 |
Previous Article | Next Article 
The Journal of Neuroscience, July 15, 2000, 20(14):5225-5233
Early Onset of Axonal Degeneration in Double
(plp / mag / )
and Hypomyelinosis in Triple
(plp / mbp / mag / )
Mutant Mice
Thomas
Uschkureit1,
Olaf
Spörkel1,
Jens
Stracke1,
Heinrich
Büssow2, and
Wilhelm
Stoffel1
1 Laboratory for Molecular Neuroscience, University of
Cologne, D-50931 Cologne, Germany, and 2 Institute of
Anatomy, University of Bonn, D-53115 Bonn, Germany
 |
ABSTRACT |
Double (plp / mag / ) and
triple
(plp / mbp / mag / )
null-allelic mouse lines deficient in proteolipid protein (PLP),
myelin-associated glycoprotein (MAG), and myelin basic protein (MBP)
were generated and characterized genetically, biochemically, and
morphologically including their behavioral capacities. The
plp / mag / mutant develops a
rapidly progressing axon degeneration in CNS with severe cognitive and motor coordinative deficits but has a normal longevity. CNS axons of the
plp / mbp / mag /
mouse are hypomyelinated and ensheathed by "pseudomyelin" with
disturbed protein and complex lipid composition. The
shiverer trait in the
plp / mbp / mag / similar to the plp / mbp / mutant is
significantly ameliorated, and its lifespan is considerably prolonged.
The longevity of these dysmyelinosis mouse mutants recommends them as
suitable models for the long-term evaluation of stem cell therapeutic strategies.
Key words:
double mutants; triple mutant; myelin proteins; myelin
lipids; ultrastructure of myelin; behavioral tests
 |
INTRODUCTION |
Myelination of axons by
oligodendrocytes in the CNS and Schwann cells in the PNS of vertebrates
is an important event in the early development. In the CNS
oligodendrocytes synthesize myelin specific proteins and lipids in a
stringently regulated temporal sequence and assemble them in
plasmamembrane processes that wrap axons as a highly compacted
multilayer membrane to insulate internodes.
Proteolipid protein (PLP) and DM20, a smaller
isoform derived from alternative splicing, are the two major integral
membrane proteins of CNS myelin (Stoffel et al., 1984 ). Their correct
integration into the highly ordered membrane sheath is required for
stabilizing the apposition of the adjacent extracellular membrane
surfaces, ultrastructurally appearing as the interperiod dense line
(IDL). Besides the naturally occurring mutants, e.g., jimpy
(Nave et al., 1986 ) and rumpshaker (Schneider et al., 1992 ),
two knock-out mouse models (Boison and Stoffel, 1994 ; Klugmann et al.,
1997 ) have elucidated the structure-function relationship of this
tetraspan membrane protein (Weimbs and Stoffel, 1992 ). In contrast
to the point mutations (jimpy, rumpshaker),
substantial myelination was observed in plp / mice with a loss of
the tight compaction at the IDL. The phenotype of the PLP-deficient
mouse was inconspicuous, and a late onset of axon degeneration
in the aging plp / mouse suggests a possible function of
PLP and/or DM20 for axonal maintenance (Griffiths
et al., 1998 ).
The family of myelin basic protein (MBP) isoproteins (21.5, 18.5, 17, and 14 kDa) results from alternative splicing. They comprise 30-40% of CNS and 5-15% of PNS myelin proteins (Lees and
Brostoff, 1984 ). MBP plays a crucial role in the compaction of the
opposing cytosolic surfaces of the plasma membrane processes, the main
dense line (MDL) in electron microscopy (Omlin et al., 1982 ). The
spontaneous shiverer mouse mutant, a "natural"
knock-out, with deletion of exons 2-7 of the MBP gene (Roach et al.,
1985 ; Molineaux et al., 1986 ) causes severe hypomyelination of CNS
axons and leads to premature death within 3 months. No major
morphological abnormalities are observed in the PNS (Rosenbluth,
1980 ).
A third minor, but important constituent of the CNS myelin membrane of
differentiating oligodendrocytes and in PNS, is the myelin-associated
glycoprotein (MAG). MAG appears as a component of the surface (Yim et
al., 1995 ). Its main function is thought to mediate axon-glia contact
during myelin assembly (Arquint et al., 1987 ; Trapp, 1990 ). MAG
expression occurs in a time-specific manner and yields the L-MAG
isoform predominantly expressed at an early and S-MAG at a later stage
of myelination (Lai et al., 1987 ; Tropak et al., 1988 ; Inuzuka et al.,
1991 ; Pedraza et al., 1991 ). Subtle ultrastructural abnormalities in
CNS myelin of mag / mice were observed (Li et al., 1994 ;
Montag et al., 1994 ). Axonal and myelin degeneration in the PNS but not
in CNS was observed in older mag / mice (Fruttiger et
al., 1995 ; Yin et al., 1998 ).
The characterization of the mouse models generated in this study
together with the monogenetic mutants [plp / ,
mbp / (shiverer) and mag / ] and
the plp / mbp / double mutant provided
extensive insight into the pivotal functions of the main myelin
proteins for oligodendrocyte development, myelin formation, myelin
structure, compaction, and maintenance of the myelin membrane, and
particularly for axonal integrity.
 |
MATERIALS AND METHODS |
Animals. PLP-deficient mice
(plp / ) (Boison and Stoffel, 1994 ) were crossed
with MAG-deficient mice (mag / ) (kindly supplied by Prof.
Bruce Trapp, Cleveland Clinic Foundation, Cleveland, OH) (Li et al.,
1994 ). The resulting F1 generation was intercrossed, and mice
homozygous for the PLP/MAG deficiency
(plp / mag / ) were obtained. We
generated the PLP/MBP/MAG-deficient triple mutant mouse line
(mag / plp / mbp / ) by crossing
MAG-deficient mice (mag / ) with PLP/MBP-deficient animals
from our transgenic breeding facility (Stoffel et al., 1997 ). The
homozygous PLP/MBP/MAG-deficient triple mutant was obtained by
intercrossing
(plpY/ mbp / mag+/ ) male
with (plp / mag / mbp+/ )
female mice. MAG/PLP/MBP-deficient triple mutant animals are infertile.
Shiverer mice (shi/shi = mbp / ) were selected from crossings of heterozygous
animals (mbp+/ ) (The Jackson Laboratory, Bar Harbor, ME).
Genotyping. Genotyping of the wild-type and mutant PLP
allele was performed by hybridizing NcoI-digested genomic
DNA with a genomic 700 bp BglII fragment that contains
sequences of exon III and intron III of the PLP gene. A 3.6 kb fragment
is indicative of the wild type and a 2.7 kb signal of the mutated
allele. The deletion of the mbp gene (exons II to VII) was
verified by Southern blotting of BamHI-digested genomic DNA
with a 350 bp PCR fragment obtained with oligonucleotide primers
hybridizing to a 5' intron sequence upstream of the deleted exon II,
5'GAGGCCGCACATCAGCCCTGATTTTTGCTAAG3', and a corresponding 3'primer,
5'CATGTATGAATGTGCATCTTGGGCAATCTATCT3', hybridizing to the sequence
flanking the deletion downstream of exon VII. A 3.5 kb BamHI
fragment is diagnostic of the wild type and a 7 kb signal of the
shiverer locus. The MAG genotype was examined by probing
BamHI/HindIII restricted DNA with the 270 bp
EcoRI/AccI fragment of exon VII. A 7.7 kb band
indicates the wild type and a 5.5 kb signal the targeted allele.
