 |
Previous Article | Next Article 
The Journal of Neuroscience, July 15, 2000, 20(14):5339-5345
Bax Inactivation in Lurcher Mutants Rescues
Cerebellar Granule Cells But Not Purkinje Cells or Inferior Olivary
Neurons
Fekrije
Selimi1,
Michael W.
Vogel2, and
Jean
Mariani1
1 Laboratoire Développement et Vieillissement du
Système Nerveux, Institut des Neurosciences, Centre National de
la Recherche Scientifique, Unité Mixte de Recherche 7624, Université Pierre et Marie Curie, 75005 Paris, France, and
2 Maryland Psychiatric Research Center, University of
Maryland Medical School, Baltimore, Maryland 21228
 |
ABSTRACT |
Lurcher is a gain-of-function mutation in the 2 glutamate
receptor gene (Grid2) that turns the receptor into a
leaky ion channel. The expression of the Lurcher gene in heterozygous
(Grid2Lc/+) mutants induces the death of
almost all Purkinje cells starting from the second postnatal week.
Ninety percent of the granule cells and 60-75% of the inferior
olivary neurons die because of the loss of their target neurons, the
Purkinje cells. The apoptotic nature of the neurodegeneration has been
demonstrated previously by the presence of activated caspase-3 and DNA
fragmentation. Bax, a pro-apoptotic gene of the Bcl-2
family, has been shown to be involved in developmental neuronal death.
To study the role of Bax in
Grid2Lc/+ neurodegeneration, double mutants
with Grid2Lc/+ mice and Bax
knock-out mice (Bax / ) were generated.
Bax deletion had no effect on the death of Purkinje
cells and inferior olivary neurons, although a temporary rescue of some
Purkinje cells could be detected in P15
Grid2Lc/+;Bax / animals. From postnatal
day 15 (P15) to P60, the number of granule cells in
Grid2Lc/+;Bax / mice did not significantly
change and was significantly increased compared with the number found
in Grid2Lc/+;Bax+/+ mice. Granule cell
number in P60 Grid2Lc/+;Bax / mice
corresponded to 70% of the number found in wild-type mice. Our results
show that Bax inactivation in
Grid2Lc/+ mice does not rescue intrinsic
Purkinje cell death or the target-related cell death of olivary
neurons, but Bax inactivation does inhibit persistently
target-related cell death in cerebellar granule cells.
Key words:
Lurcher; Bax; Purkinje cell; granule cell; inferior olive; neuronal death
 |
INTRODUCTION |
The heterozygous Lurcher mutant
(Grid2Lc/+) has been studied extensively as
a model for understanding the mechanisms of cell autonomous and
target-related neuronal cell degeneration. In the
Grid2Lc/+ mutant, almost all
cerebellar Purkinje cells (PCs), 60-75% of the olivary
neurons, and 90% of the granule cells degenerate starting after the
first week of postnatal development (Phillips, 1960 ; Caddy and Biscoe,
1979 ). Studies of Grid2Lc/+ wild
type chimeras established that
Grid2Lc/+ Purkinje cell death is cell
autonomous, whereas granule cell and olivary neuron cell death is
secondary to the loss of their primary target, the Purkinje cells
(Wetts and Herrup, 1982a ,b ). More recent molecular studies have
established that the Lurcher mutation is caused by a base pair change
in the 2 glutamate receptor gene (Grid2) that greatly
increases its conductance (Zuo et al., 1997 ). Given the nature of
Grid2 gene mutation, it appears likely that
Grid2Lc/+ Purkinje cells are dying by an
excitotoxic mechanism. The molecular mechanisms of
Grid2Lc/+ Purkinje cell death have not yet
been determined. However, the presence of activated caspase-3 and
terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling
(TUNEL) in dying Purkinje cells, granule cells, and olivary
neurons of Lurcher mice suggest that these neuronal deaths are
apoptotic (Norman et al., 1995 ; Wullner et al., 1995 ; Selimi et al.,
2000 ).
The purpose of this study was to determine the effects of deleting the
pro-apoptotic gene Bax on Purkinje, granule, and olivary neuron survival in the Grid2Lc/+
mutant. We have shown previously that
Grid2Lc/+ Purkinje cell death can be
delayed and Grid2Lc/+ olivary neurons
rescued by the overexpression of the anti-apoptotic gene
bcl-2 (Zanjani et al., 1998a ,b ). The bcl-2
proto-oncogene encodes an integral membrane protein that inhibits
apoptosis in many cell types, although its mechanism of action is still
not completely understood (Adams and Cory, 1998 ). One important
function of BCL-2 may be to counteract the pro-apoptotic effects of BAX (Gross et al., 1999 ). BCL-2 will bind to BAX, and cell death may be
regulated by the ratio of BCL-2 to BAX (Oltvai et al., 1993 ). BAX is
involved in developmental cell death because deletion of the
Bax gene reduces the incidence of naturally occurring
neuronal death in vivo (White et al., 1998 ).
Bax / neurons also survive trophic factor withdrawal
in vitro or after in vivo axotomy (Deckwerth et
al., 1996 ). The results of our study show that deletion of Bax in the Grid2Lc/+ mutant
does not prevent the excitotoxic Purkinje cell death or the
target-related olivary neuron death. However, Bax
inactivation increases survival of granule cells, supporting a role for
BAX in target-related cell death of granule cells. The dichotomy
between granule cell rescue and olivary neuron death in the
Grid2Lc/+;Bax / mutant suggests
that different cell death mechanisms are at work, even in two neuronal
populations that are dying because of the loss of the same target.
 |
MATERIALS AND METHODS |
Animals and genotyping.
Grid2Lc/+;Bax / double
mutants were generated by heterozygous matings of
Grid2Lc/+ and Bax+/
mutants in the animal facilities at the Université Pierre et
Marie Curie. Grid2Lc/+ mutants
(B6AKR strain) are maintained in a colony at the Université Pierre et Marie Curie, and heterozygous Bax+/ mutants were
obtained from Dr. Stanley Korsmeyer (Harvard Medical School, Boston,
MA). The Bax / knock-out mutant was generated by
homologous recombination to delete exons 2 through 5 to make a
nonfunctional protein (C57BL6/RW-4 strain) (Knudson et al., 1995 ). In
the mating scheme to generate homozygous and heterozygous double
mutants, Grid2Lc/+ males were first mated
with Bax heterozygous knock-out females. The
Grid2Lc/+;Bax+/ animals were then
intercrossed. Litters were killed at postnatal day 15 (P15), P30, and
P60, using the guidelines established by Le Comité National
d'Éthique pour les Sciences de la Vie et de la Santé. The
Grid2Lc/+;Bax+/ and
Grid2Lc/+;Bax+/+ control animals
used in this study were obtained in the same litters as the double mutants.
