wilcoxon-Mann-Whitney test, p < 0.01, one-tailed probability).
Equivalent microglial reactivity in IFN -deficient mice
The complete absence of detectable IFN signal in SJL/J mice,
even in mice with complete PP lesions (inferred from high TNF levels), suggested that this cytokine might be dispensable for glial
response. We confirmed this by stereotactically lesioning axons in
BALB/c-backcrossed IFN -deficient GKO mice (Fig.
1D,E). The PP lesion is
functionally equivalent in BALB/c and SJL/J mice. Consistent with the
lack of IFN in normal animals, both the extent of neurodegeneration
(Fig. 1D) and the microglial reactivity in the
hippocampus of lesioned GKO mice (Fig. 1E) were
indistinguishable from responses in normal mice (Fig. 1, compare
B, D, and C, E).
IFN enhances microglial reactivity in transgenic mice
IFN is therefore not required for glial reactivity to
neurodegenerative injury and did not affect the time course of TNF expression induced by axotomy. Nevertheless, this cytokine clearly affected the level of glial response. There was a striking difference in the strength of the denervation-induced microglial morphological changes between lesioned transgenic and nontransgenic mice (Fig. 5, compare C, E
with D, F). In transgenic mice, the
overall glial reaction was more pronounced in all aspects, especially
for 5 d post-lesion animals (Fig. 5F). The
increase in Mac-1 immunoreactivity was higher compared with
nontransgenic controls, being visible to the naked eye on some slides,
microglial processes were more extensively branched, and the number of
cells in the denervated zones was clearly elevated (Fig. 5). In the
denervated zones, the microglial cells seemed to form a continuous
conglomerate, and without counterstain of their nuclei the individual
cells were hard to distinguish from each other (Fig.
5F).

View larger version (50K):
[in this window]
[in a new window]
|
Figure 5.
Mac-1 reactivity in SJL/J and MBP-IFN
transgenic mice. Mac-1 staining of fascia dentata (granule cells and
molecular layer) from mice before and after PP lesioning.
A, C, E, Unlesioned SJL/J
(A) and SJL/J at 2 d
(C) and 5 d (E) after
lesioning; B, D, F,
unlesioned MBP-IFN transgenic (B), and
MBP-IFN transgenic, at 2 d (D) and
5 d (F) after lesioning. ca,
Commissural associational zone; g, granule cell layer;
lpp, lateral perforant path; mpp, medial
perforant path. Scale bar, 100 µm. G shows a graphic
illustration of the relationship between the density of Fink-Heimer
(FH)-stained degenerating axons and terminals and the density of
microglial Mac-1 immunoreactivity in the fascia dentata 5 d after
perforant path lesioning in MBP-IFN ( ) transgenic and SJL/J
( ) mice. The graphs portray statistically significant
linear relations between microglial Mac-1 immunoreactivity and
degeneration density (FH) in both transgenic and nontransgenic, in that the
higher the degeneration density the higher the microglial reactivity.
Comparison of the slopes of the regression lines shows that microglial
Mac-1 reactivity is significantly higher in MBP-IFN transgenic than
in SJL/J mice (p < 0.01, Student's
t test, one-tailed probability).
|
|
We confirmed a statistically significant linear relation between the
density of microglial Mac-1 immunoreactivity and Fink-Heimer staining
in both transgenic mice [Y = 1.50 + 2.70 ×,
residual SD, Sres = 0.13 for MPP
(p < 0.001) and nontransgenic SJL/J mice (Y = 0.17 + 0.87 ×,
Sres=0.16 for MPP
(p < 0.001)] (Jensen et al., 1999 ) (Fig.
5G). Notably, the slope of the regression line was
significantly steeper for transgenic than for nontransgenic SJL/J mice
(p 0.001, one-sided Student's t test)
(Fig. 5G). No difference in microglial reactivity in the MPP
and the LPP zones was observed in transgenic or nontransgenic mice
(p 0.1; Wilcoxon matched pairs signed rank sum
test, two-tailed probability; data not shown).
Increased MBP expression in lesioned hippocampus
The glial response to axotomy extends at later time points to
oligodendrocytes. The oligodendrocyte response to axonal lesioning and
terminal degeneration that was previously shown by ISH for MBP mRNA in
C57Bl/6 mice (Jensen et al., 2000 ) was confirmed to take place, with
similar kinetics, in both transgenic and nontransgenic SJL/J mice. MBP
transcription was not discernible 2 d after the lesioning, whereas
at 5 d (Fig. 6) the staining density
of individual cells was higher than in nonlesioned animals or on the
contralateral side, and the number of MBP mRNA-expressing cells in the
denervated perforant path zones had significantly increased.
Upregulation of MBP was detectable in transgenic and nontransgenic mice
(Fig. 6). The kinetics of MBP and IFN upregulation were therefore
similar, and upregulated IFN levels in transgenic mice were likely
caused by lesion-induced transcription of the MBP promoter-driven
transgene.

View larger version (92K):
[in this window]
[in a new window]
|
Figure 6.