RNA analysis. RNA was prepared from total brain of 20-d-old
mice (Chomczynski and Sacchi, 1987 ).
Northern blot. RNA (20 µg) was separated by 1%
formaldehyde-agarose gel electrophoresis and blotted to nitrocellulose
(GeneScreen Plus; NEN Life Science Products, Boston, MA) and hybridized
with the following genomic and cDNA fragments of PLP, MBP, MAG, and GAPDH labeled with the random priming DNA-labeling kit (Boehringer Mannheim, Mannheim, Germany): a genomic 700 bp BglII
fragment containing sequences of exon III and intron III of the PLP
gene, a 266 bp PCR-fragment of MAG exon IX (5'primer:
5'GCAGTTGCCCCCATAATCCTTCTGGAGTCA3', 3'primer:
5'CTCTGGGTGCCATAGAGGTTCCTGGAGGTA3'), a 540 bp PCR cDNA fragment of MBP
(5'primer: 5'CAAGAAGACCCCACAGCAGCTTCCGGAGGC3', 3'primer:
5'CAGGATTCGGGAAGGCTGAGCGGGGAGGGC3'), and a 550 bp
HindIII/XbaI cDNA fragment of human liver
glyceraldehyde 3-phosphodehydrogenase (GAPDH). Fragments were purified
using the Quiaex gel extraction kit (Qiagen, Chatsworth, CA).
Quantitative RT-PCR. Five micrograms of RNA treated
with RNase-free DNase were subjected to the first strand synthesis
(SuperscriptII; Life Technologies GmbH, Karlsruhe, Germany). We used
1/20 of the reaction for each PCR in 30 µl in the presence of
0.1 µl of 32P-dCTP. Samples were taken
after 15, 17, 19, and 21 cycles and separated on 6% polyacrylamide
gels. Gels were dried and analyzed with a PhosphorImager (Molecular
Dynamics, Sunnyvale, CA) using the Imagequant software (Molecular
Dynamics). The following oligonucleotide primers were used: MAG: 5':
5'TGCTCACCAGCATCCTCACG3', 3': 5'AGCAGCCTCCTCTCAGATCC3'; PLP: 5':
5'CAAGCTCATTCTTTGGAGCG3', 3': 5'CAATCATGAAGGTGAGCAGG3'; MBP: 5':
5'TACCTGGCCACAGCAAGTAC3', 3': 5'GTCACAATGTTCTTGAAG3'; GAPDH: 5':
5'GAGCTGAACGGGAAGCTCAC3', 3': 5'CACCACCCTGTTGCTGTAGC3'; OMgp: 5':
5'GCAGCAGCTGCAACTCTAAC3', 3': 5'GAAGCATTTACTTTCCAAGCA3'; MOG: 5':
5'CCAAGAGGAGGCAGCAATGG3', 3': 5'GTTGTAGCAGATGATCAAGG3'; NCAM120: 5': 5'CCTGAAGAGCATCCAGTACA3', 3':
5'ATGAATTCCAAGGACTCCTG3'; NCAM140: 5':
5'CCATCAGACACTATCTGGTC3', 3': 5'TCAGGAAGTAGCAGGTGATG3'; CGT: 5':
5'GAAATTCACAAGGATCAACC3', 3': 5'GTCCATTAACTGTGCTATGC3'.
Isolation of myelin and protein analysis. Myelin of total
brain of 28-d-old mice was purified by sucrose gradient centrifugation. One brain was homogenized in 10 ml of 0.32 M sucrose. The
suspension was layered on top of 20 ml of 0.85 M sucrose
and centrifuged at 10,000 × g for 20 min. The
myelin-containing interphase was collected with a bent Pasteur pipette,
diluted with three volumes of water, sedimented at 10,000 × g for 30 min, and washed twice with water (Norton and
Poduslo, 1973 ). Aliquots were separated on 10-15% SDS-PAGE.
Individual proteins were visualized by Western blot analysis (Towbin et
al., 1979 ) with SuperSignal Substrate (Pierce, Rockford, IL), using
anti-MBP antibodies (Boehringer Mannheim) and polyclonal anti-PLP
(whole protein) and anti-MAG (Gln376-Tyr390)
antibodies generated in our laboratory.
PNS proteins were isolated by homogenization and sonication of sciatic
nerves in 200 µl of BUST buffer (50 mM Tris-HCl, pH 7.4, 8 M urea, 2% -mercaptoethanol, and 0.5% SDS). After
centrifugation at 5 × 105 rpm for 20 min at 25°C the supernatant was used for protein analysis.
Lipid analysis. Lipids were extracted from mouse brain,
sciatic, and pectineus nerves as described before (Bligh and Dyer, 1959 ). The extracted lipids were dissolved in 300 µl of
chloroform/methanol (2:1), lipids from mbp-deficient mice in 30 µl
chloroform/methanol (2:1). Lipids were separated by high-performance
thin-layer chromatography (HPTLC) on silica gel-precoated plates (HPTLC
60; 10 × 10 cm plates; Merck, Darmstadt, Germany) in the solvent
system chloroform/methanol/water (65:25:4). Lipid bands were visualized
by charring with 50% H2SO4 at 120°C for 15 min and confirmed by standards. Gangliosides of purified myelin were separated in the solvent system
chloroform/methanol/water/ammonia (60:35:6:2), stained with
orcin-reagent at 95°C for 15 min. For semiquantitative lipid
analysis, HPTLC plates were scanned, and lipid bands were integrated
with a PhosphorImager. Mean values and their SEs were estimated
from three independent experiments.
Light and electron microscopy. Anesthetized mice were
perfused with 6% glutaraldehyde for light and electron microscopy. The optic nerve and cervical segments of the spinal cord were isolated, post-fixed in 1% phosphate-buffered OsO4 in 0.1 M sucrose, and embedded in Epon 812. The semithin sections
were stained with toluidine/pyronin. Ultrathin cross-sections of optic
nerve and spinal cord were contrasted with uranylacetate and lead
citrate and examined as previously described (Bussow, 1978 ).
Conduction velocity measurement. Nerve conduction was
measured by proximal stimulation of the sciatic nerve at the knee and distal close to the hip, using a Medelec electromyograph, model MS92.