Genotyping for Bax was performed by PCR using a set of three
primers: Bax exon 5 forward primer
(5'GAGCTGATCAGAACCATCATG3'), Bax intron 5 reverse primer
(5'GTTGACCAGAGTGGCGTAGG3'), and Neo reverse primer
(5'CCGCTTCCATTGCTCAGCGG3'). Cycling parameters were 5 min at 94°C for
one cycle, 1 min at 94°C, 1 min at 62°C, and 1 min 30 at 72°C for
a total of 30 cycles. PCR products were resolved on a 1.5% agarose gel.
The Grid2Lc allele was detected by PCR
followed by single strand chain Polymorphism (SSCP) as described
previously (Zuo et al., 1997 ). Briefly, 200 ng of genomic DNA were used
for a PCR with the two following primers: 5'TAAAAGCATATTGATGTTGTTG3'
and 5'CAGCATTTGTCAGGTTTGGTGAC3'. Cycling parameters were 2 min at
94°C for one cycle, 1 min at 94°C, 1 min at 60°C, and 1 min at
72°C for a total of 30 cycles. PCR products were resolved by SSCP
using GeneGel Excel 12.5/24 Kit (Amersham Pharmacia Biotech,
Uppsala, Sweden) and revealed by silver staining of the gel.
Histology. Animals were anesthetized using 0.1 mg/ml chloral
hydrate and perfused with 0.9% sodium chloride, followed by 95% ethanol. Brains were dissected, fixed overnight in Clarke's fixative, and processed for paraffin-embedding.
Parasagittal sections (10-µm-thick) of the cerebellum were processed
for calbindin immunohistochemistry. Sections were incubated overnight
at 4°C with CL-300 monoclonal antibody (dilution, 1:200; Sigma, St.
Louis MO). Immunocomplexes were revealed using a peroxidase-conjugated anti-mouse antibody (dilution, 1:500; Jackson ImmunoResearch, West
Grove, PA) and diaminobenzidine tetrahydrochloride substrate (DAB
Sigmafast; Sigma). Sections were then counterstained with cresyl
violet-thionin.
Coronal sections (10-µm-thick) of the brainstem were stained with
cresyl violet-thionin to locate the inferior olive and analyze its
morphology. Sections from 10 different rostrocaudal levels of the
inferior olive were observed in each animal to compare the morphology
of all the subnuclei of the olive.
Quantitative analysis. The total numbers of Purkinje cells
and granule cells per half-cerebellum were counted in mutant and control cerebella. Cerebellar sections were stained for calbindin immunohistochemistry, and the number of calbindin-positive Purkinje cells was counted in each 40th section at 1000× magnification. The
total number of Purkinje cells was calculated from a graph of the
number of Purkinje cells in each counted section plotted against the
distance of the section from the midline. Corrections were made
for double counting Purkinje cells based on the method of Hendry
(1976) . We chose to use this traditional correction factor for our cell
counts instead of more recently developed stereological techniques so
that our results would be directly comparable with previously published
counts. The total number of granule cells per half-cerebellum was
estimated from the volume of the internal granule cell layer (IGL)
multiplied by the average density of granule cells in the IGL. The
granule cell density was estimated by counting at 1000× magnification
the number of granule cells contained in an area of 25000 µm3. These counts were done in six
different regions in four sections from each half-cerebellum. Thus, the
number of granule cells in 24 grids were counted to obtain the average
density of granule cells. The volume of the IGL was calculated from a
graph of granule cell layer area plotted against distance from the
midline. The area of the IGL in each 40th section was measured using a
CCD camera and NIH Image software. Corrections for double counting errors were made using the methods of Hendry (1976) . Three to five
animals of each genotype were used at each age: at P15, three animals
of each genotype; at P30, four
Grid2Lc/+;Bax+/+, four
Grid2Lc/+;Bax+/ , and five
Grid2Lc/+;Bax / ; at P60, three
Grid2Lc/+;Bax+/+ and four
Grid2Lc/+;Bax / . Statistical
comparisons were made using ANOVA followed by Newman-Keuls post
hoc test (significant when p < 0.05).
 |
RESULTS |
Bax deletion does not rescue the
Lurcher phenotype
Lurcher heterozygous (Grid2Lc/+) mice
were crossed with Bax knock-out (Bax / ) mice to determine
whether Bax inactivation rescued the Lurcher phenotype.
Lurcher homozygotes were never found in the litters, suggesting that
Bax deletion does not rescue the Lurcher homozygotes and is
not sufficient to inhibit the death of brainstem neurons in these
animals. The
Grid2Lc/+;Bax / mice
were ataxic as the
Grid2Lc/+;Bax+/+ controls.
However, the volume of their cerebellum was greater than that of
Grid2Lc/+;Bax+/+ mice,
suggesting that Bax deletion does rescue some of the cells
normally degenerating in Lurcher mice.
Bax deletion inhibits granule cell death in
Lurcher mice
Purkinje cell death in Grid2Lc/+
mice begins at approximately P8, and this neurodegeneration is
accompanied by the loss of 90% of the granule cells. By P30, 90% of
Purkinje cells have already disappeared (Caddy and Biscoe, 1979 ), as
well as ~85% of granule cells (Doughty et al., 1999 ).
A qualitative observation of cerebellar sections taken from P30 animals
showed that Bax deletion in
Grid2Lc/+ mice inhibited granule cell
but not Purkinje cell death. Immunohistochemistry using an
anti-calbindin antibody to specifically stain Purkinje cells in the
cerebellum showed that almost all Purkinje cells had degenerated in
Grid2Lc/+;Bax+/+ controls
(Fig. 1A) and
Grid2Lc/+;Bax / double
mutants (Fig. 1B) by P30. The morphology of
Grid2Lc/+;Bax+/
cerebella (data not shown) was similar to
Grid2Lc/+;Bax+/+
cerebella. Only a few Purkinje cells remained in P30 animals of all
three genotypes, primarily in one lobule of the cerebellum, the
nodulus. The morphology of Purkinje cells in
Grid2Lc/+;Bax / double
mutants (Fig. 1D) and
Grid2Lc/+;Bax+/
cerebella was identical to the morphology of Purkinje cells in
Grid2Lc/+;Bax+/+ control
cerebellum (Fig. 1C). The dendrites of these cells were
atrophic, thicker, and less branched than in normal mice as described
previously (Dumesnil-Bousez and Sotelo, 1992 ; Doughty et al., 1999 ).
