 |
|||||
|
|||||
|
|||||
|
|||||
|
|||||
Previous Article | Next Article
The Journal of Neuroscience, May 15, 2000, 20(10):3725-3735
Cell Contact Regulates Fate Choice by Cortical Stem Cells
Robert Y. L. Tsai and Ronald D. G. McKay Laboratory of Molecular Biology, National Institute of Neurological Disorders and Stroke, National Institutes of Health, Bethesda, Maryland 20892
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
Cell fate is determined by intrinsic programs and external cues, such as soluble signals and cell-cell contact. Previous studies have demonstrated the roles of soluble factors in the proliferation and differentiation of cortical stem cells and cell-cell contact in maintaining stem cells in a proliferative state. In the present study, we focused on the effect of cell-cell interaction on cell-fate determination. We found that density could exert a strong influence on the cell-type composition when cortical stem cells differentiate. Multipotent stem cells, which normally gave rise to neurons, astrocytes, and oligodendrocytes under high-density culture condition, differentiated almost exclusively into smooth muscle at low density. Clonal analysis indicated that smooth muscle and astrocytes were derived from a common precursor and that the density effect on cell types used an instructive mechanism on the choice of fate rather than an effect of selective survival and/or proliferation. This instructive mechanism depended on the local and not the average density of the cells. This local signal could be mimicked by membrane extract. These findings demonstrate the importance of membrane-bound signals in specifying lineage and provide the first evidence for a short-range regulatory mechanism in cortical stem cell differentiation.
Key words: cortical stem cell; density; cell contact; cell-fate determination; smooth muscle; astrocyte
INTRODUCTION
The ventricular zone cells in the developing brain undergo extensive cell division to generate diverse cell types. One key issue in developmental neurobiology is to understand how the brain orchestrates the differentiation of various cell types in a precise temporal and spatial order. One attractive model proposed that different cell types in the brain were generated from a common precursor in the developing CNS (Gage and Fisher, 1995
; McKay, 1997
Previous work has explored the phenotypic potential of neural stem cells in culture by inducing differentiation in the presence of various soluble factors. Several studies indicate that leukemia inhibitory factor (Richards et al., 1996
Signals coming from both diffusible factors and cell contact are essential for the normal development of neuroepithelium. Diffusible factors, such as Sonic hedgehog and BMPs, play crucial roles in normal pattern formation and cellular differentiation. The importance of cell-cell contact has been implicated in several key aspects of neural development. These include (1) maintaining cortical progenitor cells (Temple and Davis, 1994
MATERIALS AND METHODS
Dissection and stem cell culture. Cortical stem cell culture was conducted as described previously with some modifications (Johe et al., 1996
View larger version (110K):[in this window]
[in a new window]
Figure 1. Stem cell culture and differentiation paradigm. Phase-contrast pictures of stem cells (P1D4) grown at low (A), intermediate (B), and high (C) density. Before differentiation, all cells, as revealed by DAPI nuclear staining (D), expressed nestin (E) and incorporated BrdU (F). G, Schematic diagram of standard differentiation paradigm as described in Materials and Methods. LD, Low density; MD, intermediate density; HD, high density; S8, serum-induced differentiation day 8. Scale bar: A-C, 50 µm; D-F, 25 µm.
Clonal analysis. Dissociated cells were plated at 400 cells per 10 cm dish. After 2 hr of settling, floating cells were removed by replacing the medium with fresh medium, and well isolated single cells were marked with a 3 mm circle (Nikon, Tokyo, Japan) on the bottom of the plates. Only cells that were grown in a circle marked as described above were referred to as clones, others as clusters.
Immunocytochemistry. The primary antibodies and their dilution used in this study were mouse
-
-tubulin class III neuron-specific isotype (clone Tuj1; Babco, Richmond, CA), 1:500; rabbit
Immunolabeling was visualized by indirect fluorescence. At indicated time points, cultured cells were fixed with ice-cold 4% paraformaldehyde solution for 15 min. After blocking with 10% normal goat serum in 1× PBS-0.3%Triton X-100, cells were incubated with primary antibody overnight at 4°C, followed by secondary antibody reaction for 1 hr at room temperature. Three washes with 1× PBS for 10 min each were performed between primary and secondary antibody incubation and after secondary antibody reaction. For double-labeled immunofluorescence, primary antibodies raised in two different species were incubated together, followed by reaction with appropriate combination of secondary antibodies coupled to either Rhodamine Red or FITC. For some experiments, nuclear staining with 4',6 diamidino-2-phenylindole (DAPI) (1 µg/ml; Accurate Chemicals, Westbury, NY) was added in the secondary antibody reaction to reveal all cell nuclei in culture.
Reverse transcription-PCR. Total RNA (1 µg), treated with DNaseI for 15 min at room temperature, was reverse-transcribed into first-strand cDNA with 300 ng of random hexamer and M-MLV reverse transcriptase (Life Technology) in a 20 µl reverse transcription (RT) reaction. Semiquantitative analysis was performed in 25 µl of PCR reaction with 0.5 µl of undiluted first-strand cDNA solution, 0.2 mM dNTP, and 0.4 mM primers. To obtain the linear range of PCR amplification, every set of PCR reaction was performed at three consecutive odd-numbered cycles determined by pilot studies. Positive control for first-strand cDNA reaction was performed with the QuantumRNA 18S internal standards (primer/Competimer, 2:8; Clontech, Cambridge, UK). Negative control for potential genomic contamination was done by leaving out the reverse transcriptase in the first-strand cDNA synthesis reaction.