Axotomy-induced increase in MBP mRNA expression.
In situ hybridization for MBP mRNA in the molecular
layer of SJL/J (A, C, E)
and MBP-IFN transgenic (TG) mice (B,
D, F). A,
B, Unlesioned fascia dentata; C,
D, 2 d after lesion; E,
F, 5 d after lesion. MBP mRNA is upregulated in
oligodendrocytes located within the denervated PP zones of the fascia
dentata molecular layer at day 5 in both types of mice. MBP
RNA-expressing cells are indicated by arrowheads.
lpp, Lateral perforant path; mpp, medial
perforant path; ca, commissural associational zone;
g, granule cell layer. Scale bar, 50 µm.
|
|
 |
DISCUSSION |
Our results show that perforant path lesioning in mice leads to
transient induction of TNF mRNA in reactive microglia. Microglial reactivity also included morphological changes and increased Mac-1 expression. Although independent of IFN , all of these were enhanced by the presence of this cytokine in MBP-IFN transgenic mice. Oligodendroglial reactivity was shown as increased MBP gene
transcription in denervated areas in both MBP-IFN transgenic and
nontransgenic SJL/J mice. The kinetics of TNF production, whether
enhanced by IFN or not, differed strikingly from those of microglial
or oligodendroglial reactivity. These results suggest innate glial programs of response to injury, some of which are amplified by immune cytokines.
Microglia are the earliest responders to axotomy and are the principal
source of TNF in the CNS (Dopp et al., 1997 ; Finsen et al., 2000 ).
The kinetics of glial reactivity after perforant path axonal lesioning
include early retraction of processes by microglia, followed by
proliferation at 1 d, coincident with upregulation of Mac-1/CR3
(Fagan and Gage, 1994 ). Astrocyte and oligodendroglial responses occur
later (Steward et al., 1990 ; Fagan and Gage, 1994 ; Jensen et al., 1994 ,
2000 ). Double-labeling controls failed to detect
GFAP+TNF mRNA-expressing cells,
confirming our findings in ischemic brain (Gregersen et al. 2000 ). Our
results therefore show induction of TNF in microglial cells after
axonal lesioning and a pronounced effect of IFN on this.
The levels of TNF detected in reactive hippocampal microglia were
relatively low, compared with levels seen in macrophage-like cells in
ischemic brain lesions (Gregersen et al. 2000 ). Additionally, the
number of Mac-1-reactive microglia was in all cases greater than the
number of ISH-detectable TNF -producing cells (Figs. 2A,H, 5). It is likely that only strongly
induced cytokine responses were detected by ISH and RT-PCR, so that
only a subpopulation of activated microglia were high expressors of
TNF . Fink-Heimer staining for degeneration showed considerable
interanimal variability (Fig. 5), and it was not possible to assess the
extent of lesioning in hippocampi from which RNA was isolated for PCR.
Nevertheless, TNF induction was clearly demonstrated.
Transient TNF transcription may reflect an inherent microglial
program. Although Mac-1 expression remain elevated through and beyond
day 5, TNF mRNA levels drop from day 2 to day 5. Microglial reactivity may be induced in response to phagocytosis of debris, but
degeneration of myelinated fibers persists for many days (Jensen et
al., 1999 ), so this is unlikely to account for the transient TNF
response. Similarly, short-lived release of injury-related mediators
from neurons would not account for continued Mac-1 reactivity. TNF
transcription by microglia/macrophages in EAE and ischemia is also
transient (Renno et al., 1995 ; Gregersen et al. 2000 ), whereas Mac-1
elevation is more prolonged. Our results show this putative microglial
TNF program to be IFN independent.
TNF has been implicated as both a neuroprotective and a neurotoxic
cytokine in ischemia (Bruce et al., 1996 ; Rothwell and Luheshi 1996 ;
Barone et al., 1997 ), and in EAE it has been implicated in
demyelination and oligodendrocyte death and as a mediator of counter-inflammatory effects (Selmaj and Raine 1988 ; Korner et al.,
1997 ; Taupin et al., 1997 ; Liu et al., 1998 ). In the case of the
perforant path lesion, there is no infiltration of leukocytes (Fagan
and Gage, 1994 ), so effects of TNF in promoting leukocyte and
endothelial reactivity are likely not relevant here. TNF can act
through two receptors, the p55 TNFRI and the p75 TNFRII (Hsu et
al., 1995 ; Rao et al., 1995 ). Although TNFRI was originally thought to
induce apoptosis, recent work suggests that this receptor may promote
neuronal survival (Gary et al., 1998 ). Both receptors are expressed by
neurons (Blotchkina et al., 1997 ; Cunningham et al., 1997 ), and it is
possible that one of the roles of transient TNF production is to
promote the axonal sprouting that is a feature of the PP lesion (Fagan
and Gage, 1990 ; Frotscher et al., 1997 ). The lack of leukocytic
infiltrate excludes T cells or macrophages, which can contribute to
regenerative responses in the CNS (Moalem et al., 1999 ), from playing
such a role here. Finally, TNF may act in either autocrine or
paracrine mode to induce secondary signals such as other cytokines
(Becher et al., 1996 ). Their kinetic advantage in the overall glial
response makes it likely that microglia would influence other cell
types. This could include induction of secondary mediators by
astrocytes as well as microglia (Gómez-Pinilla et al.,
1992 ; Théry et al., 1992 ; Shafit-Zagardo et al., 1993 ; Guthrie et al., 1995 , 1997 ), which could then act on axons or oligodendrocytes.
