 |
Previous Article | Next Article 
The Journal of Neuroscience, June 1, 2000, 20(11):4145-4155
A-Type K+ Current Mediated by the Kv4 Channel
Regulates the Generation of Action Potential in Developing Cerebellar
Granule Cells
Riichi
Shibata1, 3,
Kensuke
Nakahira1, 4,
Koji
Shibasaki1, 3,
Yoshihiko
Wakazono1,
Keiji
Imoto2, 3, and
Kazuhiro
Ikenaka1, 3
1 Laboratory of Neural Information,
2 Laboratory of Humoral Information, Department of
Informational Physiology, and 3 Department of Physiological
Sciences, the Graduate University for Advanced Studies, National
Institute for Physiological Sciences, and 4 Center for
Bio-Environmental Research, National Institute for Basic Biology,
Okazaki National Research Institutes, Okazaki, Aichi 444-8585,
Japan
 |
ABSTRACT |
During neuronal differentiation and maturation, electrical
excitability is essential for proper gene expression and the formation of synapses. The expression of ion channels is crucial for this process; in particular, voltage-gated K+ channels
function as the key determinants of membrane excitability. Previously,
we reported that the A-type K+ current
(IA) and Kv4.2
K+ channel subunit expression increased in cultured
cerebellar granule cells with time. To examine the correlation between
ion currents and the action potential, in the present study, we
measured developmental changes of action potentials in cultured granule
cells using the whole-cell patch-clamp method. In addition to an
observed increment of IA, we found
that the Na+ current also increased during
development. The increase in both currents was accompanied by a change
in the membrane excitability from the nonspiking type to the repetitive
firing type. Next, to elucidate whether Kv4.2 is responsible for the
IA and to assess the effect of Kv4 subunits
on action potential waveform, we transfected a cDNA encoding a
dominant-negative mutant Kv4.2 (Kv4.2dn) into cultured cells.
Expression of Kv4.2dn resulted in the elimination of
IA in the granule cells. This result
demonstrates that members of the Kv4 subfamily are responsible for the
IA in developing granule cells. Moreover,
elimination of IA resulted in shortening of
latency before the first spike generation. In contrast, expression of
wild-type Kv4.2 resulted in a delay in latency. This indicates that
appearance of IA is critically required for
suppression of the excitability of granule cells during their maturation.
Key words:
Kv4.2; A-type current; dominant-negative; transfection; action potential; fast spike latency; microexplant culture; whole-cell
patch clamp
 |
INTRODUCTION |
Transient inactivating A-type
current (IA) is the predominant
K+ current in many mature neurons
(Rogawski et al., 1985 ; Rudy et al., 1988 ; Bardoni and Belluzzi, 1993 ;
Keros and McBain, 1997 ; Fisher et al., 1998 ; Hoffman and Johnston,
1998 ; Martina et al., 1998 ; Kanold and Manis, 1999 ) that is initially
activated at the subthreshold range of membrane potential and
inactivated during depolarizing pulses of duration. Heterologous
expression studies have demonstrated that channels containing the
Kv1.4, Kv3.4, and Kv4 subunits give rise to A-type channels (Baldwin et
al., 1991 ; Schroter et al., 1991 ; Serodio et al., 1994 , 1996 ; Surmeier
et al., 1996 ). In addition, inactivating, A-type-like channels can be
formed when ancillary 1 subunits are coexpressed with subunits of
the Kv1 family that normally display delayed rectifier properties (Rettig et al., 1994 ; Heinemann et al., 1996 ; Sewing et al., 1996 ). Recent lines of evidence suggest that Kv4 subunits are the major components of IA in the CNS
(Tsaur et al., 1997 ; Serodio and Rudy, 1998 ), and Kv4 channel
transcripts are thought to govern the discharge patterns of action
potentials (Song et al., 1998 ; Kanold and Manis, 1999 ).
Although the functional significance of
IA is well established in the adult
CNS, the associated developmental behaviors remain to be elucidated. In
the case of amphibian spinal cord neurons, the expression of
voltage-gated K+ channels determines the
differentiation of neurons to regulate the action potential waveform
(Spitzer, 1995 ). In mammalian neurons, however, it has been difficult
to clarify the function of K+ channels
because of the complexities of functional
K+ channel subunits, such as their
molecular diversity, heteromultimeric assembly, and lack of selective blockers.
We reported previously that the level of expression of
IA increased with the development of
the granule cells in microexplant cultures from neonatal mouse
cerebella (Wakazono et al., 1997 ). Furthermore, we have reported
recently that Kv4.2 proteins are detected in the premigratory zone
(PMZ) of the cerebellum in which granule cells complete final division
and initiate maturation (Shibata et al., 1999 ). The expression of Kv4.2
was also detectable in microexplant cultures and increases with the
duration of the culture period. A concomitant increment of Kv4.2 and
IA was observed, implying that Kv4.2
may affect developmental changes in the excitability of developing
granule cells.
In the present study, we first demonstrated that action potentials
shift from firing single spikes to repetitive firing during development of the cultured granule cells. Subsequently, to assess the contribution of IA to the
discharge pattern of membrane potential, we have used the somatic gene
transfer method to introduce dominant-negative and wild-type Kv4.2 cDNA
into the cerebellar granule cells of microexplant cultures using the
lipofection method. Our results clearly demonstrate that density and
inactivation kinetics of IA mediated
by Kv4 subunits are the key determinants that regulate the generation
of the first spike in developing granule cells.
 |
MATERIALS AND METHODS |
Mouse Kv4.2 expression constructs. To isolate the
mouse Kv4.2 homolog (mKv4.2), a mouse brain cDNA library constructed
from 6-week-old C57BL/6 mice was screened using a rat sequence as a probe (the cDNA library was kindly provided by Dr. T. Yagi, National Institute for Physiological Sciences, Okazaki, Japan). A clone, named
pK8, contained the mKv4.2 coding region and approximately 1.5 kb 5' and
2.5 kb 3' untranslated regions. A 2.5 kb fragment containing the entire
coding region was isolated by digesting with BstPI and
EcoRI and used in the construction of expression vectors.
pCR3.1E was constructed from pCR3.1 (Invitrogen, Carlsbad CA). pCR3.1E
contains the enhanced green fluorescence protein
(egfp) gene instead of the neo gene in pCR3.1
through the replacement of a BlnI-BlnI fragment
with an egfp fragment from pCXegfp (kindly donated by Dr. M. Okabe, Osaka University, Osaka, Japan). The mKv4.2 expression vector
mKv4.2/pCR3.1E contains the mKv4.2 coding region at the
EcoRI site of the vector, so that expression is under the
control of the cytomegalovirus-immediately early (CMV-IE) promoter.
A dominant-negative mutation of mKv4.2, referred to as mKv4.2dn in this
manuscript, was constructed as follows. The sequence that spans from
the N-terminal region to the second transmembrane domain of mKv4.2 was
amplified by PCR with the following primers: K8dn-f,
CCGTCGACGTGGATGCCTGTTGCT; and K8dn-r, CTTATTCGAAACGGTAACGACT. The
amplified fragment was cloned into pCR2.1 using the TA-cloning kit
(Invitrogen). The nucleotide sequence was confirmed by sequencing. Then, a Flag-tag sequence (Sigma, St. Louis, MO) was added to the C
terminus of the clone by inserting double-stranded synthetic oligonucleotides: M2-f, CGACTACAAGGACGACGATGACAAGTAAGTCGACG; and M2-r,
CGTCGACTTACTTGTCATCGTCGTCCTTGTAGT. A 229 bp
NruI-XhoI fragment of the resultant clone,
K8dnM2/pCR2.1, was used to replace the C-terminal region of wild-type
mKv4.2.
Because the CMV-IE promoter strength in the expression plasmids was
insufficient in cerebellar granule cells, we switched the promoter to
the stronger artificial, CAG promoter. To do this, mKv4.2 and
mKv4.2dn were inserted into pCXegfp by replacing the egfp
gene with the channel gene to make K8/pCX and K8dnM2/pCX, respectively.
To identify the cells transfected with these constructs, pCXegfp was
always cotransfected.
Cell culture and transfection. Microexplant cultures were
prepared as described previously (Shibata et al., 1999 ). Cerebella with
midbrain and brainstem were removed from 2- or 3-d-old mice and quickly
transferred to PBS. After separating the cerebellum, pia matter was
removed carefully with fine forceps. Then, the central region of the
cerebellum was cut into four pieces in the sagittal direction, and
white matter and the deep nucleus were removed with scalpels. After
transferring the pieces of gray matter into Basal Medium Eagle (BME),
they were cut into 200-300 µm pieces with scalpels. They were then
placed on poly-L-lysine-laminin-coated glass
coverslips with the serum-free BME containing fatty acid-free BSA (1 mg/ml), insulin (10 µg/ml), transferrin (100 µg/ml), aprotinin (1 µg/ml), L-thyroxine (0.1 nM), Na-selenite (30 nM),
and glucose (2.5 mg/ml), and maintained in a CO2 incubator.