Quantitative analysis of the number of Purkinje cells per
hemi-cerebellum at P30 showed that there was no significant difference
between the numbers of Purkinje cells found in
Grid2Lc/+;Bax+/
(3208 ± 723) and
Grid2Lc/+;Bax+/+
(3162 ± 298) control mice. The number of Purkinje cells in
Grid2Lc/+;Bax / double
mutants (6364 ± 520) was very low, confirming that Bax
inactivation does not rescue Purkinje cells. However, this number was
significantly higher than the number found in
Grid2Lc/+; Bax+/ and
Grid2Lc/+;Bax+/+ mice,
suggesting that Bax inactivation might delay Lurcher Purkinje cell
death (see Fig. 4A).

View larger version (159K):
[in this window]
[in a new window]
|
Figure 1.
Bax inactivation in
Lurcher mice rescues granule cells but not Purkinje cells. Midsagittal
cerebellar sections (10-µm-thick) of 1-month-old animals were
immunostained using an anti-calbindin antibody specifically labeling
Purkinje cells and counterstained with cresyl violet-thionin. In
Grid2Lc/+; Bax+/+
control mice (A), a massive loss of Purkinje
cells and granule cells is detected. Purkinje cells have degenerated as
well in Grid2Lc/+;
Bax / double mutant mice (B), but an
increased number of cresyl violet-stained granule cells are observed.
Purkinje cells are atrophic with thicker dendrites in both
Grid2Lc/+; Bax+/+
control (C) and
Grid2Lc/+;Bax /
(D) double mutant mice.
|
|
Nuclear staining of the P30 sections using cresyl violet-thionin showed
a clear increase of the area of the internal granule cell layer in
double mutant cerebella when compared with
Grid2Lc/+;Bax+/+ and
Grid2Lc/+;Bax+/ control
cerebella. The number of granule cells per hemi-cerebellum was
significantly higher in
Grid2Lc/+;Bax /
cerebella (10.80 ± 0.78 × 106)
compared with
Grid2Lc/+;Bax+/+
(3.16 ± 0.35 × 106) and
Grid2Lc/+;Bax+/
(2.87 ± 0.13 106) cerebella
(see Fig. 4B; ANOVA followed by post hoc Newman-Keuls test
analysis, p < 0.01), confirming that Bax
inactivation in Grid2Lc/+ mice
rescues granule cells. The number of granule cells per hemi-cerebellum of Grid2Lc/+;Bax+/
animals was not statistically different from the number of granule
cells found in
Grid2Lc/+;Bax+/+ animals,
showing that inactivation of only one allele of Bax is not
sufficient to inhibit cell death in
Grid2Lc/+ mice.
Sixty to 75% of the inferior olivary neurons normally degenerate in
Grid2Lc/+ mice following the death of
their Purkinje cell targets (Caddy et al., 1979 ; Heckroth et al., 1991 ;
Herrup et al., 1996 ). Fifty-four percent of these neurons have
disappeared by P26 (Caddy and Biscoe, 1979 ). To determine whether
Bax deletion was able to rescue the target-related cell
death of olivary neurons in Lurcher mice, we analyzed the morphology of
the inferior olive in P30
Grid2Lc/+;Bax / double
mutant animals. Coronal sections of the brainstem from 10 different
rostrocaudal levels of the inferior olive were stained with cresyl
violet-thionin. No obvious difference was detected between the inferior
olive of
Grid2Lc/+;Bax / double
mutant and
Grid2Lc/+;Bax+/+ control
mice (Fig.
2B,C).
A massive loss of olivary neurons was observed in all the subnuclei of
the inferior olive in both Grid2Lc/+;Bax / double
mutants and
Grid2Lc/+;Bax+/+ control
mice when compared with the inferior olive of a wild-type mouse (Fig.
2A). The rostrocaudal extension of the inferior olive
was ~1100 µm in both
Grid2Lc/+;Bax / double
mutant and
Grid2Lc/+;Bax+/+ control
mice. This value is reduced compared with the wild-type one in
accordance with the results of Heckroth and Eisenman (1991) . This
result suggests that Bax inactivation does not inhibit the
target-related cell death of inferior olivary neurons occurring in
Grid2Lc/+ mice.

View larger version (79K):
[in this window]
[in a new window]
|
Figure 2.
Neurodegeneration in the inferior olive of Lurcher
mice is not inhibited by Bax inactivation. Coronal
sections (10-µm-thick) of the brainstem were stained using cresyl
violet-thionin. Comparison of the inferior olive in wild-type mice
(A, delineated by a dotted line) and
Grid2Lc/+; Bax+/+
(B) control mice shows a massive degeneration
of neurons in the mutant. This neurodegeneration is also observed
in Grid2Lc/+;Bax / double
mutants (C) and makes the subnuclei of
the inferior olive hardly recognizable in contrast to wild-type.
|
|
The results of the double Grid2Lc/+
and Bax / cross at P30 show that Bax
inactivation in Lurcher mice inhibits target-related granule cell death
but not the target-related death of inferior olivary neurons or
intrinsic Purkinje cell death.
Purkinje cell death is temporarily delayed by Bax
inactivation in Lurcher mice
Cerebellar sections from P15 mice were analyzed to look for an
early effect of Bax inactivation on Lurcher Purkinje cell
death. At P15, numerous Purkinje cells were still present in
Grid2Lc/+;Bax+/+ control and
Grid2Lc/+;Bax / double mutant mice
(Fig. 3). The presence of gaps in the Purkinje cell layer showed that Purkinje cell degeneration has already
begun at this age in animals of both genotypes (Fig.
3A,C), in concordance with the
observation that progressive neurodegeneration begins at approximately
P8. Quantification of the Purkinje cell number per hemi-cerebellum
(Fig. 4A) showed that
their number was significantly higher in
Grid2Lc/+;Bax / double
mutant cerebella (62,680 ± 2152) compared with Grid2Lc/+;Bax+/+ cerebella
(45,261 ± 1813; ANOVA followed by post hoc
Newman-Keuls test analysis, p < 0.05). The analysis
of the laterolateral distribution of Purkinje cells in both
Grid2Lc/+;Bax / and
Grid2Lc/+;Bax+/+ cerebella
showed that the number of Purkinje cells was increased throughout all
the regions of the cerebellum in double mutants, indicating that Bax
inactivation does not rescue a particular subpopulation of Purkinje
cells (Fig. 4C). The number of granule cells in
Grid2Lc/+;Bax /
animals was already significantly higher than in
Grid2Lc/+;Bax+/+ mice
(9.09 ± 0.38 ×106 vs 6.50 ± 0.06 × 106, respectively; ANOVA,
followed by post hoc Newman-Keuls test analysis,
p < 0.05) and was not significantly different from the one found in P30 animals (Fig. 4B).