Whether the increase in MBP-transcribing cells reflects oligodendrocyte
proliferation, differentiation of precursors, or upregulation of
established cells, it represents a myelinating response that occurs
downstream of microglial signaling. We have found a close correlation
between onset of sprouting and MBP transcription (Matthews et al.,
1976b ; Steward and Vinsant 1983 ; Jensen et al. 2000 ), which taken
together with instances of zone-specific MBP transcription without
microglial reactivity argued that sprouting is sufficient to induce MBP
(Finsen et al., 2000 ; Jensen et al. 2000 ). This would not exclude a
role for glial products in promoting myelination, and products of
microglial response could directly induce oligodendroglial MBP
transcription (Hetier et al., 1988 ; Fagan and Gage, 1990 , 1994 ;
Bartholdi and Schwab, 1998 ). Whether TNF itself acts directly on
oligodendrocytes may depend on whether these cells preferentially express p55 TNF receptors (Dopp et al., 1997 ) or both p55 and p75
(Tchelingerian et al., 1995 ). Indirect action of microglia could
involve induction or promotion of production of FGF-2, CSF-1, or CNTF
by astrocytes (Gómez-Pinilla et al., 1992 ; Théry et al.,
1992 ; Guthrie et al., 1995 ,1997 ; Oh and Yong, 1996 ). Similarly, TNF ,
possibly in conjunction with IL-1, could cause the proliferation of
astrocytes that is associated with anterograde axonal degeneration (Selmaj et al., 1990 ; Aloisi et al., 1992a ; Fagan and Gage, 1994 ).
Potentially, effects of IFN include amplification of endogenous
responses and induction of novel response. The inherent IFN independence of in vivo glial responses (Krakowski and Owens
1996 ; Rostworowski et al., 1997 ) suggests amplification rather than primary response induction. IFN can stimulate microglial cells to
upregulate MHC class I and induce MHC class II expression in vitro (Otero and Merrill, 1994 ). Microglial cells are furthermore stimulated in vitro by IFN to produce cytokines (TNF ,
IL-1, and IL-6) and other soluble mediators and to enhance phagocytic and cytopathic activity (Frei et al., 1987 ; Hetier et al., 1988 ; Merrill et al., 1993 ; Renno et al., 1995 ; Merrill and Benveniste, 1996 ). IFN , in addition to being a microglial activator, also induces an astroglial response, with cytokine production (CSF-1, IL-6,
IL-8) (Aloisi et al., 1992b ; Théry et al., 1992 ), and
proliferation in vitro and reactive gliosis in
vivo (Yong et al., 1991 ). Given the powerful potential of IFN
to activate microglial cells in vitro, it is consistent that
the microglial response to PP lesioning in vivo was much
higher in transgenic mice, in which IFN was expressed in
hippocampus. Similarly, the increased levels of TNF in transgenic
mice must reflect activity of IFN on microglia. Importantly, TNF
levels in transgenic mice downregulated with similar kinetics as in
nontransgenic mice. So, whether IFN or other stimuli induce TNF ,
a separate, distinct mechanism then overrides at later stages. The
kinetics of IFN upregulation were also quite distinct from TNF .
This is more consistent with an amplifying role for IFN .
It is uncertain whether there are endogenous sources of IFN in the
adult CNS. Motor and sensory neurons isolated from the CNS have been
reported to express IFN immunoreactivity and mRNA, respectively
(Olsson et al., 1989 ; Neumann et al., 1997 ), but there are no reports
of expression in situ in adult animals. Nonetheless, induction of developmentally silenced events may occur during injury or
inflammatory responses, so it cannot be excluded that neurons might
upregulate IFN in response to certain stimuli in adult animals.
However, our high-cycle RT-PCR analyses failed to detect it in lesioned
hippocampus. It is more likely that IFN production within the adult
CNS derives from extra CNS sources, probably immune leukocytes such as
T and NK cells. The expression of IFN receptors by microglia and
astrocytes therefore anticipates interaction with immune cells, and
this probably reflects evolutionary selection for anti-viral responses
(Griffin et al., 1992 ). Our results suggest that the IFN
response may also optimize the opportunity for regenerative responses.
Inflammation contributes to regeneration in the CNS (Tourbah et al.,
1997 ; Moalem et al., 1999 ) and likely involves induction of TNF in
glial cells. We have shown that IFN amplifies these responses.