Human embryonic kidney 293 (HEK293) cells (CRL-1573; American Type
Culture Collection, Manassas, VA) were grown in DMEM supplemented with
10% fetal bovine serum at 37°C in a 5% CO2
humidified incubator. Chinese hamster ovary-K1 (CHO-K1) cells
(JCRB9018) were grown in Ham's F12 medium with 10% fetal bovine serum
at 37°C in a 5% CO2 humidified incubator.
Cells were split and plated at 30-40% confluency on coverslips in
four-well plates before transfection. Expression of Kv1.1 or Kv3.1 in
CHO-K1 cells was performed by transfection with Kv1.1/RBG4 or
Kv3.1/pCMV (kindly donated by Dr. J. Trimmer, State University of New York).
Twenty-four hours after plating, cells were transfected with plasmid
DNA (0.2 µg/well) using LipofectAMINE plus (Life Technologies, Grand
Island, NY). For microexplant culture cells, transfection was performed
at 1 day in vitro (DIV) or 4 DIV. The first EGFP-positive cells were detectable at 12 hr after transfection, and ~10 cells per
explant became EGFP-positive. Currents and action potential were
recorded 3 d after the transfection.
Electrophysiology. Cells were thoroughly washed with the
extracellular solution containing (in mM): 145 NaCl, 2.5 KCl, 2 CaCl2, 1 MgCl2, 5 HEPES, and 10 glucose, pH adjusted to
7.4 with NaOH. In the voltage-clamp experiments, we perfused the cells
with an extracellular solution containing (in
mM): 145 NaCl, 2.5 KCl, 2 MnCl2, 1 MgCl2, 5 HEPES, 10 glucose, and 0.001 tetrodotoxin (TTX), pH adjusted to 7.4 with NaOH, to
block Na+ channel currents,
Ca2+ channel currents, and
Ca2+-activated
K+ currents. Recording pipettes were
pulled from borosilicate glass tubing (Narishige, Tokyo, Japan) and
heat-polished before use. Recordings were performed with patch pipettes
that had 5-10 M resistance when filled with the following solution
(in mM): 140 potassium gluconate, 10 KCl, 2 CaCl2, 1 MgCl2, 0.5 EDTA, 5 HEPES, and 10 glucose, pH adjusted to 7.2 with KOH. Whole-cell
patch-clamp recordings were performed at room temperature with a
patch-clamp amplifier (Axopatch-1D; Axon Instruments, Foster City, CA).
The recording was performed using a fluorescent microscope from cells that were labeled with EGFP to identify their morphology. Capacitative transients and series resistance (20-30 M ) were compensated in the
whole-cell mode, and leakage currents were not subtracted. Cell
capacitance and series resistance were read from the dials of the
patch-clamp amplifier. Potentials were not corrected for liquid
junction potential ( 6 mV). Stable recordings could be obtained later
than 3 min after breakthrough, which in these small cells should allow
equilibration of the pipette content with the cytosol. In current-clamp
mode, all compensations were set free. Membrane voltage and current
were filtered at 2 or 10 kHz using a four-pole low-pass Bessel filter.
Data acquisition and voltage control were performed with a
computer-controlled interface using pClamp software version 5.5.1 (Axon
Instruments). Curve fitting and statistical calculations were performed
with Origin (Microcal, Northampton, MA).
IA component was isolated using the
prepulse protocol. This protocol is performed by subtracting the
current evoked by a test pulse (+20 mV) after a 200 msec voltage step
at 20 mV (prepulse) at which the A-type channels were fully
inactivated, from the current evoked from a holding potential ( 80 mV).
Data analysis. The program provides an estimate of current
amplitude (I) as a function of time (t)
according to the equation:
The solution to this equation determines the sum of
noninactivating currents (A0) and the
amplitude (A1) and time constants (t1) that best fit the evoked current.
To analyze steady-state activation, we fit the currents to the
following normalized Boltzmann equation:
where I is the membrane current (in
picoamperes) at the command voltage, V is the command
voltage (in millivolts), Vr is the
reversal potential for the K+ current
(estimated as 70 mV), Gmax is the
maximal conductance (in nanosiemans) [G = I/(V Vr)],
V0.5 is the membrane potential for
half-activation, and k is the slop factor.
To analyze steady-state inactivation, we fit the currents to the
following normalized Boltzmann equation:
where I is the membrane current (in picoamperes) at
the command voltage, and Imax is the
maximal current (in picoamperes) to the step (20 mV) measured after a
200 msec control prepulse to 120 mV.
All data reported in this study are expressed as means ± SEM. Comparisons between groups were made using the Student's
paired t test. Differences were considered to be significant
when p < 0.05 (*p < 0.05, **p < 0.01, ***p < 0.001). Regression
fit in Figure 3 was given by the least-squares equation.
 |
RESULTS |
Developmental change of electrophysiological properties
Granule cells in the microexplant culture initially extend a pair
of long axons and then change morphology from bipolar to T-shaped
(Nagata and Nakatsuji, 1990 ; Wakazono et al., 1997 ). To record their
morphology and electrophysiological responses simultaneously, we
previously used Lucifer yellow, which had been added into the
patch-pipette solution to label the cells. However, cell shape
recognition was impossible before pipette attachment to the cells.
Thus, in this study, cells were labeled with EGFP, which was expressed
from an expression vector transfected at 1 or 4 DIV. Figure
1A shows EGFP-positive
cells near the explant. Approximately 10 cells per explant were labeled
and became detectable 12 hr after transfection. The labeling
experiments showed that bipolar cells (Fig. 1B) were
observed mainly at 2-3 DIV, but few cells were detected in later
stages. On the contrary, T-shaped cells (Fig. 1C) started to
appear at 4 DIV, and the number increased thereafter. Sequential
observation of a single labeled granule cell confirmed that they change
their morphology with development in vitro. The cells that
did not exhibit clear T-shapes but possessed several dendrites along
with the long thin axons were present predominantly in later periods of
culture (Fig. 1D). We speculated that the absence of
glial cells, which were necessary for neural locomotion, prevented the
efficient movement of cell bodies perpendicular to the parallel fibers.
Therefore, we also categorized such cells as mature T-shaped cells. We
found no differences in electrophysiological responses between typical
T-shaped cells and incomplete T-shaped cells.

View larger version (82K):
[in this window]
[in a new window]
|
Figure 1.
Expression of EGFP in microexplant cultures
using the lipofection method. A, A lower magnification
of EGFP-positive cells near an explant at 7 DIV. The border of the
explant is indicated by a line. The EGFP expression
vector was transfected at 4 DIV. Approximately 10 cells per explant
were labeled with EGFP. Most positive cells had short dendrites and a
pair of long processes extending radially to the explant. These cells
were typical granule cells. B, Representative bipolar
cell observed at 2 DIV. EGFP cDNA was transfected at 1 DIV.
C, Typical T-shaped cell observed at 7 DIV. The
arrow points to the T-junction. D, Many
mature granule cells had dendrites but did not exhibit T-shape. Scale
bars: A, 50 µm; B-D, 10 µm.
|
|
To demonstrate the developmental changes in membrane properties, we
compared bipolar cells at 2 DIV and T-shaped cells at 7 DIV. The
membrane capacitance, resting membrane potential (RMP), and
input resistance were measured. Capacitance increased ~1.5-fold from
bipolar cells (3.7 ± 1.2 pF, n = 10) to T-shaped
cells (5.8 ± 0.3 pF, n = 12). Similar results
were reported using dissociated granule cells (Gorter et al., 1995 ),
whereas the opposite was reported using cerebellar slices in which the
capacitance of granule cells did not increase during development
(D'Angelo et al., 1997 ; Rossi et al., 1998 ). The RMP was measured
shortly after establishing whole-cell recording mode. The bipolar cells
had relatively depolarized RMP ( 41.4 ± 3.4 mV,
n = 7), and the T-shaped cells had more negative values
( 65.8 ± 2.6 mV, n = 26). This result indicates
that the RMP shifted to negative potential during development. The
input resistance was calculated using Ohm's law from the voltage
response to a hyperpolarizing current injection. To avoid distortion by activation of voltage-dependent conductance, a small current ( 50 pA)
was used. The input resistance was high (7.2 ± 0.2 G ,
n = 6) in bipolar cells but low (2.3 ± 0.1 G ,
n = 6) in T-shaped cells. The decrease in input
resistance during development is considered to reflect an increase in
functional ion channels that were active around RMP. The negative shift
of RMP and decrease in input resistance were consistent with both
cultured (Ramoa and McCormick, 1994 ) and in vivo (D'Angelo
et al., 1997 ; Rossi et al., 1998 ) granule cells.