View larger version (129K):
[in this window]
[in a new window]
|
Figure 3.
Morphology of the cerebellum of control
Lurcher and Bax knock-out Lurcher mice at P15 and 2 months. Purkinje cell death has already begun at P15 from
Grid2Lc/+;Bax+/+
controls (A) as well as
Grid2Lc/+;Bax /
double mutant mice (C), as shown by the presence
of gaps in the Purkinje cell layer. The surface of the internal granule
cell layer is persistently increased at 2 months in
Grid2Lc/+;Bax /
double mutant mice (D) when compared with
Grid2Lc/+;Bax+/+
control animals (B).
|
|

View larger version (16K):
[in this window]
[in a new window]
|
Figure 4.
Quantitative analysis of neuronal death in the
cerebellum of Bax knock-out Lurcher mice.
A, Purkinje cell number per half-cerebellum was assessed
using anti-calbindin immunostained cerebellar sections.
B, Granule cell number per half-cerebellum was estimated
multiplying the area of the internal granule cell layer by the average
density of granule cells. Asterisks indicate that
numbers found in
Grid2Lc/+;Bax /
double mutant mice are statistically different from numbers found in
Grid2Lc/+;Bax+/+ mice
(p < 0.05, ANOVA followed by post
hoc Newman-Keuls test analysis). Error bars indicate SEM
(n = 3-5). C, Averaged
laterolateral distribution of the Purkinje cell population in P15 aged
mutants of both genotypes. The mean Purkinje cell counts per homologous
parasagittal section are plotted against the distance from the midline
(percentage). Cell numbers in
Grid2Lc/+;Bax /
double mutants are significantly higher than in
Grid2Lc/+;Bax+/+ mice
without any effect of the laterolateral position (two-factor ANOVA).
Each point represents mean ± SEM (for some points,
the error bar is smaller than the dot).
|
|
These results show that Bax inactivation does not inhibit
but temporarily delays the degeneration of some Purkinje cells in Lurcher mice until P30.
Granule cell rescue by Bax inactivation
is persistent
The effect of Bax inactivation in P60 animals was
analyzed to determine whether granule cell rescue was a lasting effect
in Grid2Lc/+ double mutants (Fig.
3B,D). In
Grid2Lc/+;Bax+/+ control
mice as well as in
Grid2Lc/+;Bax / double
mutant mice, Purkinje cell degeneration was almost complete at this
age, except for few cells still remaining in the nodulus (525 ± 97 vs 1268 ± 218, respectively; ANOVA followed by post
hoc Newman-Keuls test analysis, p > 0.05) (Fig.
4A). The number of granule cells per
Grid2Lc/+;Bax+/+
half-cerebellum was 1.39 ± 0.06 × 106, ~10% of the normal number of
granule cells. Thus, the degeneration of granule cells is almost
complete at this age in
Grid2Lc/+;Bax+/+ control
mice as 10% of these cells still remain at P730 (Caddy and
Biscoe, 1979 ). The analysis of cerebellar sections from P60
Grid2Lc/+;Bax / double
mutant mice (Fig. 3D) revealed that the area of the internal
granule cell layer was still increased when compared with
Grid2Lc/+;Bax+/+ control
mice (Fig. 3B). The number of granule cells per hemi-cerebellum in
Grid2Lc/+;Bax / mice
(11.05 ± 0.41 × 106) was
significantly higher compared with
Grid2Lc/+;Bax+/+ controls
(ANOVA followed by the Newman-Keuls post hoc test analysis,
p < 0.05). This number was not significantly different from the numbers of granule cells found in
Grid2Lc/+;Bax / mice at
P15 and P30 (ANOVA followed by the Newman-Keuls post hoc
test analysis, p > 0.05). The number of rescued
granule cells is ~70% of the number of granule cells found in
wild-type animals (Vogel et al., 1991 ). These results indicate that
granule cell rescue by Bax inactivation in Lurcher is
persistent until at least 2 months.
 |
DISCUSSION |
The Lurcher mutant presents a unique opportunity to study two
distinct neuronal cell death mechanisms in the same in vivo model in which the primary cause of Purkinje cell death has been identified as a gain of function mutation in a glutamate receptor channel and the secondary cause of granule and olivary neuron cell
death is loss of target trophic support. In this study, we show that
deletion of Bax expression in the
Grid2Lc/+ mutant does not prevent
Purkinje cell or olivary neuron cell death, but it does rescue granule cells.
Purkinje cell death in the
Grid2Lc/+ mutant
All but a few cerebellar Purkinje cells, 90% of the granule
cells, and 60-75% of the olivary neurons degenerate postnatally in
the Grid2Lc/+ mutant (Phillips, 1960 ;
Caddy and Biscoe, 1979 ). Whereas
Grid2Lc/+ PC loss is attributable to
a cell autonomous genetic defect involving a gain of function mutation
in the 2 glutamate receptor (Grid2) (Zuo et al., 1997 ),
the mechanisms of PC death in the
Grid2Lc/+ mutant have not yet been
definitively characterized. Grid2Lc/+
PC death has been described as necrotic based on morphological criteria
(Dumesnil-Bousez and Sotelo, 1992 ). However, dying
Grid2Lc/+ PCs have been labeled with TUNEL and
contain increased levels of apoptosis-related proteins, such as BAX,
BCL-x, and both pro-caspase-3 and activated caspase-3, suggesting an
apoptotic mechanism (Norman et al., 1995 ; Wullner et al., 1995 , 1998 ;
Selimi et al., 2000 ).
The involvement of apoptosis-related proteins in
Grid2Lc/+ Purkinje cell death is also
shown by the ability of bcl-2 transgene overexpression to
delay Grid2Lc/+ PC death (Zanjani et
al., 1998a ,b ). One of the mechanisms by which BCL-2 may exert its
neuroprotective action is through inhibition of the pro-apoptotic
protein BAX (Oltvai et al., 1993 ; Antonsson et al., 1997 ; Mahajan,
1998 ). BAX mRNA is expressed at high levels in the postnatal mouse
brain (De Bilbao et al., 1999 ). BAX protein expression levels may
gradually decline in the cerebellum through the first 21 d of
development, although expression levels of BAX remain high in PCs in
the adult (Vekrellis et al., 1997 ). BAX plays an important role in
naturally occurring cell death because neuronal cell death is reduced
in Bax / mice; for example, the number of facial nucleus
motoneurons is increased by 51% (Deckwerth et al., 1996 ; White et al.,
1998 ).
