 |
Previous Article | Next Article 
The Journal of Neuroscience, August 1, 2000, 20(15):5724-5732
The SNARE Vti1a- Is Localized to Small Synaptic Vesicles and
Participates in a Novel SNARE Complex
Wolfram
Antonin2,
Dietmar
Riedel2, and
Gabriele Fischer
von Mollard1
1 Zentrum Biochemie und Molekulare Zellbiologie,
Abteilung Biochemie II, Universität Göttingen, 37073 Göttingen, Germany, and 2 Abteilung Neurobiologie,
Max-Planck Institut für Biophysikalische Chemie, 37077 Göttingen, Germany
 |
ABSTRACT |
Specific soluble N-ethylmaleimide-sensitive factor
attachment protein (SNAP) receptor (SNARE) proteins are required
for different membrane transport steps. The SNARE Vti1a has been
colocalized with Golgi markers and Vti1b with Golgi and the
trans-Golgi network or endosomal markers in fibroblast
cell lines. Here we study the distribution of Vti1a and Vti1b in brain.
Vti1b was found in synaptic vesicles but was not enriched in this
organelle. A brain-specific splice variant of Vti1a was identified that
had an insertion of seven amino acid residues next to the putative
SNARE-interacting helix. This Vti1a- was enriched in small synaptic
vesicles and clathrin-coated vesicles isolated from nerve terminals.
Vti1a- also copurified with the synaptic vesicle R-SNARE
synaptobrevin during immunoisolation of synaptic vesicles and
endosomes. Therefore, both synaptobrevin and Vti1a- are integral
parts of synaptic vesicles throughout their life cycle. Vti1a- was
part of a SNARE complex in nerve terminals, which bound
N-ethylmaleimide-sensitive factor and -SNAP. This
SNARE complex was different from the exocytic SNARE complex because
Vti1a- was not coimmunoprecipitated with syntaxin 1 or SNAP-25.
These data suggest that Vti1a- does not function in exocytosis but
in a separate SNARE complex in a membrane fusion step during recycling
or biogenesis of synaptic vesicles.
Key words:
SNARE; synaptic vesicle; clathrin-coated vesicle; endosome; Vti1; nerve terminal; membrane traffic
 |
INTRODUCTION |
Transport between different
organelles requires complex formation between specific members of the
N-ethylmaleimide-sensitive factor attachment protein (SNAP)
receptor (SNARE) protein family on both transport vesicles
(v-SNARE) and target membranes (t-SNARE) (Rothman, 1994 ). SNARE
proteins have common structural features. Most of them contain a
C-terminal membrane anchor. They interact with each other via predicted
coiled coil domains close to the membrane. These SNARE proteins are
conserved in evolution, numbering 21 family members in yeast and so far
over 35 in mammals (Jahn and Sudhof, 1999 ) The SNARE complex required
for exocytosis of synaptic vesicles has been studied extensively. It
consists of the synaptic vesicle v-SNARE synaptobrevin and the plasma
membrane t-SNAREs syntaxin 1 and SNAP-25. Synaptobrevin and syntaxin
contribute one helix and SNAP-25 two helices to a parallel four-helix
bundle (Sutton et al., 1998 ). A conserved arginine in synaptobrevin
interacts with the three glutamines from the t-SNAREs in a central
layer of the SNARE complex. The SNARE complex required for exocytosis in yeast also consists of a four-helix bundle with interactions between
one arginine and three glutamine containing helices (Rossi et al.,
1997 ), suggesting that this is a common feature of SNARE complexes
(Fasshauer et al., 1998b ). Therefore, SNARE proteins have been
reclassified as R-SNAREs (arginine) or Q-SNAREs (glutamine). All
t-SNAREs are Q-SNAREs, whereas v-SNAREs are either R-SNAREs or
Q-SNAREs.
The composition of SNARE complexes required for intracellular traffic
is less clear. A single SNARE can be part of different complexes. Yeast
Vti1p interacts with the cis-Golgi t-SNARE Sed5p in
retrograde traffic to the cis-Golgi (Lupashin et al., 1997 ), with the endosomal t-SNARE Pep12p in traffic from the Golgi to the
endosome (Fischer von Mollard et al., 1997 ) and with the vacuolar t-SNARE Vam3p in biosynthetic transport pathways to the
vacuole/lysosome (Fischer von Mollard and Stevens, 1999 ) and in
homotypic vacuolar fusion (Ungermann et al., 1999 ). Vti1p binds to the
t-SNAREs Tlg1p (early endosome) and Tlg2p [trans-Golgi
network (TGN)] (Holthuis et al., 1998 ). Two proteins related to yeast
Vti1p were identified in mammals (Lupashin et al., 1997 ; Fischer von
Mollard and Stevens, 1998 ). Mouse Vti1a and Vti1b share only 30% amino
acid identity and have a similar degree of homology with the yeast
protein (33 and 27%). Tagged Vti1b/Vti1-rp1 overlapped with Golgi and
TGN proteins (Advani et al., 1998 ). Vti1-rp1/Vti1b was found in
endosomes according to unpublished results mentioned by Xu et al.
(1998) . Vti1-rp2/Vti1a was localized to the Golgi apparatus. Vti1a
could be coimmunoprecipitated with the cis-Golgi t-SNARE
syntaxin 5 and the TGN syntaxin 6. Antibodies against Vti1a block
intra-Golgi traffic (Xu et al., 1998 ).
Here we describe a brain-specific splice variant of Vti1a that is
localized to synaptic vesicles. This Vti1a- is not part of the
exocytic SNARE complex but may function in a novel SNARE complex
required for synaptic vesicle recycling or biogenesis.
 |
MATERIALS AND METHODS |
Materials. Reagents were used from the following
sources: enzymes for DNA manipulations from New England Biolabs
(Beverly, MA); secondary antibodies from Jackson ImmunoResearch (West
Grove, PA); Eupergit C1Z methacrylate microbeads from Röhm Pharma
(Darmstadt, Germany); glutathione (GSH)-Sepharose 6B and
cyanogen bromide (CNBr)-Sepharose 4B (Amer-sham Pharmacia
Biotech, Uppsala, Sweden); and Ni-NTA agarose from Qiagen
(Hilden, Germany). All other reagents were purchased from Sigma
(Deisenhofen, Germany). Plasmid manipulations were performed in the
Echerichia coli strain XL1Blue.
N-ethylmaleimide-sensitive factor (NSF) and -SNAP in
pQE-9 plasmids encoding for His6-tagged fusion proteins were kindly provided by S. Whiteheart and J. E. Rothman (Sloan-Kettering
Center, New York, NY).
