WWW.JNEUROSCI.ORG
-
The Journal of Neuroscience
 QUICK SEARCH:   [advanced]


     
-


HOME
  |  
SEARCH  |   ARCHIVE  |   SUBSCRIBE  |   CONTACT  |   HELP

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit an eLetter
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (45)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jensen, M. B.
Right arrow Articles by Owens, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jensen, M. B.
Right arrow Articles by Owens, T.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH

 Previous Article  |  Next Article 

The Journal of Neuroscience, May 15, 2000, 20(10):3612-3621

IFNgamma Enhances Microglial Reactions to Hippocampal Axonal Degeneration

Michael B. Jensen1, 2, Iørn V. Hegelund1, Nina D. Lomholt1, 2, Bente Finsen1, and Trevor Owens2

1 Department of Anatomy and Neurobiology, University of Southern Denmark/Odense University, Odense C, DK 5000 Denmark, and 2 Montreal Neurological Institute, McGill University, Montreal, Quebec, Canada H3A 2B4


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Glial reactivity is implicated in CNS repair and regenerative responses. Microglia, the cells responding earliest to axonal injury, produce tumor necrosis factor-alpha (TNFalpha ), a cytokine with both cytopathic and neuroprotective effects. We have studied activation of hippocampal microglia to produce TNFalpha in response to transection of perforant path axons in SJL/J mice. TNFalpha mRNA was produced in a transient manner, peaking at 2 d and falling again by 5 d after lesioning. This was unlike other markers of glial reactivity, such as Mac-1 upregulation, which were sustained over longer time periods. Message for the immune cytokine interferon-gamma (IFNgamma ) was undetectable, and glial reactivity to axonal lesions occurred as normal in IFNgamma -deficient mice. Microglial responses to lesion-induced neuronal injury were markedly enhanced in myelin basic protein promoter-driven transgenic mice, in which IFNgamma was endogenously produced in hippocampus. The kinetics of TNFalpha downregulation 5 d after lesion was not affected by transgenic IFNgamma , indicating that IFNgamma acts as an amplifier and not an inducer of response. These results are discussed in the context of a regenerative role for TNFalpha in the CNS, which is innately regulated and potentiated by IFNgamma .

Key words: fascia dentata; axonal lesioning; microglia; tumor necrosis factor-alpha ; transgenic mice; oligodendrocytes


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Microglia and astrocytes react to CNS injury with cascades of cellular reactivity that include secretion of soluble mediators, leading to promotion of regeneration and repair. Frequently, this involves interaction with cells of the immune system (Wekerle et al., 1986; Raivich et al., 1998). Intercellular interactions are mediated at least in part by cytokines, prominent among which are the immune cytokine interferon-gamma (IFNgamma ) and the more widely produced tumor necrosis factor-alpha (TNFalpha ). IFNgamma orchestrates glial reactivity, in particular through induction of TNFalpha (Renno et al., 1995). Stimulation of glial cells in vitro by IFNgamma induces major histocompatibility complex (MHC) and adhesion molecule upregulation, proliferation (astrocytes), and production of cytokines and other soluble mediators, including TNFalpha (Fontana et al., 1984; Frei et al., 1987; Hayes et al., 1987; Yong et al., 1991; Aloisi et al., 1992a; Merrill et al., 1993; Sebire et al., 1993; Merrill and Benveniste 1996). Transgenic overexpression of IFNgamma can induce demyelinating pathology and gliosis (Corbin et al., 1996; Horwitz et al., 1997; Renno et al., 1998). However, gliosis is also inducible in IFNgamma -deficient animals (Rostworowski et al., 1997), and experimental autoimmune encephalomyelitis (EAE) can be induced, with production of TNFalpha , in mice lacking IFNgamma (Krakowski and Owens, 1996). TNFalpha is associated with inflammation and neurotoxicity (Selmaj and Raine, 1988; Rothwell and Luheshi, 1996; Barone et al., 1997; Korner et al., 1997; Probert et al., 1997; Taupin et al., 1997; Stalder et al., 1998). TNFalpha also stimulates the production of growth factors in astroglial cells (Aloisi et al., 1992a,b; Lee et al., 1993; Shafit-Zagardo et al., 1993; Brodie, 1996) and may play a neuroprotective role. Ischemic neuronal degeneration was exacerbated in mice lacking TNFalpha receptors (Bruce et al., 1996), direct protective effects on neurons in culture have been described (Cheng et al., 1994), and in vivo administration of TNFalpha ameliorates EAE (Liu et al., 1998). These observations highlight the need to understand the relative roles of IFNgamma and TNFalpha .

We have examined these issues by studying microglial response at a site of anterograde axonal and terminal degeneration in the CNS. Transection of perforant path (PP) afferents from the entorhinal cortex induces degeneration of PP fibers and synaptic terminals in the molecular layer of the fascia dentata of the hippocampus (Matthews et al., 1976a). This induces glial activation (Fagan and Gage,, 1990, 1994; Jensen et al., 1994, 1997, 1999) and leads to reactive sprouting and synaptogenesis in the denervated zones (Matthews et al., 1976b; Steward and Vinsant, 1983; Fagan and Gage, 1990, 1994; Frotscher et al., 1997). Glial reactivity in the PP lesion model is immune-independent (Fagan and Gage, 1994; Finsen et al., 2000). We find that reactive microglia produce TNFalpha with a transient time course that is distinct from kinetics for other markers of reactivity. Microglial reactivity was normal in IFNgamma -deficient mice, and IFNgamma expression was not detected by RT-PCR in hippocampus of normal mice. Nevertheless, microglial reactivity and TNFalpha production were significantly enhanced in transgenic mice that expressed IFNgamma in hippocampus. Our data argue for an innately regulated program of TNFalpha production in the CNS that is subject to amplification by immune-derived IFNgamma .


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Mice

The myelin basic protein (MBP)-IFNgamma transgenic mice were homozygotes of the A519 line, backcrossed for six generations onto the SJL/J background, as described by Renno et al. (1998). In these mice the IFNgamma transgene is constitutively expressed in the CNS under the control of a 1.3 kb MBP promoter. The transgenic mice develop and breed normally. Unmanipulated MBP-IFNgamma transgenic mice show no spontaneous pathology, unlike other MBP promoter-driven IFNgamma transgenic mice (Corbin et al., 1996; Horwitz et al., 1997). This has been attributed to thresholds for effect (Renno et al., 1998) and allows us to test the concomitant roles of IFNgamma and other stimuli. There is expression of IFNgamma mRNA in the spinal cord, and very low levels of TNFalpha mRNA are also detectable (Renno et al., 1998). BALB/c-backcrossed IFNgamma -deficient GKO mice (Dalton et al., 1993) were originally obtained from Genentech (San Francisco, CA) and were maintained in our facility. SJL/J mice were purchased from Harlan Sprague Dawley (Indianapolis, IN) or Bomholtgaard (Skensved, Denmark). Animal breeding and experiments were conducted according to National Danish Animal Care Committee and Canadian Council on Animal Care guidelines, as administered by the McGill University Animal Care Committee.

Surgical procedures

Mice were subjected to wire knife-lesioning of the perforant path projection arising from the entorhinal cortex to terminate in the hippocampus. For lesioning the mice were anesthetized, and the perforant path was transected with a stereotaxically inserted wire knife as described by Jensen et al. (1999). Control mice were either unoperated or sham-operated, treated the same way as the lesioned animals except that the wire knife was not inserted into the brain. The contralateral, unoperated hippocampus also served as a control.

Histology

At survival times of 24 hr, 48 hr, 5 d, and 10 d after lesion, mice were anesthetized, and their brains were removed and snap-frozen in CO2 snow and processed histologically as described by Gregersen et al. (2000) and Jensen et al. (1999). Nonradioactive in situ hybridization (ISH) was used to visualize cellular TNFalpha mRNA expression (Gregersen et al., 2000). Parallel sections were stained with a modification of the Fink-Heimer silver impregnation method described by Hjorth-Simonsen (1970) to demonstrate argyrophilic, degenerating axons and terminals, or they were stained with toluidine blue as a general cell stain. Immunocytochemical staining for the microglial surface antigen complement receptor type 3 (Mac-1) (Perry et al., 1985) was performed as described previously (Jensen et al., 1999). Mice with inadequate lesions as shown by Fink-Heimer staining were excluded from further analysis. ISH for MBP mRNA was performed as described [Jensen et al. (2000), and see below]. Between 3 and 10 animals per group (e.g., at each time point per treatment) were processed, and every tenth section through the hippocampus was examined for each histological analysis.