The basic calponin (bCALP)-specific oligonucleotide sequences were selected from the mouse bCALP gene in regions most diverse from the rat acidic calponin. Their sequences were as follows: 5' bCALP primer, GAGAGAAGGCAGGAACATCZ; 3' bCALP primer, AGTGTTCCATGCCCAGACC; 5' SM22 primer, TGTTCCAGACTGTTGACCTC; and 3' SM22 primer, GTGATACCTCAAAGCTGTCC.
Membrane preparation. The membrane preparation was based on the method of Temple and Davis (1994)
RESULTS
Cortical stem cells differentiate into smooth muscle at low density
Withdrawal of the mitogenic effect of bFGF was shown to initiate cortical stem cell differentiation into neurons, astrocytes, and oligodendrocytes (Johe et al., 1996
Serial immunocytochemical staining was performed at various time points to analyze the kinetics of cell fate at different densities. The average percentage of immunoreactive cells in 16 random high-power fields (HPFs) on a 10 cm dish was used for each data point, and six independent experiments were performed for every analysis. Neural stem cells were cultured at three different densities (high, intermediate, and low) as described in Materials and Methods. Before differentiation, the majority of cells formed clusters of various sizes depending on the initial plating density (Fig. 1A-C). Cells at this stage had small, round, or polygonal cell bodies with multiple short processes. All of the cells, as revealed by DAPI nuclear staining in Figure 1D, expressed nestin (Fig. 1E) and remained proliferative as judged by their ability to incorporate bromodeoxyuridine (BrdU) (18 hr pulse) (Fig. 1F). After differentiation, cells at high density displayed at least four different cell fates. Some cells in the center of dense clusters were immunoreactive to Tuj1, a monoclonal antiserum that recognizes a neuron-specific subtype of
View larger version (190K):[in this window]
[in a new window]
Figure 2. Cell-type composition in high-, intermediate-, and low-density cultures. After 8 d of differentiation in serum at high density, 15% of cells were neurons (A; Tuj1), and 60-80% were astrocytes (B;
At intermediate density, SMA immunoreactivity appeared in 10-20% of cells in the peripheral region of a cluster or between clusters (Fig. 2C). The majority of cells displayed strong GFAP immunoreactivity (Fig. 2D). These GFAP+ astrocytes had flat cell bodies and wide processes in contrast to the fibrous astrocytes seen at high density. Cells (12.6%) were immunoreactive with Tuj1 (Fig. 2E). These neurons differentiated in the center of clusters, possessed simple neuritic processes, and expressed epitopes recognized by A2B5, indicating that they were young postmitotic neurons (R. Y. L. Tsai, unpublished data). On the other hand, almost all cells at low density displayed flat morphology and expressed SMA after 2 d of differentiation (Fig. 2F). However, the
Previous studies have shown that astrocytes, both in vitro and in vivo, can express SMA (Lecain et al., 1991
View larger version (50K):[in this window]
[in a new window]
Figure 3. Expression of smooth muscle proteins at low density. Expression of several smooth muscle-specific proteins in low-density culture was examined by immunocytochemistry and RT-PCR. A, After 4 d of differentiation, 30-40% of the cells were ) experiment was done by omitting reverse transcriptase in the first-strand cDNA synthesis reaction to control for potential genomic contamination. rRNA (18 S) reaction was used to control for RNA isolation and first-strand cDNA synthesis efficiency.
Smooth muscle and astrocytes are derived from the same lineage
To address whether smooth muscle is derived from a separate lineage, we performed the following experiments. P1D0 stem cells as described in Figure 1G were plated at clonal density (400 per 10 cm dish), and well isolated single cells were marked after 2 hr of settling. Clones were grown for 6 d (P1D6) in bFGF before induction of differentiation. Twenty percent of the marked clones grew to a large clone size (>400 cells per clone). Cell fates were assessed by the expression of GFAP, SMA, and
View larger version (57K):[in this window]
[in a new window]
Figure 4. Smooth muscle and astrocytes were derived from the same precursors. All clones with a large clone size (>400 cells per clone) gave rise to both astrocytes in the center (A) and smooth muscle at the periphery (B). Insets, A-B, DAPI staining of the same fields. At the junction, GFAP+ cells intermixed with SMA+ cells (C, D). Four types of expression pattern could be identified in the transition: cells that were distinctly labeled with
Stem cells grown at high density retain the same developmental potential as cells grown at low density
Cells expanded at high density may undergo cell-fate restriction and possess different developmental potential from cells grown at low density. To examine this possibility, P1D4 cells grown at high density were replated at clonal density. Single cells were marked 2 hr after plating and induced to differentiate by 10% FBS. The cell number and expression of GFAP and SMA of every clone was analyzed 3 d later. Quantitative analysis of 743 clones from four separate experiments showed that the number of cells within a clone ranged from 0 to 18 cells. Most clones contained one to three cells (52.2%) (Table 1). All of the cells that survived after 3 d of differentiation at low density showed smooth muscle morphology and expressed SMA (Fig. 5A). Of all clones analyzed, only 14.5% of them died and therefore failed to give rise to smooth muscle fates. If these cells that died at low density represented a nonsmooth muscle lineage, they would have to divide 13.5 times in 2 d to make up for the 2000:1 nonsmooth muscle to smooth muscle ratio at high density.