Cloning of rat Vti1a and Vti1a- . Sequence data
from rat expressed sequence tags (ESTs) (GenBank accession
numbers AI010508, AI227646, and AI555622) were used to assemble the
sequence of rat Vti1a. Oligonucleotide primers annealing a few base
pairs upstream of the start codon and downstream of the stop codon of rat Vti1a (GGG GTA CCG GAG CTG CCA TGT CAG and CGG GAT CCG CCT CAG TGT
CCT CTG AC) were used to PCR amplify DNA from rat lung and rat
cerebellum cDNA ZAPII libraries (Stratagene, La Jolla, CA).
The PCR products derived from cerebellum cDNA were reamplified using
the same primers and cloned into pGEM-Teasy (Promega, Madison, WI). The
nucleotide sequences of inserts of three clones with slightly smaller
and three clones with slightly larger inserts were determined. The
smaller clones encoded Vti1a and the larger clones Vti1a- with an
insertion of 21 base pairs.
Reverse transcription-PCR. Total RNA was isolated
from different rat tissues (cerebellum, cortex, hippocampus, lung,
liver, kidney, and spleen; 200 mg each) using TRIZOL reagent (Life
Technologies, Rockville, MD) following the instructions of the
manufacturer. RNA (5 µg) was used for an RT-PCR reaction using
the Superscript II kit (Life Technologies) following the instructions
of the manufacturer in a total volume of 20 µl. Ten percent of the
products of the RT-PCR were used as a template for the specific PCRs.
The three oligonucleotides gagaaccagagggcacatc (Vti1a, annealing with
codons 110-116 and therefore only with Vti1a), ttgataaaattacgtgaggag (Vti1a- , annealing with the vti1- specific codons 115-121), and
gagaagaagcaaatggttg (MB7, annealing with codons 33-38) were used as
forward primers each in combination with the oligonucleotide gggatcctagcggttttggatgattcttc (rVbsol, annealing with codons 187-180) as a reverse primer.
Protein purification. Recombinant NSF and -SNAP were
purified as described previously (Hanson et al., 1995 ). Recombinant glutathione S-transferase (GST)-rat Vti1a [amino acids (aa)
1-114] and GST-rat Vti1a (aa 115-192) were purified using
GSH-Sepharose 6B following the instructions of the manufacturer.
Antibodies. Antisera were raised in rabbits against a fusion
protein containing GST and the amino acids 1-207 of mouse Vti1b (pBK9)
or amino acids 1-187 of mouse Vti1a (pBK10) purified from E. coli. The antisera were affinity purified with Affigel 10 columns with covalently bound 6His-mVti1b (amino acids 1-207, pBK38) or 6His-mVti1a (amino acids 1-187, pBK39), respectively, for
immunofluorescence. Vti1a antiserum specific for the N-terminal or
C-terminal region of the protein was affinity-purified using
recombinant GST-rat Vti1a (aa 1-114) or GST-rat Vti1a (aa 115-192),
respectively, coupled to CNBr-Sepharose 4B. The affinity-purified
antisera were specific for their targets [the C-terminal antiserum did
not recognize GST-Vti1a (aa 1-114) and the N-terminal antiserum did
not detect GST-Vti1a (aa 115-192)].
The following antibodies were described previously: synaptophysin
(monoclonal antibody, Cl7.2) (Jahn et al., 1985 ); rab5 (monoclonal antibody, Cl 621.3) (Fischer von Mollard et al., 1994 ); rab5 (rabbit antiserum R6) and rab3a (monoclonal antibody, Cl42.2) (Matteoli et al.,
1991 ); SNAP-25 (Cl71.2) (Bruns et al., 1997 ); and synaptobrevin (monoclonal antibody, Cl69.1). The following antibodies were kind gifts: syntaxin 1 (monoclonal antibody HPC-1; provided by Dr. C. Barnstable, New Haven, CT) (Barnstable et al., 1985 ); and Sec61 (rabbit serum; provided by Dr. E. Hartmann, Göttingen, Germany). Commercial sources were used for the following antibodies: secretory carrier membrane protein (SCAMP) (rabbit serum; Synaptic Systems, Göttingen, Germany); and syntaxin 6 (monoclonal antibody;
Transduction Laboratories, Lexington, KY).
Immunofluorescence. Adult female Sprague Dawley rats were
anesthetized, perfused, and post-fixed as described previously
(Mugnaini and Dahl, 1983 ), with modifications. Briefly, a rat was
perfused transcardially with ice-cold 0.9% NaCl, followed by fixative
(4% formaline, 0.9% NaCl, and 0.5% ZnCl2). The
brain was dissected and immersed in the same fixative overnight at
4°C. After rinse in 0.1 M Tris-HCl, pH 7.2, the
tissue was incubated overnight in 20% sucrose containing 0.1 M Tris-HCl, pH 7.2, and then sectioned on a
cryostat at 8 µm. The sections were mounted on
poly-L-lysine-coated glass slides and incubated
in PBS containing 3% goat serum and 0.3% Triton X-100 (GSDB) for 30 min. The sections were incubated overnight with the respective
antibodies, washed with PBS, and incubated for 1 hr at room temperature
with secondary antibodies (Cy2-conjugated goat anti-mouse antibody and
Cy3-conjugated goat anti-rabbit antibody (Jackson ImmunoResearch) in
GSDB. After washing with PBS, the sections were coverslipped with
mounting solution (Dako, Glostrup, Denmark) and analyzed with a
confocal microscope (LSM-410-invert; Zeiss, Göttingen, Germany).
Culturing of neurons from the hippocampi of neonatal rats (Sprague
Dawley) was done as described previously (Rosenmund et al., 1995 ).
After 3 weeks in culture, the cells were processed for
immunofluorescence as described previously (Hannah et al., 1998 ) using
Triton X-100 as detergent. The staining was analyzed with a confocal
microscope (LSM-410-invert; Zeiss).
Electron microscopy. For immunogold labeling, purified
synaptic vesicles (as described below) were adsorbed to glow discharged nickel grids. Thereafter, labeling with diluted respective antibodies [synaptophsin antiserum (G 95), 1:100, Vti1a affinity-purified serum,
1:50)] and 10 nm goat anti-rabbit IgG gold conjugates diluted at 1:100
in 1% BSA in phosphate buffer were performed. The samples were
post-fixed for 10 min with 2% glutharaldehyde in phosphate buffer,
washed with H2O, rinsed with 3 drops of 1%
uranyl acetate, and immediately dried with filter paper.
Isolation of organelles. Small synaptic vesicles were
purified as described previously (Huttner et al., 1983 ).
Clathrin-coated vesicles were purified from rat brain synaptosomes as
described previously (Maycox et al., 1992 ).