In situ hybridization

Probes. TNFalpha mRNA was detected with a probe mixture composed of two alkaline phosphate (AP)-labeled probes (probe I: 5'-CTTCTCATCCCTTTGGGGACCGATCACC-3'; probe II: 5'-C GTA GTC GGG GCA GCC TTG TCC CTT GAA-3') complementary to bases 305-332 and 570-597 of murine TNFalpha cDNA, respectively (Pennica et al., 1985). MBP mRNA was detected with an AP-labeled probe (5'-XTCT- CTGGGGCAGGGAGCCATAATGGGTAG T-3') complementary to bases 56-85 of murine MBP cDNA (Takahashi et al., 1985). A probe specific for the "house-keeping" gene glyceraldehyde-3-phosphatedehydrogenase (GAPDH) (5'-XCCTGCTTCACCACCTTCTTGATGATGTCA-3') complementary to bases 808-833 of murine GAPDH cDNA (Sabath et al., 1990) was used as positive control. All probes were purchased from DNA Technology (Aarhus, Denmark).

ISH procedure. Cryostat sections (16 µm thick) mounted on RNase-free glass slides were immersed in 96% ethanol for 18-24 hr and subsequently left to air dry for 20 min. Five picomoles of the probe were dissolved in 1 ml hybridization buffer consisting of 50% formamide, 20% 20× SSC, 2.5% 40× Denhardt's solution, 10% dextran, and 1% single-stranded DNA and hybridized overnight at 37°C. For posthybridization the sections were rinsed in 1× SSC, 3 × 30 min at 55°C, then transferred to Tris-HCl, pH 9.5, for 2 × 10 min at room temperature. Thereafter the sections were rinsed for 2 × 15 min in Tris-HCl, pH 9.5, and subjected to AP development. Substrates for the color reaction were nitro-blue tetrazolium (Sigma, Poole, UK) and 5-bromo-4-chloro-3-indoyl phosphate (Sigma). Development was performed in the dark at room temperature for up to 50 hr and arrested by immersing the sections in water. The sections were coverslipped with Aquamount (Merck, Darmstadt, Germany) and stored in the dark. Some sections were counterstained with hematoxylin before coverslipping.

Double labeling for TNFalpha mRNA and astroglial glial fibrillary acidic protein (GFAP) was performed as described by Gregersen et al. (2000).

Control reactions. Sections hybridized with TNFalpha probe I or II alone displayed identical but weaker hybridization signal compared with sections hybridized with the TNFalpha probe mixture. For additional controls, sections were incubated with the hybridization buffer alone, an excess (×100) of unlabeled TNF probe mixture, or hybridized subsequent to treatment with ribonuclease A (50 µg/ml; Pharmacia). None of these controls displayed specific hybridization signal (see Fig. 2G). Sections hybridized with the MBP or GAPDH probe showed a distinctly different hybridization signal. Specificity of MBP ISH was confirmed similarly.

RT-PCR analysis. Mice (10-13 per group) were transcardially perfused with ice-cold PBS, the brains were removed, and the hippocampi were dissected out under a dissecting microscope. The hippocampi were immediately snap-frozen in liquid nitrogen and stored at -80°C until further processing. Total RNA was purified from the dissected hippocampi using Trizol RNA isolation reagent (Life Technologies, Burlington, Ontario, Canada) according to the manufacturer's protocol. For PCR analysis, equivalent amounts of total hippocampal RNA were subjected to an RT protocol. Briefly, 3 µg mRNA was added to a tube containing 400 U Moloney murine leukemia virus-RT (Life Technologies), 10 mM of each dNTP (Pharmacia Biotech, Montreal, Quebec, Canada), 50 pmol random hexamer primer (Boehringer Mannheim, Laval, QC, Canada), 23 U RNA guard RNase inhibitor (Pharmacia Biotech), and a 5× first-strand buffer containing 250 mM Tris-HCl, pH 8.3, 375 mM KCl, and 15 mM MgCl2 (Life Technologies).

The PCR conditions that were used were previously optimized for linear amplification to allow direct comparison between samples. Equal amounts of cDNA were amplified using 2.5 U Taq DNA polymerase (Life Technologies), 10 mM of each dNTP (Pharmacia Biotech), 50 pmol of each primer, and a 10× PCR buffer mixture containing 500 mM KCl, 100 mM Tris-HCl, pH 8.3, 15 mM MgCl, and 0.1% gelatin (Life Technologies). The primers that were used were as described by Renno et al. (1995), except for IFNgamma : IFNgamma sense primer 5'-ACACTGCATCTTGGCTTTGC-3', IFNgamma antisense primer 5'-CGACTCCTTTTCCGCTTCCT-3', TNFalpha sense primer 5'-AGCACAGAAAGCATGATCCG-3', TNFalpha antisense primer 5'-CAGAGCAATGACTCCAAAGT-3'. The primers for beta -actin as an internal control were sense 5'-TGGGTCAGAAGGACTCCTATC-3' and antisense 5'-CAGGCAGCTCATAGCTCTTCT-3' (Renno et al., 1995). PCR was performed in a Programmable Thermal Controller-100 (MJ Research) for 28 cycles (IFNgamma ) (denaturation 1 min at 94°C, annealing 1 min at 60°C, extension 1 min at 72°C) or 34 cycles (TNFalpha ) (denaturation 1 min at 95°C, annealing 1 min at 60°C, extension 1 min at 72°C). Fifty microliters per sample of PCR amplification products (450 bp for IFNgamma , 289 bp for TNFalpha , 650 bp for beta -actin) were run in 1.5% agarose gels in Tris-acetate-EDTA buffer and visualized by ethidium bromide or SYBR Green (Molecular Probes, Eugene, OR) staining. For quantitation, gels were visualized by Fluorimager (Molecular Dynamics, Sunnyvale, CA) and subsequently analyzed using ImageQuant v. 1.1 for Apple Macintosh. After background correction, the signals for IFNgamma mRNA and TNFalpha mRNA were normalized against beta -actin mRNA, from the same PCR run. Results are presented as ratios between ipsilateral (lesioned) and contralateral (control, unlesioned) RNA levels from the same mouse.

Densitometry and cell counting. TNFalpha mRNA-expressing cells in the molecular layer of the dorsotemporal part of the fascia dentata in SJL/J mice that were PP-lesioned 2 d previously were counted systematically using a 100× oil objective and the Cast-Grid microscope system (Olympus). Counting was performed in parallel ISH, blinded sections (n >=  8 per animal) with an intersectional distance of 160 µm. Counting was performed in the entire molecular layer because it was impossible to make a clear distinction between the PP-denervated perforant path zones and the inner nondenervated commissural-associational zone in ISH sections. The counting unit was a small, oval to elongated microglial-like nucleus, surrounded by ISH product (see Fig. 2C). Recounts showed <10% variability. An estimate of the cell density was obtained by dividing the total number of counted cells by the total sampling area. Density estimates (cells per millimeters squared) were plotted against the corresponding Fink-Heimer values measured in parallel sections, obtained as outlined by Jensen et al. (1999). For quantitative measurements of the level of microglial Mac-1 immunoreactivity and the extent and size of lesion, Mac-1-stained sections and corresponding Fink-Heimer-stained, blinded sections (n >=  6 for each animal) were analyzed as described by Jensen et al. (1999).

Statistical analysis. Wilcoxon matched pairs signed rank sum test was used to determine whether the Mac-1 and Fink-Heimer values for the medial perforant path (MPP) zone were different from the values for the lateral perforant path (LPP) zone. The relation between the Mac-1 and Fink-Heimer values was thereafter described by linear regression, as was the relation between the density of TNF mRNA-expressing cells and Fink-Heimer values, and the slopes of the two Mac-1 regression lines were compared by Student's t test. Comparison of IFNgamma transgene expression at days 2 and 5, and comparison of TNFalpha levels in transgenic and nontransgenic mice at day 2, was performed by the Wilcoxon-Mann-Whitney test for comparison of unpaired samples.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Stereotactic lesioning of perforant path axons in SJL/J mice results in zonally defined axonal and terminal degeneration in the hippocampus (Fig. 1A,B). This is accompanied by glial reactivity 2 d after lesion in the perforant path zones of the fascia dentata (Jensen et al., 1999). Microglial reactivity can be visualized as morphological changes, increased Mac-1 staining (Fig. 1C) (Jensen et al., 1999), and cellular proliferation, and these cells also upregulate MHC I and CD45 in the rat (Jensen et al., 1997). Astroglial and oligodendroglial reactivity are detectable as hypertrophy and increased GFAP staining (Jensen et al., 1994) and increased oligodendroglial MBP gene expression (Jensen et al. 2000), with slightly delayed time profile, in the same region. There is a statistically significant linear correlation between the immunohistochemically quantitated microglial Mac-1 reactivity and the extent of neurodegeneration (measured as Fink-Heimer staining) (Jensen et al., 1999). Neuronal, microglial, and oligodendroglial development, morphology, and distribution in fascia dentata and adjacent regions in MBP-IFNgamma transgenic mice were identical to those in nontransgenic SJL/J mice (Renno et al., 1998) (data not shown). Neurodegenerative pathology after lesioning in transgenic hippocampus was indistinguishable from that in SJL/J mice, and Nissl and Fink-Heimer staining showed the same pattern and zonal restriction of changes.