View this table: [in this window]
[in a new window]
Table 1. Interclonal analysis of cell fate and survival
View larger version (79K):[in this window]
[in a new window]
Figure 5. Cells expanded at high density differentiated into smooth muscle at low density. Stem cells grown at high density (P1D4) were labeled with green fluorescence protein (GFP)-expressing retrovirus and replated at clonal density before differentiation. A, Under the regular differentiation paradigm (10% FBS), all surviving cells expressed SMA and smooth muscle morphology.
One potential artifact introduced by the replating and clonal analysis procedure is selective dissociation, adherence, and/or survival of certain cell types. To address this possibility, we conducted a parallel experiment as described in Figure 5A with the exception of differentiating condition. Instead of 10% FBS, CNTF (20 ng/ml), which was shown to induce astrocytic differentiation in >97% of cultured stem cells (Johe et al., 1996
Density acts instructively on cell-fate determination
The previous results demonstrate that smooth muscle and astrocytes were derived from precursors with the same developmental potential before differentiation. Two possible mechanisms remain for the density effect on cell types. Density can either affect the proliferation and/or survival of selective cell types without influencing the fate choice or act instructively on lineage determination. To distinguish between these two possibilities, single cells were marked and grown in serum-containing medium. The development of identified clones was followed sequentially after 8 hr and thereafter every 24 hr for cell survival and morphology. After 5 d, the cellular identity was confirmed by immunocytochemistry (Table 2). Of 285 clones examined, 60.4% of the clones gave rise to only smooth muscle without cell death, and 17.5% of the clones became all smooth muscle before revealing any cell death. Only 10.5% of the clones exhibited intraclonal cell death before becoming smooth muscle. If neurons and glia were derived from these clones that exhibited intraclonal cell death before commitment to smooth muscle lineage, they would have to divide 12.8 times in 2 d to account for the difference seen at high and low density (see Discussion). Therefore, it is unlikely that density-mediated cell-type switch could be attributed to the selective mechanism. Based on the data presented (Figs. 4, 5; Tables 1, 2), we conclude that the models of two lineages, cell-fate restriction during bFGF expansion at high density, or selective proliferation and/or survival could not account for the cell-type composition seen at different densities. Therefore, cell density must act directly on cell-fate determination.
View this table: [in this window]
[in a new window]
Table 2. Intraclonal analysis of cell fate and survival Cell fates are affected by local density instead of average density
The density effect on smooth muscle cell fate could be caused by local signals or by global signals, such as tropic factors and medium deprivation at high density. To address the effect of local versus global density, we compared two culture conditions with similar average density but distinct intercellular distance: one with higher intraclonal density but fewer clones and the other with evenly dispersed cells. For culture with high intraclonal density, P1 cells were plated clonally (200 cells per 10 cm dish) and grown for 6 d in bFGF. Approximately 10-20 clusters on each plate achieved large clone size and high local density in the center. The total cell number on these plates was estimated to be 1.2 × 104 per 10 cm plate. To obtain cultures with evenly dispersed cells and high average density, P1D4 cells were replated at high density and induced to differentiate by mitogen withdrawal 1 d later. The total cell count in this condition was 1 × 105 per 10 cm dish. As shown in Figure 6, cells grown at high intraclonal density but low average density gave rise to both astrocytes and smooth muscle (A), whereas cells grown at low local density all became smooth muscle despite their higher average density (B). These findings demonstrated that the density effect on fate choice occurred in the local microenvironment and excluded the possibilities of long-ranged diffusible factors or medium deprivation as the cause.
View larger version (71K):[in this window]
[in a new window]
Figure 6. Effect of local versus average density on cell-fate determination. A, Cells grown at high local density but low average density gave rise to both astrocytes and smooth muscle. B, Cultures with evenly dispersed cells all differentiated into smooth muscle despite higher total cell count per plate.