Action potential and voltage-dependent currents
Next, we investigated developmental changes in excitability using
whole-cell voltage-clamp and current-clamp configurations. Responses
were recorded from bipolar cells at 2 DIV (Fig.
2A) and T-shaped cells
at 4-6 DIV (Fig. 2B-D). We did not use any channel
blockers to record inward current and outward
K+ current along with action
potential.

View larger version (27K):
[in this window]
[in a new window]
|
Figure 2.
Developmental changes in membrane current and
action potential in the granule cells. A, Representative
whole-cell current (A1 and
A2) and voltage response
(A3) recorded from a bipolar cell at
2 DIV. Records were obtained from the same cell.
A1, Cell was elicited with step
depolarizations from a holding potential of 80 mV to a potential of
between 60 and +40 mV with 20 mV increments for 16 msec in
voltage-clamp mode to monitor fast inward currents
(inset; the same protocol was applied in
B1,
C1, and
D1). Fast-rising inward currents were
not evoked in bipolar cells. A2, The
same protocol as shown in A1 was applied for
250 msec to monitor outward currents (this protocol was also applied in
B1,
C1, and
D1).
A3, A depolarizing current step of 30 pA for 800 msec did not evoke action potential from a holding potential
of 50 mV. B-D, Representative whole-cell currents
(B1,
B2,
C1,
C2,
D1, and
D2) and voltage responses
(B3,
C3, and
D3) recorded from T-shaped cells at
4-7 DIV. Recordings in B, C, and
D were obtained from the same cell. Fast-rising inward
currents and fast-inactivating currents increased in T-shaped cells.
B3,
C3,
D3, A depolarizing current step of 22 (B3), 10 (C3), or 14 (D3) pA was applied for 800 msec from
a holding potential of 50 (B3),
83 (C3), or 82
(D3) mV, respectively. In the
T-shaped cells, three types of discharge patterns, single spike
(B3), rapidly adapting
(C3), and repetitive firing
(D3), were observed.
|
|
Figure
2A1-A3
shows typical recordings from a bipolar cell. Depolarizing potentials
were applied to the cells for 16 (Fig. 2A1) or 250 (Fig.
2A2) msec to record fast inward
currents and net outward currents, respectively. In bipolar cells, no
inward current was observed at any voltage pulse applied to the
membrane. As reported previously by Wakazono et al. (1997) , slowly
inactivating delayed rectifier currents were present predominantly, and
a small amount of fast inactivating IA
was observed. When depolarizing currents were injected, no action
potential was generated (Fig. 2A3).
The T-shaped granule cells exhibited four distinct discharge patterns
in response to depolarizing current injection under the current-clamp
mode (Fig. 2B-D). Among 26 cells we
recorded in this experiment, 23% (6 of 26) of the cells exhibited
single action potential (single-type) (Fig.
2B3). Fifty percent (13 of 26)
of the cells exhibited rapid adapting repetitive firing (adapting-type) (Fig. 2C3), and 23% (6 of 26) of the
cells exhibited nonattenuating repetitive firing (repetitive-type)
(Fig. 2D3). Only one T-shaped cell did not produce action potential, even after injection of a large
current (silent cell) (data not shown). The silent cell was observed at
4 DIV of microexplant culture, and the single- and adapting-type cells
appeared at 4-5 DIV. The repetitive-type firing emerged after 6 DIV.
These results suggest the occurrence of a development-related shift in
the different response patterns. Furthermore, the resting membrane
potentials for each of the cell types were 46.6 ± 4.9 (mean ± SEM, single-type cells; n = 6), 66.3 ± 4.1 (adapting-type cells; n = 13), and
78.0 ± 2.2 mV (repetitive-type cells; n = 6),
respectively. These data also support the idea that action potential
changed from single to repetitive during the development of granule cells.
To determine whether the change of firing pattern is attributable to
the appearance of specific membrane conductance, ion currents were
compared. In the single-type cells, small inward currents were observed
(Fig. 2B1). The amplitude of
the inward currents was increased in the adapting-type cells (Fig.
2C1) and further increased in the
repetitive-type cells (Fig.
2D1). This indicates that the
level of inward currents is accompanied by the onset of repetitive
firing. Both inward currents and action potential were completely
eliminated by the application of 1 µM TTX (data
not shown). Thus, the action potential of the cells is critically
dependent on the activation of TTX-sensitive
Na+ channels. Figure 2,
B2,
C2, and
D2, shows the developmental changes of
outward currents in T-shaped cells. The amplitude of fast-inactivating current components, as well as the inward current, increased.
Because the developmental changes in the amplitude of
Na+ and the
IA were very similar, we plotted
Na+ currents as a function of
IA (Fig.
3). The
IA was isolated by a prepulse
protocol. The size of Na+ currents was in
proportion to that of IA
(INa = 51 + 0.65 · IA; r = 0.61) (Fig.
3A). Furthermore, these two currents also exhibited correlation with the RMP. As RMP became more negative, the amplitudes of Na+ and
IA became larger (Fig. 3B).
These data indicate that increments of Na+
current and IA are accompanied by
maturation of granule cells.

View larger version (22K):
[in this window]
[in a new window]
|
Figure 3.
A-Type currents and Na+
currents increased over a similar time course. A, The
amplitude Na+ current was plotted as a function of
A-type current recorded from the same cell. These currents were
recorded from a mix of bipolar and T-shaped cells. A-Type current was
isolated by the prepulse protocol, and its peak amplitude was measured.
The relationship between the A-type current and the
Na+ current was fitted by the least-squares method
(solid line; r = 0.65).
B, The size of the Na+ current
(filled circles) and the A-type current
(open circles) was plotted as a function of RMP. Note
that the increase in amplitude of both currents correlated with the
depth of the RMP.
|
|
Properties of IA in granule cells
We characterized the voltage dependency of activation and
inactivation of IA in the granule
cells. The voltage dependence of activation was studied by stepping the
membrane voltage of the cells to potentials between 60 and +20 mV
with 5 mV increments (Fig.
4A). The voltage
dependence of inactivation was assessed by measuring the peak amplitude
of current responses evoked by a 20 mV test pulse, after a 200 msec
prepulse to conditioning voltages between 120 and 15 mV with 5 mV
intervals (Fig. 4B). The mean activation of
IA is plotted as normalized
conductance as a function of test voltage in Figure 4C.
Fitting these data to the Boltzmann equation indicated the midpoints of
activation (Vhact of 4.6 mV) and
inactivation (Vhinac of 42.2 mV) and
the slope factors (kact of 5.0 mV and
kinac of 5.7 mV). These values are
consistent with the previous report by Wakazono et al. (1997) .

View larger version (19K):
[in this window]
[in a new window]
|
Figure 4.
Voltage dependence of activation and inactivation
of transient current in the granule cells. A,
Superimposed current traces evoked by depolarizing steps to potentials
between 60 and +20 mV with 5 mV increment after 80 mV.
B, Superimposed current traces evoked by test
depolarization to +20 mV after 200 msec prepulse to potentials between
120 and 15 mV with 5 mV increment. C, Plot of
normalized peak current as a function of conditioning voltage.
Boltzmann functions with half-activation voltage of 4.6 mV and
half-inactivation voltage of 42.2 mV. Spontaneous inward spikes
occasionally remained after blockade of spontaneous activity by TTX and
Ca2+ channel blocker.
|
|
We then examined the recovery rate of
IA from inactivation (Fig.
5). A depolarizing voltage step was
applied to fully inactivate the A-type channels, followed by a
hyperpolarizing step of variable length to remove inactivation (the
protocol is shown in Fig. 5A). The
IA took more than 40 msec to fully
recover from inactivation at 120 mV, and the value of (recovery
time constant) was 6.6 msec at 120 mV, 15.5 msec at 80 mV, and 41.4 msec at 50 mV (Fig. 5B).

View larger version (26K):
[in this window]
[in a new window]
|
Figure 5.
Recovery from inactivation of A-type currents.
A, Inactivation recovery was examined by inactivating
the A-type current and then stepping to 120, 80, or 50 mV for
increasing before a test step to 20 mV. The voltage protocol is shown
above the current traces. Current traces recovered from 120
(top traces), 80 (middle traces), and
50 (bottom traces) mV are shown. B,
Plots of peak current as a function of prepulse duration at 120
(filled circles), 80 (open
circles), and 50 (filled squares) mV.