View larger version (83K):
[in this window]
[in a new window]
 
Figure 1.   Neurodegeneration and microglial reactivity in the perforant path lesion model. A-C, Perforant path-lesioned SJL/J mouse, 5 d after lesioning. A, Nissl staining of hippocampus from a lesioned SJL/J mouse. B, Fink-Heimer-stained degenerating fibers and terminals in the perforant path (pp) zone of the molecular layer of the fascia dentata, the molecular layer of CA3 (m), and stratum lacunosum-moleculare of CA1 (lm) of hippocampus. Same mouse as shown in A but section from a more ventral level. C, Mac-1-stained reactive microglia in the PP zone of dentate molecular layer and denervated zones in CA3 and CA1. Section parallel to that shown in A. D-F, Perforant path-lesioned GKO IFNgamma -deficient mouse, 5 d after lesioning. D, Fink-Heimer staining of an incompletely lesioned mouse. E, F, Mac-1 staining of parallel section showing ipsilateral (E) and contralateral (F) fascia dentata. Arrows in A and B indicate the wire knife transection site. The large arrow in D indicates MPP; the small arrow indicates LPP. FD, Fascia dentata; g, granule cell layer; p, pyramidal cells; pp, perforant path zones of molecular layer; ipsi, ipsilateral; con, contralateral. Scale bar: A, B, 500 µm; C, 350 µm; D, 400 µm; E, F, 250 µm.

Transient induction of TNFalpha mRNA in microglia in PP-lesioned hippocampus

We first characterized the time course and regional and cellular expression of TNFalpha mRNA in SJL/J mice, using ISH. We found that TNFalpha was induced transiently in the denervated zones at day 2 (Fig. 2A,E) but was expressed at undetectable levels at both earlier and later time points (Fig. 2D,F). The hybridization signal was located in the perinuclear region of the cells and occasionally radiated out in process-like extensions (Fig. 2B,C), reminiscent of the activated microglial cells observed in parallel sections, as shown in later figures. ISH-positive cells were occasionally seen as closely apposed doublets, suggestive of recent cell division (Fig. 2C). In double-labeling experiments, no GFAP+ cells were ISH positive (Fig. 3A), confirming that microglia were the major source of TNFalpha . The density of TNF mRNA-expressing cells in the denervated zones showed a statistically significant correlation to the extent of neurodegeneration [Y = -7.90 + 8.90 ×, residual SD, Sres = 1.30 (p < 0.05)] (Fig. 3B). TNFalpha mRNA was not detected around the retrogradely degenerating neurons in the entorhinal cortex or around the transection site where the wire knife entered (data not shown). TNFalpha mRNA-positive cells were not detected in the contralateral hippocampus (data not shown) or in unlesioned or control tissue (data not shown, and Fig. 2G).



View larger version (105K):
[in this window]
[in a new window]
 
Figure 2.   Time course and cellular distribution of TNFalpha mRNA expression in PP-lesioned hippocampus. In situ hybridization was used to show induction of TNFalpha mRNA in fascia dentata at various times after PP lesioning. A-G, SJL/J; H-J, A519 MBP-IFNgamma transgenic. A, Low-power photomicrograph showing induction of TNFalpha mRNA in scattered cells (arrows) in the denervated molecular layer. B, C, Higher-power photomicrographs from the same section as shown in A. The TNFalpha mRNA-expressing cells (arrows in B) have small, round to oval microglia-like nuclei and occasionally elaborate process-like extensions. Arrowheads in C indicate a closely apposed cell "doublet." D-F, Time course of TNFalpha induction. D-F show granule cells (left) and molecular layer (right) from mice lesioned 24 hr, 48 hr, and 5 d previously. G, Control showing a section equivalent to that in E but pretreated with RNase A before ISH. H, Fascia dentata from a PP-lesioned transgenic mouse (same magnification as A); I and J show granule cells and molecular layer (as in D-G) from mice lesioned 48 hr and 5 d previously (same magnifications as D-G). Arrows indicate TNFalpha mRNA-expressing cells. g, Granule cell layer; mol, molecular layer. Scale bars: A, H, 100 µm; B, 125 µm; C, 250 µm; D-G, I, J, 50 µm.



View larger version (52K):
[in this window]
[in a new window]
 
Figure 3.   TNFalpha expression by microglia. A (large panel), Photomicrograph showing induction of TNFalpha by ISH (dark purple) and GFAP staining (brown) in the molecular layer of the fascia dentata of an SJL/J mouse that was lesioned 2 d previously. Two closely apposed ISH-positive cells are indicated by arrows. GFAP+ astrocyte is located at bottom right. The cell body is indicated with a large arrowhead, and a GFAP+ process with small arrowheads. GFAP-stained cells did not show ISH product, neither did ISH-positive cells stain for GFAP. Small panel, Focal plane emphasizes astrocyte morphology and processes. Scale bar, 100 µm. B, Graphic illustration of the relationship between the density of Fink-Heimer-stained degenerating axons and terminals and the number of TNFalpha -expressing cells in the fascia dentata 2 d after perforant path lesioning in six SJL/J mice. A statistically significant linear relation between microglial TNFalpha expression and degeneration density is evident (p < 0.05, Student's t test, one-tailed probability).

RT-PCR detection of TNFalpha in lesioned hippocampus

Results from ISH analysis showed that TNFalpha expression was transient. To confirm downregulation after peak expression, we used the more sensitive RT-PCR analysis. We microdissected hippocampi from perfused SJL/J mice that had been lesioned 2 and 5 d previously, isolated RNA, and analyzed cytokine mRNA levels by RT-PCR. INFgamma message was undetectable in RNA from any CNS tissue in SJL/J, whether lesioned or not (Fig. 4A,C). We confirmed the absence of message by 40-cycle PCRs (data not shown). Messenger RNA for TNFalpha was weakly detectable by 34-cycle RT-PCR in unlesioned hippocampi (Fig. 4A). Levels of TNFalpha message increased significantly by 2 d after lesioning (Fig. 4A,B,D). Because TNFalpha mRNA was undetectable by ISH in contralateral hippocampus, and Mac-1 induction resulting from degeneration of the crossed tempero-ammonic projection is confined to contralateral CA1, we have previously used the contralateral fascia dentata as a control for normalization of data (Jensen et al., 1999). We confirmed that RT-PCR-detectable increases in TNFalpha mRNA in unlesioned, contralateral hippocampi were small relative to whole brain (three- to eightfold at 2 d) compared with those seen in lesioned hippocampi (19- to 31-fold at 2 d) (Fig. 4D). Although it introduced a slight underrepresentation of the effect, data from a large number of mice were calculated as ipsilateral/contralateral ratios to normalize the results. Figure 4B shows as much as five- to sevenfold increases in TNFalpha levels at 2 d after lesion. Guided by the quantitative data showing highest numbers of TNF mRNA-expressing cells in the best lesioned animals (Fig. 3B) and absence of TNF mRNA-expressing microglia at day 5 (Fig. 2F,J), we considered animals with a fold increase of <= 2.5 to be suboptimally lesioned (day 2) or their microglia to have downregulated TNF gene expression. The median value attained 3.6 for well-lesioned mice (Fig. 4B). TNFalpha levels fell by 5 d after lesion to, or close to, baseline levels (fold increase <= 2.5) (Fig. 4A,B).