The effect of density on cell fate can be mimicked by stem cell membrane extract
The effect of local signals could be mediated by cell-cell contact or short-ranged and/or short-lived secreted molecules. To test the hypothesis that smooth muscle fate could be inhibited at low density by membrane prepared from P1D4 cortical stem cell, dissociated stem cells were mixed with membrane extract for 2 hr in suspension to allow for binding and plated on 6 cm dishes (1266/cm2). Twenty-four hours after plating, cells were induced to differentiate by serum. After 6 d of differentiation, cell types were assessed by the expression of GFAP and SMA in 80 HPFs per 6 cm dish. Two independent experiments were performed for each analysis. In the presence of membrane extract, isolated GFAP-expressing cells were seen at low density (Fig. 7B) in contrast to the usual smooth muscle fate without membrane extract (Fig. 7F). Our results revealed a fourfold decrease in the SMA to GFAP ratio (2.7 ± 0.9, SD; n = 2) with 25 µg/ml of membrane extract, and a 1.5-fold decrease (7.5 ± 0.3, SD; n = 2) with 25 µg/ml of heat-inactivated membrane extract over control group (10.0 ± 2.2, SD; n = 2) (Fig. 7G). Although our findings suggest that the effect of local density is mediated by cell-cell contact, we cannot exclude the possibility that short-ranged secreted signals are also working in parallel.
View larger version (58K):[in this window]
[in a new window]
Figure 7. Membrane-mediated fate switch of smooth muscle cells to astrocytes. Stem cells were cultured with homotypic surface membrane before induction of differentiation. Isolated astrocytes could be seen in low-density culture with 25 µg/ml membrane extract (A-C), whereas in the control group, most cells were smooth muscle (D-F). A, D, DAPI staining. B, E,
DISCUSSION
We have used a culture system of multipotent stem cells to examine the effect of cell contact on lineage determination. This in vitro system offers the advantage of revealing the full developmental potential of stem cells without the restraint imposed by the in vivo environment. In this study, we observed the development of astrocytes or smooth muscle from cortical stem cells in a density-dependent manner. In contrast to previous work showing the effect of soluble factors on cell fate, changing the cell density as a variable directly influences the number of cells in different culture conditions and makes quantitative analysis of cell fate more complex.
Smooth muscle as a distinct cell fate of cortical stem cells
Previous studies reported the expression of SMA in astrocytes both in vivo and in vitro (Lecain et al., 1991
Instructive versus selective effects of density on cell-type composition
To explain the cell-type composition at high and low density, four possible regulatory mechanisms are proposed (Fig. 8A). In the first two models, smooth muscle and astrocytes are derived from different precursors present during dissection and P0 expansion (two lineages) or during bFGF expansion at high density (restriction). After differentiation, density could influence the survival and/or proliferation of specific cell types. In the other two scenarios, smooth muscle and astrocytes are derived from the same precursor before differentiation. Here, density might act on a common precursor to influence the proliferation and/or survival of specific lineages within a clone (intraclonal selection) or instructively on the fate choice of multipotent stem cells (instruction).
View larger version (20K):[in this window]
[in a new window]
Figure 8. Models of density-mediated fate choice by cortical stem cells. A, Schematic diagram of four regulatory mechanisms of the density effect on cell types. B, A model of CNS-to-PNS cell-fate switch during cellular differentiation. CS, Cortical stem cell; NcS, neural crest stem cell; AcP, astrocytic precursor; Ac, astrocyte; OcP, PSA-NCAM+ oligodendrocyte precursor; Oc, oligodendrocyte; SmP, smooth muscle precursor; Sm, smooth muscle; ScP, Schwann cell precursor; Sc, Schwann cell; HD, high density; LD, low density.
In the first (two-lineage) model, smooth muscle might come from precursors of meningeal or neural crest origin. By clonal analysis of P0D4 stem cells, we demonstrated that the same precursors could give rise to both smooth muscle and astrocytes as long as they grew to a larger clone size (>400 cells per clone). Invariably, astrocytes were always present in the center with smooth muscle in the periphery (Fig. 4). In the second model, precursors expanded in bFGF at high density might undergo cell-fate restriction, and density might act selectively on the proliferation and/or survival of certain cell types during differentiation. In the clonal analysis of P1D4 stem cells expanded at high density, 85.5% of the clones survived at low density, and they all gave rise to smooth muscle. If interclonal selection were to account for the different profiles seen at high and low density, some of the remaining clones would have to give rise to glial progeny and divide at an unprecedented rate that would make up the nonsmooth muscle to smooth muscle ratio seen at high density (>2000:1) in 2 d. Compared with the doubling time of CNS stem cells in vivo (10-12 hr) (Takahashi et al., 1995
These results strongly favor a common precursor for astrocytic and smooth muscle fates. These multipotent cells may choose their fates stochastically, and cell density may act selectively within individual clones to promote the survival and/or proliferation of neurons and glia at high density and that of smooth muscle at low density. If this intraclonal selection mechanism were to work, nonsmooth muscle clones would still need to divide 12.8 times in 2 d [amplification ratio: 2000 × (78%/22%) = 7000]. This calculated mitotic rate is still too fast for progenitors in vivo or in vitro, especially when they are undergoing differentiation. Together, we conclude that density affects cell lineage by an instructive mechanism.