Behavioral testing (Wallace et al., 1980 ). The following
tests were performed with eight mice of each genotype except for the
shiverer mice with six and the PLP/MBP/MAG-deficient mice with seven mice. The behavior tests, which were performed during a 2 month period, were started with mice of the following age: controls:
CD1 10 weeks; C57/Bl6 12 weeks; (mag / ) 20 weeks; (plp / ) 10 weeks;
(mbp / ) 6-8 weeks;
(mag / plp / ) 10 weeks;
(plp / mbp / ) 10 weeks;
(mag / plp / mbp / )
8 weeks.
Morris water maze (Morris, 1984 ). Water mazes took place in
a black circular polyethylene tub (69 cm diameter, 22 cm high) with an
escape platform, a black cylinder (7.5 cm diameter), submerged 0.5 cm
below the surface of the water, in a constant position). Water
temperature was 21°C. The animal was set into the water at a randomly
determined quadrant. A trial was finished when the mouse had reached
the escape platform or at the set time of 90 sec. Animals were allowed
to recover for 30 sec on the platform before another trial was started.
Each mouse was tested in four subsequent trials over 5 d. Escape
latency, number of squares crossed, and swimming speed were
video-recorded. At the fifth day an additional 30 sec trial was
performed with the escape platform being removed (probe trial). The
number of crossings of the previous position of the platform was
counted. The trials were registered and processed with the software
MOR 005 (Tropon-Werke, Cologne, Germany) and statistically
evaluated using the ANOVA software (Tropon-Werke) (Morris, 1984 ;
Klapdor and van der Staay, 1996 ; Klapdor and van der Staay, 1998 ).
Open field. Animals were placed in the middle of a box
(60 × 60 cm), the bottom of which was subdivided into 10 × 10 cm squares. Square crossings, rearing, grooming, and the location of
the mouse (middle, wall, corner) were registered under video control
over periods of 15 min. Mice were adapted in a quiet room under red light illumination. Data were processed with the software OBSERVE 004 (Tropon-Werke) and statistically evaluated with ANOVA software.
Rotarod test (Wallace et al., 1980 ). Animals were placed on
a resting rod (diameter 3 cm) 20 cm above the ground for 1 min, and the
rotation started at 0.4 rpm and doubled every 60 sec. The time interval
during that the mice stayed on the rod was measured. The test was
repeated three times a day over a period of 5 d. In the final task
on day 5, the mouse was placed on the rod constantly rotating at 4 or 8 rpm, respectively. The drop off frequency within 90 sec was measured
(Kuhn et al., 1995 ).
Descending a vertical pole (Wallace et al., 1980 ). A pole
wrapped with cord (2 cm diameter, 80 cm length) and bordered at its
upper end by a plate was held in a horizontal position. The mouse was
placed with its forelimbs pointing to the platform. After turning the
pole into a vertical position the time needed to turn around and
required to descend and reach the floor was measured. Also the drop
offs, sliding down and climbing up again, was scored. The procedure was
repeated three times. A cutoff of 300 sec was chosen.
Horizontal bridge (Wallace et al., 1980 ). Mice were placed
in the middle of a horizontal wooden bar (2 × 2 cm, 60 cm length) bridging two platforms (50 cm above the floor). The time to reach the
platform, dropping off the bridge, and the time until the drop off
occurs were measured.
Horizontal wire (Wallace et al., 1980 ). The mouse was placed
with its forelimbs to the middle of a horizontal metal wire (2 mm
diameter, 60 cm length) connecting two platforms (5 × 2 cm; 50 cm
above the floor). The time needed to reach one of the platforms, dropping off the wire, and the time until the drop off occurred were
measured. A cutoff time of 180 sec was selected.
 |
RESULTS |
We generated two mutant mouse lines, the
plp / mag / double mutant by crossing the
plp / into the mag / locus and a
homozygous triple mutant
plp / mbp / mag / lacking PLP,
MAG, and MBP by crossing the mbp+/ genotype into the
homozygous plp / mag / double mutant. For
comparison we included the monogenic mutants, the
plp / mbp / double
mutant, and the wild type in the biochemical, morphological, and
physiological analyses of six mutant genotypes: plp / ;
mbp / (shi/shi);
mag / ; plp / mag / ;
plp / mbp / , and
plp / mbp / mag / .
Their genotypes were verified by Southern blot analysis, which revealed
the restriction fragments length polymorphism diagnostic for the
respective targeted gene loci (data not shown). The missing mRNAs in
Northern blot analysis (Fig.
1A), together with the
absence of PLP, MBP, and MAG in SDS-PAGE and Western blot
analysis proved that we had generated the two homozygous mouse lines
(Fig. 1B,C). Sensitive protein detection methods
(silver staining) and extensive Western blot analysis using polyclonal
PLP and MAG antibodies and a monoclonal MBP antibody failed to detect
any of the gene products in the respective mutants, including
hypothetical immunoreactive PLP-related polypeptides (Fig.
1B) (Boison and Stoffel, 1994 ; Klugmann et al.,
1997 ). Western blot analysis of sciatic nerve using the MBP-specific
antibody revealed that MBP is selectively upregulated twofold in
peripheral nerves of plp / mag / double
mutant mice as previously reported for mag / mice (Fig.
1B) (Li et al., 1994 ).

View larger version (41K):
[in this window]
[in a new window]
|
Figure 1.
A, Northern blot analysis;
B, SDS-PAGE analysis [silver (top) and
Coomassie staining (bottom)]; C, Western
blot analysis of wt and six mutant mouse lines.
|
|
Phenotypes of myelin mutants
Plp / and mag / single null allelic
mutants had no obvious phenotype. However, the double mutant
plp / mag / developed a tremor of the
hindlimbs around postnatal week 4. The initial tremor constantly
progressed to dragging and jerky-like movement of the hindlimbs with
increasing age. No convulsions were observed. Despite these
neurological symptoms, the plp / mag /
double mutant had a normal life span (see Table 7). The motor behavior
of triple mutant mice
(plp / mbp / mag / )
differed from that of the plp / mbp / double
mutant by the combination of the shiverer trait with its high-frequency tremor and the PLP/MAG deficiency with its impairment described above. Seizures and convulsions did not occur until 3 months
after birth but then with a high frequency. Their life span is 7-9
months, significantly longer than that of the MBP-deficient (shiverer) mouse of ~3 months (see Table 7) (Chernoff,
1981 ).
Transcriptional regulation of gene expression in the
mouse mutants
We studied the complex gene expression pattern of oligodendrocytes
in the single, double, and triple mutants first on the transcriptional
level by Northern blot analysis (Fig. 1A). Searching for compensatory mechanisms, we expanded this study to genes possibly involved in this mechanism by quantitative RT-PCR of RNA of additional oligodendrocyte-specific proteins (MOG, OMGP, CGT) and two forms of the
neural cell adhesion molecule N-CAM (140 and 120 kDa isoforms). Total
RNA from p20 mouse brains and the respective oligonucleotide primers
yielded PCR fragments of the expected size. Two housekeeping enzymes,
GAPDH and cyclophilin, were included for comparison (Table 1).