View larger version (30K):
[in this window]
[in a new window]
 
Figure 4.   Cytokine levels in PP-lesioned hippocampus. A, Ethidium bromide-stained gels showing PCR-amplified IFNgamma , TNFalpha , and beta -actin cDNA from hippocampi of individual mice. IFNgamma message was undetectable in both unlesioned and lesioned SJL/J mice (A, top gel, lanes 1, 3, 4). IFNgamma message was detected at roughly equivalent levels in both unlesioned and 2 day-lesioned MBP-IFNgamma transgenic (Tg) mice (A, top gel, lanes 2, 5). TNFalpha mRNA was induced transiently in nontransgenic and MBP-IFNgamma transgenic mice at day 2 (A, middle gel, lanes 3, 5). beta -actin mRNA levels (bottom gel) were equivalent in all samples, indicating equal RNA input. B, C, Fluorimager quantitation of data from these and other experiments is shown as fold increase relative to unlesioned contralateral hippocampi for each mouse. Each point represents the relative cytokine level, normalized to beta -actin, for one mouse. Data for IFNgamma in C include samples independently analyzed for TNFalpha in B. Values for fold increase <= 2.5 are considered to be at or below baseline level, indicating either suboptimal lesioning (day 2) or downregulation to baseline levels (day 5). Medians for well-lesioned day 2 mice are indicated by a horizontal line. Wilcoxon-Mann-Whitney test shows induction of higher TNF levels in Tg than nTg mice at day 2 (p < 0.5, one-tailed probability). Wilcoxon-Mann-Whitney test also reveals a statistically significant increase in IFNgamma levels from day 2 to day 5 after lesion in transgenic mice (p < 0.001, one-tailed probability), although some of the animals in the day 5 group appear to be suboptimally lesioned. The horizontal lines indicate median values. ND, None detected. D, Fluorimager image of a gel stained with SYBR Green, showing TNFalpha and beta -actin amplimers after 30-cycle RT-PCR of RNA from paired ipsilateral (lesioned, I) and contralateral (unlesioned, C) hippocampi from three different SJL/J mice, 2 d after surgery. RNA from unlesioned brain was analyzed as a control (B).

Effect of IFNgamma on TNFalpha  expression

We then examined the induction and progression of the TNFalpha response in SJL/J-backcrossed MBP-IFNgamma transgenic mice. Expression of IFNgamma in the unlesioned hippocampus of transgenic mice was confirmed by RT-PCR (Fig. 4A). The time course of appearance and the cellular source of TNFalpha mRNA in hippocampus of lesioned MBP-IFNgamma transgenic mice was determined by nonradioactive ISH and identical to SJL/J mice (Fig. 2, compare H--J, D-F). At 2 d after lesion, mRNA-expressing cells were morphologically identifiable as microglia in transgenic mice, similar to SJL/J (Fig. 2 compare B, C; shown for SJL/J only). TNFalpha mRNA became undetectable at 5 d in both types of mice (Fig. 2F,J).

RT-PCR-detectable TNFalpha mRNA levels were marginally higher in the hippocampus of transgenic mice than in nontransgenic mice, consistent with the original description of these mice (Fig. 4A). This difference was slight and did not constitute a significant bias to lesion effects. Two days after axonal lesioning, an up to 10-fold or greater increase in TNFalpha mRNA was measured in the denervated hippocampus, levels that were never attained in nontransgenics (Fig. 4B). Wilcoxon-Mann-Whitney test on well-lesioned mice [fold increase >2.5; median of 7.3 for transgenics (n = 7) and of 3.6 for nontransgenic mice (n = 7), showed statistically higher TNF levels in transgenic than nontransgenic mice (p < 0.05, one-tailed probability)]. The elevated TNFalpha production at 2 d was transient and by 5 d levels had declined to, or close to, baseline levels (Fig. 4A,B). This decrease agreed with the ISH data in Figure 2, which showed that TNFalpha mRNA was induced transiently in microglial cells in the denervated areas in transgenic mice at day 2, becoming undetectable at day 5. Expression of IFNgamma in the hippocampus therefore promoted a striking elevation of microglial TNFalpha production in response to anterograde axonal and terminal degeneration, but the transient nature of this TNFalpha production was unaffected by IFNgamma .

Enhanced IFNgamma expression in lesioned hippocampus of MBP-IFNgamma transgenic mice

IFNgamma was readily detectable by RT-PCR from uninjured hippocampi of transgenic mice (Fig. 4A). Levels of expression increased after PP lesion (Fig. 4A,C). Strikingly, the kinetics of IFNgamma upregulation were distinct from those for TNFalpha . IFNgamma mRNA levels, in RNA samples for which elevated TNFalpha levels are shown in Figure 4B, barely increased over control at 2 d (median of 1.2, maximum of 1.95), but increased up to 9.7-fold in well lesioned mice at 5 d after the lesion (Fig. 4C) (Wilcoxon-Mann-Whitney test, p < 0.01, one-tailed probability).

Equivalent microglial reactivity in IFNgamma -deficient mice

The complete absence of detectable IFNgamma signal in SJL/J mice, even in mice with complete PP lesions (inferred from high TNFalpha levels), suggested that this cytokine might be dispensable for glial response. We confirmed this by stereotactically lesioning axons in BALB/c-backcrossed IFNgamma -deficient GKO mice (Fig. 1D,E). The PP lesion is functionally equivalent in BALB/c and SJL/J mice. Consistent with the lack of IFNgamma in normal animals, both the extent of neurodegeneration (Fig. 1D) and the microglial reactivity in the hippocampus of lesioned GKO mice (Fig. 1E) were indistinguishable from responses in normal mice (Fig. 1, compare B, D, and C, E).

IFNgamma enhances microglial reactivity in transgenic mice

IFNgamma is therefore not required for glial reactivity to neurodegenerative injury and did not affect the time course of TNFalpha expression induced by axotomy. Nevertheless, this cytokine clearly affected the level of glial response. There was a striking difference in the strength of the denervation-induced microglial morphological changes between lesioned transgenic and nontransgenic mice (Fig. 5, compare C, E with D, F). In transgenic mice, the overall glial reaction was more pronounced in all aspects, especially for 5 d post-lesion animals (Fig. 5F). The increase in Mac-1 immunoreactivity was higher compared with nontransgenic controls, being visible to the naked eye on some slides, microglial processes were more extensively branched, and the number of cells in the denervated zones was clearly elevated (Fig. 5). In the denervated zones, the microglial cells seemed to form a continuous conglomerate, and without counterstain of their nuclei the individual cells were hard to distinguish from each other (Fig. 5F).



View larger version (50K):
[in this window]
[in a new window]
 
Figure 5.   Mac-1 reactivity in SJL/J and MBP-IFNgamma transgenic mice. Mac-1 staining of fascia dentata (granule cells and molecular layer) from mice before and after PP lesioning. A, C, E, Unlesioned SJL/J (A) and SJL/J at 2 d (C) and 5 d (E) after lesioning; B, D, F, unlesioned MBP-IFNgamma transgenic (B), and MBP-IFNgamma transgenic, at 2 d (D) and 5 d (F) after lesioning. ca, Commissural associational zone; g, granule cell layer; lpp, lateral perforant path; mpp, medial perforant path. Scale bar, 100 µm. G shows a graphic illustration of the relationship between the density of Fink-Heimer (FH)-stained degenerating axons and terminals and the density of microglial Mac-1 immunoreactivity in the fascia dentata 5 d after perforant path lesioning in MBP-IFNgamma (bullet ) transgenic and SJL/J (open circle ) mice. The graphs portray statistically significant linear relations between microglial Mac-1 immunoreactivity and degeneration density (FH) in both transgenic and nontransgenic, in that the higher the degeneration density the higher the microglial reactivity. Comparison of the slopes of the regression lines shows that microglial Mac-1 reactivity is significantly higher in MBP-IFNgamma transgenic than in SJL/J mice (p < 0.01, Student's t test, one-tailed probability).

We confirmed a statistically significant linear relation between the density of microglial Mac-1 immunoreactivity and Fink-Heimer staining in both transgenic mice [Y = -1.50 + 2.70 ×, residual SD, Sres = 0.13 for MPP (p < 0.001) and nontransgenic SJL/J mice (Y = 0.17 + 0.87 ×, Sres=0.16 for MPP (p < 0.001)] (Jensen et al., 1999) (Fig. 5G). Notably, the slope of the regression line was significantly steeper for transgenic than for nontransgenic SJL/J mice (p 0.001, one-sided Student's t test) (Fig. 5G). No difference in microglial reactivity in the MPP and the LPP zones was observed in transgenic or nontransgenic mice (p 0.1; Wilcoxon matched pairs signed rank sum test, two-tailed probability; data not shown).