Developmental stage at which the fate switch occurs
Previous work by Mujtaba et al. (1998)
Possible signaling mechanisms
The pattern of smooth muscle repression, particularly in the transitional region, is reminiscent of the local signaling mechanism of Drosophila Notch protein (Artavanis-Tsakonas et al., 1995
Conclusion
Our results indicate that homotypic interaction between stem cells represses smooth muscle fate and promotes astrocytic lineage by an instructive mechanism. We cannot distinguish yet whether the primary effect of cell contact is to repress smooth muscle generation, promote gliogenesis, or a combination of both. Nevertheless, the data present a clear demonstration of a cell-fate determination mechanism mediated by homotypic cell contact in cortical stem cells. The significance of the roles of membrane-mediated fate switch between smooth muscle and astrocytes in vivo is unknown. If CNS stem cells can adopt the smooth muscle fate in vivo, this process may be involved in the formation of blood-brain interface that is made up by astrocytes, smooth muscle, and endothelial cells.
FOOTNOTES Received Jan. 10, 2000; revised March 3, 2000; accepted March 9, 2000.
Correspondence should be addressed to Dr. Ronald D. G. McKay at the above address. E-mail: mckay{at}codon.nih.gov.
REFERENCES
- Artavanis-Tsakonas S, Matsuno K, Fortini ME (1995) Notch signaling. Science 268:225-232
[Abstract/Free Full Text] .- Barakat I, Sensenbrenner M, Vincendon G (1982) The importance of cell contact for the proliferation of neuroblasts in culture and its stimulation by meningeal extract. Neurochem Res 7:287-300[Web of Science][Medline].
- Bottenstein JE, Sato GH (1979) Growth of a rat neuroblastoma cell line in serum-free supplemented medium. Proc Natl Acad Sci USA 76:514-517
[Abstract/Free Full Text] .- Buniatian GH, Gebhardt R, Mecke D, Traub P, Wiesinger H (1999) Common myofibroblastic features of newborn rat astrocytes and cirrhotic rat liver stellate cells in early cultures and in vivo. Neurochem Int 35:317-327[Web of Science][Medline].
- Cai L, Hayes NL, Nowakowski RS (1997) Local homogeneity of cell cycle length in developing mouse cortex. J Neurosci 17:2079-2087
[Abstract/Free Full Text] .- Ferhat L, Charton G, Represa A, Ben-Ari Y, der Terrossian E, Khrestchatisky M (1996) Acidic calponin cloned from neural cells is differentially expressed during rat brain development. Eur J Neurosci 8:1501-1509[Web of Science][Medline].
- Gage FH, Ray J, Fisher LJ (1995) Isolation, characterization, and use of stem cells from the CNS. Annu Rev Neurosci 18:159-192[Web of Science][Medline].
- Galileo DS, Gray GE, Owens GC, Majors J, Sanes JR (1990) Neurons and glia arise from a common progenitor in chicken optic tectum: demonstration with two retroviruses and cell type-specific antibodies. Proc Natl Acad Sci USA 87:458-462
[Abstract/Free Full Text] .- Gao WO, Heintz N, Hatten ME (1991) Cerebellar granule cell neurogenesis is regulated by cell-cell interactions in vitro. Neuron 6:705-715[Web of Science][Medline].
- Ghosh A, Greenberg ME (1995) Distinct roles for bFGF and NT-3 in the regulation of cortical neurogenesis. Neuron 15:89-103[Web of Science][Medline].
- Hatten ME (1985) Neuronal regulation of astroglial morphology and proliferation in vitro. J Cell Biol 100:384-396
[Abstract/Free Full Text] .- Hatten ME (1987) Neuronal inhibition of astroglial cell proliferation is membrane mediated. J Cell Biol 104:1353-1360
[Abstract/Free Full Text] .- Hazel T, Panchision DM, Warriner P, McKay RDG (1997) In: Regional plasticity of multipotential precursors from the developing CNS. Meeting for the Society for Neuroscience, October, 1997.
- Jahoda CA, Reynolds AJ, Chaponnier C, Forester JC, Gabbiani G (1991) Smooth muscle alpha-actin is a marker for hair follicle dermis in vivo and in vitro. J Cell Sci 99:627-636
[Abstract/Free Full Text] .- Johe KK, Hazel TG, Muller T, Dugich-Djordjevic MM, McKay RD (1996) Single factors direct the differentiation of stem cells from the fetal and adult central nervous system. Genes Dev 10:3129-3140
[Abstract/Free Full Text] .- Kato H, Taniguchi Y, Kurooka H, Minoguchi S, Sakai T, Nomura-Okazaki S, Tamura K, Honjo T (1997) Involvement of RBP-J in biological functions of mouse Notch1 and its derivatives. Development 124:4133-4141[Abstract].
- Keirstead HS, Ben-Hur T, Rogister B, O'Leary MT, Dubois-Dalcq M, Blakemore WF (1999) Polysialylated neural cell adhesion molecule-positive CNS precursors generate both oligodendrocytes and Schwann cells to remyelinate the CNS after transplantation. J Neurosci 19:7529-7536
[Abstract/Free Full Text] .- Kilpatrick TJ, Bartlett PF (1993) Cloning and growth of multipotential neural precursors: requirements for proliferation and differentiation. Neuron 10:255-265[Web of Science][Medline].
- Koblar SA, Turnley AM, Classon BJ, Reid KL, Ware CB, Cheema SS, Murphy M, Bartlett PF (1998) Neural precursor differentiation into astrocytes requires signaling through the leukemia inhibitory factor receptor. Proc Natl Acad Sci USA 95:3178-3181
[Abstract/Free Full Text] .- Kopan R, Cagan R (1997) Notch on the cutting edge. Trends Genet 13:465-467[Web of Science][Medline].