For immunoisolation of organelles, monoclonal antibodies Cl 69.1 (anti-synaptobrevin), Cl 42.2 (anti-rab3a) and Cl 621.3 (anti-rab5) were covalently coupled to Eupergit C1Z methacrylate microbeads as
described previously (Burger et al., 1989 ). Rat brain was homogenized in 25 ml of homogenization buffer [320 mM sucrose, 5 mM HEPES, pH 7.4, 1 mM EDTA, 0.1 mM
GTP S, and protease inhibitors (10 µg/ml soybean trypsin inhibitor,
1 µg/ml pepstatin, 11 µg/ml benzamidine, 1 µg/ml antipain, 1 µg/ml leupeptin, and 0.1 mM phenylmethylsulfonyl fluoride)] using a glass Teflon homogenizer (10 strokes, 1000 rpm).
Postnuclear supernatant (PNS) was generated by centrifugation at
1000 × gav for 10 min.
PNS was further centrifuged for 30 min at 50.000 × gav to remove myelin increasing the
unspecific binding to the beads. The resulting supernatant (800 µg of
protein) was incubated in 800 µl of homogenization buffer with 20 µl of the appropriate beads for 1 hr at 4°C. The incubation mixture
was layered on top of a sucrose cushion (0.5 ml, 0.8 M) and centrifuged for 5 min at 4600 × gav. The supernatants were centrifuged
for 30 min at 200,000 × gav at
4°C using a Beckman TLA120.2 rotor to sediment nonbound membranes.
The bead pellets were washed five times with PBS. Aliquots of
each sample as well as the starting PNS were analyzed by SDS-PAGE and immunoblotting.
Immunoprecipitation. A synaptosomal fraction (P2) was
solubilized in extraction buffer (50 mM Tris-HCl,
pH 7.4, 150 mM NaCl, 1 mM
EDTA, 0.1 mM phenylmethylsulfonyl fluoride, and
1% Triton X-100) at a final protein concentration of 0.5 mg/ml for 1 hr at 4°C. Lysates were clarified by centrifugation at 200,000 × g for 10 min. After transfer of the supernatant to a
fresh tube, immunoprecipitations were conducted for 2 hr at 4°C with
monoclonal antibodies against syntaxin 6, syntaxin 1 (HPC-1), SNAP-25
(71.2), synaptobrevin (69.1), or affinity-purified antibody specific
for Vti1a. Antibodies were bound to Protein A-Sepharose beads (Amersham Pharmacia Biotech) for 60 min, sedimented, and washed eight times with
extraction buffer. The supernatants were precipitated (Wessel and
Flügge, 1984 ). The immunoprecipitates and 30% of the
precipitated supernatants were analyzed by SDS-PAGE and immunoblotting
using the above antibodies. In the case of the detection of SNAP-25, an
anti-mouse Fc antibody was used as a secondary antibody to exclude a
cross-reactivity with the light chain of the antibodies used for immunoprecipitation.
Binding of NSF and -SNAP to SNARE complexes.
Detection of a 20 S complex containing Vti1a- was done as described
previously (Söllner et al., 1993a ), using the LP2 fraction from
rat (high-speed membrane fraction of lysed synaptosomes) as starting
material instead of bovine brain membranes. In brief, the LP2 fraction (0.5 mg/ml final protein concentration) was solubilized in 20 mM HEPES, pH 7.4, 100 mM
KCl, 1 mM EDTA, and 0.5% Triton X-100 at 4°C
for 1 hr. Insoluble material was removed by centrifugation at
200,000 × gav for 10 min. The
supernatant (1 ml) was incubated with recombinant NSF (0.3 µM) and -SNAP (0.9 µM) for 1 hr at 4°C and then layered on top
of a 10-35% (w/v) glycerol gradient containing the same buffer as
above and subjected to centrifugation for 19 hr in an SW41 rotor
(Beckman) at 40,000 rpm at 4°C. Fractions (1 ml) were collected, and
the proteins were precipitated by trichloroacetic acids, separated by
SDS-PAGE, and electrotransferred to nitrocellulose. The blots were
immunodecorated with the indicated antibodies. In a control reaction,
NSF and -SNAP were omitted.
SNARE complex disassembly reaction. LP2 fractions
(high-speed membrane fraction of lysed synaptosomes, 0.5 mg/ml final
concentration of protein) were preincubated with 3 µM NSF, 9 µM -SNAP,
3 mM MgCl2, and 3 mM ATP in 50 mM HEPES, pH
7.4, for 10 min at 30°C. Then, trypsin was added to a final
concentration of 0.05 mg/ml, and the samples were incubated for another
15 min at 30°C. Reaction was stopped by adding soybean trypsin
inhibitor and phenylmethylsulfonyl fluoride to a final concentration of
100 µg/ml and 1 mM, respectively. SDS sample
buffer was added, and the samples were heated immediately for 5 min at
100°C. As a control, the reaction was either performed in the absence
of NSF and -SNAP or the ATPase activity of NSF was abolished by
replacing ATP with 3 mM ATP S or
MgCl2 with 10 mM EDTA, respectively.
 |
RESULTS |
Identification of a brain-specific Vti1a splice variant
For the characterization of Vti1a and Vti1b proteins, we generated
polyclonal antibodies in rabbits using purified recombinant fusion
proteins as antigens (see Materials and Methods for details). Both
antisera reacted with single bands of 27 (Vti1a) and 29 (Vti1b) kDa,
respectively, close to the predicted molecular weight of the proteins.
A tissue survey by immunoblotting of homogenate extracts revealed that
both Vti1a and Vti1b are widely distributed in all tissues examined
(Fig. 1). In brain extracts, the
Vti1a-specific antiserum recognized an additional band with a slightly
lower mobility that was not observed in other tissues. To determine whether this higher molecular weight band is produced from a splice variant of the Vti1a mRNA, the coding sequences of Vti1a were amplified
from lung and cerebellum rat cDNA libraries (Fig.
2A). A single band was
amplified from the lung cDNA library. In contrast, two bands, one band
of slightly lower mobility than the PCR product from lung, were
amplified from the cerebellum cDNA. Both bands were cloned into
plasmids, and the inserts were sequenced. The top band
corresponded to rat Vti1a, except for an insertion of 21 nucleotides.
This sequence encoded the brain-specific splice variant Vti1a- with
the insertion of the amino acid sequence LIKLREE C-terminal of residue
114. Residue 114 is located at the beginning of a domain, which is
conserved among the Vti1 proteins from different species and is
predicted to form an -helix (Fig. 2C). Alignment with the
different SNAREs predicts that the SNARE-interacting helix (SNARE
motif) of Vti1a starts at residue 132. The bottom band
encoded the rat Vti1a.