Data were fitted with a single exponential with time constants of 6.6 (at 120 mV), 15.5 (at 80 mV), and 41.4 (at 50 mV) msec,
respectively.
|
|
The effect of dominant-negative mKv4.2 in HEK293 cells
Several studies have revealed the contribution of the
IA to discharge pattern based on
pharmacological experiments (Cull-Candy et al., 1989 ; Bardoni and
Belluzzi, 1993 ; D'Angelo et al., 1998 ). However, assessment of the
specific role of IA in these studies is difficult because of the loose selectivity of channel blockers. To
identify the molecule carrying the IA
and its specific function in the regulation of action potential, we
used dominant-negative constructs of mKv4.2. Johns et al. (1997)
reported that a Kv4.2 dominant-negative construct, which had been
truncated after the first transmembrane segment, suppressed currents
encoded by Kv4 family genes. In the present experiment, we used a
similar strategy. The mKv4.2 cDNA was cleaved at a position in the
second intracellular loop, so that the resultant cDNA contained two
transmembrane domains (mKv4.2dn).
To evaluate the efficiency of the dominant-negative effect of
mKv4.2dn on mKv4.2-mediated current, the channel constructs were
expressed in HEK293 (Fig. 6). This cell
line expresses only a low level of voltage-gated
K+ channels and is therefore suitable for
the analysis of channel activity introduced by gene transfer.

View larger version (27K):
[in this window]
[in a new window]
|
Figure 6.
mKv4.2dn suppressed the mKv4.2 current in
transiently transfected HEK293 cells.
A1, Wild-type mKv4.2 current was
obtained when mKv4.2 and pCR3.1 vectors were cotransfected into HEK293
cells. Cells were held at 80 mV and then stepped to test potentials
ranging from 60 to +40 mV (in 20 mV increments) for 250 msec.
A2, Wild-type mKv4.2 current was
functionally eliminated when mKv4.2 and Kv4.2dn were cotransfected.
Currents were evoked as described in A1.
B, Mean amplitude of peak currents at a +40 mV test
pulse in HEK293 cells expressed with mKv4.2, mKv4.2 plus mKv4.2dn,
mKv4.2dn, and pCR3.1E (mean ± SEM). The amplitude of the
endogenous current expressed in HEK293 cells was measured from cells
transfected with pCR3.1E. mKv4.2dn did not produce a functional
current. The differences between mKv4.2 and mKv4.2 plus mKv4.2dn are
statistically significant (Student's t test;
***p < 0.001). C, D,
Kv1.1 current (C1) or Kv3.1 current
(D1) was obtained when Kv3.1 were
cotransfected into CHO-K1 cells. Cells were held at 80 mV and then
stepped to test potentials ranging from 60 to +40 mV (in 20 mV
increments) for 250 msec. Neither Kv1.1 current
(C2) nor Kv3.1 current
(D2) was suppressed by cotransfection
with mKv4.2dn. E, Mean amplitude of peak currents at a
+40 mV test pulse in CHO-K1 cells expressed with Kv1.1, Kv1.1 plus
mKv4.2dn, Kv3.1, and Kv3.1 plus mKv4.2dn (mean ± SEM).
|
|
When the cells were transfected with wild-type mKv4.2, they expressed a
fast-inactivating outward current with an inactivation rate of 20-30
msec at 20 mV depolarizing stimulation. The amplitude of mKv4.2
currents was 713.9 ± 80.5 pA/pF (n = 5) at +40 mV
(Fig. 6A1). The inactivation
rate was similar to that reported previously using a Xenopus
oocyte expression system (Serodio et al., 1994 , 1996 ). To assess the
effect of mKv4.2dn on mKv4.2 currents, they were cotransfected at a 1:1
molar ratio. The amplitude of emerging currents was reduced
significantly (125.0 ± 22.5 pA/pF, n = 8) (Fig.
6A2). The dominant-negative
construct itself exhibited no significant current (77.0 ± 16.0 pA/pF, n = 5). To examine the specificity of mKv4.2dn,
it was tested with Kv1.1 or Kv3.1 using CHO-K1 cells. Mean amplitudes
of peak currents were compared in Figure 6B. Neither
Kv1.1 (135.7 ± 21.4 pA/pF in Kv1.1 transfected cells, and
213.2 ± 23.8 pF/pA in Kv1.1 and mKv4.2dn transfected cells) (Fig.
6C) nor Kv3.1 (219.0 ± 49.2 pA/pF in Kv3.1 transfected cells, and 241.9 ± 20.8 pA/pF in Kv3.1 and mKv4.2dn transfected cells) (Fig. 6D) was suppressed by the expression of
mKv4.2dn, indicating that the effect of mKv4.2dn is specific to Kv4
(Fig. 6E).
The effect of mKv4.2 and mKv4.2dn in granule cells
We introduced mKv4.2dn into granule cells in the microexplant
culture. Figure 7, A and
B, shows typical examples of current trace recorded from a
control cell and an mKv4.2dn-transfected cell. Separation of the
transient and sustained currents was performed by the prepulse protocol
(Fig.
7A2,B2).
Isolated IA are shown in Figure 7,
A3 and
B3.

View larger version (23K):
[in this window]
[in a new window]
|
Figure 7.
Expression of mKv4.2dn suppressed the A-type
current of cerebellar granule cells.
A1, Cerebellar granule cells
transfected with EGFP in the microexplant culture exhibited a large
transient and maintained outward current by a series of depolarizing
pulses of 60 to +40 mV. A2, The
transient component of the current can be inactivated with a prepulse
to 20 mV. A3, Isolated A-type
current was obtained by subtracting A2 from
A1.
B1-B3,
Cotransfection of mKv4.2dn and EGFP results in a marked suppression of
the transient component without affecting the maintained component of
outward currents. C, Quantitative analysis indicated the
suppression of A-type current and no effect on delayed rectifier
current in the peak density evoked at 20 mV. Mean ± SEM is
displayed. ***p < 0.001 versus control cells.
D, Voltage-current density relationship for A-type
currents recorded from control cells (filled
circles) and mKv4.2dn-transfected cells (open
circles). Mean ± SEM is displayed.
|
|
In the control cells that were transfected with pCXegfp alone, the
current density of isolated IA was
120.6 ± 10.1 pA/pF at +20 mV (n = 33). On the
other hand, in mKv4.2dn-transfected cells, it was drastically decreased
to 30.5 ± 6.3 pA/pF (n = 20) (Fig. 7, compare
A3 and
B3; Fig. 7C). This effect
of mKv4.2dn on K+ currents was specific to
IA, because the delayed rectifier
currents were not suppressed (52.0 ± 11.9 pA/pF in control cells,
n = 33; 74.1 ± 20.5 pA/pF in mKv4.2dn-transfected
cells, n = 20) (Fig. 7C). Figure
7D shows that mKv4.2dn suppresses
IA at all voltages from 60 to 40 mV.
This result indicated that IA observed
in developing granule cells were carried by Kv4 (shal) family
K+ channels.
Next, we examined the effect of wild-type mKv4.2 expression in granule
cells (Fig. 8). Figure
8A shows a representative current evoked by 20 mV of
depolarizing voltage in a control cell and a mKv4.2-transfected cell.
Transfection of mKv4.2 resulted in an increase in rate of inactivation.
As shown in Figure 8B, the inactivation time constant
of IA decreased as depolarizing
voltage increased in both control and mKv4.2-transfected cells, but the value recorded from mKv4.2-transfected cells was always approximately threefold larger than that of control cells. This value was similar to
that obtained from transfected HEK293 cells. The density of IA and voltage dependency of
activation were not altered (Fig. 8C).

View larger version (17K):
[in this window]
[in a new window]
|
Figure 8.
Expression of mKv4.2 altered the inactivation time
constant of A-type currents in the cerebellar granule cells.
A, Representative current recorded from a granule cell
transfected with EGFP alone (A1) and
with EGFP plus mKv4.2 (A2). Because
the transfection of 0.2 µg/well mKv4.2 DNA caused serious damage to
the granule cells (see Discussion), the amount of DNA for transfection
was reduced to 0.05 µg/well. A depolarizing pulse to +20 mV from a
holding potential of 80 mV was given. B, Time constant
of inactivation as a function of voltage in control cells
(filled circles) and mKv4.2-transfected cells
(open circles). Time constant of inactivation of the
mKv4.2 current in HEK293 cells (filled triangles)
is also plotted. Mean ± SEM is displayed. C,
Voltage-current density relationship for A-type currents recorded from
control cells (filled circles) and
mKv4.2-transfected cells (open circles). Mean ± SEM is displayed.
|
|
The effect of mKv4.2 and mKv4.2dn on
membrane excitability
In mature T-shaped cells at 7 DIV, rapidly adapting and
repetitive-type action potentials were recorded from both mKv4.2dn- and
mKv4.2-transfected cells. This indicated that the ability to generate
action potential developed normally, even when the exogenous genes were
introduced. It is reported that the application of 4-AP, a blocker of
IA, altered the amplitude of
afterhyperpolarization (AHP) and frequency of repetitive firing
(D'Angelo et al., 1998 ). Therefore, we examined the properties of
action potentials.