BAX expression is increased in dying
Grid2Lc/+ PCs, suggesting it may play
a role in their death (Wullner et al., 1998 ). Yet, it is surprising
that deletion of BAX expression only slightly delays
Grid2Lc/+ PC death. The number of
Grid2Lc/+ Purkinje cells is
significantly increased at P15 in the
Grid2Lc/+double mutant, but by P30
this number has returned to a low level, and at P60 is not
significantly different to the one found in the
Grid2Lc/+mutant. The available
evidence suggests that Grid2Lc/+ PCs
may die by an excitotoxic mechanism induced by the accumulation of
leaky GRID2 subunits at developing PC-parallel fiber synapses (Zuo et
al., 1997 ; De Jager and Heintz, 1998 ). The Lurcher gain of function
mutation in Grid2 results in a large, constitutive inward
sodium current in the cells that express the subunit and might induce a
defect in Ca2+ homeostasis (Zuo et al.,
1997 ). Although we cannot rule out a role for BAX-induced apoptosis in
Grid2Lc/+ PCs, their death in
Bax knock-out Lurcher mutants indicates that BAX is not
necessary for their demise. One likely hypothesis is that there are
multiple pathways and/or other BCL-2 family members capable of inducing
cell death in stressed cells, including Purkinje cells. The slight
delay in Grid2Lc/+ PC death seen at
P15 may represent the difference between BAX cell death usually induced
in Grid2Lc/+ mutants and a different
mechanism induced in
Grid2Lc/+;Bax / double
mutants. BCL-2 overexpression may be able to temporarily rescue
Grid2Lc/+ Purkinje cells (Zanjani et
al., 1998a ) because of its ability to bind to BAX and prevent the
formation of BAX channels (Antonsson et al., 1997 ; Mahajan, 1998 )
and/or its ability to regulate intracellular Ca2+ homeostasis (Murphy et al., 1996 ;
Ichimiya et al., 1998 ; Kuo et al., 1998 ). However, in the end, the
Grid2Lc/+mutation is lethal and
neither Bax inactivation or bcl-2 overexpression can rescue Lurcher Purkinje cells.
Granule cell survival and olivary neuron death
In the olivocerebellar system, surgical and genetic lesions have
shown that the survival of olivary neurons and granule cells is
dependent on interactions with their PC targets (Harkmark, 1956 ; Sotelo
and Changeux, 1974 ; Caddy and Biscoe, 1979 ; Wetts and Herrup, 1982a ,b ;
Zanjani et al., 1990 ; Vogel et al., 1991 ; Herrup et al., 1996 ). Many
olivary neurons and granule cells undergo apoptotic cell death when
deprived of their target (Chu and Oberdick, 1995 ; Smeyne et al., 1995 ).
In the Grid2Lc/+ mutant, activated
caspase-3 is found in dying granule cells and olivary neurons (Selimi
et al., 2000 ). There are multiple lines of evidence that support a role
for BCL-2-related proteins, including BAX, in target-related cell
death. We have shown previously that overexpression of bcl-2
in Grid2Lc/+ olivary neurons will
rescue most of the olivary neurons from target-related cell death
(Zanjani et al., 1998b ). This result is consistent with previous
studies showing in vitro rescue of neurons from trophic
factor withdrawal (Garcia et al., 1992 ; Allsopp et al., 1993 ;
Batistatou et al., 1993 ) and in vivo rescue of neurons from
axotomy or ischemia by bcl-2 overexpression (Dubois-Dauphin et al., 1994 ; Martinou et al., 1994 ; Farlie et al., 1995 ; Bonfanti et
al., 1996 ; De Bilbao and Dubois-Dauphin, 1996 ) or deletion of
Bax expression (Deckwerth et al., 1996 ; White et al.,
1998 ).
However, our results reveal differences in the pathway leading to this
target-related cell death in vivo; deletion of
Bax expression in
Grid2Lc/+ mutants rescues granule
cells but does not prevent olivary neuron death. Both populations are
dying because of loss of their target, but granule cell death appears
to be dependent on Bax expression, whereas olivary neuron
cell death can be independent of Bax. Granule cell rescue
could have been a consequence of the delay in Purkinje cell death. For
example, in pcd mutant mice, Purkinje cell death occurs
between the third and sixth postnatal week, and the number of granule
cells is not different from controls in P30 animals. However, this
number is significantly decreased in 3-month-old pcd mutants
and follows an exponential decay, suggesting that a transient trophic
support from Purkinje cells is not sufficient to inhibit persistently
target-related granule cell death (Triarhou, 1998 ). Not even a slight
decrease in granule cell numbers was observed in Bax knock-out Lurcher
mice from P15 to P60, suggesting that the delay in Purkinje cell death
is unlikely to be the only cause of granule cell rescue. Our estimates
of granule cell numbers indicate that there is an eightfold increase in
the number of surviving granule cells in the
Grid2Lc/+;Bax / double
mutants compared with
Grid2Lc/+;Bax+/+ controls.
Granule cell numbers in our Bax knock-out Lurcher mutants
are only reduced by 30% compared with wild-type numbers (Vogel et al.,
1991 ). The number of granule cells in
Grid2Lc/+;Bax / double
mutants is comparable with the maximum of granule cells detected in
Grid2Lc/+;Bax+/+ cerebella
(8 × 106) (Caddy and Biscoe, 1979 ).
Thus, Bax inactivation does not significantly affect the deficit in
granule cell genesis detected in Lurcher mutants. It seems more likely
that the primary cause of granule cell rescue in Bax knock-out Lurcher
mice is the loss of Bax expression. Wild-type and Lurcher granule cells
have been shown to express Bax during the period of degeneration in
Lurcher cerebellum (Vekrellis et al., 1997 ; Wullner et al., 1998 ), and
our results suggest that Bax plays an important role in regulating
granule cell death after removal of target-related trophic support.