View larger version (63K):
[in this window]
[in a new window]
|
Figure 1.
Vti1a and Vti1b were expressed in all tissues.
Homogenates were prepared from the indicated mouse tissues, and 20 µg
separated by SDS-PAGE Western blots were stained with antisera against
Vti1a or Vti1b. The Vti1a antiserum recognized a ubiquitous protein of
27 kDa and an additional slightly larger brain-specific band. Vti1b
antiserum bound to a single band of 29 kDa.
|
|

View larger version (55K):
[in this window]
[in a new window]
|
Figure 2.
The brain-specific splice variant Vti1a- had an
insertion of seven amino acid residues. A, A single band
was PCR-amplified from a lung cDNA library, a double band from a
cerebellum cDNA library using primers specific for Vti1a. The slightly
larger band encoded Vti1a- with a insertion of seven amino acids
after Q114. B, Expression pattern of Vti1a and Vti1a-
in different tissues. RT-PCRs were performed using primer pairs
amplifying both Vti1a and Vti1a- (expected sizes, 511 and 490 bp;
top), Vti1a only (forward primer annealing with codons
110-116, 265 bp; middle), or Vti1a- only (forward
primer annealing with Vti1a- -specific codons 115-121, 253 bp;
bottom). Vti1a was amplified from all tissues examined.
Vti1a- was amplified from the neuronal tissues cerebellum, cortex,
and hippocampus, but not from lung, liver, kidney, or spleen.
C, Alignment of Saccharomyces cerevisiae
Vti1p, the C-terminal part of a predicted C. elegans
protein (GenBank accession number CAB16506), mouse Vti1b, rat
Vti1a (GenBank accession number AF262221), and rat Vti1a- (GenBank
accession number AF262222). Filled circles indicate the
beginning and end of the predicted SNARE-interacting helix (SNARE
motif). The open circle marks the position of the
conserved glutamine or aspartate residue in layer 0, and
asterisks indicate hydrophobic positions in the heptade
repeats.
|
|
To further analyze the expression patterns of both splice variants,
RT-PCRs were performed with RNAs isolated from different rat tissues.
Primer pairs were designed to amplify both splice variants (Fig.
2B, top), Vti1a only (middle),
or Vtia- only (bottom). Vti1a was amplified from all
tissues examined. Vti1a- was expressed in the neuronal tissues
cerebellum, cortex, and hippocampus, but not in lung, liver, kidney, or
spleen. These data confirm that Vti1a- is a brain-specific splice variant.
Mouse and rat Vti1a, as well as a human Vti1a assembled from the EST
database, have an aspartate residue at position 156 instead of the
conserved glutamine found in the center of the SNARE helix in other
Q-SNAREs and all other Vti1 proteins. Still, an aspartate residue would
be able to form a strong ionic interaction with an arginine residue in
the center of the SNARE motif. Rat and mouse Vti1a were 96% identical
in their amino acid sequence. Conserved exchanges were found in nine
amino acid residues (D/E, R/K, A/S, and A/T). The C-terminal part of a
predicted Caenorhabditis elegans protein (GenBank
accession number CAB16506) had a high degree of homology with mouse
Vti1a (41% amino acid identity) and a lower degree of homology with
mouse Vti1b (25% amino acid identity).
Vti1a localized to cell bodies and nerve terminals in neurons
In previous studies, Vti1a was localized to the Golgi apparatus of
fibroblasts (Xu et al., 1998 ). The localization of Vti1b is less clear
because it was found to colocalize with either Golgi and TGN (Advani et
al., 1998 ) or with endosomal markers (Xu et al., 1998 ). To investigate
the localization of both proteins in neurons, we performed indirect
immunofluorescence on both cultured hippocampal neurons and hippocampal
tissue sections. In cultured neurons, Vti1b was localized to large
cisternae in the cell body and to a few structures in processes close
to the cell bodies (Fig. 3). No overlap
was found between the staining of Vti1b and of synaptobrevin 2, an
R-SNARE specific for synaptic vesicles. In contrast, the staining
pattern for Vti1a was different. Vti1a was also found in the
perinuclear region of the cell body, but Vti1a and Vti1b stained
different structures. An additional pool of Vti1a was observed in the
processes and overlapped there with synaptobrevin in the nerve
terminals. To further analyze the subcellular distribution, hippocampal
sections were stained (Fig. 4). Again, Vti1b antiserum stained the cell bodies of pyramidal cells but not the
nerve terminals of the mossy fibers. The staining for Vti1b and
synaptobrevin did not overlap. Vti1a and synaptobrevin clearly
colocalized in the large nerve terminals of the mossy fibers. Vti1a was
also found in the cell bodies of pyramidal cells. These data indicate
that a subfraction of Vti1a was localized to nerve terminals.

View larger version (21K):
[in this window]
[in a new window]
|
Figure 3.
Vti1a localized to the cell body as well as to
nerve terminals of hippocampal neurons. Cultured hippocampal neurons
were double stained for Vti1a or Vti1b and synaptobrevin. Vti1a and
Vti1b were found in the cell body. In addition, Vti1a colocalized with
synaptobrevin in nerve terminals. Scale bar, 20 µM.
|
|

View larger version (111K):
[in this window]
[in a new window]
|
Figure 4.
Vti1a localized to the cell body as well as to
mossy fiber terminals in hippocampal sections. Rat hippocampal sections
were double stained for Vti1a or Vti1b and synaptobrevin. Vti1a and
Vti1b were found in the cell bodies of pyramidal cells. Vti1a also
colocalized with synaptobrevin in mossy fiber nerve terminals. The
insets in the top panels show a threefold
magnification of an area from the mossy fiber nerve terminals. Scale
bar, 30 µM.
|
|
Vti1a- was enriched in synaptic vesicles
Next, we wanted to distinguish between Vti1a and the splice
variant Vti1a- and localize them to different compartments within the nerve terminal by subcellular fractionation and immunoblotting. First, synaptic vesicles were purified according to Huttner et al.
(1983) . Synaptic vesicles (CPG3) were isolated from brain homogenate
(H) via the fractions synaptosomes (P2) and high-speed pellet of lysed
synaptosomes (LP2) (Fig. 5). Vti1a-
copurified together with synaptic vesicles as indicated by the marker
synaptobrevin in the fractions P2, LP2, and CPG3. The lower molecular
weight ubiquitous Vti1a and the slightly larger brain-specific
Vti1a- were both present in early fractions of the purification,
such as H and P1. In contrast, only Vti1a- was found in the purified fractions LP2 and CPG3. These data indicate that Vti1a- was enriched in synaptic vesicles.