Figure 9A shows the action
potentials recorded from control cells
(A1), mKv4.2dn-transfected cells
(A2), and mKv4.2-transfected cells
(A3). These traces clearly demonstrate
that latency from the starting point of current injection to the peak
of the first action potential [fast spike latency (FSL)] was
different among these cells. FSL was shorter in mKv4.2dn-transfected
cells (Fig. 9A2) compared with the
control cells, even when the injected current was smaller in
mKv4.2dn-transfected cells (10 pA in nKv4.2dn, and 14 pA in control
cells) (Fig. 9A1). On the contrary,
FSL was longer in mKv4.2-transfected cells (Fig.
9A3), even when the injected current
was larger (30 pA). In Figure 9B, mean FSL was plotted against the amount of injected current. The curve shifted to the left
by the transfection of mKv4.2dn and shifted to the right by
transfection of mKv4.2, indicating that
IA suppressed the generation of the
first spike in developing granule cells. We also found that the FSL in
control and mKv4.2-transfected cells became shorter to the level of
mKv4.2dn-transfected cells when the membrane potential was preheld at
50 mV at which the A-type channels were inactivated (data not
shown).

View larger version (20K):
[in this window]
[in a new window]
|
Figure 9.
Effect of elimination or prolonged inactivation
kinetics of A-type current on the latency to the first spike.
A, Discharge pattern of EGPF-transfected cells
(A1, Control),
mKv4.2dn plus EGFP-transfected cells
(A2), and mKv4.2 plus
EGFP-transfected cells (A3). The
cells were held at or near 80 mV and injected with a current of 14 (A1), 10 (A2), or 30 (A3) pA for 800 msec.
B, The latency to the first spike was plotted as a
function of amplitude of injected currents (mean ± SEM;
n = 6 for control cells, n = 4 for mKv4.2dn-transfected cells, and n = 5 for
mKv4.2-transfected cells). The FSL recorded from mKv4.2dn-transfected
cells is shorter and the FSL from mKv4.2-transfected cells is longer
compared with the FSL from control cells.
|
|
The minimum current required for generating action potential (Fig.
10A) and the
amplitude of the first action potential (Fig. 10B)
were also affected by alteration of
IA. The minimum injected current was
1.8 times smaller in mKV4.2dn-transfected cells and 2.2 times larger in
wild-type mKV4.2-transfected cells. The amplitude of the first action
potential was larger in mKv4.2dn-transfected cells (52.4 ± 2.6 mV, n = 9) and smaller in mKv4.2-transfected cells
(37.2 ± 3.4 mV, n = 4) compared with the control
cells (45.5 ± 1.4 mV, n = 12) (Fig.
10B).

View larger version (29K):
[in this window]
[in a new window]
|
Figure 10.
Effects of mKv4.2dn or mKv4.2dn expression on the
physiology of granule cells. A, Minimum amplitude of
injected current required for generating spikes. The data indicate that
the minimum amplitude of injection was reduced in mKv4.2dn-transfected
cells and increased in mKv4.2-transfected cells compared with control
cells. Mean ± SEM. The differences between control cells
(n = 12) and mKv4.2dn-transfected cells
(n = 9, *p < 0.05), or between
control cells and mKv4.2-transfected cells (n = 5, **p < 0.01) were statistically significant.
B, The amplitude of the first spike. The amplitude was
larger in mKv4.2dn-transfected cells and smaller in mKv4.2-transfected
cells compared with control cells. Mean ± SEM. The differences
between control cells and mKv4.2dn-transfected cells, or between
control cells and mKv4.2-transfected cells were statistically
significant (*p < 0.05). C-E, The
threshold of action potential (C), amplitude of
AHP (D), and RMP (E) did
not appear to be affected by changes in A-type current
properties.
|
|
In contrast to the parameters shown above, mKv4.2dn did not affect the
depth of afterhyperpolarization (Fig. 10C). The
inconsistency of this result with the effect of 4-AP on action
potential is probably attributable to the blocking of other components
of ion currents by 4-AP, such as delayed rectifier currents and
Ca2+-activated
K+ currents (Yeh et al., 1976 ; Thompson,
1982 ; Arhem and Johansson, 1989 ; Kehl, 1990 ; Davies et al., 1991 ;
Choquet and Korn, 1992 ; Campbell et al., 1993 ; Castle and Slawsky,
1993 ). The threshold of action potential and RMP were also unaffected
by the expression of mKv4.2 or mKv4.2dn (Fig. 10, D and
E, respectively).
These results suggest that the specific role of Kv4 family channels on
developing granule neurons is to suppress excitability by inhibiting
the generation of the first spike.
 |
DISCUSSION |
Molecular identity and the role of the
IA
In the present study, we have demonstrated that the
IA in developing cerebellar granule
cells of microexplant cultures was functionally eliminated by the
dominant-negative mutant of mKv4.2 (Fig. 7). Although the voltage could
not be clamped adequately in the long axonal and dendritic arbors of
the granule cells, space-clamp error in the neurites did not affect the
currents mediated by the Kv4 channel, because Kv4.2 proteins were
localized to the cell body in this culture system, as we reported
previously (Shibata et al., 1999 ). This result directly demonstrates
that members of Kv4 -subunits are responsible for the
IA. In adult cerebellar granule cells,
Kv4.3, but not Kv4.1, expression was also reported (Serodio and Rudy,
1998 ). Thus, the probability that Kv4.2 and Kv4.3 form heteromultimeric
complexes to conduct IA cannot be
ruled out. We showed previously that the expression patterns of Kv4.2
mRNA and protein correlated with the appearance of the
IA (Shibata et al., 1999 ), suggesting
that this subunit is the major component of the A-type channels in the
granule cells.
In addition, to provide a direct link between
IA and the Kv4 subfamily in developing
granule cells, we demonstrated that, when functional Kv4 channels are
eliminated, the latency to the first spike and the minimum injected
current for spike generation greatly decreased (Figs. 9, 10). The
effect of dominant-negative channels was restricted to the above
phenomenon because other parameters, such as afterhyperpolarization,
threshold, and RMP, did not change significantly. This finding revealed
that the role of IA is to control
first spike latency without affecting the other parameters.
A potassium channel blocker 4-AP is commonly used to analyze the role
of current components. When the functional role of
IA in action potential in the
cerebellar granule cells was studied by blocking
IA with 1 mM
4-AP, not only the first spike latency but also afterhyperpolarization
and frequency of spikes were affected drastically (D'Angelo et al.,
1998 ). Such multiple effects on the discharge pattern were thought to
be caused by partial inhibition of tetraethylammonium-sensitive
delayed rectifier components (Belluzzi et al., 1985 ; Numann et al.,
1987 ; Cull-Candy et al., 1989 ; Wang et al., 1991 ; Bardoni and Belluzzi,
1993 ). Our experiments using the dominant-negative constructs
illustrate the role of genuine IA
encoded by Kv4 subunits.
The various parameters of IA, such as
activation, inactivation, and recovery from inactivation (see Figs. 4,
5), aptly account for the observed discharge characteristics. First,
because the RMP of mature T-shaped cells was near 80 mV, A-type
channels could be fully activated when the cells were depolarized.
Second, IA should be inactivated after
the first spike and recover from inactivation by an AHP at a potential
more negative than 50 mV (Fig. 5). These characteristics of
IA cause the limited effect on
regulation of action potential. It should be noted, however, that the
voltage dependency of activation and inactivation of IA we observed displayed more positive
potential compared with that observed in other cells and the cerebellar
granule cells in different experimental conditions (Bardoni and
Belluzzi, 1993 ; Serodio et al., 1994 ). The differences of voltage
dependency might be explained by different modifications of channel
proteins or subunit composition.
A similar effect of fast-inactivating K+
current on excitability was reported using pyramidal neurons in dorsal
cochlear nuclei (Kanold and Manis, 1999 ). In these cells, the latency
before the generation of the first spike of action potential decreased
as the membrane potential became more positive, whereupon only the fast-inactivating K+ current
(IKIF) should inactivate before
depolarizing stimulation. These cells maintained their repetitive
discharge in this condition. This result strongly supports our
conclusion that IA produced by Kv4
channels primarily participates in suppression of the first spike.
However, it should also be noted that the amplitude of AHP observed in
our microexplant culture was smaller (approximately 50 mV) (Fig.
10D) than that observed in granule cells in
vivo at approximately postnatal day 20 (P20) (approximately
80 mV) (D'Angelo et al., 1997 , 1998 ). Therefore, the effect of the
K+ current under the AHP near 80 mV
remains to be investigated.