The only significant difference in the expression pattern between the
mutants and wt was a twofold to threefold overexpression of MAG in
shiverer and plp / mbp / double
mutant mice (Table 1). Further analysis of the transcripts of the MAG
gene revealed that the overexpression of MAG is predominantly
contributed by the smaller isoform, S-MAG, in the mutant CNS (data not
shown). This overexpression was restricted to the mRNA but not to MAG protein synthesis as shown by Western blot analysis (Fig.
1C).
Deficiencies of CNS-myelin proteins are associated with alterations
in myelin membrane lipid synthesis
To explore the differences in myelination the total amount of
myelin, isolated from brain homogenates of 6-week-old mutant and
wt mice by discontinuous sucrose gradient centrifugation, was determined (Norton and Poduslo, 1973 ). The yield of total myelin
from brains of wt, plp / , mag / , and plp / mag / double mutant mice was approximately identical (wt: 18.1 ± 2.4 mg; plp / : 18.6 ± 5.3 mg; mag / :
16.7 ± 0.9 mg; plp / mag / : 18.3 ± 2.9 mg). However, the amount of myelin obtained from brains of the remaining mutants was strikingly low (mbp / : 0.7 ± 0.3 mg; plp / mbp / : 0.7 ± 0.5 mg;
plp / mbp / mag / : 0.6 ± 0.4 mg). Although the amount of myelin from brains of mice carrying the
shiverer genotype were similar, oligodendrocytes of the
double mutant plp / mbp / and the triple
mutant plp / mbp / mag / mice
wrap a significant number of larger diameter axons with a
"pseudomyelin" sheath (see Fig. 4A, electron microscopy).
In view of the ultrastructural finding of "pseudomyelin" membranes
around larger diameter axons in the
plp / mbp / and the triple mutant CNS (Fig.
3) and the minute amount of proteins
isolated from their myelin, we studied the lipid composition of
purified myelin fractions of the different genotypes, not of total
brain. Previous reports focused on the lipids of whole brain of
shiverer mouse (Norton and Poduslo, 1973 ; Bird et al., 1978 ;
Cammer et al., 1984 ; Iwamori et al., 1985 ). We analyzed total lipids
from purified CNS myelin, pectineus, and sciatic nerves by HPTLC.
Whereas the lipid composition of CNS myelin of plp / ,
mag / , and plp / mag / mutants
was unaffected, mutants carrying the MBP deletion showed significant differences in the amounts of total phospholipids and
myelin-specific lipids. In CNS myelin of all mutants carrying the
MBP deletion, the ratio of the oligodendrocyte-specific lipids, galactocerebrosides, and sulfatides to phospholipids was reduced fourfold. This ratio remained unchanged in the other mutants like in control mice (Fig. 2A,C). Cerebrosides and
sulfatides were both considerably reduced in the CNS of MBP-deficient
mice, although the gene expression of the key enzyme of
galactocerebroside and sulfatide biosynthesis, the
UDP-galactose:ceramide galactosyltransferase (CGT) (EC 2.4.1.45)
(Schulte and Stoffel, 1993 ), was not altered (Table 1).

View larger version (38K):
[in this window]
[in a new window]
|
Figure 2.
Analysis of total lipids of purified myelin and
sciatic nerve. Six aliquots of brain extracts of mice carrying the
shiverer genotype and one aliquot of the other genotypes
were separated by HPTLC. A, Total lipids, solvent
system: chloroform/methanol/water 65:25:4. CN, Normal
fatty acid-substituted GalC; CH, -hydroxy
fatty acid-substituted GalC; PE,
phosphatidylethanolamine; SN, normal fatty
acid-substituted sGalC; SH, -hydroxy fatty
acid-substituted sGalC; LPE,
lysophosphatidylethanolamine; PC, phosphatidylcholine;
PS, phosphatidylserine; PI,
phosphatidylinositol; SPM, sphingomyelin.
B, Gangliosides of purified myelin, solvent system:
chloroform/methanol/water/ammonia 60:35:6:2, were identified by
comparison with HPLC purified standards. C,
Semiquantitative lipid analysis, quantification with a PhosphorImager
(mean ± SEM).
|
|
The lipid analysis of CNS myelin of the mutants containing the
shiverer trait furthermore revealed that the sphingomyelin fraction consisted of only one species, stearoyl-sphingomyelin. This structure was ascertained by MALDI-TOF MS (matrix-assisted laser desorption/ionization time of flight mass spectroscopy) (data not shown).
Gangliosides of CNS myelin of mice with the mbp /
mutation were distinctly decreased. Complex higher gangliosides
(GM1, GD1a, GD1b, GT1b, and
GQ1b) were almost absent, and only
GM3 were present as main ganglioside species
(Fig. 2B). Membrane lipids in the myelin sheaths of
peripheral nerves were unaffected in the different genotypes.
Behavioral characteristics of the mutants
To further characterize each mutant, we studied the cognitive and
motor-coordinative capacities in behavioral tests. The two double and
the triple mutants differ clearly from each other by the degree of
impaired neuromotor coordination. Mouse mutants carrying the
shiverer trait (mbp / ;
plp / mbp / ;
plp / mbp / mag / ) were
excluded from the Morris water maze escape task (Morris, 1984 ) because
they were unable to swim over the period of time required for the task.
Plp / mag / double mutant mice were compared with their respective monogenic mutants and two wild-type strains (C57/Bl6, inbred; CD1, outbred). Whereas plp / and
mag / mice showed a normal swimming speed and learning
behavior and were indistinguishable from wt mice, none of
the plp / mag / mutants was able to locate
the platform and acquire spatial discrimination in the water maze.
Because of their jerky-like movement of the hindlimbs they were not
able to swim, but drifted on the water surface. That explains their
distinctly reduced swimming speed compared to wt mice (Table
2). None of these mice ever
entered the previous training quadrant during the probe trial.
Locomotor activity of the mutants was measured in the open field test
(Table 3). As expected,
shiverer and triple mutant mice showed a dramatic decrease
in activity compared to plp / and wt mice. The
locomotor activity of mag / and the two double mutants,
plp / mbp / and
plp / mag / , ranged in between these two
groups.
To determine the motor and posture pattern, the following tasks were
applied to challenge mutant mice: clinging to a horizontal wire (Table
6), moving on a horizontal bridge (Table
4), and descending from a vertical pole
(data not shown). The most striking result was that mag /
mice, plp / mag / double and triple mutants did not reach the platform when starting from the middle of the horizontal wire or bridge. In these two tasks a clear gradation between
mutants became apparent: whereas the mag / mutant on the
average dropped off twice during the defined "cutoff" time, plp / mag / double mutant mice fell from the
bridge seven times, and only half of tested triple mutant mice were
able to remain on the bridge. In the vertical pole task the double and
triple mutant mice slid down the pole instead of climbing down in a
coordinate fashion like wild-type mice (data not shown).