The molecular pathways that link trophic factor deprivation with cell
death have not yet been fully characterized. The binding of trophic
factors with their receptors triggers a variety of signaling responses
that promote cell survival, in some cases through interactions with
BCL-2-related proteins (Kaplan and Miller, 1997 ; Pettmann and
Henderson, 1998 ). For example, NGF or IGF-1 can induce the
phosphorylation of BAD, a non-membrane-bound BCL-2 relative, by
activating Akt, a serine-threonine protein kinase. In the absence of
trophic factor, nonphosphorylated BAD will bind to Bcl-x and prevent
the anti-apoptotic activity of BCL-x. The anti-apoptotic activity of
BCL-x may involve binding to BAX to prevent it from opening a pore in
mitochondrial membranes (Gross et al., 1999 ). Recently, NGF has also
been shown to promote Bcl-2 expression in NGF-responsive neurons
(Riccio et al., 1999 ). It is yet not clear what pathway or pathways are
involved in cell death in granule cells and olivary neurons. There are
a large variety of BCL-2-related cell death proteins that promote or
block cell death (Gross et al., 1999 ). For example, the loss of
Bax expression in Bcl-x deficient mice prevents
most, but not all, cell death so there must be other cell
death-promoting proteins (Shindler et al., 1997 ). The rescue of granule
cells, but not olivary neurons, by Bax inactivation after
target loss indicates that, although BAX is required for target-related
cell death in granule cells, there may be other cell death-promoting
proteins functioning in olivary neurons.
 |
FOOTNOTES |
Received Nov. 29, 1999; revised March 28, 2000; accepted May 1, 2000.
This work was supported by European Community Biotech Grant BIO4C960774
(to J.M.) and National Institutes of Health Grant NS34309 (to M.W.V.).
We thank P. Bouquet for her help with the histology, P. Nguyen from the
Centre de Traitement et de Productíon d'Images for his help with
digital figures, and F. Frédéric for her help with
statistical analysis. Bax knock-out mice were kindly
provided by Dr. S. Korsmeyer.
Correspondence should be addressed to Dr. Jean Mariani, Laboratoire
Développement et Vieillissement du Système Nerveux, Institut des Neurosciences, Centre National de la Recherche
Scientifique, Unité Mixte de Recherche 7624, Université
Pierre et Marie Curie, 9 Quai St. Bernard, 75005 Paris, France. E-mail:
Jean.Mariani{at}snv.jussieu.fr.
 |
REFERENCES |
-
Adams JM,
Cory S
(1998)
The bcl-2 protein family: arbiters of cell survival.
Science
281:1322-1326[Abstract/Free Full Text].
-
Allsopp TE,
Wyatt S,
Paterson HF,
Davies AM
(1993)
The proto-oncogene bcl-2 can selectively rescue neurotrophic factor-dependent neurons from apoptosis.
Cell
73:295-307[Web of Science][Medline].
-
Antonsson B,
Conti F,
Ciavatta A,
Montessuit S,
Lewis S,
Martinou I,
Bernasconi L,
Bernard A,
Mermod JJ,
Mazzei G,
Maundrell K,
Gambale F,
Sadoul R,
Martinou JC
(1997)
Inhibition of Bax channel-forming activity by Bcl-2.
Science
277:370-372[Abstract/Free Full Text].
-
Batistatou A,
Merry DE,
Korsmeyer SJ,
Greene LA
(1993)
Bcl-2 affects survival but not neuronal differentiation of PC12 cells.
J Neurosci
13:4422-4428[Abstract].
-
Bonfanti L,
Strettoi E,
Chierzi S,
Cenni MC,
Liu X-H,
Martinou J-C,
Maffei L,
Rabacchi SA
(1996)
Protection of retinal ganglion cells from natural and axotomy-induced cell death in neonatal transgenic mice overexpressing bcl-2.
J Neurosci
16:4186-4194[Abstract/Free Full Text].
-
Caddy KWT,
Biscoe TJ
(1979)
Structural and quantitative studies on the normal C3H and Lurcher mutant mouse.
Phil Trans R Soc Lond B Biol Sci
287:167-201[Abstract/Free Full Text].
-
Chu T,
Oberdick J
(1995)
An early critical period in olivocerebellar interactions defined by targeted ablation of Purkinje cells.
Soc Neurosci Abstr
21:916.
-
De Bilbao F,
Dubois-Dauphin M
(1996)
Time course of axotomy-induced apoptotic cell death in facial motoneurons of neonatal wild type and bcl-2 transgenic mice.
Neuroscience
71:1111-1119[Web of Science][Medline].
-
De Bilbao F,
Guarin E,
Nef P,
Vallet P,
Giannakopoulos P,
Dubois-Dauphin M
(1999)
Postnatal distribution of cpp32/caspase 3 mRNA in the mouse central nervous system: an in situ hybridization study.
J Comp Neurol
409:339-357[Web of Science][Medline].
-
De Jager PL,
Heintz N
(1998)
The lurcher mutation and ionotropic glutamate receptors: contributions to programmed neuronal death in vivo.
Brain Pathol
8:795-807[Web of Science][Medline].
-
Deckwerth TL,
Elliott JL,
Knudson CM,
Johnson EMJ,
Snider WD,
Korsmeyer SJ
(1996)
BAX is required for neuronal death after trophic factor deprivation and during development.
Neuron
17:401-411[Web of Science][Medline].
-
Doughty ML,
Lohof A,
Selimi F,
Delhaye-Bouchaud N,
Mariani J
(1999)
Afferent-target cell interactions in the cerebellum: negative effect of granule cells on Purkinje cell development in Lurcher mice.
J Neurosci
19:3448-3456[Abstract/Free Full Text].
-
Dubois-Dauphin M,
Frankowski H,
Tsujimoto Y,
Huarte J,
Martinou J-C
(1994)
Neonatal motoneurons overexpressing the bcl-2 protooncogene in transgenic mice are protected from axotomy-induced cell death.
Proc Natl Acad Sci USA
91:3309-3313[Abstract/Free Full Text].
-
Dumesnil-Bousez N,
Sotelo C
(1992)
Early development of the Lurcher cerebellum: Purkinje cell alterations and impairment of synaptogenesis.
J Neurocytol
21:506-529[Web of Science][Medline].
-
Farlie PG,
Dringen R,
Rees SM,
Kannourakis G,
Bernard O
(1995)
bcl-2 transgene expression can protect neurons against developmental and induced cell death.
Proc Natl Acad Sci USA
92:4397-4401[Abstract/Free Full Text].
-
Garcia I,
Martinou I,
Tsujimoto Y,
Martinou JC
(1992)
Prevention of programmed cell death of sympathetic neurons by the bcl-2 proto-oncogene.
Science
258:302-304[Abstract/Free Full Text].