Our results demonstrated that the majority of the
IA was conducted by the Kv4 family;
however, the current could not be eliminated completely by the
expression of mKv4.2dn (Fig. 7C), and ~25% of the peak
current remained. This suggests several possibilities: first, the
turnover rate of the functional Kv4 channel complex was too slow to be
replaced during our experiments using the transient expression system;
second, the expression level of mKv4.2dn was insufficient; or third,
channels other than Kv4 were involved in the
IA. It has been reported that Kv1.1 in
combination with Kv 1 -subunit encodes A-type channels when
expressed in Xenopus oocytes (Rettig et al., 1994 ; Heinemann
et al., 1996 ; Sewing et al., 1996 ). Our in situ
hybridization experiments in vivo showed that the Kv1.1 mRNA
could be detected in the internal granule layer (IGL) at the second
postnatal week (data not shown), suggesting that this channel might
contribute to the IA. The Kv 1
subunit is also known to be expressed in external granule layer and IGL at early postnatal stages (Downen et al., 1999 ). We did not examine the
expression of the Kv1.1 gene in the microexplant culture, but these
results suggest that Kv1.1 may be expressed at low levels in our system
and give rise to the residual IA after
the elimination by mKv4.2dn.
Expression system as a tool for channel analysis
When expressed in an heterologous expression system, cloned mKv4.2
currents differ significantly from native
IA in a number of properties, such as
inactivation rate and 4-AP sensitivity (Serodio et al., 1994 , 1996 ).
For example, the cloned homomeric Kv4.2 current expressed in
Xenopus oocytes exhibited half-activation at 0 mV and
half-inactivation at 60 mV, with two voltage-dependent inactivation
constants of 20-40 and 100-200 msec. On the other hand, in the
cerebellar granule cells, IA displayed
half-activation at 46.7 mV and half-inactivation at 78.8 mV, with
one voltage-independent inactivation constant of 19 msec (Bardoni and
Belluzzi, 1993 ). In this study, the mKv4.2 current expressed in HEK293
cells and the IA in mouse cerebellar
granule cells also exhibited different inactivation constants (Figs. 6,
8). In most cases, -subunits accelerate the inactivation rate of
functional -subunit channels (Rettig et al., 1994 ; Heinemann et al.,
1996 ; Sewing et al., 1996 ). Furthermore, intracellular modulation of
the channels, such as phosphorylation, also alters the kinetics of
channel gating. It is plausible that differences of channel properties
observed between in vivo and in vitro systems are
attributable to these factors.
One of the interesting findings in our results is that the inactivation
rate of IA became very similar to that
of the mKv4.2 current in HEK293 cells when wild-type mKv4.2 was
introduced into the granule cells (Fig. 8). Although the experiment was
designed to overcome the limitations of the heterologous expression
system, the outcome appears to indicate that the introduced gene
overrides the intrinsic system. This change in kinetics of native
IA may be explained by several
possibilities: (1) excess wild-type mKv4.2 expression may result in the
formation of unusual homomultimers that exclude Kv4.3 involved in
native complex formation; (2) intrinsic Kv4.2 channels in granule cells
are different isoforms from cloned mKv4.2; and (3) extrinsic mKv4.2
failed to be processed properly by cellular modification mechanisms. It
also should be noted that transfection of equal amounts of mKv4.2 cDNA
and EGFP cDNA causes serious damage to the granule cells (over 10 cells
per explant survived when EGFP or EGFP plus mKv4.2dn were transfected,
whereas only 1-2 cells per explant survived when mKv4.2 were
transfected in addition to EGFP). Because this cell death could not be
rescued by the application of 1 µM TTX or 2 mM 4-AP in the culture medium to block channel
activity, the toxic effect might not be mediated by the regular channel
function on the cell surface. It may instead be caused by abnormal
accumulation of mKv4.2 in the Golgi apparatus or in some other organelles.
Developmental role of IA encoded by the
Kv4 subfamily
In general, IA is thought to
function in dendrites and synapses to regulate the excitability of the
postsynaptic membrane and hence control the reception and integration
of synaptic signals in the adult brain (Sheng et al., 1992 ; Hoffman et
al., 1997 ). Previously, we reported (Shibata et al., 1999 ) that Kv4.2
immunoreactivity was detectable in the glomeruli of IGL in adult mice,
whereas at P7 it is detected in the cell body of granule cells in the PMZ and IGL. Kv4.2 proteins were also localized in the cell body of granule cells in microexplant cultures. Our results suggest that
IA encoded by the Kv4 family functions
in the cell body and regulates electrical excitability to determine the
differentiation of granule cells in a manner distinct from that in the
postsynapse. Cell migration and morphological change, however, were not
affected by the elimination or overexpression of
IA (data not
shown). The influences of
IA on neuronal development remain to
be examined.
 |
FOOTNOTES |
Received Dec. 6, 1999; revised Feb. 16, 2000; accepted Feb. 24, 2000.
This work was supported by Grant in Aid 07458207 for Scientific
Research on Priority Areas on "Functional Development of Neural Circuit," Grant in Aid #09780748, Ministry of Education, Science, Sports, and Culture of Japan, and a grant from the Hoansha Foundation. We thank Dr. T. Yagi for providing the cDNA library, Dr. M. Okabe for
providing the pCXegfp vector, and Dr. J. S. Trimmer for providing the Kv1.1/RBG4 and Kv3.1/pCMV vectors.
Correspondence should be addressed to Dr. Kensuke Nakahira, Laboratory
of Neural Information, Department of Informational Physiology, National
Institute for Physiological Sciences, Okazaki National Research
Institutes, 38 Nishigonaka, Myodaiji, Okazaki, Aichi 444-8585, Japan.
E-mail: nakahira{at}nips.ac.jp.
Dr. Wakazono's present address: Photon Medical Research Center,
Hamamatsu University School of Medicine, Hamamatsu 431-3192 Japan.
 |
REFERENCES |
-
Arhem P,
Johansson S
(1989)
A model for the fast 4-aminopyridine effects on amphibian myelinated nerve fibres. A study based on voltage-clamp experiments.
Acta Physiol Scand
137:53-61[Web of Science][Medline].
-
Baldwin TJ,
Tsaur ML,
Lopez GA,
Jan YN,
Jan LY
(1991)
Characterization of a mammalian cDNA for an inactivating voltage-sensitive K+ channel.
Neuron
7:471-483[Web of Science][Medline].
-
Bardoni R,
Belluzzi O
(1993)
Kinetic study and numerical reconstruction of A-type current in granule cells of rat cerebellar slices.
J Neurophysiol
69:2222-2231[Abstract/Free Full Text].
-
Belluzzi O,
Sacchi O,
Wanke E
(1985)
A fast transient outward current in the rat sympathetic neurone studied under voltage-clamp conditions.
J Physiol (Lond)
358:91-108[Abstract/Free Full Text].
-
Campbell DL,
Qu Y,
Rasmusson RL,
Strauss HC
(1993)
The calcium-independent transient outward potassium current in isolated ferret right ventricular myocytes. II. Closed state reverse use-dependent block by 4-aminopyridine.
J Gen Physiol
101:603-626[Abstract/Free Full Text].
-
Castle NA,
Slawsky MT
(1993)
Characterization of 4-aminopyridine block of the transient outward K+ current in adult rat ventricular myocytes.
J Pharmacol Exp Ther
265:1450-1459[Abstract].
-
Choquet D,
Korn H
(1992)
Mechanism of 4-aminopyridine action on voltage-gated potassium channels in lymphocytes.
J Gen Physiol
99:217-240[Abstract/Free Full Text].
-
Cull-Candy SG,
Marshall CG,
Ogden D
(1989)
Voltage-activated membrane currents in rat cerebellar granule neurones.
J Physiol (Lond)
414:179-199[Abstract/Free Full Text].
-
D'Angelo E,
De Filippi G,
Rossi P,
Taglietti V
(1997)
Synaptic activation of Ca2+ action potentials in immature rat cerebellar granule cells in situ.
J Neurophysiol
78:1631-1642[Abstract/Free Full Text].
-
D'Angelo E,
De Filippi G,
Rossi P,
Taglietti V
(1998)
Ionic mechanism of electroresponsiveness in cerebellar granule cells implicates the action of a persistent sodium current.
J Neurophysiol
80:493-503[Abstract/Free Full Text].
-
Davies NW,
Pettit AI,
Agarwal R,
Standen NB
(1991)
The flickery block of ATP-dependent potassium channels of skeletal muscle by internal 4-aminopyridine.
Pflügers Arch
419:25-31[Web of Science][Medline].
-
Downen M,
Belkowski S,
Knowles H,
Cardillo M,
Prystowsky MB
(1999)
Developmental expression of voltage-gated potassium channel
subunits.
Brain Res Dev Brain Res
117:71-80[Medline]. -
Fisher TE,
Voisin DL,
Bourque CW
(1998)
Density of transient K+ current influences excitability in acutely isolated vasopressin and oxytocin neurones of rat hypothalamus.
J Physiol (Lond)
511:423-432[Abstract/Free Full Text].
-
Gorter JA,
Aronica E,
Hack NJ,
Balazs R,
Wadman WJ
(1995)
Development of voltage-activated potassium currents in cultured cerebellar granule neurons under different growth conditions.