Our findings suggest a model for glial reaction to axonal injury
and subsequent regenerative response by which TNF and other cytokine
production, amplified by IFN , are directed to regeneration. Involvement of these cytokines in inflammatory pathology may be seen as
an inadvertent consequence of their overproduction or failure to remove
inducing stimuli within a prescribed time.
 |
FOOTNOTES |
Received Sept. 27, 1999; revised Feb. 25, 2000; accepted March 1, 2000.
This study was supported by grants to M.B.J. and B.F. from The Danish
Medical Research Council, Retired President Leo Nielsen and Wife Karen
Margrethe Nielsen's Foundation, Kong Christian d. X's Foundation, The
Foundation to the Advance of Medical Science, The Danish Multiple
Sclerosis Society, President Ejnar Jonassen's Foundation, Lily
Benthine Lund's Foundation, The Munkemølle Foundation, A. J. Andersen's Foundation, and University of Southern Denmark/Odense University. Research at The Montreal Neurological Institute was supported by grants to T.O. from the Multiple Sclerosis Society of
Canada and Medical Research Council-Canada. We thank Grethe Jensen,
Dorete Jensen, Jacob Bang Jensen, and Margrethe Krogh Rasmussen (Odense
University) for technical assistance, and Albert Meier (Aarhus
University) for photography. We thank Lyne Bourbonnière, Grace
Chan, and Elise Tran (Montreal Neurological Institute) for help with
PCR and analysis.
Correspondence should be addressed to Dr. Bente Finsen, Department of
Anatomy and Neurobiology, University of Southern Denmark/Odense University, Winsløwparken 21, Odense C, DK 5000 Denmark. E-mail: finsen{at}imbmed.usd.dk.
 |
REFERENCES |
-
Aloisi F,
Borsellino G,
Samoggia P,
Testa U,
Chelucci C,
Russo G,
Peschle C,
Levi G
(1992a)
Astrocyte cultures from human embryonic brain: characterization and modulation of surface molecules by inflammatory cytokines.
J Neurosci Res
32:494-506[Web of Science][Medline].
-
Aloisi F,
Care A,
Borsellino G,
Gallo P,
Rosa S,
Bassani A,
Cabibbo A,
Testa U,
Levi G,
Peschle C
(1992b)
Production of hemolymphopoietic cytokines (IL-6, IL-8, colony-stimulating factors) by normal human astrocytes in response to IL-1 beta and tumor necrosis factor-alpha.
J Immunol
149:2358-2366[Abstract].
-
Barone FC,
Arvin B,
White RF,
Miller A,
Webb CL,
Willette RN,
Lysko PG,
Feuerstein GZ
(1997)
Tumor necrosis factor-
: a mediator of focal ischemic brain injury.
Stroke
28:1233-1244[Abstract/Free Full Text]. -
Bartholdi D,
Schwab ME
(1998)
Oligodendroglial reaction following spinal cord injury in rat: transient upregulation of MBP mRNA.
Glia
23:278-284[Web of Science][Medline].
-
Becher B,
Dodelet V,
Fedorowicz V,
Antel JP
(1996)
Soluble tumor necrosis factor receptor inhibits interleukin 12 production by stimulated human microglial cells in vitro.
J Clin Invest
98:1539-1543[Web of Science][Medline].
-
Blotchkina GI,
Meistrell III ME,
Blotchkina IL,
Tracey KJ
(1997)
Expression of TNF and TNF receptors (p55 and p75) in the rat brain after focal cerebral ischemia.
Mol Med
3:765-781[Web of Science][Medline].
-
Brodie C
(1996)
Differential effects of Th1 and Th2 derived cytokines on NGF synthesis by mouse astrocytes.
FEBS Lett
394:117-120[Web of Science][Medline].
-
Bruce AJ,
Boling W,
Kindy MS,
Peschon J,
Kraemer PJ,
Carpenter MK,
Holtsberg FW,
Mattson MP
(1996)
Altered neuronal and microglial responses to excitotoxic and ischemic brain injury in mice lacking TNF receptors.
Nat Med
2:788-794[Web of Science][Medline].
-
Cheng B,
Christakos S,
Mattson MP
(1994)
Tumor necrosis factors protect neurons against metabolic-excitotoxic insults and promote maintenance of calcium homeostasis.
Neuron
12:139-153[Web of Science][Medline].
-
Corbin JG,
Kelly D,
Rath EM,
Baerwald KD,
Suzuki K,
Popko B
(1996)
Targeted CNS expression of interferon-gamma in transgenic mice leads to hypomyelination, reactive gliosis, and abnormal cerebellar development.
Mol Cell Neurosci
7:354-370[Web of Science][Medline].
-
Cunningham Jr ET,
Stalder AK,
Sanna PP,
Liu SS,
Bloom FE,
Howes Jr EL,
Campbell IL,
Margolis TP
(1997)
Distribution of tumor necrosis factor receptor messenger RNA in normal and herpes simplex virus infected trigeminal ganglia in the mouse.
Brain Res
758:99-106[Web of Science][Medline].