-
Gross A,
McDonnell JM,
Korsmeyer SJ
(1999)
BCL-2 family members and the mitochondria in apoptosis.
Genes Dev
13:1899-1911[Free Full Text].
-
Harkmark W
(1956)
The influence of the cerebellum on development and maintenance of the inferior olive and the pons.
J Exp Zool
131:333-372[Web of Science].
-
Heckroth JA,
Eisenman LM
(1991)
Olivary morphology and olivocerebellar topography in adult lurcher mutant mice.
J Comp Neurol
312:641-651[Web of Science][Medline].
-
Hendry IA
(1976)
A method to correct adequately for the change in neuronal size when estimating neuronal numbers after nerve growth factor treatment.
J Neurocytol
5:337-349[Web of Science][Medline].
-
Herrup K,
Shojaeian-Zanjani H,
Panzini L,
Sunter K,
Mariani J
(1996)
The numerical matching of source and target populations in the CNS: the inferior olive to Purkinje cell projection.
Dev Brain Res
96:28-35[Medline].
-
Ichimiya M,
Chang SH,
Liu H,
Berezesky IK,
Trump BF,
Amstad PA
(1998)
Effect of Bcl-2 on oxidant-induced cell death and intracellular Ca2+ mobilization.
Am J Physiol
275:C832-C839[Abstract/Free Full Text].
-
Kaplan DR,
Miller FD
(1997)
Signal transduction by the neurotrophin receptors.
Curr Opin Cell Biol
9:213-221[Web of Science][Medline].
-
Knudson CM,
Tung KSK,
Tourtelotte WG,
Brown AJ,
Korsmeyer SJ
(1995)
Bax-deficient mice with lymphoid hyperplasia and male germ cell death.
Science
270:96-99[Abstract/Free Full Text].
-
Kuo TH,
Kim HR,
Zhu L,
Yu Y,
Lin HM,
Tsang W
(1998)
Modulation of endoplasmic reticulum calcium pump by Bcl-2.
Oncogene
17:1903-1910[Web of Science][Medline].
-
Mahajan
(1998)
Bcl-2 and Bax interactions in mitochondria probed with green fluorescent protein and fluorescence resonance energy transfer.
Nat Biotech
16:547-552[Web of Science][Medline].
-
Martinou J-C,
Dubois-Dauphin M,
Staple J,
Rodriguez I,
Frankowski H,
Missotten M,
Albertini P,
Talabot D,
Catsicas S,
Pietra C,
Huarte J
(1994)
Overexpression of BCL-2 in transgenic mice protects neurons from naturally occurring cell death and experimental ischemia.
Neuron
13:1017-1030[Web of Science][Medline].
-
Murphy AN,
Bredesen DE,
Cortopassi G,
Wang E,
Fiskum G
(1996)
Bcl-2 potentiates the maximal calcium uptake capacity of neural cell mitochondria.
Proc Natl Acad Sci USA
93:9893-9898[Abstract/Free Full Text].
-
Norman D,
Feng L,
Gubbay J,
Chan E,
Heintz N
(1995)
The lurcher gene induces apoptotic death in cerebellar Purkinje cells.
Development
121:1183-1193[Abstract].
-
Oltvai ZN,
Milliman CL,
Korsmeyer SJ
(1993)
Bcl-2 heterodimerizes in vivo with a conserved homolog, Bax, that accelerates programmed cell death.
Cell
74:609-619[Web of Science][Medline].
-
Pettmann B,
Henderson CE
(1998)
Neuronal cell death.
Neuron
20:633-647[Web of Science][Medline].
-
Phillips RJS
(1960)
"Lurcher," a new gene in linkage group XI of the house mouse.
J Genet
57:35-42.
-
Riccio A,
Ahn S,
Davenport CM,
Blendy JA,
Ginty DD
(1999)
Mediation by a CREB family transcription factor of NGF-dependent survival of sympathetic neurons.
Science
286:2358-2361[Abstract/Free Full Text].
-
Selimi F,
Doughty M,
Delhaye-Bouchaud N,
Mariani J
(2000)
Target-related and intrinsic neuronal death in Lurcher mutant mice are both mediated by caspase-3 activation.
J Neurosci
20:992-1000[Abstract/Free Full Text].
-
Shindler KS,
Latham CB,
Roth KA
(1997)
Bax deficiency prevents the increased cell death of immature neurons in bcl-x-deficient mice.
J Neurosci
17:3112-3119[Abstract/Free Full Text].
-
Smeyne RJ,
Chu T,
Lewin A,
Bian F,
Crisman SS,
Kunsch C,
Lira SA,
Oberdick J
(1995)
Local control of granule cell generation by cerebellar Purkinje cells.
Mech Cell Neurosci
6:230-251.
-
Sotelo C,
Changeux J-P
(1974)
Transsynaptic degeneration "en cascade" in the cerebellar cortex of staggerer mutant mice.
Brain Res
67:519-526[Web of Science][Medline].
-
Triarhou LC
(1998)
Rate of neuronal fallout in a transsynaptic cerebellar model.
Brain Res Bull
47:219-222[Web of Science][Medline].
-
Vekrellis K,
McCarthy MJ,
Watson A,
Whitfield J,
Rubin LL,
Ham J
(1997)
Bax promotes neuronal cell death and is downregulated during the development of the nervous system.
Development
124:1239-1249[Abstract].
-
Vogel MW,
McInnes M,
Zanjani HS,
Herrup K
(1991)
Cerebellar Purkinje cells provide target support over a limited spatial range: evidence from lurcher chimeric mice.
Dev Brain Res
64:87-94[Medline].
-
Wetts R,
Herrup K
(1982a)
Interaction of granule, Purkinje and inferiorolivary neurons in lurcher chimeric mice. I. Qualitative studies.
J Embryol Exp Morphol
68:87-98[Web of Science][Medline].
-
Wetts R,
Herrup K
(1982b)
Interaction of granule, Purkinje and inferior olivary neurons in lurcher chimeric mice. II. Granule cell death.
Brain Res
250:358-363[Web of Science][Medline].
-
White FA,
Keller-Peck CR,
Knudson M,
Korsmeyer SJ,
Snider WD
(1998)
Widespread elimination of naturally occurring neuronal death in Bax-deficient mice.
J Neurosci
18:1428-1439[Abstract/Free Full Text].
-
Wullner U,
Loschmann P-A,
Weller M,
Klockgether T
(1995)
Apoptotic cell death in the cerebellum of mutant weaver and lurcher mice.
Neurosci Lett
200:109-112[Web of Science][Medline].