J Neurophysiol
74:298-306[Abstract/Free Full Text].
-
Heinemann SH,
Rettig J,
Graack HR,
Pongs O
(1996)
Functional characterization of Kv channel
-subunits from rat brain.
J Physiol (Lond)
493:625-633[Abstract/Free Full Text]. -
Hoffman DA,
Johnston D
(1998)
Downregulation of transient K+ channels in dendrites of hippocampal CA1 pyramidal neurons by activation of PKA and PKC.
J Neurosci
18:3521-3528[Abstract/Free Full Text].
-
Hoffman DA,
Magee JC,
Colbert CM,
Johnston D
(1997)
K+ channel regulation of signal propagation in dendrites of hippocampal pyramidal neurons.
Nature
387:869-875[Medline].
-
Johns DC,
Nuss HB,
Marban E
(1997)
Suppression of neuronal and cardiac transient outward currents by viral gene transfer of dominant-negative Kv4.2 constructs.
J Biol Chem
272:31598-31603[Abstract/Free Full Text].
-
Kanold PO,
Manis PB
(1999)
Transient potassium currents regulate the discharge patterns of dorsal cochlear nucleus pyramidal cells.
J Neurosci
19:2195-2208[Abstract/Free Full Text].
-
Kehl SJ
(1990)
4-Aminopyridine causes a voltage-dependent block of the transient outward K+ current in rat melanotrophs.
J Physiol (Lond)
431:515-528[Abstract/Free Full Text].
-
Keros S,
McBain CJ
(1997)
Arachidonic acid inhibits transient potassium currents and broadens action potentials during electrographic seizures in hippocampal pyramidal and inhibitory interneurons.
J Neurosci
17:3476-3487[Abstract/Free Full Text].
-
Martina M,
Schultz JH,
Ehmke H,
Monyer H,
Jonas P
(1998)
Functional and molecular differences between voltage-gated K+ channels of fast-spiking interneurons and pyramidal neurons of rat hippocampus.
J Neurosci
18:8111-8125[Abstract/Free Full Text].
-
Nagata I,
Nakatsuji N
(1990)
Granule cell behavior on laminin in cerebellar microexplant cultures.
Brain Res Dev Brain Res
52:63-73[Medline].
-
Numann RE,
Wadman WJ,
Wong RK
(1987)
Outward currents of single hippocampal cells obtained from the adult guinea-pig.
J Physiol (Lond)
393:331-353[Abstract/Free Full Text].
-
Ramoa AS,
McCormick DA
(1994)
Developmental changes in electrophysiological properties of LGNd neurons during reorganization of retinogeniculate connections.
J Neurosci
14:2089-2097[Abstract].
-
Rettig J,
Heinemann SH,
Wunder F,
Lorra C,
Parcej DN,
Dolly JO,
Pongs O
(1994)
Inactivation properties of voltage-gated K+ channels altered by presence of
-subunit.
Nature
369:289-294[Medline]. -
Rogawski MA,
Beinfeld MC,
Hays SE,
Hokfelt T,
Skirboll LR
(1985)
Cholecystokinin and cultured spinal neurons. Immunohistochemistry, receptor binding, and neurophysiology.
Ann NY Acad Sci
448:403-412[Web of Science][Medline].
-
Rossi P,
De Filippi G,
Armano S,
Taglietti V,
D'Angelo E
(1998)
The weaver mutation causes a loss of inward rectifier current regulation in premigratory granule cells of the mouse cerebellum.
J Neurosci
18:3537-3547[Abstract/Free Full Text].
-
Rudy B,
Hoger JH,
Lester HA,
Davidson N
(1988)
At least two mRNA species contribute to the properties of rat brain A-type potassium channels expressed in Xenopus oocytes.
Neuron
1:649-658[Web of Science][Medline].
-
Schroter KH,
Ruppersberg JP,
Wunder F,
Rettig J,
Stocker M,
Pongs O
(1991)
Cloning and functional expression of a TEA-sensitive A-type potassium channel from rat brain.
FEBS Lett
278:211-216[Web of Science][Medline].
-
Serodio P,
Rudy B
(1998)
Differential expression of Kv4 K+ channel subunits mediating subthreshold transient K+ (A-type) currents in rat brain.
J Neurophysiol
79:1081-1091[Abstract/Free Full Text].
-
Serodio P,
Kentros C,
Rudy B
(1994)
Identification of molecular components of A-type channels activating at subthreshold potentials.
J Neurophysiol
72:1516-1529[Abstract/Free Full Text].
-
Serodio P,
Vega-Saenz de Miera E,
Rudy B
(1996)
Cloning of a novel component of A-type K+ channels operating at subthreshold potentials with unique expression in heart and brain.
J Neurophysiol
75:2174-2179[Abstract/Free Full Text].
-
Sewing S,
Roeper J,
Pongs O
(1996)
Kv
1 subunit binding specific for shaker-related potassium channel subunits.
Neuron
16:455-463[Web of Science][Medline]. -
Sheng M,
Tsaur ML,
Jan YN,
Jan LY
(1992)
Subcellular segregation of two A-type K+ channel proteins in rat central neurons.
Neuron
9:271-284[Web of Science][Medline].
-
Shibata R,
Wakazono Y,
Nakahira K,
Trimmer JS,
Ikenaka K
(1999)
Expression of Kv3.1 and Kv4.2 genes in developing cerebellar granule cells.
Dev Neurosci
21:87-93[Web of Science][Medline].
-
Song WJ,
Tkatch T,
Baranauskas G,
Ichinohe N,
Kitai ST,
Surmeier DJ
(1998)
Somatodendritic depolarization-activated potassium currents in rat neostriatal cholinergic interneurons are predominantly of the A type and attributable to coexpression of Kv4.2 and Kv4.1 subunits.
J Neurosci
18:3124-3137[Abstract/Free Full Text].
-
Spitzer NC
(1995)
Spontaneous activity: functions of calcium transients in neuronal differentiation.
Perspect Dev Neurobiol
2:379-386[Web of Science][Medline].
-
Surmeier DJ,
Mermelstein PG,
Goldowitz D
(1996)
The weaver mutation of GIRK2 results in a loss of inwardly rectifying K+ current in cerebellar granule cells.
Proc Natl Acad Sci USA
93:11191-11195[Abstract/Free Full Text].
-
Thompson S
(1982)
Aminopyridine block of transient potassium current.
J Gen Physiol
80:1-18[Abstract/Free Full Text].
-
Tsaur ML,
Chou CC,
Shih YH,
Wang HL
(1997)
Cloning, expression and CNS distribution of Kv4.3, an A-type K+ channel
subunit.
FEBS Lett
400:215-220[Web of Science][Medline]. -
Wakazono Y,
Kurahashi T,
Nakahira K,
Nagata I,
Takayama C,
Inoue Y,
Kaneko A,
Ikenaka K
(1997)
Appearance of a fast inactivating voltage-dependent K+ currents in developing cerebellar granule cells in vitro.
Neurosci Res
29:291-301[Web of Science][Medline].
-
Wang Y,
Strahlendorf JC,
Strahlendorf HK
(1991)
A transient voltage-dependent outward potassium current in mammalian cerebellar Purkinje cells.
Brain Res
567:153-158[Web of Science][Medline].
-
Yeh JZ,
Oxford GS,
Wu CH,
Narahashi T
(1976)
Dynamics of aminopyridine block of potassium channels in squid axon membrane.
J Gen Physiol
68:519-535[Abstract/Free Full Text].