Increased MBP expression in lesioned hippocampus

The glial response to axotomy extends at later time points to oligodendrocytes. The oligodendrocyte response to axonal lesioning and terminal degeneration that was previously shown by ISH for MBP mRNA in C57Bl/6 mice (Jensen et al., 2000) was confirmed to take place, with similar kinetics, in both transgenic and nontransgenic SJL/J mice. MBP transcription was not discernible 2 d after the lesioning, whereas at 5 d (Fig. 6) the staining density of individual cells was higher than in nonlesioned animals or on the contralateral side, and the number of MBP mRNA-expressing cells in the denervated perforant path zones had significantly increased. Upregulation of MBP was detectable in transgenic and nontransgenic mice (Fig. 6). The kinetics of MBP and IFNgamma upregulation were therefore similar, and upregulated IFNgamma levels in transgenic mice were likely caused by lesion-induced transcription of the MBP promoter-driven transgene.



View larger version (92K):
[in this window]
[in a new window]
 
Figure 6.   Axotomy-induced increase in MBP mRNA expression. In situ hybridization for MBP mRNA in the molecular layer of SJL/J (A, C, E) and MBP-IFNgamma transgenic (TG) mice (B, D, F). A, B, Unlesioned fascia dentata; C, D, 2 d after lesion; E, F, 5 d after lesion. MBP mRNA is upregulated in oligodendrocytes located within the denervated PP zones of the fascia dentata molecular layer at day 5 in both types of mice. MBP RNA-expressing cells are indicated by arrowheads. lpp, Lateral perforant path; mpp, medial perforant path; ca, commissural associational zone; g, granule cell layer. Scale bar, 50 µm.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Our results show that perforant path lesioning in mice leads to transient induction of TNFalpha mRNA in reactive microglia. Microglial reactivity also included morphological changes and increased Mac-1 expression. Although independent of IFNgamma , all of these were enhanced by the presence of this cytokine in MBP-IFNgamma transgenic mice. Oligodendroglial reactivity was shown as increased MBP gene transcription in denervated areas in both MBP-IFNgamma transgenic and nontransgenic SJL/J mice. The kinetics of TNFalpha production, whether enhanced by IFNgamma or not, differed strikingly from those of microglial or oligodendroglial reactivity. These results suggest innate glial programs of response to injury, some of which are amplified by immune cytokines.

Microglia are the earliest responders to axotomy and are the principal source of TNFalpha in the CNS (Dopp et al., 1997; Finsen et al., 2000). The kinetics of glial reactivity after perforant path axonal lesioning include early retraction of processes by microglia, followed by proliferation at 1 d, coincident with upregulation of Mac-1/CR3 (Fagan and Gage, 1994). Astrocyte and oligodendroglial responses occur later (Steward et al., 1990; Fagan and Gage, 1994; Jensen et al., 1994, 2000). Double-labeling controls failed to detect GFAP+TNFalpha mRNA-expressing cells, confirming our findings in ischemic brain (Gregersen et al. 2000). Our results therefore show induction of TNFalpha in microglial cells after axonal lesioning and a pronounced effect of IFNgamma on this.

The levels of TNFalpha detected in reactive hippocampal microglia were relatively low, compared with levels seen in macrophage-like cells in ischemic brain lesions (Gregersen et al. 2000). Additionally, the number of Mac-1-reactive microglia was in all cases greater than the number of ISH-detectable TNFalpha -producing cells (Figs. 2A,H, 5). It is likely that only strongly induced cytokine responses were detected by ISH and RT-PCR, so that only a subpopulation of activated microglia were high expressors of TNFalpha . Fink-Heimer staining for degeneration showed considerable interanimal variability (Fig. 5), and it was not possible to assess the extent of lesioning in hippocampi from which RNA was isolated for PCR. Nevertheless, TNFalpha induction was clearly demonstrated.

Transient TNFalpha transcription may reflect an inherent microglial program. Although Mac-1 expression remain elevated through and beyond day 5, TNFalpha mRNA levels drop from day 2 to day 5. Microglial reactivity may be induced in response to phagocytosis of debris, but degeneration of myelinated fibers persists for many days (Jensen et al., 1999), so this is unlikely to account for the transient TNFalpha response. Similarly, short-lived release of injury-related mediators from neurons would not account for continued Mac-1 reactivity. TNFalpha transcription by microglia/macrophages in EAE and ischemia is also transient (Renno et al., 1995; Gregersen et al. 2000), whereas Mac-1 elevation is more prolonged. Our results show this putative microglial TNFalpha program to be IFNgamma independent.

TNFalpha has been implicated as both a neuroprotective and a neurotoxic cytokine in ischemia (Bruce et al., 1996; Rothwell and Luheshi 1996; Barone et al., 1997), and in EAE it has been implicated in demyelination and oligodendrocyte death and as a mediator of counter-inflammatory effects (Selmaj and Raine 1988; Korner et al., 1997; Taupin et al., 1997; Liu et al., 1998). In the case of the perforant path lesion, there is no infiltration of leukocytes (Fagan and Gage, 1994), so effects of TNFalpha in promoting leukocyte and endothelial reactivity are likely not relevant here. TNFalpha can act through two receptors, the p55 TNFRI and the p75 TNFRII (Hsu et al., 1995; Rao et al., 1995). Although TNFRI was originally thought to induce apoptosis, recent work suggests that this receptor may promote neuronal survival (Gary et al., 1998). Both receptors are expressed by neurons (Blotchkina et al., 1997; Cunningham et al., 1997), and it is possible that one of the roles of transient TNFalpha production is to promote the axonal sprouting that is a feature of the PP lesion (Fagan and Gage, 1990; Frotscher et al., 1997). The lack of leukocytic infiltrate excludes T cells or macrophages, which can contribute to regenerative responses in the CNS (Moalem et al., 1999), from playing such a role here. Finally, TNFalpha may act in either autocrine or paracrine mode to induce secondary signals such as other cytokines (Becher et al., 1996). Their kinetic advantage in the overall glial response makes it likely that microglia would influence other cell types. This could include induction of secondary mediators by astrocytes as well as microglia (Gómez-Pinilla et al., 1992; Théry et al., 1992; Shafit-Zagardo et al., 1993; Guthrie et al., 1995, 1997), which could then act on axons or oligodendrocytes.

Whether the increase in MBP-transcribing cells reflects oligodendrocyte proliferation, differentiation of precursors, or upregulation of established cells, it represents a myelinating response that occurs downstream of microglial signaling. We have found a close correlation between onset of sprouting and MBP transcription (Matthews et al., 1976b; Steward and Vinsant 1983; Jensen et al. 2000), which taken together with instances of zone-specific MBP transcription without microglial reactivity argued that sprouting is sufficient to induce MBP (Finsen et al., 2000; Jensen et al. 2000). This would not exclude a role for glial products in promoting myelination, and products of microglial response could directly induce oligodendroglial MBP transcription (Hetier et al., 1988; Fagan and Gage, 1990, 1994; Bartholdi and Schwab, 1998). Whether TNFalpha itself acts directly on oligodendrocytes may depend on whether these cells preferentially express p55 TNFalpha receptors (Dopp et al., 1997) or both p55 and p75 (Tchelingerian et al., 1995). Indirect action of microglia could involve induction or promotion of production of FGF-2, CSF-1, or CNTF by astrocytes (Gómez-Pinilla et al., 1992; Théry et al., 1992; Guthrie et al., 1995,1997; Oh and Yong, 1996). Similarly, TNFalpha , possibly in conjunction with IL-1, could cause the proliferation of astrocytes that is associated with anterograde axonal degeneration (Selmaj et al., 1990; Aloisi et al., 1992a; Fagan and Gage, 1994).

Potentially, effects of IFNgamma include amplification of endogenous responses and induction of novel response. The inherent IFNgamma independence of in vivo glial responses (Krakowski and Owens 1996; Rostworowski et al., 1997) suggests amplification rather than primary response induction. IFNgamma can stimulate microglial cells to upregulate MHC class I and induce MHC class II expression in vitro (Otero and Merrill, 1994). Microglial cells are furthermore stimulated in vitro by IFNgamma to produce cytokines (TNFalpha , IL-1, and IL-6) and other soluble mediators and to enhance phagocytic and cytopathic activity (Frei et al., 1987; Hetier et al., 1988; Merrill et al., 1993; Renno et al., 1995; Merrill and Benveniste, 1996). IFNgamma , in addition to being a microglial activator, also induces an astroglial response, with cytokine production (CSF-1, IL-6, IL-8) (Aloisi et al., 1992b; Théry et al., 1992), and proliferation in vitro and reactive gliosis in vivo (Yong et al., 1991). Given the powerful potential of IFNgamma to activate microglial cells in vitro, it is consistent that the microglial response to PP lesioning in vivo was much higher in transgenic mice, in which IFNgamma was expressed in hippocampus. Similarly, the increased levels of TNFalpha in transgenic mice must reflect activity of IFNgamma on microglia. Importantly, TNFalpha levels in transgenic mice downregulated with similar kinetics as in nontransgenic mice. So, whether IFNgamma or other stimuli induce TNFalpha , a separate, distinct mechanism then overrides at later stages. The kinetics of IFNgamma upregulation were also quite distinct from TNFalpha . This is more consistent with an amplifying role for IFNgamma .