- LaBonne C, Bronner-Fraser M (1998) Neural crest induction in Xenopus: evidence for a two-signal model. Development 125:2403-2414[Abstract].
- Lecain E, Alliot F, Laine MC, Calas B, Pessac B (1991) Alpha isoform of smooth muscle actin is expressed in astrocytes in vitro and in vivo. J Neurosci Res 28:601-606[Web of Science][Medline].
- Lee MK, Tuttle JB, Rebhun LI, Cleveland DW, Frankfurter A (1990) The expression and posttranslational modification of a neuron-specific beta-tubulin isotype during chick embryogenesis. Cell Motil Cytoskeleton 17:118-132[Web of Science][Medline].
- Lendahl U, Zimmerman LB, McKay RD (1990) CNS stem cells express a new class of intermediate filament protein. Cell 60:585-595[Web of Science][Medline].
- Li L, Miano JM, Cserjesi P, Olson EN (1996) SM22 alpha, a marker of adult smooth muscle, is expressed in multiple myogenic lineages during embryogenesis. Circ Res 78:188-195
[Abstract/Free Full Text] .- Lillien LE, Raff MC (1990) Differentiation signals in the CNS: type-2 astrocyte development in vitro as a model system. Neuron 5:111-119[Web of Science][Medline].
- Luskin MB, Pearlman AL, Sanes JR (1988) Cell lineage in the cerebral cortex of the mouse studied in vivo and in vitro with a recombinant retrovirus. Neuron 1:635-647[Web of Science][Medline].
- Matsuno K, Eastman D, Mitsiades T, Quinn AM, Carcanciu ML, Ordentlich P, Kadesch T, Artavanis-Tsakonas S (1998) Human deltex is a conserved regulator of Notch signalling. Nat Genet 19:74-78[Web of Science][Medline].
- McKay R (1997) Stem cells in the central nervous system. Science 276:66-71
[Abstract/Free Full Text] .- McMorris FA, Dubois-Dalcq M (1988) Insulin-like growth factor I promotes cell proliferation and oligodendroglial commitment in rat glial progenitor cells developing in vitro. J Neurosci Res 21:199-209[Web of Science][Medline].
- Miano JM, Olson EN (1996) Expression of the smooth muscle cell calponin gene marks the early cardiac and smooth muscle cell lineages during mouse embryogenesis. J Biol Chem 271:7095-7103
[Abstract/Free Full Text] [Erratum (1997) 272:27492].- Mujtaba T, Mayer-Proschel M, Rao MS (1998) A common neural progenitor for the CNS and PNS. Dev Biol 200:1-15[Web of Science][Medline].
- Murphy M, Reid K, Dutton R, Brooker G, Bartlett PF (1997) Neural stem cells. J Investig Dermatol Symp Proc 2:8-13[Medline].
- Nishida W, Kitami Y, Hiwada K (1993) cDNA cloning and mRNA expression of calponin and SM22 in rat aorta smooth muscle cells. Gene 130:297-302[Web of Science][Medline].
- Nye JS, Kopan R, Axel R (1994) An activated Notch suppresses neurogenesis and myogenesis but not gliogenesis in mammalian cells. Development 120:2421-2430
[Abstract/Free Full Text] .- Owens GK (1995) Regulation of differentiation of vascular smooth muscle cells. Physiol Rev 75:487-517
[Abstract/Free Full Text] .- Peled A, Petit I, Kollet O, Magid M, Ponomaryov T, Byk T, Nagler A, Ben-Hur H, Many A, Shultz L, Lider O, Alon R, Zipori D, Lapidot T (1999) Dependence of human stem cell engraftment and repopulation of NOD/SCID mice on CXCR4. Science 283:845-848
[Abstract/Free Full Text] .- Petridou S, Maltseva O, Spanakis S, Masur SK (2000) TGF-beta receptor expression and smad2 localization are cell density dependent in fibroblasts. Invest Ophthalmol Vis Sci 41:89-95
[Abstract/Free Full Text] .- Pfrieger FW, Barres BA (1997) Synaptic efficacy enhanced by glial cells in vitro. Science 277:1684-1687
[Abstract/Free Full Text] .- Price J, Turner D, Cepko C (1987) Lineage analysis in the vertebrate nervous system by retrovirus- mediated gene transfer. Proc Natl Acad Sci USA 84:156-160
[Abstract/Free Full Text] .- Represa A, Trabelsi-Terzidis H, Plantier M, Fattoum A, Jorquera I, Agassandian C, Ben-Ari Y, der Terrossian E (1995) Distribution of caldesmon and of the acidic isoform of calponin in cultured cerebellar neurons and in different regions of the rat brain: an immunofluorescence and confocal microscopy study. Exp Cell Res 221:333-343[Web of Science][Medline].