Finally, the learning behavior and skill of the mutants was scored on a
rotating rod on 5 subsequent days (Kuhn et al., 1995 ). All mice,
including the heavily affected animals with the shiverer trait, learned to stay on the rod rotating with increasing speed and
improved their skill. The time mice remained on the rod depended significantly on the degree of impairment of their motor coordination. This is illustrated by the record of cumulative falls from the rotating
rod (Table 5). The performance of
plp / mice was comparable to wt mice in this
task, whereas mag / mice exhibited small but significant
differences compared to wt mice. Triple mutant mice are the
most affected genotype in this task. The performance of shiverer and double mutant mice
plp / mbp / and
plp / mag / can be classified as
intermediate between these genotypes, mag / and the plp / mbp / mag / .
Conduction velocity of peripheral nerves of the mutant mice
is unchanged
The impact of the protein deficiency on the conduction velocity of
peripheral nerves was measured by electromyography. Proximal stimulation of the sciatic nerve at the knee and distal close to the
hip was applied. No significant differences in conduction velocities of
peripheral nerves of wt and mutant mice, 4-5 months of age,
were observed. They range between 26.5 and 32 m/sec.
Morphology of mutant CNS myelin structures
The genetic, biochemical, physiological, and behavioral traits of
each phenotype were complemented by extensive morphological studies of
CNS myelin of the different mutants by electron microscopy, which also
depicts schematically these structural changes of the myelin membrane
(Fig. 3). The CNS myelin sheath of
mag / mice showed regular MDLs and IDLs with some subtle
morphological abnormalities, e.g., doubled myelin sheaths, shortened
periaxonal collar, and the appearance of longitudinal channels within
compacted myelin (Li et al., 1994 ; Montag et al., 1994 ). In agreement
with a previous report, we observed no reduced periaxonal spacing
(Montag et al., 1994 ).

View larger version (96K):
[in this window]
[in a new window]
|
Figure 3.
Electron micrographs of cross-sections through the
optic nerves of mag / , double mutant
(mag / plp / ), and triple mutant
(mag / mbp / plp / )
mice. The comparison of the three sections demonstrates the different
types of compaction. The axon of the MAG-deficient mouse is surrounded
by two distinct myelin sheaths with a normal periodicity. Myelin
formation in plp / mag / double
mutant is characterized by a decompaction of the IDL as well as by
condensed areas with indistinguishable main and intraperiod dense
lines. Triple mutants show areas of pseudocompacted myelin around axons
with large diameter. No MDL but a pseudo-IDL formed by the compaction
of outer surfaces is visible. Scale bar, 200 nm.
|
|
Another compaction type of the myelin membrane is dictated by the lack
of the integral membrane protein PLP. Myelin membrane stacks of
plp / and plp / mag / mice are
decompacted in the absence of PLP and DM20 at the
IDL (Boison and Stoffel, 1994 ; Montag et al., 1994 ; Boison et al.,
1995 ). In addition, condensed areas with main and intraperiod dense
lines that are indistinguishable in electron density were observed
(Fig. 3). In plp / mag / double mutant mice
the morphological abnormalities of the mag / and plp / single mutants are accumulated. Most strikingly we
observed in the plp / mag / double mutant an
early onset of axon degeneration around postnatal day 40 (P40),
which starts in the plp / mouse only at later stages of
life (Griffiths et al., 1998 ). An increased number of degenerated axons
of the optic nerve and the ventral funiculus of the spinal cord is seen
in light microscopy of optic nerves of 40-d-old mice, and a massive
axonal degeneration is apparent in P120 mice (Fig.
4).

View larger version (194K):
[in this window]
[in a new window]
|
Figure 4.
A, Semithin cross-sections of the
spinal cord (anterior median fissure) of the indicated genotypes.
Whereas mag / mice are indistinguishable from
wt controls,
plp / mag / double mutants have
comparable amounts of slightly disordered myelin; in
shiverer mice almost no myelin is detectable, whereas in
the triple mutant axons with a larger diameter show myelin sheaths
(asterisks). Note the increased number of
oligodendrocytes in the MBP-deficient animals (mbp /
and
plp / mbp / mag / )
and axonal degeneration in
plp / mag / double mutant mice
(black arrows). Scale bar, 10 µm. B,
Top, Semithin cross-sections of the optic nerve of 40- and 120-d-old plp-/-mag / double
mutant mice. Note the enlarged number of axonal degeneration with
increasing age. Scale bar, 10 µm. Bottom, Electron
micrographs of cross-sections of optic nerve of
plp / mag / double mutant and
plp / mbp / mag /
triple mutant mice (black arrows, axonal degeneration).
Scale bar, 2 µm.
|
|
The three genotypes that we included in this study, the
shiverer , the plp / mbp /
double, and plp / mbp / mag /
triple mutant mice show another type of dysmorphic myelin structure. Hypomyelination of the CNS is the dominant leading symptom in the
shiverer mouse (Chernoff, 1981 ) and is combined with a
remarkable increase of oligodendrocytes in the spinal cord (Nagara et
al., 1983 ) accompanied by the appearance of numerous Schmidt-Lantermann incisures in the PNS (Gould et al., 1995 ). The shiverer
genotype confers this phenotype to the two other mutants. However,
unlike oligodendrocytes of the shiverer mutant that are
nearly unable to enwrap CNS axons, oligodendrocytes of the
plp / mbp / double and the
plp / mbp / mag / triple
mutants spirally surround large-diameter axons as loosely compacted
myelin consisting of only few lamellae (Fig. 4A).
They adhere tightly at their extracytosolic surfaces forming a distinct
electron-dense line of a myelin-like structure with a compacted IDL.
The complete surrounding of an axon by alternately compacted myelin in
the plp / mbp / double and triple mutants is
obviously sufficient to facilitate a normal life span in the plp / mbp / and an extended lifespan in the
plp / mbp / mag / mutant under
laboratory conditions. Addition of the mag / genotype to
the double mutant causes the early onset of axonal degenerations in the
triple mutant mouse, which shortens its life span (Table 7).
 |
DISCUSSION |
Gene targeting by homologous recombination of mutant mouse genes
that replace the wt genes has proven to be a useful tool in the
functional analysis of structural proteins of CNS and PNS myelin. Here
we describe the generation and characterization of two new mutant mouse
lines, a plp / mag /
double mutant and a homozygous triple mutant lacking PLP, MBP, and MAG
(plp / mbp / mag / ). Surprisingly, plp / mag / double mutants, in
contrast to their respective single mutants, showed severe neurological
symptoms with increasing age.
The triple mutant, like the other homozygous
plp / mbp / double mutant, bears a strong
resemblance to shiverer mice. However, the tremor
contributed by the shiverer trait is mild, the first seizures of convulsions occur only infrequently and not before the age
of 3 months, whereas the monogenic shiverer mutant mice developed this phenotype 1 month after birth (Bird et al., 1978 ; Chernoff, 1981 ). The shortened life expectancy of triple mutant mice
(7-9 months) compared to the
plp / mbp / double
mutant (life span, 2 years) obviously derives from the additional
deprivation of MAG in the myelin of these mutants. In view of the
twofold to threefold overexpression of S-MAG in shiverer and
plp / mbp / double
mutants, it is tempting to speculate on a similar role of this MAG
isoform for CNS myelin maintenance because it has been shown for PNS
myelin (Fujita et al., 1998 ). N-CAM on the other hand, which like MAG
is a member of the Ig superfamily, appears not to be involved in this
process, although it has been suggested to substitute for the function
of MAG in the PNS of MAG-deficient mice (Montag et al., 1994 ). The
double mutant deficient in MAG and N-CAM (Carenini et al., 1997 )
supported this with regard to axonal and myelin maintenance, but not
with regard to myelin formation in the PNS. However, in our study
neither the upregulation of the expression of N-CAM120 nor of N-CAM140
was observed in the mutant CNS.