It is uncertain whether there are endogenous sources of IFNgamma in the adult CNS. Motor and sensory neurons isolated from the CNS have been reported to express IFNgamma immunoreactivity and mRNA, respectively (Olsson et al., 1989; Neumann et al., 1997), but there are no reports of expression in situ in adult animals. Nonetheless, induction of developmentally silenced events may occur during injury or inflammatory responses, so it cannot be excluded that neurons might upregulate IFNgamma in response to certain stimuli in adult animals. However, our high-cycle RT-PCR analyses failed to detect it in lesioned hippocampus. It is more likely that IFNgamma production within the adult CNS derives from extra CNS sources, probably immune leukocytes such as T and NK cells. The expression of IFNgamma receptors by microglia and astrocytes therefore anticipates interaction with immune cells, and this probably reflects evolutionary selection for anti-viral responses (Griffin et al., 1992). Our results suggest that the IFNgamma response may also optimize the opportunity for regenerative responses. Inflammation contributes to regeneration in the CNS (Tourbah et al., 1997; Moalem et al., 1999) and likely involves induction of TNFalpha in glial cells. We have shown that IFNgamma amplifies these responses.

Our findings suggest a model for glial reaction to axonal injury and subsequent regenerative response by which TNFalpha and other cytokine production, amplified by IFNgamma , are directed to regeneration. Involvement of these cytokines in inflammatory pathology may be seen as an inadvertent consequence of their overproduction or failure to remove inducing stimuli within a prescribed time.


    FOOTNOTES

Received Sept. 27, 1999; revised Feb. 25, 2000; accepted March 1, 2000.

This study was supported by grants to M.B.J. and B.F. from The Danish Medical Research Council, Retired President Leo Nielsen and Wife Karen Margrethe Nielsen's Foundation, Kong Christian d. X's Foundation, The Foundation to the Advance of Medical Science, The Danish Multiple Sclerosis Society, President Ejnar Jonassen's Foundation, Lily Benthine Lund's Foundation, The Munkemølle Foundation, A. J. Andersen's Foundation, and University of Southern Denmark/Odense University. Research at The Montreal Neurological Institute was supported by grants to T.O. from the Multiple Sclerosis Society of Canada and Medical Research Council-Canada. We thank Grethe Jensen, Dorete Jensen, Jacob Bang Jensen, and Margrethe Krogh Rasmussen (Odense University) for technical assistance, and Albert Meier (Aarhus University) for photography. We thank Lyne Bourbonnière, Grace Chan, and Elise Tran (Montreal Neurological Institute) for help with PCR and analysis.

Correspondence should be addressed to Dr. Bente Finsen, Department of Anatomy and Neurobiology, University of Southern Denmark/Odense University, Winsløwparken 21, Odense C, DK 5000 Denmark. E-mail: finsen{at}imbmed.usd.dk.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