- Reynolds BA, Weiss S (1992) Generation of neurons and astrocytes from isolated cells of the adult mammalian central nervous system. Science 255:1707-1710
[Abstract/Free Full Text] .- Reynolds BA, Tetzlaff W, Weiss S (1992) A multipotent EGF-responsive striatal embryonic progenitor cell produces neurons and astrocytes. J Neurosci 12:4565-4574[Abstract].
- Richards LJ, Kilpatrick TJ, Dutton R, Tan SS, Gearing DP, Bartlett PF, Murphy M (1996) Leukaemia inhibitory factor or related factors promote the differentiation of neuronal and astrocytic precursors within the developing murine spinal cord. Eur J Neurosci 8:291-299[Web of Science][Medline].
- Sanes JR, Rubenstein JL, Nicolas JF (1986) Use of a recombinant retrovirus to study post-implantation cell lineage in mouse embryos. EMBO J 5:3133-3142[Web of Science][Medline].
- Schmitt-Graff A, Pau H, Spahr R, Piper HM, Skalli O, Gabbiani G (1990) Appearance of alpha-smooth muscle actin in human eye lens cells of anterior capsular cataract and in cultured bovine lens-forming cells. Differentiation 43:115-122[Web of Science][Medline].
- Solway J, Seltzer J, Samaha FF, Kim S, Alger LE, Niu Q, Morrisey EE, Ip HS, Parmacek MS (1995) Structure and expression of a smooth muscle cell-specific gene, SM22 alpha. J Biol Chem 270:13460-13469
[Abstract/Free Full Text] .- Takahashi T, Nowakowski RS, Caviness Jr V (1995) The cell cycle of the pseudostratified ventricular epithelium of the embryonic murine cerebral wall. J Neurosci 15:6046-6057[Abstract].
- Temple S (1989) Division and differentiation of isolated CNS blast cells in microculture. Nature 340:471-473[Medline].
- Temple S, Davis AA (1994) Isolated rat cortical progenitor cells are maintained in division in vitro by membrane-associated factors. Development 120:999-1008[Abstract].
- Trabelsi-Terzidis H, Fattoum A, Represa A, Dessi F, Ben-Ari Y, der Terrossian E (1995) Expression of an acidic isoform of calponin in rat brain: western blots on one- or two-dimensional gels and immunolocalization in cultured cells. Biochem J 306:211-215.
- Verdi JM, Schmandt R, Bashirullah A, Jacob S, Salvino R, Craig CG, Program AE, Lipshitz HD, McGlade CJ (1996) Mammalian NUMB is an evolutionarily conserved signaling adapter protein that specifies cell fate. Curr Biol 6:1134-1145[Web of Science][Medline].
- Walsh C, Cepko CL (1992) Widespread dispersion of neuronal clones across functional regions of the cerebral cortex. Science 255:434-440
[Abstract/Free Full Text] .- Williams BP, Read J, Price J (1991) The generation of neurons and oligodendrocytes from a common precursor cell. Neuron 7:685-693[Web of Science][Medline].
- Zhong W, Feder JN, Jiang MM, Jan LY, Jan YN (1996) Asymmetric localization of a mammalian numb homolog during mouse cortical neurogenesis. Neuron 17:43-53[Web of Science][Medline].
- Zhong W, Jiang MM, Weinmaster G, Jan LY, Jan YN (1997) Differential expression of mammalian Numb, Numblike and Notch1 suggests distinct roles during mouse cortical neurogenesis. Development 124:1887-1897[Abstract].
Copyright © 2000 Society for Neuroscience 0270-6474/00/20103725-11$05.00/0
This article has been cited by other articles:
I. Kulbatski and C. H. Tator
Region-specific Differentiation Potential of Adult Rat Spinal Cord Neural Stem/Precursors and Their Plasticity in Response to In Vitro Manipulation
J. Histochem. Cytochem., May 1, 2009; 57(5): 405 - 423.
[Abstract] [Full Text] [PDF]
T. Andersson, E. Sodersten, J. K. Duckworth, A. Cascante, N. Fritz, P. Sacchetti, I. Cervenka, V. Bryja, and O. Hermanson
CXXC5 Is a Novel BMP4-regulated Modulator of Wnt Signaling in Neural Stem Cells
J. Biol. Chem., February 6, 2009; 284(6): 3672 - 3681.
[Abstract] [Full Text] [PDF]
Y.-J. Ren, Z.-Y. Zhou, F.-Z. Cui, Ying Wang, J.-P. Zhao, and Q.-Y. Xu
Hyaluronic Acid/Polylysine Hydrogel as a Transfer System for Transplantation of Neural Stem Cells
Journal of Bioactive and Compatible Polymers, January 1, 2009; 24(1): 56 - 62.
[Abstract] [PDF]
K. J.L Fernandes, J. G Toma, and F. D Miller
Multipotent skin-derived precursors: adult neural crest-related precursors with therapeutic potential
Phil Trans R Soc B, January 12, 2008; 363(1489): 185 - 198.