The results of the lipid analysis and the morphological data suggest
that the loss of MBP expression causes an impairment of oligodendrocyte
development. GM3 besides
GD3, and GD1a and GT1b as minor components, appear to play an
important role during the dichotomy of the differentiation of
oligodendrocyte precursors. Addition of exogenous
GM3 to oligodendrocyte precursors in culture increased the number and the thickness of the oligodendrocyte processes
(Yim et al., 1994 , 1995 ). Also the degree of phosphorylation of MBP and
MAG is dependent on GM3.
GM3 increases the phosphorylation of MAG and
simultaneously reduces MBP phosphorylation (Yim et al., 1994 ). This
observation is of special interest in view of our finding that the
gangliosides in CNS myelin of mice with the mbp /
mutation in general were distinctly decreased, and only GM3 was synthesized by oligodendrocytes of these
mutants. Ganglioside GM1 on the other hand is
characteristic for isolated myelin of wild type (Suzuki et al., 1967 )
and is also present in the myelin fraction of all mutants without the
shiverer deletion. Mouse myelin isolated from mutants
carrying the shiverer allele is deficient in
GM1 (Raff et al., 1978 ; Iwamori et al.,
1985 ).
Gangliosides are markers in oligodendrocyte maturation (Raff et al.,
1978 ; Yim et al., 1994 ). The ganglioside pattern of myelin of the
mutants with the shiverer trait might express a state in the
maturation of oligodendrocyte precursor cells. The
plp / mbp / and
plp / mbp / mag / triple
mutants might be useful models for studies of oligodendrocyte
development and maturation.
The array and the results of behavioral tests performed in this study
contribute significantly to the characterization of the different
phenotypes of the mutants. This becomes most obvious by the analysis of
the rather inconspicuous behavior of the mutants containing the
mag / allele. In the behavioral tests selected in this
study, these mice showed a surprisingly poor performance. Although
behavioral tests that require motor and reflex responses are known to
significantly decline with age (Wallace et al., 1980 ), and therefore
age differences might explain the differences in locomotor activity
between our findings and a previous report (Li et al., 1994 ), this
effect obviously is caused by the MAG depletion. This suggestion is
supported by other behavioral tests because mutants with the
mag / genotype are affected when they crossed the
horizontal bridge during the defined "cutoff" time. Plp / mag / mice were hardly able to cling
to the horizontal wire because of their motor deficits.
Axonal degeneration is missing in the CNS of mag / single
mutants. The early onset and rapidly progressing axonal degeneration in
CNS of plp / mag / double mutant is
demonstrated in electron microscopy of p40 and p120 optic nerves. It
parallels the first signs and the progression of the neurological
symptoms of this double mutant. This again suggests an important role
of MAG in maintaining the integrity of CNS axons similar to the
function of MAG in PNS myelin (Fruttiger et al., 1995 ; Yin et al.,
1998 ). The detrimental effect of MAG deficiency on axons occurs only in
the plp / mag / double mutant.
A recent report discusses the function of a neuron expressed sr
(soma-restricted) PLP in the maintenance of axons (Bongarzone et al.,
1999 ). SrPLP is an alternative splice product of PLP. Exon 1 of srPLP
codes for a signal sequence of 11 amino acid residues that resemble
strong homology with ER retention signal sequences. The lack of the
minor PLP splice product (2%) of PLP/DM20 is
thought to cause the late onset of axonal degeneration in the CNS of
the plp / mouse. However, we regard the contribution of
srPLP to axonal degeneration as minute compared with the MAG deficiency in the plp / mag / double mutant. The
additional load of the mag / genotype induces
dramatically axonal degeneration.
The results reported here strongly suggest that an imbalance of PLP and
MBP in favor of PLP in the CNS may downregulate myelin synthesis in
oligodendrocytes, because the shiverer phenotype is
ameliorated in plp / mbp / and
plp / mbp / mag / triple mutant mice. This idea is supported by the phenotype of transgenic mice showing different PLP gene dosage effects, e.g., PLP or
DM20 overexpression (Kagawa et al., 1994 ;
Readhead et al., 1994 ; Johnson et al., 1995 ).
Plp / mag / double mutant animals and triple
mutant mice lacking two and three important constituents of CNS myelin,
respectively, might be valuable models for further studies on how
oligodendrocytes function during the assembly of this highly ordered
membrane structure. The generation and analysis of these two new
mutants strongly indicates the cooperative functions of MAG and PLP in
maintaining axon integrity in the CNS.
As a perspective, the double and triple mutants are promising models
for stem cell biology and therapy. The recent development in the field
of totipotent embryonic and stem cell-derived glial precursor cells and
their prospective use as source of cell type-specific somatic
precursors for neural implantation has promising perspectives also for
efficient myelination and remyelination of axons in CNS. The md rat
characterized by a point mutation in exon III of the PLP gene (Thr75 to
Pro) (Boison and Stoffel, 1989 ) and the shaking pup (His36 to Pro) are
preferred dysmyelinosis models in transplantation studies (Archer et
al., 1997 ; Brustle et al., 1999 ). The two models suffer from the short
viability of these mutants. The mouse models described and
characterized here genetically, biochemically, morphologically, and
behaviorally have a considerably longer life span, which recommends them as valuable tools for the long-term evaluation of stem cell therapeutic strategies.
 |
FOOTNOTES |
Received March 20, 2000; revised April 20, 2000; accepted April 26, 2000.
This work was supported by the Deutsche Forschungsgemeinschaft, SFB
243, the Bundesministerium für Wissenschaft, Forschung und
Technologie, 01KS 9502, and the European Community contract BMH 4CT
96-0990. W.S. is responsible for the content of this publication. The
mag / mouse line was kindly supplied by Dr. B. Trapp, (Cleveland Clinic Foundation, Cleveland, OH).
Correspondence should be addressed to Wilhelm Stoffel, Laboratory for
Molecular Neuroscience, Institute of Biochemistry, Faculty of Medicine,
University of Cologne, Joseph-Stelzmann-Strasse 52, D-50931 Cologne,
Germany. E-mail: Wilhelm.Stoffel{at}uni-koeln.de.
 |
REFERENCES |
-
Archer DR,
Cuddon PA,
Lipsitz D,
Duncan LD
(1997)
Myelination of the canine central nervous system by glial cell transplantation: a model for repair of human myelin disease.
Nat Med
3:54-59[Web of Science][Medline].