View larger version (34K):
[in this window]
[in a new window]
|
Figure 5.
Vti1a- copurified with synaptic vesicles.
Synaptosomes (P2) were isolated from rat brain
homogenate (H). The synaptosomes were
osmotically lysed and separated into a low-speed membrane fraction
(LP1) containing synaptic plasma membranes and a
high-speed pellet (LP2) with synaptic vesicles. The
synaptic vesicles were further purified by sucrose density gradient
centrifugation and chromatography on a CPG column yielding the highly
enriched fraction CPG3. Vti1a- copurified with the synaptic vesicle
marker synaptobrevin (Syb). Vti1b was present in
synaptic vesicles but was not enriched compared with homogenate.
|
|
Vti1b was present throughout the purification but was not enriched in
the CPG3 fraction. By comparing immunoblots of purified synaptic
vesicles and known amounts of recombinant Vti1b and Vti1a, it was
estimated that synaptic vesicles contain at least 10 times less Vti1b
than Vti1a- (data not shown).
To confirm that Vti1a- localized to synaptic vesicles, the CPG3
fraction was analyzed by immunogold electron microscopy. Vti1a
antiserum specifically stained synaptic vesicles (Fig.
6B). The labeling
intensities were low because the antisera were used at high dilutions
to avoid background staining (Fig. 6C). The antiserum
against the abundant synaptic vesicle protein synaptophysin gave a
stronger staining (Fig. 6A). Only small structures
representing synaptic vesicles were decorated by Vti1a antiserum in the
crude LP2 fraction; larger membranes were not labeled (data not shown). These data confirm that Vti1a was specifically localized to synaptic vesicles.

View larger version (75K):
[in this window]
[in a new window]
|
Figure 6.
Vti1a was localized to synaptic vesicles using
immunogold electron microscopy. The CPG3 fraction was adsorbed to
coated grids and incubated with antisera against the synaptic vesicle
marker synaptophysin (A), against Vti1a
(B), or without antiserum
(C) followed by 10 nm goat anti-rabbit IgG gold
conjugates and negative staining. Scale bar, 500 nm.
|
|
Vti1a- was enriched in clathrin-coated vesicles
Next, we wanted to examine whether Vti1a- is present on the
synaptic vesicle membrane throughout the synaptic vesicle recycling pathway. The synaptic vesicle membrane is incorporated into the plasma
membrane upon exocytosis and endocytosed via clathrin-coated vesicles.
Synaptic vesicles are reformed either by uncoating of these
clathrin-coated vesicles or via an endosomal intermediate (Hannah et
al., 1999 ). Clathrin-coated vesicles were isolated from synaptosomes
(Maycox et al., 1992 ). Clathrin light chain and the synaptic vesicle
proteins synaptophysin and synaptobrevin were used as marker proteins
for the enrichment of clathrin-coated vesicles (Fig.
7). Vti1a- coenriched in parallel with
synaptophysin and synaptobrevin, indicating that Vti1a- was
localized to clathrin-coated vesicles. Synaptophysin was less enriched
than clathrin light chain because the major pool of synaptophysin is
associated with synaptic vesicles. In contrast, less Vti1b was present
on purified clathrin-coated vesicles compared with the starting
material. Therefore, Vti1b was only a minor component of
clathrin-coated vesicles in the nerve terminal. As shown previously
(Maycox et al., 1992 ; Fischer von Mollard et al., 1994 ), rab3a and rab5
were deriched in clathrin-coated vesicles compared with the starting material of the last purification step (D2O
load).

View larger version (41K):
[in this window]
[in a new window]
|
Figure 7.
Vti1a- copurified with clathrin-coated vesicles
isolated from nerve terminals. Clathrin-coated vesicles
(CCVs) were isolated from synaptosomes with brain
homogenate as the starting material. Highly enriched clathrin-coated
vesicles were isolated from the high-speed pellet of lysed synaptosomes
(Ficoll load) via the fractions Ficoll SN and D2O load.
Vti1a- copurified in parallel with the synaptic vesicle markers
synaptobrevin (Syb), synaptophysin (Syp),
and SCAMP in clathrin-coated vesicles. Clathrin light chain
(CLC) was highly enriched. Very low amounts of Vti1b
were found in clathrin-coated vesicles.
|
|
Vti1a- was found on immunoisolated synaptic vesicles
and endosomes
By subcellular fractionation, we have shown that Vti1a- was
enriched in synaptic vesicles. To verify this finding, we used an
immunoisolation procedure as an independent method to purify organelles. Antibodies against synaptobrevin, rab3a, or rab5 were coupled to Eupergit beads and used for isolation of organelles from a
50,000 × g supernatant of brain homogenate (Burger et
al., 1989 ). Synaptic vesicles are the predominant organelle in this starting material because each neuron forms ~1000 synapses containing numerous synaptic vesicles. Golgi membranes, clathrin-coated vesicles, endocytic intermediates, and endosomes are much less abundant. Synaptobrevin as a membrane protein is present on synaptic vesicle membranes throughout their life cycle, i.e., is present on mature synaptic vesicles as well as on membranes during the biogenesis and in
the process of recycling, such as clathrin-coated vesicles, endocytic
intermediates, and endosomes. Rab3a and rab5 have overlapping but not
identical distributions. Rab3a is enriched in synaptic vesicles but
absent from clathrin-coated vesicles and Golgi membranes. Rab5 is found
predominantly on endosomes but also on a subpopulation of synaptic
vesicles. Almost all Vti1a- -containing organelles present in the
starting material were bound to synaptobrevin beads, as well as to
rab3a-beads (Fig. 8). Organelles
containing synaptobrevin were quantitatively isolated by synaptobrevin
beads and rab3a beads. These data confirm that Vti1a- was localized
to synaptic vesicles. Less Vti1a- -containing organelles were
isolated with rab5 beads. Some Vti1a- , as well as some
synaptobrevin, was not bound to rab5 beads because some synaptic
vesicles do not contain rab5. These data indicate that Vti1a-
together with synaptobrevin was present on synaptic vesicle membranes
throughout their life cycle.

View larger version (70K):
[in this window]
[in a new window]
|
Figure 8.