[Abstract] [Full Text] [PDF]
C. Busch, M. Oppitz, M. H. Sailer, L. Just, M. Metzger, and U. Drews
BMP-2-dependent integration of adult mouse subventricular stem cells into the neural crest of chick and quail embryos
J. Cell Sci., November 1, 2006; 119(21): 4467 - 4474.
[Abstract] [Full Text] [PDF]
M. H. M. Sailer, T. G. Hazel, D. M. Panchision, D. J. Hoeppner, M. E. Schwab, and R. D. G. McKay
BMP2 and FGF2 cooperate to induce neural-crest-like fates from fetal and adult CNS stem cells
J. Cell Sci., December 15, 2005; 118(24): 5849 - 5860.
[Abstract] [Full Text] [PDF]
H. Shinohara, J. Udagawa, R. Morishita, H. Ueda, H. Otani, R. Semba, K. Kato, and T. Asano
Gi2 Signaling Enhances Proliferation of Neural Progenitor Cells in the Developing Brain
J. Biol. Chem., September 24, 2004; 279(39): 41141 - 41148.
[Abstract] [Full Text] [PDF]
M. Bani-Yaghoub, S. E. Kendall, D. P. Moore, S. Bellum, R. A. Cowling, G. N. Nikopoulos, C. J. Kubu, C. Vary, and J. M. Verdi
Insulin acts as a myogenic differentiation signal for neural stem cells with multilineage differentiation potential
Development, September 1, 2004; 131(17): 4287 - 4298.
[Abstract] [Full Text] [PDF]
J. Imitola, E. Y. Snyder, and S. J. Khoury
Genetic programs and responses of neural stem/progenitor cells during demyelination: potential insights into repair mechanisms in multiple sclerosis
Physiol Genomics, August 15, 2003; 14(3): 171 - 197.
[Abstract] [Full Text] [PDF]
P. Rajan, D. M. Panchision, L. F. Newell, and R. D.G. McKay
BMPs signal alternately through a SMAD or FRAP-STAT pathway to regulate fate choice in CNS stem cells
J. Cell Biol., June 9, 2003; 161(5): 911 - 921.
[Abstract] [Full Text] [PDF]
M. Enarsson, A. Erlandsson, H. Larsson, and K. Forsberg-Nilsson
Extracellular Signal-Regulated Protein Kinase Signaling Is Uncoupled From Initial Differentiation of Central Nervous System Stem Cells to Neurons
Mol. Cancer Res., December 1, 2002; 1(2): 147 - 154.
[Abstract] [Full Text] [PDF]
R. Y.L. Tsai and R. D.G. McKay
A nucleolar mechanism controlling cell proliferation in stem cells and cancer cells
Genes & Dev., December 1, 2002; 16(23): 2991 - 3003.
[Abstract] [Full Text] [PDF]
K. Oishi, Y. Ogawa, S. Gamoh, and M. K Uchida
Contractile responses of smooth muscle cells differentiated from rat neural stem cells
J. Physiol., April 1, 2002; 540(1): 139 - 152.
[Abstract] [Full Text] [PDF]
D. M. Panchision, J. M. Pickel, L. Studer, S.-H. Lee, P. A. Turner, T. G. Hazel, and R. D.G. McKay
Sequential actions of BMP receptors control neural precursor cell production and fate
Genes & Dev., August 15, 2001; 15(16): 2094 - 2110.
[Abstract] [Full Text] [PDF]
V. Calaora, B. Rogister, K. Bismuth, K. Murray, H. Brandt, P. Leprince, M. Marchionni, and M. Dubois-Dalcq
Neuregulin Signaling Regulates Neural Precursor Growth and the Generation of Oligodendrocytes In Vitro
J. Neurosci., July 1, 2001; 21(13): 4740 - 4751.
[Abstract] [Full Text] [PDF]
E. A. Maher, F. B. Furnari, R. M. Bachoo, D. H. Rowitch, D. N. Louis, W. K. Cavenee, and R. A. DePinho
Malignant glioma: genetics and biology of a grave matter
Genes & Dev., June 1, 2001; 15(11): 1311 - 1333.
[Full Text] [PDF]
M. Koch, J. R. Murrell, D. D. Hunter, P. F. Olson, W. Jin, D. R. Keene, W. J. Brunken, and R. E. Burgeson
A Novel Member of the Netrin Family, {beta}-Netrin, Shares Homology with the {beta} Chain of Laminin: Identification, Expression, and Functional Characterization
J. Cell Biol., October 16, 2000; 151(2): 221 - 234.
[Abstract] [Full Text] [PDF]
K. Oishi, Y. Ogawa, S. Gamoh, and M. K Uchida
Contractile responses of smooth muscle cells differentiated from rat neural stem cells
J. Physiol., April 1, 2002; 540(1): 139 - 152.
[Abstract] [Full Text] [PDF]
This Article Abstract 
Full Text (PDF) Submit an eLetter Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in Web of Science Similar articles in PubMed Alert me to new issues of the journal Download to citation manager 
Citing Articles Citing Articles via HighWire Citing Articles via Web of Science (113) Citing Articles via Google Scholar Google Scholar Articles by Tsai, R. Y. L. Articles by McKay, R. D. G. Search for Related Content PubMed PubMed Citation Articles by Tsai, R. Y. L. Articles by McKay, R. D. G.
|
|
|
|
 |
|