  • Aloisi F, Borsellino G, Samoggia P, Testa U, Chelucci C, Russo G, Peschle C, Levi G (1992a) Astrocyte cultures from human embryonic brain: characterization and modulation of surface molecules by inflammatory cytokines. J Neurosci Res 32:494-506[Web of Science][Medline].
  • Aloisi F, Care A, Borsellino G, Gallo P, Rosa S, Bassani A, Cabibbo A, Testa U, Levi G, Peschle C (1992b) Production of hemolymphopoietic cytokines (IL-6, IL-8, colony-stimulating factors) by normal human astrocytes in response to IL-1 beta and tumor necrosis factor-alpha. J Immunol 149:2358-2366[Abstract].
  • Barone FC, Arvin B, White RF, Miller A, Webb CL, Willette RN, Lysko PG, Feuerstein GZ (1997) Tumor necrosis factor-alpha : a mediator of focal ischemic brain injury. Stroke 28:1233-1244[Abstract/Free Full Text].
  • Bartholdi D, Schwab ME (1998) Oligodendroglial reaction following spinal cord injury in rat: transient upregulation of MBP mRNA. Glia 23:278-284[Web of Science][Medline].
  • Becher B, Dodelet V, Fedorowicz V, Antel JP (1996) Soluble tumor necrosis factor receptor inhibits interleukin 12 production by stimulated human microglial cells in vitro. J Clin Invest 98:1539-1543[Web of Science][Medline].
  • Blotchkina GI, Meistrell III ME, Blotchkina IL, Tracey KJ (1997) Expression of TNF and TNF receptors (p55 and p75) in the rat brain after focal cerebral ischemia. Mol Med 3:765-781[Web of Science][Medline].
  • Brodie C (1996) Differential effects of Th1 and Th2 derived cytokines on NGF synthesis by mouse astrocytes. FEBS Lett 394:117-120[Web of Science][Medline].
  • Bruce AJ, Boling W, Kindy MS, Peschon J, Kraemer PJ, Carpenter MK, Holtsberg FW, Mattson MP (1996) Altered neuronal and microglial responses to excitotoxic and ischemic brain injury in mice lacking TNF receptors. Nat Med 2:788-794[Web of Science][Medline].
  • Cheng B, Christakos S, Mattson MP (1994) Tumor necrosis factors protect neurons against metabolic-excitotoxic insults and promote maintenance of calcium homeostasis. Neuron 12:139-153[Web of Science][Medline].
  • Corbin JG, Kelly D, Rath EM, Baerwald KD, Suzuki K, Popko B (1996) Targeted CNS expression of interferon-gamma in transgenic mice leads to hypomyelination, reactive gliosis, and abnormal cerebellar development. Mol Cell Neurosci 7:354-370[Web of Science][Medline].
  • Cunningham Jr ET, Stalder AK, Sanna PP, Liu SS, Bloom FE, Howes Jr EL, Campbell IL, Margolis TP (1997) Distribution of tumor necrosis factor receptor messenger RNA in normal and herpes simplex virus infected trigeminal ganglia in the mouse. Brain Res 758:99-106[Web of Science][Medline].
  • Dalton DK, Pitts-Meek S, Keshav S, Figari IS, Bradley A, Stewart TA (1993) Multiple defects of immune cell function in mice with disrupted interferon-gamma genes. Science 259:1739-1742[Abstract/Free Full Text].
  • Dopp JM, Mackenzie-Graham A, Otero GC, Merrill JE (1997) Differential expression, cytokine modulation, and specific functions of type-1 and type-2 tumor necrosis factor receptors in rat glia. J Neuroimmunol 75:104-112[Web of Science][Medline].
  • Fagan AM, Gage FH (1990) Cholinergic sprouting in the hippocampus, a proposed role for IL-1. Exp Neurol 110:105-120[Web of Science][Medline].
  • Fagan AM, Gage FH (1994) Mechanisms of sprouting in the adult central nervous system: cellular responses in areas of terminal degeneration and reinnervation in the rat hippocampus. Neuroscience 58:705-725[Web of Science][Medline].
  • Finsen B, Jensen MB, Lomholt ND, Hegelund IV, Poulsen FR, Owens T (2000) Axotomy-induced glial reactions in normal and cytokine transgenic mice. In: The functional roles of glial cells in health and disease. Dialogue between glia and neurons (Matsas R, Tsacopoulos M, eds), pp 157-171. New York: Plenum.
  • Fontana A, Fierz W, Wekerle H (1984) Astrocytes present myelin basic protein to encephalitogenic T-cell lines. Nature 307:273-276[Medline].
  • Frei K, Seipl C, Groscurth P, Schwerdel C, Fontana A (1987) Antigen presentation and tumour cytotoxicity by interferon-gamma -treated microglial cells. Eur J Immunol 17:1271-1278[Web of Science][Medline].
  • Frotscher M, Heimrich B, Deller T (1997) Sprouting in the hippocampus is layer specific. Trends Neurosci 20:218-223[Web of Science][Medline].
  • Gary DS, Bruce-Keller AJ, Kindy MS, Mattson MP (1998) Ischemic and excitotoxic brain injury is enhanced in mice lacking the p55 tumor necrosis factor receptor. J Cereb Blood Flow Metab 18:1283-1287[Web of Science][Medline].
  • Gómez-Pinilla F, Lee JW-K, Cotman CW (1992) Basic FGF in adult rat brain: cellular distribution and response to entorhinal lesion and fimbria-fornix transection. J Neurosci 12:345-355[Abstract].
  • Gregersen R, Lambertsen KL, Finsen B (2000) Brain macrophages and microglia are major sources of tumor necrosis factor alpha (TNF-alpha ) in a murine model of permanent middle cerebral occlusion. J Cereb Blood Flow Metab 20:53-65[Web of Science][Medline].
  • Griffin DE, Levine B, Tyor WR, Irani DN (1992) The immune response in viral encephalitis. Semin Immunol 4:111-119[Medline].
  • Guthrie KM, Nguyen T, Gall CM (1995) Insulin-like growth factor-1 mRNA is increased in deafferented hippocampus: spatiotemporal correspondence of a trophic event with axon sprouting. J Comp Neurol 352:147-160[Web of Science][Medline].
  • Guthrie KM, Woods AG, Nguyen T, Gall CM (1997) Astroglial ciliary neurotrophic factor mRNA expression is increased in fields of axonal sprouting in deafferented hippocampus. J Comp Neurol 386:137-148[Web of Science][Medline].
  • Hayes GM, Woodroofe MN, Cuzner ML (1987) Microglia are the major cell type expressing MHC class II in human white matter. J Neurol Sci 80:25-37[Web of Science][Medline].
  • Hetier E, Ayala J, Denefle P, Bousseau A, Rouget P, Mallat M, Prochiantz A (1988) Brain macrophages synthesize interleukin-1 and interleukin-1 mRNAs in vitro. J Neurosci Res 21:391-397[Web of Science][Medline].
  • Hjorth-Simonsen A (1970) Fink-Heimer silver impregnation of degenerating axons and terminals in mounted cryostat sections of fresh and fixed brains. Stain Technol 45:199-204[Web of Science][Medline].
  • Horwitz MS, Evans CF, McGavern DB, Rodriguez M, Oldstone MB (1997) Primary demyelination in transgenic mice expressing interferon-gamma. Nat Med 3:1037-1041[Web of Science][Medline].
  • Hsu H, Xiong J, Goeddel DV (1995) The TNF receptor 1-associated protein TRADD signals cell death and NF-kappa B activation. Cell 81:495-504[Web of Science][Medline].
  • Jensen MB, González B, Castellano B, Zimmer J (1994) Microglial and astroglial reactions to anterograde axonal degeneration: a histochemical and immunocytochemical study of the adult rat fascia dentata after entorhinal perforant path lesions. Exp Brain Res 98:245-260[Web of Science][Medline].
  • Jensen MB, Finsen B, Zimmer J (1997) Morphological and microglial changes in the denervated fascia dentata: correlation with blood-brain-barrier damage and astroglial reactions. Exp Neurol 143:103-116[Web of Science][Medline].
  • Jensen MB, Hegelund IV, Poulsen FR, Owens T, Zimmer J, Finsen B (1999) Microglial reactivity correlates to the density of the anterogradely degenerating axons and terminals following perforant path denervation of the mouse fascia dentata. Neuroscience 93:507-518[Web of Science][Medline].
  • Jensen MB, Poulsen FR, Finsen B (2000) Oligodendrocytes upregulate myelin basic protein gene expression in fields of axonal sprouting in denervated mouse hippocampus. Int J Dev Neurosci 18:221-235[Web of Science][Medline].
  • Korner H, Riminton DS, Strickland DH, Lemckert FA, Pollard JD, Sedgwick JD (1997) Critical points of tumor necrosis factor action in central nervous system autoimmune inflammation defined by gene targeting. J Exp Med 186:1585-1590[Abstract/Free Full Text].
  • Krakowski ML, Owens T (1996) Interferon-gamma confers resistance to experimental allergic encephalomyelitis. Eur J Immunol 26:1641-1646[Web of Science][Medline].
  • Lee SC, Liu W, Dickson DW, Brosnan CF, Berman JW (1993) Cytokine production by human fetal microglia and astrocytes: differential induction by lipopolysaccharide and IL-1beta . J Immunol 150:2659-2667[Abstract].
  • Liu J, Marino MW, Wong G, Grail D, Dunn A, Bettadapura J, Slavin AJ, Old L, Bernard CC (1998) TNF is a potent anti-inflammatory cytokine in autoimmune-mediated demyelination. Nat Med 4:78-83[Web of Science][Medline].
  • Matthews DA, Cotman C, Lynch G (1976a) An electron microscopic study of lesion-induced synaptogenesis in the dentate gyrus of the adult rat. I. Magnitude and time course of degeneration. Brain Res 115:1-21[Web of Science][Medline].
  • Matthews DA, Cotman C, Lynch G (1976b) An electron microscopic study of lesion-induced synaptogenesis in the dentate gyrus of the adult rat. II. Reappearance of morphologically normal synaptic contacts. Brain Res 115:23-41[Web of Science][Medline].
  • Merrill JE, Benveniste EN (1996) Cytokines in inflammatory brain lesions: helpful and harmful. Trends Neurosci 19:331-338[Web of Science][Medline].
  • Merrill JE, Ignarro LJ, Sherman MP, Melinek J, Lane TE (1993) Microglial cell cytotoxicity of oligodendrocytes is mediated through nitric oxide. J Immunol 151:2132-2141[Abstract].
  • Moalem G, Leibowitz-Amit R, Yoles E, Mor F, Cohen IR, Schwartz M (1999) Autoimmune T cells protect neurons from secondary degeneration after central nervous system axotomy. Nat Med 5:49-55[Web of Science][Medline].
  • Neumann H, Schmidt H, Wilharm E, Behrens L, Wekerle H (1997) Interferon gamma  gene expression in sensory neurons: evidence for autocrine gene regulation. J Exp Med 186:2023-2031[Abstract/Free Full Text].
  • Oh LY, Yong VW (1996) Astrocytes promote process outgrowth by adult human oligodendrocytes in vitro through interaction between bFGF and astrocyte extracellular matrix. Glia 17:237-253[Web of Science][Medline].
  • Olsson T, Kristensson K, Ljungdahl A, Maehlen J, Holmdahl R, Klareskog L (1989) Gamma-interferon-like immunoreactivity in axotomized rat motor neurons. J Neurosci 9:3870-3875[Abstract].
  • Otero GC, Merrill JE (1994) Cytokine receptors on glial cells. Glia 2:117-128.
  • Pennica D, Hayflick JS, Bringman TS, Palladino MA, Goeddel DV (1985) Cloning and expression in Escherichia coli of the cDNA for murine tumor necrosis factor. Proc Natl Acad Sci USA 82:6060-6064[Abstract/Free Full Text].
  • Perry VH, Hume DA, Gordon S (1985) Immunohistochemical localization of macrophages and microglia in the adult and developing mouse brain. Neuroscience 15:313-326[Web of Science][Medline].
  • Probert L, Akassoglou K, Kassiotis G, Pasparakis M, Alexopoulou L, Kollias G (1997) TNF-alpha transgenic and knockout models of CNS inflammation and degeneration. J Neuroimmunol 72:137-141[Web of Science][Medline].
  • Raivich G, Jones LL, Kloss CUA, Werner A, Neumann H, Kreutzberg GW (1998) Immune surveillance in the injured nervous system: T-lymphocytes invade the axotomized mouse facial motor nucleus and aggregate around sites of neuronal degeneration. J Neurosci 18:5804-5816[Abstract/Free Full Text].
  • Rao P, Hsu KC, Chao MV (1995) Upregulation of NF-kappa B-dependent gene expression mediated by the p75 tumor necrosis factor receptor. J Interferon Cytokine Res 15:171-177[Web of Science][Medline].
  • Renno T, Krakowski M, Piccirillo C, Lin J-Y, Owens T (1995) TNFalpha production by resident microglia and infiltrating leukocytes in the central nervous system of mice with experimental allergic encephalomyelitis. J Immunol 154:944-953[Abstract].
  • Renno T, Taupin V, Bourbonnière L, Verge G, Tran E, De Simone R, Krakowski M, Rodriguez M, Peterson A, Owens T (1998) Interferon-gamma in progression to persistent demyelination and neurological deficit following acute EAE. Mol Cell Neurosci 12:376-389[Web of Science][Medline].
  • Rostworowski M, Balasingam V, Chabot S, Owens T, Yong VW (1997) Astrogliosis in the neonatal and adult murine brain post-trauma: elevation of inflammatory cytokines and the lack of requirement for endogenous interferon-gamma. J Neurosci 17:3664-3674[Abstract/Free Full Text].
  • Rothwell NJ, Luheshi GN (1996) Brain TNF: damage limitation or damaged reputation? Nat Med 2:746-747[Web of Science][Medline].
  • Sabath DE, Broome HE, Prystowsky MB (1990) Glyceraldehyde-3-phosphate dehydrogenase mRNA is a major interleukin 2-induced transcript in a cloned T-helper lymphocyte. Gene 16:185-191.
  • Sebire G, Hery C, Peudenier S, Tardieu M (1993) Adhesion proteins on human microglial cells and modulation of their expression by IL-1 alpha and TNF alpha. Res Virol 144:47-52[Web of Science][Medline].
  • Selmaj KW, Raine CS (1988) Tumor necrosis factor mediates myelin and oligodendrocyte damage in vitro. Ann Neurol 23:339-346[Web of Science][Medline].
  • Selmaj KW, Farooq M, Norton WT, Raine CS, Brosnan CF (1990) Proliferation of astrocytes in vitro in response to cytokines: a primary role for tumor necrosis factor. J Immunol 144:129-135[Abstract].
  • Shafit-Zagardo B, Sharma N, Berman JW, Bornstein MB, Brosnan CF (1993) CSF-1 expression is upregulated in astrocyte cultures by IL-1 and TNF and affects microglial proliferation and morphology in organotypic cultures. Int J Dev Neurosci 2:189-198.
  • Stalder AK, Carson MJ, Pagenstecher A, Asensio VC, Kincaid C, Benedict M, Powell HC, Masliah E, Campbell IL (1998) Late-onset chronic inflammatory encephalopathy in immune-competent and severe combined immune-deficient (SCID) mice with astrocyte-targeted expression of tumor necrosis factor. Am J Pathol 153:767-783[Abstract/Free Full Text].
  • Steward O, Vinsant SL (1983) The process of reinnervation in the dentate gyrus of the adult rat: a quantitative electron microscopic analysis of terminal proliferation and reactive synaptogenesis. J Comp Neurol 214:370-386[Web of Science].
  • Steward O, Torre ER, Phillips LL, Trimmer PA (1990) The process of reinnervation in the dentate gyrus of adult rats: time course of increases in mRNA for glial fibrillary acidic protein. J Neurosci 10:2373-2384[Abstract].
  • Takahashi N, Roach A, Teplow DB, Prusiner SB, Hood L (1985) Cloning and characterization of the myelin basic protein gene from mouse: one gene can encode both 14 kd and 18.5 kd MBPs by alternate use of exons. Cell 42:139-148[Web of Science][Medline].
  • Taupin V, Renno T, Bourbonniere L, Peterson AC, Rodriguez M, Owens T (1997) Increased severity of experimental autoimmune encephalomyelitis, chronic macrophage/microglial reactivity, and demyelination in transgenic mice producing tumor necrosis factor-alpha in the central nervous system. Eur J Immunol 27:905-913[Web of Science][Medline].
  • Tchelingerian JL, Monge M, Le Saux F, Zalc B, Jacque C (1995) Differential oligodendroglial expression of the tumor necrosis factor receptors in vivo and in vitro. J Neurochem 65:2377-2380[Web of Science][Medline].
  • Théry C, Stanley ER, Mallat M (1992) Interleukin 1 and tumor necrosis factor-alpha stimulate the production of colony-stimulating factor 1 by murine astrocytes. J Neurochem 59:1183-1186[Web of Science][Medline].
  • Tourbah A, Linnington C, Bachelin C, Avellana-Adalid V, Wekerle H, BaronVan Evercooren A (1997) Inflammation promotes survival and migration of the CG4 oligodendrocyte progenitors transplanted in the spinal cord of both inflammatory and demyelinated rats. J Neurosci Res 50:853-861[Web of Science][Medline].
  • Wekerle H, Linington C, Lassmann H, Meyermann R (1986) Cellular immune reactivity within the CNS. Trends Neurosci 9:271-277.
  • Yong VW, Moumdjian R, Yong FP, Ruijs TC, Freedman MS, Cashman N, Antel JP (1991) Gamma-interferon promotes proliferation of adult human astrocytes in vitro and reactive gliosis in the adult mouse brain in vivo. Proc Natl Acad Sci USA 88:7016-7020[Abstract/Free Full Text].