Vti1a- was found on immunoisolated synaptic
vesicles and endosomes. A 50,000 × g supernatant
of rat brain homogenate was incubated with antibodies against
synaptobrevin (Syb), rab3a, or rab5 coupled to Eupergit
beads. Glycine was coupled to control beads. The bead fractions were
washed and unbound, and bound fractions were separated by SDS-PAGE and
analyzed by immunoblotting for different markers. Most
Vti1a- -containing organelles could be isolated with synaptobrevin
and rab3a beads. A large fraction of Vti1a- was found on
rab5-containing organelles. Vti1b could also be immunoisolated with
synaptobrevin, rab3a, and rab5 beads but to a smaller extend than
Vti1a- . Control beads did not bind any proteins, and the endoplasmic
reticulum protein Sec61 was not bound to the immunobeads,
indicating that the immunoisolations of organelles were specific.
|
|
A fraction of Vti1b-containing organelles were immunoisolated with
synaptobrevin, rab3a, and rab5 beads. More than 50% of Vti1b remained
unbound in these immunoisolations. Because synaptic vesicles are so
abundant in the starting material, these data indicate that Vti1b was
present on synaptic vesicles at lower concentrations, as well as on
other membranes not connected to the synaptic vesicle pathway at higher concentrations.
Vti1a- did not coimmunoprecipitate with the exocytic
SNARE complex
Because we identified Vti1a- as a synaptic vesicle protein, we
wanted to determine whether Vti1a- was in a complex with the SNAREs
required for fusion of synaptic vesicles with the plasma membrane.
SNARE complexes were immunoprecipitated from Triton X-100 extracts of
synaptosomes using antibodies against Vti1a, SNAP-25, syntaxin 1, and
synaptobrevin, respectively. SNAREs in these immunoprecipitates were
detected by immunoblotting (Fig. 9).
Syntaxin 1, SNAP-25, and synaptobrevin were not present in the Vti1a
immunoprecipitates, although Vti1a- was quantitatively removed from
the extract. Vti1a antiserum coimmunoprecipitated syntaxin 6 as
described by Xu et al. (1998) , indicating that the Vti1a antiserum was
able to immunoprecipitate a SNARE complex (data not shown). The three
SNAREs of the exocytic SNARE complex were coimmunoprecipitated with
antibodies against synaptobrevin, syntaxin 1, or SNAP-25, indicating
that SNARE complexes were present under our experimental conditions.
Vti1a- was not coimmunoprecipitated by antibodies against syntaxin 1 and SNAP-25. These data indicate that Vti1a- was not part of the
exocytic SNARE complex. A small amount of Vti1a- was present in the
synaptobrevin immunoprecipitates. It is likely that this interaction is
weak or nonspecific because synaptobrevin was absent from Vti1a
immunoprecipitates.

View larger version (42K):
[in this window]
[in a new window]
|
Figure 9.
Vti1a- was not found in the exocytic SNARE
complex. SNARE complexes were isolated from Triton X-100 extracts of
synaptosomes using antisera against Vti1a, SNAP-25, syntaxin 1 (Syx1), or synaptobrevin (Syb). Vti1a
antiserum did not coimmunoprecipitate syntaxin 1, SNAP-25, or
synaptobrevin. SNAP-25, syntaxin 1, and synaptobrevin
coimmunoprecipitated as a SNARE complex.
|
|
Vti1a- was part of an NSF- and -SNAP-containing SNARE complex
in nerve terminals
After establishing that Vti1a- was not part of the exocytic
SNARE complex, we wanted to determine whether Vti1a- was part of a
novel SNARE complex in nerve terminals. SNARE complexes have the
characteristic ability to bind NSF and -SNAP and form a 20 S
complex. NSF disassembles these complexes in the presence of ATP and
Mg2+ (Söllner et al., 1993b ). Two
different approaches were taken to study whether Vti1a- in nerve
terminals exists in a SNARE complex, which can bind NSF and -SNAP
and is disassembled by NSF. First, detergent extracts from the
high-speed pellet of lysed synaptosomes (LP2) containing mostly
synaptic vesicles were incubated with NSF and -SNAP under conditions
that favor formation of a 20 S complex or without addition of NSF and
-SNAP. These extracts were separated on a glycerol density gradient,
and Vti1a- and synaptobrevin were identified by immunoblotting (Fig.
10). Significantly more Vti1a- and
synaptobrevin were found in the higher density fractions 11-14 in the
presence of NSF and -SNAP compared with the extract without
additions. These data indicate that a subfraction of Vti1a- was
present in a SNARE complex that bound NSF and -SNAP.

View larger version (30K):
[in this window]
[in a new window]
|
Figure 10.
Vti1a- was part of a SNARE complex that bound
NSF and -SNAP. Detergent extracts from lysed synaptosomes
(high-speed membrane fraction LP2) were incubated without additions
( ) or with NSF and -SNAP and separated on a glycerol gradient.
Fractions were analyzed by SDS-PAGE and immunoblotting. A subfraction
of Vti1a- and synaptobrevin (Syb) were shifted to
denser fractions 11-13 in the presence of NSF and -SNAP.
|
|
In the second approach, we used the observation that the four-helix
bundle in the assembled SNARE complex (core complex) is much more
protease-resistant than the rest of the molecules or the disassembled
SNAREs (Fasshauer et al., 1998a ; Poirier et al., 1998 ). Therefore, we
looked for a protease-resistant Vti1a- fragment under conditions in
which a SNARE complex is stable. Detergent extracts from the high-speed
pellet of lysed synaptosomes (LP2) were treated with trypsin under
different conditions: SNARE complex disassembly by addition of NSF,
-SNAP, ATP, and Mg2+ (Fig.
11A, first
lane); inhibition of disassembly in the presence of NSF and
-SNAP by EDTA (second lane); or without additions, maintaining SNARE complexes (third lane). Vti1a- was
detected in these fractions by immunoblotting. A protease-resistant
Vti1a- fragment of 14 kDa was identified in fractions favoring SNARE complex formation but not under conditions of SNARE complex
disassembly. Next, we wanted to determine whether the 14 kDa fragment
was part of the N-terminal or C-terminal half of Vti1a- with the
SNARE motif. The antiserum against Vti1a was affinity-purified
with an immobilized GST fusion with either the amino acid residues 1-114 of Vti1a or residues 115-192. The resulting antibodies were specific for the N-terminal or C-terminal part of Vti1a, respectively (data not shown). SNARE complex disassembly was also inhibited by
addition of ATP S to exclude effects of EDTA. The 14 kDa fragment was
only recognized by the antiserum specific for the C-terminal half (Fig.
11C) but not by the antiserum against the N-terminal part
(Fig. 11B). These data indicate that the C-terminal
part of Vti1a- with the SNARE motif was protected from
proteases only under conditions in which SNARE complexes are stable.
Therefore, Vti1a- was part of a novel SNARE complex in nerve
terminals.

View larger version (60K):
[in this window]
[in a new window]
|
Figure 11.