-
Arquint M,
Roder J,
Chia LS,
Down J,
Wilkinson D,
Bayley H,
Braun P,
Dunn R
(1987)
Molecular cloning and primary structure of myelin-associated glycoprotein.
Proc Natl Acad Sci USA
84:600-604[Abstract/Free Full Text].
-
Bird TD,
Farrell DF,
Sumi SM
(1978)
Brain lipid composition of the shiverer mouse: (genetic defect in myelin development).
J Neurochem
31:387-391[Web of Science][Medline].
-
Bligh E,
Dyer W
(1959)
A rapid method of total lipid extraction and purification.
Can J Biochem Physiol
37:911-917.
-
Boison D,
Stoffel W
(1989)
Myelin-deficient rat: a point mutation in exon III (A
-C, Thr75 -Pro) of the myelin proteolipid protein causes dysmyelination and oligodendrocyte death.
EMBO J
8:3295-302[Web of Science][Medline]. -
Boison D,
Stoffel W
(1994)
Disruption of the compacted myelin sheath of axons of the central nervous system in proteolipid protein-deficient mice.
Proc Natl Acad Sci USA
91:11709-11713[Abstract/Free Full Text].
-
Boison D,
Büssow H,
D'Urso D,
Muller HW,
Stoffel W
(1995)
Adhesive properties of proteolipid protein are responsible for the compaction of CNS myelin sheaths.
J Neurosci
15:5502-5513[Abstract].
-
Bongarzone ER,
Campagnoni CW,
Kampf K,
Jacobs EC,
Handley VW,
Schonmann V,
Campagnoni AT
(1999)
Identification of a new exon in the myelin proteolipid protein gene encoding novel protein isoforms that are restricted to the somata of oligodendrocytes and neurons [In Process Citation].
J Neurosci
19:8349-8357[Abstract/Free Full Text].
-
Brustle O,
Jones KN,
Learish RD,
Karram K,
Choudhary K,
Wiestler OD,
Duncan ID,
McKay RD
(1999)
Embryonic stem cell-derived glial precursors: a source of myelinating transplants [see comments].
Science
285:754-756[Abstract/Free Full Text].
-
Büssow H
(1978)
Schwann cell myelin ensheathing CNS axons in the nerve fibre layer of the cat retina.
J Neurocytol
7:207-214[Web of Science][Medline].
-
Cammer W,
Kahn S,
Zimmerman T
(1984)
Biochemical abnormalities in spinal cord myelin and CNS homogenates in heterozygotes affected by the shiverer mutation.
J Neurochem
42:1372-1378[Web of Science][Medline].
-
Carenini S,
Montag D,
Cremer H,
Schachner M,
Martini R
(1997)
Absence of the myelin-associated glycoprotein (MAG) and the neural cell adhesion molecule (N-CAM) interferes with the maintenance, but not with the formation of peripheral myelin.
Cell Tissue Res
287:3-9[Web of Science][Medline].
-
Chernoff GF
(1981)
Shiverer: an autosomal recessive mutant mouse with myelin deficiency.
J Hered
72:128[Abstract/Free Full Text].
-
Chomczynski P,
Sacchi N
(1987)
Single-step method of RNA isolation by acid guanidinium thiocyanate- phenol-chloroform extraction.
Anal Biochem
162:156-159[Web of Science][Medline].
-
Fruttiger M,
Montag D,
Schachner M,
Martini R
(1995)
Crucial role for the myelin-associated glycoprotein in the maintenance of axon-myelin integrity.
Eur J Neurosci
7:511-515[Web of Science][Medline].
-
Fujita N,
Kemper A,
Dupree J,
Nakayasu H,
Bartsch U,
Schachner M,
Maeda N,
Suzuki K,
Popko B
(1998)
The cytoplasmic domain of the large myelin-associated glycoprotein isoform is needed for proper CNS but not peripheral nervous system myelination.
J Neurosci
18:1970-1978[Abstract/Free Full Text].
-
Gould RM,
Byrd AL,
Barbarese E
(1995)
The number of Schmidt-Lanterman incisures is more than doubled in shiverer PNS myelin sheaths.
J Neurocytol
24:85-98[Web of Science][Medline].
-
Griffiths I,
Klugmann M,
Anderson T,
Yool D,
Thomson C,
Schwab MH,
Schneider A,
Zimmermann F,
McCulloch M,
Nadon N,
Nave KA
(1998)
Axonal swellings and degeneration in mice lacking the major proteolipid of myelin.
Science
280:1610-1613[Abstract/Free Full Text].
-
Inuzuka T,
Fujita N,
Sato S,
Baba H,
Nakano R,
Ishiguro H,
Miyatake T
(1991)
Expression of the large myelin-associated glycoprotein isoform during the development in the mouse peripheral nervous system.
Brain Res
562:173-175[Web of Science][Medline].
-
Iwamori M,
Harpin ML,
Lachapelle F,
Baumann N
(1985)
Brain gangliosides of quaking and shiverer mutants: qualitative and quantitative changes of monosialogangliosides in the quaking brain.
J Neurochem
45:73-78[Web of Science][Medline].
-
Johnson RS,
Roder JC,
Riordan JR
(1995)
Over-expression of the DM-20 myelin proteolipid causes central nervous system demyelination in transgenic mice.
J Neurochem
64:967-976[Web of Science][Medline].
-
Kagawa T,
Ikenaka K,
Inoue Y,
Kuriyama S,
Tsujii T,
Nakao J,
Nakajima K,
Aruga J,
Okano H,
Mikoshiba K
(1994)
Glial cell degeneration and hypomyelination caused by overexpression of myelin proteolipid protein gene.
Neuron
13:427-442[Web of Science][Medline].
-
Klapdor K,
van der Staay FJ
(1996)
The Morris water-escape task in mice: strain differences and effects of intra-maze contrast and brightness.
Physiol Behav
60:1247-1254[Medline].
-
Klapdor K,
van der Staay FJ
(1998)
Repeated acquisition of a spatial navigation task in mice: effects of spacing of trials and of unilateral middle cerebral artery occlusion.
Physiol Behav
63:903-909[Medline].
-
Klugmann M,
Schwab MH,
Puhlhofer A,
Schneider A,
Zimmermann F,
Griffiths IR,
Nave KA
(1997)
Assembly of CNS myelin in the absence of proteolipid protein.
Neuron
18:59-70[Web of Science][Medline].
-
Kuhn PL,
Petroulakis E,
Zazanis GA,
McKinnon RD
(1995)
Motor function analysis of myelin mutant mice using a rotarod.
Int J Dev Neurosci
13:715-722[Web of Science][Medline].
-
Lai C,
Brow MA,
Nave KA,
Noronha AB,
Quarles RH,
Bloom FE,
Milner RJ,
Sutcliffe JG
(1987)
Two forms of 1B236/myelin-associated glycoprotein, a cell adhesion molecule for postnatal neural development, are produced by alternative splicing.
Proc Natl Acad Sci USA
84:4337-4341[Abstract/Free Full Text].