-
Dalton DK,
Pitts-Meek S,
Keshav S,
Figari IS,
Bradley A,
Stewart TA
(1993)
Multiple defects of immune cell function in mice with disrupted interferon-gamma genes.
Science
259:1739-1742[Abstract/Free Full Text].
-
Dopp JM,
Mackenzie-Graham A,
Otero GC,
Merrill JE
(1997)
Differential expression, cytokine modulation, and specific functions of type-1 and type-2 tumor necrosis factor receptors in rat glia.
J Neuroimmunol
75:104-112[Web of Science][Medline].
-
Fagan AM,
Gage FH
(1990)
Cholinergic sprouting in the hippocampus, a proposed role for IL-1.
Exp Neurol
110:105-120[Web of Science][Medline].
-
Fagan AM,
Gage FH
(1994)
Mechanisms of sprouting in the adult central nervous system: cellular responses in areas of terminal degeneration and reinnervation in the rat hippocampus.
Neuroscience
58:705-725[Web of Science][Medline].
-
Finsen B,
Jensen MB,
Lomholt ND,
Hegelund IV,
Poulsen FR,
Owens T
(2000)
Axotomy-induced glial reactions in normal and cytokine transgenic mice.
In: The functional roles of glial cells in health and disease. Dialogue between glia and neurons (Matsas R,
Tsacopoulos M,
eds), pp 157-171. New York: Plenum.
-
Fontana A,
Fierz W,
Wekerle H
(1984)
Astrocytes present myelin basic protein to encephalitogenic T-cell lines.
Nature
307:273-276[Medline].
-
Frei K,
Seipl C,
Groscurth P,
Schwerdel C,
Fontana A
(1987)
Antigen presentation and tumour cytotoxicity by interferon-
-treated microglial cells.
Eur J Immunol
17:1271-1278[Web of Science][Medline]. -
Frotscher M,
Heimrich B,
Deller T
(1997)
Sprouting in the hippocampus is layer specific.
Trends Neurosci
20:218-223[Web of Science][Medline].
-
Gary DS,
Bruce-Keller AJ,
Kindy MS,
Mattson MP
(1998)
Ischemic and excitotoxic brain injury is enhanced in mice lacking the p55 tumor necrosis factor receptor.
J Cereb Blood Flow Metab
18:1283-1287[Web of Science][Medline].
-
Gómez-Pinilla F,
Lee JW-K,
Cotman CW
(1992)
Basic FGF in adult rat brain: cellular distribution and response to entorhinal lesion and fimbria-fornix transection.
J Neurosci
12:345-355[Abstract].
-
Gregersen R,
Lambertsen KL,
Finsen B
(2000)
Brain macrophages and microglia are major sources of tumor necrosis factor alpha (TNF-
) in a murine model of permanent middle cerebral occlusion.
J Cereb Blood Flow Metab
20:53-65[Web of Science][Medline]. -
Griffin DE,
Levine B,
Tyor WR,
Irani DN
(1992)
The immune response in viral encephalitis.
Semin Immunol
4:111-119[Medline].
-
Guthrie KM,
Nguyen T,
Gall CM
(1995)
Insulin-like growth factor-1 mRNA is increased in deafferented hippocampus: spatiotemporal correspondence of a trophic event with axon sprouting.
J Comp Neurol
352:147-160[Web of Science][Medline].
-
Guthrie KM,
Woods AG,
Nguyen T,
Gall CM
(1997)
Astroglial ciliary neurotrophic factor mRNA expression is increased in fields of axonal sprouting in deafferented hippocampus.
J Comp Neurol
386:137-148[Web of Science][Medline].
-
Hayes GM,
Woodroofe MN,
Cuzner ML
(1987)
Microglia are the major cell type expressing MHC class II in human white matter.
J Neurol Sci
80:25-37[Web of Science][Medline].
-
Hetier E,
Ayala J,
Denefle P,
Bousseau A,
Rouget P,
Mallat M,
Prochiantz A
(1988)
Brain macrophages synthesize interleukin-1 and interleukin-1 mRNAs in vitro.
J Neurosci Res
21:391-397[Web of Science][Medline].
-
Hjorth-Simonsen A
(1970)
Fink-Heimer silver impregnation of degenerating axons and terminals in mounted cryostat sections of fresh and fixed brains.
Stain Technol
45:199-204[Web of Science][Medline].
-
Horwitz MS,
Evans CF,
McGavern DB,
Rodriguez M,
Oldstone MB
(1997)
Primary demyelination in transgenic mice expressing interferon-gamma.
Nat Med
3:1037-1041[Web of Science][Medline].
-
Hsu H,
Xiong J,
Goeddel DV
(1995)
The TNF receptor 1-associated protein TRADD signals cell death and NF-
B activation.
Cell
81:495-504[Web of Science][Medline]. -
Jensen MB,
González B,
Castellano B,
Zimmer J
(1994)
Microglial and astroglial reactions to anterograde axonal degeneration: a histochemical and immunocytochemical study of the adult rat fascia dentata after entorhinal perforant path lesions.
Exp Brain Res
98:245-260[Web of Science][Medline].