-
Wullner U,
Weller M,
Schulz J,
Krajewski S,
Reed J,
Klockgether T
(1998)
Bcl-2, Bax and Bcl-x expression in neuronal apoptosis: a study of mutant weaver and lurcher mice.
Acta Neuropathol (Berl)
96:233-238[Medline].
-
Zanjani HS,
Mariani J,
Herrup K
(1990)
Cell loss in the inferior olive of the staggerer mutant mouse is an indirect effect of the gene.
J Neurogenet
6:229-241[Web of Science][Medline].
-
Zanjani HS,
Rondi-Reig L,
Vogel MW,
Martinou JC,
Delhaye-Bouchaud N,
Mariani J
(1998a)
Overexpression of a Hu-Bcl-2 gene in Lurcher mutant mice delays Purkinje cell death.
C R Acad Sci III
321:633-640[Medline].
-
Zanjani HS,
Vogel MW,
Martinou JC,
Delhaye-Bouchaud N,
Mariani J
(1998b)
Postnatal expression of Hu-Bcl-2 gene in Lurcher mutant mice fails to rescue Purkinje cells, but protects inferior olivary neurons from target related cell death.
J Neurosci
18:319-327[Abstract/Free Full Text].
-
Zuo J,
De Jager PL,
Takahashi KA,
Jiang W,
Linden DJ,
Heintz N
(1997)
Neurodegeneration in Lurcher mice caused by mutation in
2 glutamate receptor.
Nature
388:769-773[Medline].
Copyright © 2000 Society for Neuroscience 0270-6474/00/20145339-07$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
A-r. Jung, T. W. Kim, I. J. Rhyu, H. Kim, Y. D. Lee, S. Vinsant, R. W. Oppenheim, and W. Sun
Misplacement of Purkinje Cells during Postnatal Development in Bax Knock-Out Mice: A Novel Role for Programmed Cell Death in the Nervous System?
J. Neurosci.,
March 12, 2008;
28(11):
2941 - 2948.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. D. Steele, O. D. King, W. S. Jackson, C. A. Hetz, A. W. Borkowski, P. Thielen, R. Wollmann, and S. Lindquist
Diminishing Apoptosis by Deletion of Bax or Overexpression of Bcl-2 Does Not Protect against Infectious Prion Toxicity In Vivo
J. Neurosci.,
November 21, 2007;
27(47):
13022 - 13027.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Dong, A. Li, N. Yamaguchi, S. Sakaguchi, and D. A. Harris
Doppel Induces Degeneration of Cerebellar Purkinje Cells Independently of Bax
Am. J. Pathol.,
August 1, 2007;
171(2):
599 - 607.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Coultas, S. Terzano, T. Thomas, A. Voss, K. Reid, E. G. Stanley, C. L. Scott, P. Bouillet, P. Bartlett, J. Ham, et al.
Hrk/DP5 contributes to the apoptosis of select neuronal populations but is dispensable for haematopoietic cell apoptosis
J. Cell Sci.,
June 15, 2007;
120(12):
2044 - 2052.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. K. Wong, M. Fricker, A. Wyttenbach, A. Villunger, E. M. Michalak, A. Strasser, and A. M. Tolkovsky
Mutually Exclusive Subsets of BH3-Only Proteins Are Activated by the p53 and c-Jun N-Terminal Kinase/c-Jun Signaling Pathways during Cortical Neuron Apoptosis Induced by Arsenite
Mol. Cell. Biol.,
October 1, 2005;
25(19):
8732 - 8747.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Stefanis
Caspase-Dependent and -Independent Neuronal Death: Two Distinct Pathways to Neuronal Injury
Neuroscientist,
February 1, 2005;
11(1):
50 - 62.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Chiesa, P. Piccardo, S. Dossena, L. Nowoslawski, K. A. Roth, B. Ghetti, and D. A. Harris
Bax deletion prevents neuronal loss but not neurological symptoms in a transgenic model of inherited prion disease
PNAS,
January 4, 2005;
102(1):
238 - 243.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Shintani and D. J. Klionsky
Autophagy in Health and Disease: A Double-Edged Sword
Science,
November 5, 2004;
306(5698):
990 - 995.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. A. Linseman, B. D. Butts, T. A. Precht, R. A. Phelps, S. S. Le, T. A. Laessig, R. J. Bouchard, M. L. Florez-McClure, and K. A. Heidenreich
Glycogen Synthase Kinase-3{beta} Phosphorylates Bax and Promotes Its Mitochondrial Localization during Neuronal Apoptosis
J. Neurosci.,
November 3, 2004;
24(44):
9993 - 10002.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. A. Linseman, R. A. Phelps, R. J. Bouchard, S. S. Le, T. A. Laessig, M. L. McClure, and K. A. Heidenreich
Insulin-Like Growth Factor-I Blocks Bcl-2 Interacting Mediator of Cell Death (Bim) Induction and Intrinsic Death Signaling in Cerebellar Granule Neurons
J. Neurosci.,
November 1, 2002;
22(21):
9287 - 9297.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. A. Linseman, M. L. McClure, R. J. Bouchard, T. A. Laessig, F. A. Ahmadi, and K. A. Heidenreich
Suppression of Death Receptor Signaling in Cerebellar Purkinje Neurons Protects Neighboring Granule Neurons from Apoptosis via an Insulin-like Growth Factor I-dependent Mechanism
J. Biol. Chem.,
June 28, 2002;
277(27):
24546 - 24553.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. A. Maianski, F. P. J. Mul, J. D. van Buul, D. Roos, and T. W. Kuijpers
Granulocyte colony-stimulating factor inhibits the mitochondria-dependent activation of caspase-3 in neutrophils
Blood,
January 15, 2002;
99(2):
672 - 679.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Vila, V. Jackson-Lewis, S. Vukosavic, R. Djaldetti, G. Liberatore, D. Offen, S. J. Korsmeyer, and S. Przedborski
Bax ablation prevents dopaminergic neurodegeneration in the 1-methyl- 4-phenyl-1,2,3,6-tetrahydropyridine mouse model of Parkinson's disease
PNAS,
February 8, 2001;
(2001)
51633998.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
M. Vila, V. Jackson-Lewis, S. Vukosavic, R. Djaldetti, G. Liberatore, D. Offen, S. J. Korsmeyer, and S. Przedborski
Bax ablation prevents dopaminergic neurodegeneration in the 1-methyl- 4-phenyl-1,2,3,6-tetrahydropyridine mouse model of Parkinson's disease
PNAS,
February 27, 2001;
98(5):
2837 - 2842.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|