-
Lees M,
Brostoff SW
(1984)
In: Proteins of myelin. New York: Plenum.
-
Li C,
Tropak MB,
Gerlai R,
Clapoff S,
Abramow-Newerly W,
Trapp B,
Peterson A,
Roder J
(1994)
Myelination in the absence of myelin-associated glycoprotein.
Nature
369:747-750[Medline].
-
Molineaux SM,
Engh H,
de Ferra F,
Hudson L,
Lazzarini RA
(1986)
Recombination within the myelin basic protein gene created the dysmyelinating shiverer mouse mutation.
Proc Natl Acad Sci USA
83:7542-7546[Abstract/Free Full Text].
-
Montag D,
Giese KP,
Bartsch U,
Martini R,
Lang Y,
Bluthmann H,
Karthigasan J,
Kirschner DA,
Wintergerst ES,
Nave KA
(1994)
Mice deficient for the myelin-associated glycoprotein show subtle abnormalities in myelin.
Neuron
13:229-246[Web of Science][Medline].
-
Morris R
(1984)
Developments of a water-maze procedure for studying spatial learning in the rat.
J Neurosci Methods
11:47-60[Web of Science][Medline].
-
Nagara H,
Suzuki K,
Tateishi J
(1983)
Radial component of central myelin in shiverer mouse.
Brain Res
263:336-339[Web of Science][Medline].
-
Nave KA,
Lai C,
Bloom FE,
Milner RJ
(1986)
Jimpy mutant mouse: a 74-base deletion in the mRNA for myelin proteolipid protein and evidence for a primary defect in RNA splicing.
Proc Natl Acad Sci USA
83:9264-9268[Abstract/Free Full Text].
-
Norton WT,
Poduslo SE
(1973)
Myelination in rat brain: method of myelin isolation.
J Neurochem
21:749-757[Web of Science][Medline].
-
Omlin FX,
Webster HD,
Palkovits CG,
Cohen SR
(1982)
Immunocytochemical localization of basic protein in major dense line regions of central and peripheral myelin.
J Cell Biol
95:242-248[Abstract/Free Full Text].
-
Pedraza L,
Frey AB,
Hempstead BL,
Colman DR,
Salzer JL
(1991)
Differential expression of MAG isoforms during development.
J Neurosci Res
29:141-148[Web of Science][Medline].
-
Raff MC,
Mirsky R,
Fields KL,
Lisak RP,
Dorfman SH,
Silberberg DH,
Gregson NA,
Leibowitz S,
Kennedy MC
(1978)
Galactocerebroside is a specific cell-surface antigenic marker for oligodendrocytes in culture.
Nature
274:813-816[Medline].
-
Readhead C,
Schneider A,
Griffiths I,
Nave KA
(1994)
Premature arrest of myelin formation in transgenic mice with increased proteolipid protein gene dosage.
Neuron
12:583-595[Web of Science][Medline].
-
Roach A,
Takahashi N,
Pravtcheva D,
Ruddle F,
Hood L
(1985)
Chromosomal mapping of mouse myelin basic protein gene and structure and transcription of the partially deleted gene in shiverer mutant mice.
Cell
42:149-155[Web of Science][Medline].
-
Rosenbluth J
(1980)
Peripheral myelin in the mouse mutant Shiverer.
J Comp Neurol
193:729-739[Web of Science][Medline].
-
Schneider A,
Montague P,
Griffiths I,
Fanarraga M,
Kennedy P,
Brophy P,
Nave KA
(1992)
Uncoupling of hypomyelination and glial cell death by a mutation in the proteolipid protein gene.
Nature
358:758-761[Medline].
-
Schulte S,
Stoffel W
(1993)
Ceramide UDPgalactosyltransferase from myelinating rat brain: purification, cloning, and expression.
Proc Natl Acad Sci USA
90:10265-10269[Abstract/Free Full Text].
-
Stoffel W,
Hillen H,
Giersiefen H
(1984)
Structure and molecular arrangement of proteolipid protein of central nervous system myelin.
Proc Natl Acad Sci USA
81:5012-5016[Abstract/Free Full Text].
-
Stoffel W,
Boison D,
Bussow H
(1997)
Functional analysis in vivo of the double mutant mouse deficient in both proteolipid protein (PLP) and myelin basic protein (MBP) in the central nervous system.
Cell Tissue Res
289:195-206[Web of Science][Medline].
-
Suzuki K,
Poduslo SE,
Norton WT
(1967)
Gangliosides in the myelin fraction of developing rats.
Biochim Biophys Acta
144:375-381[Medline].
-
Towbin H,
Staehelin T,
Gordon J
(1979)
Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.
Proc Natl Acad Sci USA
76:4350-4354[Abstract/Free Full Text].
-
Trapp BD
(1990)
Myelin-associated glycoprotein. Location and potential functions.
Ann NY Acad Sci
605:29-43[Web of Science][Medline].
-
Tropak MB,
Johnson PW,
Dunn RJ,
Roder JC
(1988)
Differential splicing of MAG transcripts during CNS and PNS development.
Brain Res
464:143-155[Medline].
-
Wallace JE,
Krauter EE,
Campbell BA
(1980)
Motor and reflexive behavior in the aging rat.
J Gerontol
35:364-370[Abstract].
-
Weimbs T,
Stoffel W
(1992)
Proteolipid protein (PLP) of CNS myelin: positions of free, disulfide- bonded, and fatty acid thioester-linked cysteine residues and implications for the membrane topology of PLP
Biochemistry
31:12289-12296[Medline].
-
Yim SH,
Farrer RG,
Hammer JA,
Yavin E,
Quarles RH
(1994)
Differentiation of oligodendrocytes cultured from developing rat brain is enhanced by exogenous GM3 ganglioside.
J Neurosci Res
38:268-281[Web of Science][Medline].
-
Yim SH,
Farrer RG,
Quarles RH
(1995)
Expression of glycolipids and myelin-associated glycoprotein during the differentiation of oligodendrocytes: comparison of the CG-4 glial cell line to primary cultures.
Dev Neurosci
17:171-180[Web of Science][Medline].
-
Yin X,
Crawford TO,
Griffin JW,
Tu P,
Lee VM,
Li C,
Roder J,
Trapp BD
(1998)
Myelin-associated glycoprotein is a myelin signal that modulates the caliber of myelinated axons.
J Neurosci
18:1953-1962[Abstract/Free Full Text].
Copyright © 2000 Society for Neuroscience 0270-6474/00/20145225-09$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
G. Veit, B. Kobbe, D. R. Keene, M. Paulsson, M. Koch, and R. Wagener
Collagen XXVIII, a Novel von Willebrand Factor A Domain-containing Protein with Many Imperfections in the Collagenous Domain
J. Biol. Chem.,
February 10, 2006;
281(6):
3494 - 3504.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Jalabi, N. Boehm, D. Grucker, and M. S. Ghandour
Recovery of Myelin after Induction of Oligodendrocyte Cell Death in Postnatal Brain
J. Neurosci.,
March 16, 2005;
25(11):
2885 - 2894.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|