-
Jensen MB,
Finsen B,
Zimmer J
(1997)
Morphological and microglial changes in the denervated fascia dentata: correlation with blood-brain-barrier damage and astroglial reactions.
Exp Neurol
143:103-116[Web of Science][Medline].
-
Jensen MB,
Hegelund IV,
Poulsen FR,
Owens T,
Zimmer J,
Finsen B
(1999)
Microglial reactivity correlates to the density of the anterogradely degenerating axons and terminals following perforant path denervation of the mouse fascia dentata.
Neuroscience
93:507-518[Web of Science][Medline].
-
Jensen MB,
Poulsen FR,
Finsen B
(2000)
Oligodendrocytes upregulate myelin basic protein gene expression in fields of axonal sprouting in denervated mouse hippocampus.
Int J Dev Neurosci
18:221-235[Web of Science][Medline].
-
Korner H,
Riminton DS,
Strickland DH,
Lemckert FA,
Pollard JD,
Sedgwick JD
(1997)
Critical points of tumor necrosis factor action in central nervous system autoimmune inflammation defined by gene targeting.
J Exp Med
186:1585-1590[Abstract/Free Full Text].
-
Krakowski ML,
Owens T
(1996)
Interferon-gamma confers resistance to experimental allergic encephalomyelitis.
Eur J Immunol
26:1641-1646[Web of Science][Medline].
-
Lee SC,
Liu W,
Dickson DW,
Brosnan CF,
Berman JW
(1993)
Cytokine production by human fetal microglia and astrocytes: differential induction by lipopolysaccharide and IL-1
.
J Immunol
150:2659-2667[Abstract]. -
Liu J,
Marino MW,
Wong G,
Grail D,
Dunn A,
Bettadapura J,
Slavin AJ,
Old L,
Bernard CC
(1998)
TNF is a potent anti-inflammatory cytokine in autoimmune-mediated demyelination.
Nat Med
4:78-83[Web of Science][Medline].
-
Matthews DA,
Cotman C,
Lynch G
(1976a)
An electron microscopic study of lesion-induced synaptogenesis in the dentate gyrus of the adult rat. I. Magnitude and time course of degeneration.
Brain Res
115:1-21[Web of Science][Medline].
-
Matthews DA,
Cotman C,
Lynch G
(1976b)
An electron microscopic study of lesion-induced synaptogenesis in the dentate gyrus of the adult rat. II. Reappearance of morphologically normal synaptic contacts.
Brain Res
115:23-41[Web of Science][Medline].
-
Merrill JE,
Benveniste EN
(1996)
Cytokines in inflammatory brain lesions: helpful and harmful.
Trends Neurosci
19:331-338[Web of Science][Medline].
-
Merrill JE,
Ignarro LJ,
Sherman MP,
Melinek J,
Lane TE
(1993)
Microglial cell cytotoxicity of oligodendrocytes is mediated through nitric oxide.
J Immunol
151:2132-2141[Abstract].
-
Moalem G,
Leibowitz-Amit R,
Yoles E,
Mor F,
Cohen IR,
Schwartz M
(1999)
Autoimmune T cells protect neurons from secondary degeneration after central nervous system axotomy.
Nat Med
5:49-55[Web of Science][Medline].
-
Neumann H,
Schmidt H,
Wilharm E,
Behrens L,
Wekerle H
(1997)
Interferon
gene expression in sensory neurons: evidence for autocrine gene regulation.
J Exp Med
186:2023-2031[Abstract/Free Full Text]. -
Oh LY,
Yong VW
(1996)
Astrocytes promote process outgrowth by adult human oligodendrocytes in vitro through interaction between bFGF and astrocyte extracellular matrix.
Glia
17:237-253[Web of Science][Medline].
-
Olsson T,
Kristensson K,
Ljungdahl A,
Maehlen J,
Holmdahl R,
Klareskog L
(1989)
Gamma-interferon-like immunoreactivity in axotomized rat motor neurons.
J Neurosci
9:3870-3875[Abstract].
-
Otero GC,
Merrill JE
(1994)
Cytokine receptors on glial cells.
Glia
2:117-128.
-
Pennica D,
Hayflick JS,
Bringman TS,
Palladino MA,
Goeddel DV
(1985)
Cloning and expression in Escherichia coli of the cDNA for murine tumor necrosis factor.
Proc Natl Acad Sci USA
82:6060-6064[Abstract/Free Full Text].
-
Perry VH,
Hume DA,
Gordon S
(1985)
Immunohistochemical localization of macrophages and microglia in the adult and developing mouse brain.
Neuroscience
15:313-326[Web of Science][Medline].
-
Probert L,
Akassoglou K,
Kassiotis G,
Pasparakis M,
Alexopoulou L,
Kollias G
(1997)
TNF-
transgenic and knockout models of CNS inflammation and degeneration.
J Neuroimmunol
72:137-141[Web of Science][Medline]. -
Raivich G,
Jones LL,
Kloss CUA,
Werner A,
Neumann H,
Kreutzberg GW
(1998)
Immune surveillance in the injured nervous system: T-lymphocytes invade the axotomized mouse facial motor nucleus and aggregate around sites of neuronal degeneration.