Copyright © 2000 Society for Neuroscience 0270-6474/00/20114145-11$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
M. Zhang, X.-W. Fei, Y.-L. He, G. Yang, and Y.-A. Mei
Bradykinin inhibits the transient outward K+ current in mouse Schwann cells via the cAMP/PKA pathway
Am J Physiol Cell Physiol,
June 1, 2009;
296(6):
C1364 - C1372.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Liang, H. Wang, H. Chen, Y. Cui, L. Gu, J. Chai, and K. Wang
Structural Insights into KChIP4a Modulation of Kv4.3 Inactivation
J. Biol. Chem.,
February 20, 2009;
284(8):
4960 - 4967.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Diwakar, J. Magistretti, M. Goldfarb, G. Naldi, and E. D'Angelo
Axonal Na+ Channels Ensure Fast Spike Activation and Back-Propagation in Cerebellar Granule Cells
J Neurophysiol,
February 1, 2009;
101(2):
519 - 532.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Catacuzzeno, B. Fioretti, D. Pietrobon, and F. Franciolini
The differential expression of low-threshold K+ currents generates distinct firing patterns in different subtypes of adult mouse trigeminal ganglion neurones
J. Physiol.,
November 1, 2008;
586(21):
5101 - 5118.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Rusznak, G. Bakondi, K. Pocsai, A. Por, L. Kosztka, B. Pal, D. Nagy, and G. Szucs
Voltage-gated Potassium Channel (Kv) Subunits Expressed in the Rat Cochlear Nucleus
J. Histochem. Cytochem.,
May 1, 2008;
56(5):
443 - 465.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Nerbonne, B. R. Gerber, A. Norris, and A. Burkhalter
Electrical remodelling maintains firing properties in cortical pyramidal neurons lacking KCND2-encoded A-type K+ currents
J. Physiol.,
March 15, 2008;
586(6):
1565 - 1579.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-J. Hu, B. J. Alter, Y. Carrasquillo, C.-S. Qiu, and R. W. Gereau IV
Metabotropic Glutamate Receptor 5 Modulates Nociceptive Plasticity via Extracellular Signal-Regulated Kinase Kv4.2 Signaling in Spinal Cord Dorsal Horn Neurons
J. Neurosci.,
November 28, 2007;
27(48):
13181 - 13191.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. C. Jackson and B. P. Bean
State-Dependent Enhancement of Subthreshold A-Type Potassium Current by 4-Aminopyridine in Tuberomammillary Nucleus Neurons
J. Neurosci.,
October 3, 2007;
27(40):
10785 - 10796.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z.-G. Zhao, M. Zhang, X.-M. Zeng, X.-W. Fei, L.-Y. Liu, Z.-H. Zhang, and Y.-A. Mei
Flufenamic Acid Bi-Directionally Modulates the Transient Outward K+ Current in Rat Cerebellar Granule Cells
J. Pharmacol. Exp. Ther.,
July 1, 2007;
322(1):
195 - 204.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. L. Bourdeau, F. Morin, C. E. Laurent, M. Azzi, and J.-C. Lacaille
Kv4.3-Mediated A-Type K+ Currents Underlie Rhythmic Activity in Hippocampal Interneurons
J. Neurosci.,
February 21, 2007;
27(8):
1942 - 1953.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. L. Fawcett, C. M. Santi, A. Butler, T. Harris, M. Covarrubias, and L. Salkoff
Mutant Analysis of the Shal (Kv4) Voltage-gated Fast Transient K+ Channel in Caenorhabditis elegans
J. Biol. Chem.,
October 13, 2006;
281(41):
30725 - 30735.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Koyama and S. B. Appel
A-type K+ Current of Dopamine and GABA Neurons in the Ventral Tegmental Area
J Neurophysiol,
August 1, 2006;
96(2):
544 - 554.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Osorio, G. Alcaraz, F. Padilla, F. Couraud, P. Delmas, and M. Crest
Differential targeting and functional specialization of sodium channels in cultured cerebellar granule cells
J. Physiol.,
December 15, 2005;
569(3):
801 - 816.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. L. Molineux, F. R. Fernandez, W. H. Mehaffey, and R. W. Turner
A-Type and T-Type Currents Interact to Produce a Novel Spike Latency-Voltage Relationship in Cerebellar Stellate Cells
J. Neurosci.,
November 23, 2005;
25(47):
10863 - 10873.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Kim, D.-S. Wei, and D. A. Hoffman
Kv4 potassium channel subunits control action potential repolarization and frequency-dependent broadening in rat hippocampal CA1 pyramidal neurones
J. Physiol.,
November 15, 2005;
569(1):
41 - 57.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. H Jerng, K. Kunjilwar, and P. J Pfaffinger
Multiprotein assembly of Kv4.2, KChIP3 and DPP10 produces ternary channel complexes with ISA-like properties
J. Physiol.,
November 1, 2005;
568(3):
767 - 788.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Yuan, A. Burkhalter, and J. M. Nerbonne
Functional Role of the Fast Transient Outward K+ Current IA in Pyramidal Neurons in (Rat) Primary Visual Cortex
J. Neurosci.,
October 5, 2005;
25(40):
9185 - 9194.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. O. Kanold and P. B. Manis
Encoding the Timing of Inhibitory Inputs
J Neurophysiol,
May 1, 2005;
93(5):
2887 - 2897.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. P. Sergeant, S. Ohya, J. A. Reihill, B. A. Perrino, G. C. Amberg, Y. Imaizumi, B. Horowitz, K. M. Sanders, and S. D. Koh
Regulation of Kv4.3 currents by Ca2+/calmodulin-dependent protein kinase II
Am J Physiol Cell Physiol,
February 1, 2005;
288(2):
C304 - C313.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Toledo-Rodriguez, B. Blumenfeld, C. Wu, J. Luo, B. Attali, P. Goodman, and H. Markram
Correlation Maps Allow Neuronal Electrical Properties to be Predicted from Single-cell Gene Expression Profiles in Rat Neocortex
Cereb Cortex,
December 1, 2004;
14(12):
1310 - 1327.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. G. Birnbaum, A. W. Varga, L.-L. Yuan, A. E. Anderson, J. D. Sweatt, and L. A. Schrader
Structure and Function of Kv4-Family Transient Potassium Channels
Physiol Rev,
July 1, 2004;
84(3):
803 - 833.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. W. Varga, L.-L. Yuan, A. E. Anderson, L. A. Schrader, G.-Y. Wu, J. R. Gatchel, D. Johnston, and J. D. Sweatt
Calcium-Calmodulin-Dependent Kinase II Modulates Kv4.2 Channel Expression and Upregulates Neuronal A-Type Potassium Currents
J. Neurosci.,
April 7, 2004;
24(14):
3643 - 3654.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. G. Akar, R. C. Wu, I. Deschenes, A. A. Armoundas, V. Piacentino III, S. R. Houser, and G. F. Tomaselli
Phenotypic differences in transient outward K+ current of human and canine ventricular myocytes: insights into molecular composition of ventricular Ito
Am J Physiol Heart Circ Physiol,
February 1, 2004;
286(2):
H602 - H609.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Hattori, F. Murakami, and W.-J. Song
Quantitative Relationship Between Kv4.2 mRNA and A-Type K+ Current in Rat Striatal Cholinergic Interneurons During Development
J Neurophysiol,
July 1, 2003;
90(1):
175 - 183.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Mitterdorfer and B. P. Bean
Potassium Currents during the Action Potential of Hippocampal CA3 Neurons
J. Neurosci.,
December 1, 2002;
22(23):
10106 - 10115.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. C Amberg, S. D. Koh, W. J Hatton, K. J Murray, K. Monaghan, B. Horowitz, and K. M Sanders
Contribution of Kv4 channels toward the A-type potassium current in murine colonic myocytes
J. Physiol.,
October 15, 2002;
544(2):
403 - 415.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. D. Plant, P. J. Kemp, C. Peers, Z. Henderson, and H. A. Pearson
Hypoxic Depolarization of Cerebellar Granule Neurons by Specific Inhibition of TASK-1
Stroke,
September 1, 2002;
33(9):
2324 - 2328.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. L. Adamson, M. A. Reid, and R. L. Davis
Opposite Actions of Brain-Derived Neurotrophic Factor and Neurotrophin-3 on Firing Features and Ion Channel Composition of Murine Spiral Ganglion Neurons
J. Neurosci.,
February 15, 2002;
22(4):
1385 - 1396.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. J Beck, M. Bowlby, W F. An, K. J Rhodes, and M. Covarrubias
Remodelling inactivation gating of Kv4 channels by KChIP1, a small-molecular-weight calcium-binding protein
J. Physiol.,
February 1, 2002;
538(3):
691 - 706.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. H. Holmqvist, J. Cao, R. Hernandez-Pineda, M. D. Jacobson, K. I. Carroll, M. A. Sung, M. Betty, P. Ge, K. J. Gilbride, M. E. Brown, et al.
Elimination of fast inactivation in Kv4 A-type potassium channels by an auxiliary subunit domain
PNAS,
January 22, 2002;
99(2):
1035 - 1040.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. S Nadal, Y. Amarillo, E. V.-S. de Miera, and B. Rudy
Evidence for the presence of a novel Kv4-mediated A-type K+ channel-modifying factor
J. Physiol.,
December 15, 2001;
537(3):
801 - 809.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Riazanski, A. Becker, J. Chen, D. Sochivko, A. Lie, O. D Wiestler, C. E Elger, and H. Beck
Functional and molecular analysis of transient voltage-dependent K+ currents in rat hippocampal granule cells
J. Physiol.,
December 1, 2001;
537(2):
391 - 406.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. W. Varga, A. E. Anderson, J. P. Adams, H. Vogel, and J. D. Sweatt
Input-Specific Immunolocalization of Differentially Phosphorylated Kv4.2 in the Mouse Brain
Learn. Mem.,
September 1, 2000;
7(5):
321 - 332.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
M. S Nadal, Y. Amarillo, E. V.-S. de Miera, and B. Rudy
Evidence for the presence of a novel Kv4-mediated A-type K+ channel-modifying factor
J. Physiol.,
December 15, 2001;
537(3):
801 - 809.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|