A C-terminal 14 kDa fragment of Vti1a-
with the SNARE motif was protease-protected under conditions of SNARE
complex assembly but not disassembly. Detergent extracts from lysed
synaptosomes (high-speed membrane fraction LP2) were incubated with NSF
and -SNAP plus ATP + Mg2+ (disassembly of SNARE
complexes), ATP S + Mg2+, or ATP + EDTA
(inhibition of disassembly). SNARE complexes remained assembled without
addition of NSF and -SNAP. Fractions were incubated with trypsin and
separated by SDS-PAGE. Immunoblots were developed with antisera against
Vti1a (left), against the N-terminal half of Vti1a
(middle), or against the C-terminal half of Vti1a
(right).
|
|
 |
DISCUSSION |
We identified Vti1a- as a brain-specific splice variant of
Vti1a. Our results show that the brain-specific Vti1a- but not the
ubiquitous Vti1a is enriched in synaptic vesicles and nerve terminal-derived clathrin-coated vesicles. Vti1a- and synaptobrevin were isolated to a similar degree by rab5 beads used to immunoisolate endosomes and rab5-containing synaptic vesicles. Our data indicate that
both synaptobrevin and Vti1a- are integral components of the
synaptic vesicle membrane throughout the vesicle life cycle. Vti1b was
found at low concentrations on synaptic vesicles and nerve
terminal-derived clathrin-coated vesicles. These data indicate that
Vti1b may only be a minor component or only present on a subpopulation
of synaptic vesicles.
The brain-specific Vti1a- had an insertion of seven amino acid
residues at position 114 of the ubiquitous Vti1a. This insertion is
located at the beginning of an evolutionary conserved predicted -helix. The domain that forms the SNARE-interacting helix according to sequence alignments (Fasshauer et al., 1998b ) is close by and starts
at amino acid residue 132. The close proximity of the brain-specific insert to the SNARE motif raises the possibility that binding of SNARE
partners is influenced by these additional amino acid residues. The
insertion may be important for sorting of Vti1a- to synaptic
vesicles. Consensus signals for targeting of proteins to synaptic
vesicles are still unknown. However, it was found that the SNARE motif
of synaptobrevin is important for localization to synaptic-like
microvesicles (SLMV) in the neuroendocrine cell line PC12 (Grote et
al., 1995 ).
Two lines of evidence demonstrated that Vti1a- was present in a
SNARE complex, which was disassembled by the addition of NSF and
-SNAP in nerve terminals. First, Vti1a- moved to denser fractions
in a glycerol gradient upon the addition of NSF and -SNAP,
suggesting the presence of Vti1a- in a SNARE complex that bound NSF
and -SNAP. In addition, a C-terminal fragment of Vti1a- with the
SNARE motif was protected from protease digestion only under conditions
in which SNARE complexes are stable but not when they are disassembled.
Although enriched on synaptic vesicles Vti1a- coimmunoprecipitated
with neither syntaxin 1 nor with SNAP-25. These data indicate that
Vti1a- does not function in the SNARE complex required for regulated
exocytosis. These results provide further evidence for the specific
formation of SNARE complexes in vivo. Although it was
observed that noncognate SNARE complexes can form in vitro
and have similar properties as cognate SNARE complexes (Fasshauer et
al., 1999 ; Yang et al., 1999 ), these noncognate SNARE complexes could
not be isolated by coimmunoprecipitation from cell extracts (Fasshauer
et al., 1999 ). Because we identified a novel, Vti1a- -containing
SNARE complex within the nerve terminal, our data also indicate that a
second membrane fusion step is required at some point in the life cycle
of synaptic vesicles and that Vti1a- functions in this step.
Vti1a- may be required for a fusion step during synaptic vesicle
recycling. Synaptic vesicle membranes can undergo several hundred
rounds of exocytosis and reloading with neurotransmitter. Therefore, it
is critical that the protein composition of synaptic vesicles is
maintained or restored during recycling. Several models have been
suggested for synaptic vesicle recycling (Cremona and De Camilli,
1997 ). Synaptic vesicles may transiently fuse with the plasma membrane,
release their content via the fusion pore, and reseal. This
kiss-and-run mechanism may be favored under conditions of strong
stimulation and avoids mixing of synaptic vesicle proteins with plasma
membrane proteins (Alés et al., 1999 ). Clathrin-coated vesicles
are intermediates in synaptic vesicle recycling, as was demonstrated
using several different approaches (Miller and Heuser, 1984 ; van der
Bliek and Meyerowitz, 1991 ). However, it is still under debate whether
uncoating of clathrin-coated vesicles results directly in synaptic
vesicles without any further intermediates and without fusion steps
(Takei et al., 1996 ; Murthy and Stevens, 1998 ) or whether an endosomal
intermediate is involved. Nerve terminals contain early endosomes, as
indicated by the presence of the early endosome marker protein rab5
(Fischer von Mollard et al., 1994 ). According to a model with a sorting
compartment, uncoated clathrin-coated vesicles would fuse with
endosomes requiring a SNARE complex. Vti1a- may be involved in this
fusion step. Synaptic vesicles are generated by budding from these
endosomes. Both pathways could exist in parallel. Synaptic vesicles may
reform from clathrin-coated vesicles as long as they have the correct protein composition. A passage through the endosome may be required as
a sorting step to restore the protein composition of synaptic vesicles.
Budding of SLMV has been reconstituted in vitro with PC12
cells from both an endosomal compartment and a subplasmalemmal compartment still connected with the plasma membrane. Synaptic vesicle
proteins accumulate in a subplasmalemmal tubulocisternal compartment
that is devoid of the endosomal marker transferrin receptor. SLMV
budding from this compartment is dependent on clathrin, AP-2, and other
proteins required for formation of clathrin-coated vesicles (Schmidt
and Huttner, 1998 ; Shi et al., 1998 ). On the other hand, SLMV are
formed from endosomes isolated from PC12 cells (Clift-O'Grady et al.,
1998 ). The resulting SLMV are devoid of transferrin receptor present in
the donor compartment. This budding step is dependent on the adaptor
complex AP-3. The transport of endocytosed synaptobrevin to early
endosomes and the budding of SLMV from tubular extensions of early
endosomes has been observed in PC12 cells using immunoelectron
microscopy (de Wit et al., 1999 )
It is possible that Vti1a- or Vti1b have a role in the biogenesis of
synaptic vesicles. The biogenesis of synaptic vesicles is still
unclear. Most data indicate that synaptic vesicle proteins leave the
TGN in vesicles destined for the constitutive secretory pathway (Hannah
et al., 1999 ). These vesicles are transported through the axon by fast
axonal transport. Mature synaptic vesicles are formed after several
rounds of constitutive exocytosis and recycling via an endosome. In
yeast, Vti1p is not involved in constitutive secretion and does not
bind the plasma membrane t-SNAREs Sso1p/Sso2p. In contrast, yeast Vti1p
binds all endosomal, vacuolar-lysosomal, and Golgi t-SNAREs (Fischer
von Mollard et al., 1997 ; Holthuis et al., 1998 ). Therefore, a role in
constitutive exocytosis seems unlikely.