J Neurosci
18:5804-5816[Abstract/Free Full Text].
-
Rao P,
Hsu KC,
Chao MV
(1995)
Upregulation of NF-
B-dependent gene expression mediated by the p75 tumor necrosis factor receptor.
J Interferon Cytokine Res
15:171-177[Web of Science][Medline]. -
Renno T,
Krakowski M,
Piccirillo C,
Lin J-Y,
Owens T
(1995)
TNF
production by resident microglia and infiltrating leukocytes in the central nervous system of mice with experimental allergic encephalomyelitis.
J Immunol
154:944-953[Abstract]. -
Renno T,
Taupin V,
Bourbonnière L,
Verge G,
Tran E,
De Simone R,
Krakowski M,
Rodriguez M,
Peterson A,
Owens T
(1998)
Interferon-gamma in progression to persistent demyelination and neurological deficit following acute EAE.
Mol Cell Neurosci
12:376-389[Web of Science][Medline].
-
Rostworowski M,
Balasingam V,
Chabot S,
Owens T,
Yong VW
(1997)
Astrogliosis in the neonatal and adult murine brain post-trauma: elevation of inflammatory cytokines and the lack of requirement for endogenous interferon-gamma.
J Neurosci
17:3664-3674[Abstract/Free Full Text].
-
Rothwell NJ,
Luheshi GN
(1996)
Brain TNF: damage limitation or damaged reputation?
Nat Med
2:746-747[Web of Science][Medline].
-
Sabath DE,
Broome HE,
Prystowsky MB
(1990)
Glyceraldehyde-3-phosphate dehydrogenase mRNA is a major interleukin 2-induced transcript in a cloned T-helper lymphocyte.
Gene
16:185-191.
-
Sebire G,
Hery C,
Peudenier S,
Tardieu M
(1993)
Adhesion proteins on human microglial cells and modulation of their expression by IL-1 alpha and TNF alpha.
Res Virol
144:47-52[Web of Science][Medline].
-
Selmaj KW,
Raine CS
(1988)
Tumor necrosis factor mediates myelin and oligodendrocyte damage in vitro.
Ann Neurol
23:339-346[Web of Science][Medline].
-
Selmaj KW,
Farooq M,
Norton WT,
Raine CS,
Brosnan CF
(1990)
Proliferation of astrocytes in vitro in response to cytokines: a primary role for tumor necrosis factor.
J Immunol
144:129-135[Abstract].
-
Shafit-Zagardo B,
Sharma N,
Berman JW,
Bornstein MB,
Brosnan CF
(1993)
CSF-1 expression is upregulated in astrocyte cultures by IL-1 and TNF and affects microglial proliferation and morphology in organotypic cultures.
Int J Dev Neurosci
2:189-198.
-
Stalder AK,
Carson MJ,
Pagenstecher A,
Asensio VC,
Kincaid C,
Benedict M,
Powell HC,
Masliah E,
Campbell IL
(1998)
Late-onset chronic inflammatory encephalopathy in immune-competent and severe combined immune-deficient (SCID) mice with astrocyte-targeted expression of tumor necrosis factor.
Am J Pathol
153:767-783[Abstract/Free Full Text].
-
Steward O,
Vinsant SL
(1983)
The process of reinnervation in the dentate gyrus of the adult rat: a quantitative electron microscopic analysis of terminal proliferation and reactive synaptogenesis.
J Comp Neurol
214:370-386.
-
Steward O,
Torre ER,
Phillips LL,
Trimmer PA
(1990)
The process of reinnervation in the dentate gyrus of adult rats: time course of increases in mRNA for glial fibrillary acidic protein.
J Neurosci
10:2373-2384[Abstract].
-
Takahashi N,
Roach A,
Teplow DB,
Prusiner SB,
Hood L
(1985)
Cloning and characterization of the myelin basic protein gene from mouse: one gene can encode both 14 kd and 18.5 kd MBPs by alternate use of exons.
Cell
42:139-148[Web of Science][Medline].
-
Taupin V,
Renno T,
Bourbonniere L,
Peterson AC,
Rodriguez M,
Owens T
(1997)
Increased severity of experimental autoimmune encephalomyelitis, chronic macrophage/microglial reactivity, and demyelination in transgenic mice producing tumor necrosis factor-alpha in the central nervous system.
Eur J Immunol
27:905-913[Web of Science][Medline].
-
Tchelingerian JL,
Monge M,
Le Saux F,
Zalc B,
Jacque C
(1995)
Differential oligodendroglial expression of the tumor necrosis factor receptors in vivo and in vitro.
J Neurochem
65:2377-2380[Web of Science][Medline].
-
Théry C,
Stanley ER,
Mallat M
(1992)
Interleukin 1 and tumor necrosis factor-alpha stimulate the production of colony-stimulating factor 1 by murine astrocytes.