Copyright © 2000 Society for Neuroscience  0270-6474/00/20103612-10$05.00/0


This article has been cited by other articles:


Home page
J. Immunol.Home page
R. Khorooshi, A. A. Babcock, and T. Owens
NF-{kappa}B-Driven STAT2 and CCL2 Expression in Astrocytes in Response to Brain Injury
J. Immunol., November 15, 2008; 181(10): 7284 - 7291.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. A. Babcock, H. Toft-Hansen, and T. Owens
Signaling through MyD88 Regulates Leukocyte Recruitment after Brain Injury
J. Immunol., November 1, 2008; 181(9): 6481 - 6490.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
T. Mizuno, G. Zhang, H. Takeuchi, J. Kawanokuchi, J. Wang, Y. Sonobe, S. Jin, N. Takada, Y. Komatsu, and A. Suzumura
Interferon-{gamma} directly induces neurotoxicity through a neuron specific, calcium-permeable complex of IFN-{gamma} receptor and AMPA GluR1 receptor
FASEB J, June 1, 2008; 22(6): 1797 - 1806.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Chen, P. Iribarren, J. Huang, L. Zhang, W. Gong, E. H. Cho, S. Lockett, N. M. Dunlop, and J. M. Wang
Induction of the Formyl Peptide Receptor 2 in Microglia by IFN-{gamma} and Synergy with CD40 Ligand
J. Immunol., February 1, 2007; 178(3): 1759 - 1766.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
A. A. Babcock, M. Wirenfeldt, T. Holm, H. H. Nielsen, L. Dissing-Olesen, H. Toft-Hansen, J. M. Millward, R. Landmann, S. Rivest, B. Finsen, et al.
Toll-Like Receptor 2 Signaling in Response to Brain Injury: An Innate Bridge to Neuroinflammation
J. Neurosci., December 6, 2006; 26(49): 12826 - 12837.
[Abstract] [Full Text] [PDF]


Home page
RadiologyHome page
D.-E. Kim, K. Tsuji, Y. R. Kim, F.-J. Mueller, H.-S. Eom, E. Y. Snyder, E. H. Lo, R. Weissleder, and D. Schellingerhout
Neural Stem Cell Transplant Survival in Brains of Mice: Assessing the Effect of Immunity and Ischemia by using Real-time Bioluminescent Imaging
Radiology, December 1, 2006; 241(3): 822 - 830.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Monsonego, J. Imitola, S. Petrovic, V. Zota, A. Nemirovsky, R. Baron, Y. Fisher, T. Owens, and H. L. Weiner
Abeta-induced meningoencephalitis is IFN-{gamma}-dependent and is associated with T cell-dependent clearance of Abeta in a mouse model of Alzheimer's disease
PNAS, March 28, 2006; 103(13): 5048 - 5053.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
V. Blais and S. Rivest
Effects of TNF-{alpha} and IFN-{gamma} on Nitric Oxide-Induced Neurotoxicity in the Mouse Brain
J. Immunol., June 1, 2004; 172(11): 7043 - 7052.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
A. A. Babcock, W. A. Kuziel, S. Rivest, and T. Owens
Chemokine Expression by Glial Cells Directs Leukocytes to Sites of Axonal Injury in the CNS
J. Neurosci., August 27, 2003; 23(21): 7922 - 7930.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
Y. H. Chong, Y. J. Shin, and Y.-H. Suh
Cyclic AMP Inhibition of Tumor Necrosis Factor alpha Production Induced by Amyloidogenic C-Terminal Peptide of Alzheimer's Amyloid Precursor Protein in Macrophages: Involvement of Multiple Intracellular Pathways and Cyclic AMP Response Element Binding Protein
Mol. Pharmacol., March 1, 2003; 63(3): 690 - 698.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. H. Chong, J. H. Sung, S. A. Shin, J.-H. Chung, and Y.-H. Suh
Effects of the beta -Amyloid and Carboxyl-terminal Fragment of Alzheimer's Amyloid Precursor Protein on the Production of the Tumor Necrosis Factor-alpha and Matrix Metalloproteinase-9 by Human Monocytic THP-1
J. Biol. Chem., June 22, 2001; 276(26): 23511 - 23517.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit an eLetter
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (45)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jensen, M. B.
Right arrow Articles by Owens, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jensen, M. B.
Right arrow Articles by Owens, T.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH

-
-

Home  |   Search  |   Archive  |   Subscribe  |   Contact  |   Help

-
Copyright 2009 by Society for Neuroscience ONLINE ISSN: 1529-2401
-