J Neurochem
59:1183-1186[Web of Science][Medline].
-
Tourbah A,
Linnington C,
Bachelin C,
Avellana-Adalid V,
Wekerle H,
BaronVan Evercooren A
(1997)
Inflammation promotes survival and migration of the CG4 oligodendrocyte progenitors transplanted in the spinal cord of both inflammatory and demyelinated rats.
J Neurosci Res
50:853-861[Web of Science][Medline].
-
Wekerle H,
Linington C,
Lassmann H,
Meyermann R
(1986)
Cellular immune reactivity within the CNS.
Trends Neurosci
9:271-277.
-
Yong VW,
Moumdjian R,
Yong FP,
Ruijs TC,
Freedman MS,
Cashman N,
Antel JP
(1991)
Gamma-interferon promotes proliferation of adult human astrocytes in vitro and reactive gliosis in the adult mouse brain in vivo.
Proc Natl Acad Sci USA
88:7016-7020[Abstract/Free Full Text].
Copyright © 2000 Society for Neuroscience 0270-6474/00/20103612-10$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
R. Khorooshi, A. A. Babcock, and T. Owens
NF-{kappa}B-Driven STAT2 and CCL2 Expression in Astrocytes in Response to Brain Injury
J. Immunol.,
November 15, 2008;
181(10):
7284 - 7291.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. A. Babcock, H. Toft-Hansen, and T. Owens
Signaling through MyD88 Regulates Leukocyte Recruitment after Brain Injury
J. Immunol.,
November 1, 2008;
181(9):
6481 - 6490.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Mizuno, G. Zhang, H. Takeuchi, J. Kawanokuchi, J. Wang, Y. Sonobe, S. Jin, N. Takada, Y. Komatsu, and A. Suzumura
Interferon-{gamma} directly induces neurotoxicity through a neuron specific, calcium-permeable complex of IFN-{gamma} receptor and AMPA GluR1 receptor
FASEB J,
June 1, 2008;
22(6):
1797 - 1806.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Chen, P. Iribarren, J. Huang, L. Zhang, W. Gong, E. H. Cho, S. Lockett, N. M. Dunlop, and J. M. Wang
Induction of the Formyl Peptide Receptor 2 in Microglia by IFN-{gamma} and Synergy with CD40 Ligand
J. Immunol.,
February 1, 2007;
178(3):
1759 - 1766.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. A. Babcock, M. Wirenfeldt, T. Holm, H. H. Nielsen, L. Dissing-Olesen, H. Toft-Hansen, J. M. Millward, R. Landmann, S. Rivest, B. Finsen, et al.
Toll-Like Receptor 2 Signaling in Response to Brain Injury: An Innate Bridge to Neuroinflammation
J. Neurosci.,
December 6, 2006;
26(49):
12826 - 12837.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D.-E. Kim, K. Tsuji, Y. R. Kim, F.-J. Mueller, H.-S. Eom, E. Y. Snyder, E. H. Lo, R. Weissleder, and D. Schellingerhout
Neural Stem Cell Transplant Survival in Brains of Mice: Assessing the Effect of Immunity and Ischemia by using Real-time Bioluminescent Imaging
Radiology,
December 1, 2006;
241(3):
822 - 830.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Monsonego, J. Imitola, S. Petrovic, V. Zota, A. Nemirovsky, R. Baron, Y. Fisher, T. Owens, and H. L. Weiner
Abeta-induced meningoencephalitis is IFN-{gamma}-dependent and is associated with T cell-dependent clearance of Abeta in a mouse model of Alzheimer's disease
PNAS,
March 28, 2006;
103(13):
5048 - 5053.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Blais and S. Rivest
Effects of TNF-{alpha} and IFN-{gamma} on Nitric Oxide-Induced Neurotoxicity in the Mouse Brain
J. Immunol.,
June 1, 2004;
172(11):
7043 - 7052.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. A. Babcock, W. A. Kuziel, S. Rivest, and T. Owens
Chemokine Expression by Glial Cells Directs Leukocytes to Sites of Axonal Injury in the CNS
J. Neurosci.,
August 27, 2003;
23(21):
7922 - 7930.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. H. Chong, Y. J. Shin, and Y.-H. Suh
Cyclic AMP Inhibition of Tumor Necrosis Factor alpha Production Induced by Amyloidogenic C-Terminal Peptide of Alzheimer's Amyloid Precursor Protein in Macrophages: Involvement of Multiple Intracellular Pathways and Cyclic AMP Response Element Binding Protein
Mol. Pharmacol.,
March 1, 2003;
63(3):
690 - 698.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. H. Chong, J. H. Sung, S. A. Shin, J.-H. Chung, and Y.-H. Suh
Effects of the beta -Amyloid and Carboxyl-terminal Fragment of Alzheimer's Amyloid Precursor Protein on the Production of the Tumor Necrosis Factor-alpha and Matrix Metalloproteinase-9 by Human Monocytic THP-1
J. Biol. Chem.,
June 22, 2001;
276(26):
23511 - 23517.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|