So far we do not know the SNARE partners of Vti1a- and Vti1b in the
nerve terminal. Candidates would be endosomal SNARE proteins. Three
R-SNAREs have been localized to the endosomal system: endobrevin/ vesicle-associated membrane protein -8 (VAMP-8), which is expressed at
low levels in brain (Advani et al., 1998 ; Wong et al., 1998 ), VAMP-7/TI-VAMP (Advani et al., 1999 ), and VAMP-4 (Steegmaier et al.,
1999 ). Recently, endogenous VAMP-7/TI-VAMP has been localized to
somatodendritic tubules and vesicles in cultured neurons but not to
nerve terminals (Coco et al., 1999 ). Therefore, VAMP-7 and Vti1a- do
not colocalize in synapses. Q-SNAREs identified in TGN or endosomal
membranes are syntaxin 6 (Simonsen et al., 1999 ), syntaxin 12/13
(Prekeris et al., 1998 ; Tang et al., 1998b ), syntaxin 7, syntaxin 8 (Wang et al., 1997 ; Prekeris et al., 1999 ), syntaxin 11, which is
expressed at low levels in brain (Valdez et al., 1999 ), and syntaxin 10 (Tang et al., 1998a ).
The localization of Vti1a- to synaptic vesicles suggests that this
SNARE is more specialized for certain trafficking steps and may only
bind to a subset of SNARE proteins required for these trafficking steps
in vivo than the promiscuous yeast Vti1p.
 |
FOOTNOTES |
Received Feb. 2, 2000; revised May 10, 2000; accepted May 15, 2000.
This work was supported by grants from the Volkswagen Stiftung and the
Deutsche Forschungsgemeinschaft SFB 532, TP B6, and TP B7. We thank B. Köhler and M. Druminski for excellent technical assistance and S. Lausmann for preparing and staining the hippocampal sections. We also
thank Dr. C. Rosenmund (Max-Planck Institut für Biophysikalische
Chemie, Göttingen, Germany) for generating the neuronal cell
cultures and M. Margittai and S. Pabst for providing purified,
recombinant NSF and -SNAP. We acknowledge Dr. C. Barnstable (New
Haven, CT) and Dr. E. Hartmann (Universität Göttingen, Göttingen, Germany) for the kind gift of antibodies and S. Whiteheart and J. E. Rothman (Sloan-Kettering Center, New York,
NY) for the kind gift of expression constructs. We are grateful to Dr.
K. von Figura and Dr. R. Jahn for their support, stimulating
discussions, and critical reading of this manuscript.
Correspondence should be addressed to Gabriele Fischer von Mollard,
Zentrum Biochemie und Molekulare Zellbiologie, Abteilung Biochemie II,
Universität Göttingen, Heinrich-Düker Weg 12, 37073 Göttingen, Germany. E-mail: mollard{at}uni-bc2.gwdg.de.
 |
REFERENCES |
-
Advani RJ,
Bae HR,
Bock JB,
Chao DS,
Doung YC,
Prekeris R,
Yoo JS,
Scheller RH
(1998)
Seven novel mammalian SNARE proteins localize to distinct membrane compartments.
J Biol Chem
273:10317-10324[Abstract/Free Full Text].
-
Advani RJ,
Yang B,
Prekeris R,
Lee KC,
Klumperman J,
Scheller RH
(1999)
VAMP-7 mediates vesicular transport from endosomes to lysosomes.
J Cell Biol
146:765-775[Abstract/Free Full Text].
-
Alés E,
Tabares L,
Poyato JM,
Valero V,
Lindau M,
de Toledo GA
(1999)
High calcium concentrations shift the mode of exocytosis to the kiss-and-run mechanism.
Nat Cell Biol
1:40-44[Medline].
-
Barnstable CJ,
Hofstein R,
Akagawa K
(1985)
A marker of early amacrine cell development in rat retina.
Dev Brain Res
20:286-290.
-
Bruns D,
Engers S,
Yang C,
Ossig R,
Jeromin A,
Jahn R
(1997)
Inhibition of transmitter release correlates with the proteolytic activity of tetanus toxin and botulinus toxin A in individual cultured synapses of Hirudo medicinalis.
J Neurosci
17:1898-1910[Abstract/Free Full Text].
-
Burger PM,
Mehl E,
Cameron PL,
Maycox PR,
Baumert M,
Lottspeich F,
De Camilli P,
Jahn R
(1989)
Synaptic vesicles immunoisolated from rat cerebral cortex contain high levels of glutamate.
Neuron
3:715-720[ISI][Medline].
-
Clift-O'Grady L,
Desnos C,
Lichtenstein Y,
Faúndes V,
Horng JT,
Kelly RB
(1998)
Reconstitution of synaptic vesicle biogenesis from PC12 cell membranes.
Methods
16:150-159[ISI][Medline].
-
Coco S,
Raposo G,
Martinez S,
Fontaine JJ,
Takamori S,
Zahraoui A,
Jahn R,
Matteoli M,
Louvard D,
Galli T
(1999)
Subcellular localization of tetanus neurotoxin-insensitive vesicle-associated membrane protein (VAMP)/VAMP7 in neuronal cells: evidence for a novel membrane compartment.
J Neurosci
15:9803-9812.
-
Cremona O,
De Camilli P
(1997)
Synaptic vesicle endocytosis.
Curr Opin Neurobiol
7:323-330[ISI][Medline].
-
de Wit H,
Lichtenstein Y,
Geuze HJ,
Kelly RB,
van der Sluijs P,
Klumperman J
(1999)
Synaptic vesicles from by budding from tubular extensions of sorting endosomes in PC12 cells.
Mol Biol Cell
10:4163-4176[Abstract/Free Full Text].
-
Fasshauer D,
Eliason W,
Brunger A,
Jahn R
(1998a)
Identification of a minimal core of the synaptic SNARE complex sufficient for reversible assembly and disassembly.
Biochemistry
37:10354-10362[Medline].
-
Fasshauer D,
Sutton RB,
Brunger AT,
Jahn R
(1998b)
Conserved structural features of the synaptic fusion complex: SNARE proteins reclassified as Q- and R-SNAREs.
Proc Natl Acad Sci USA
95:15781-15786[Abstract/Free Full Text].
-
Fasshauer D,
Antonin W,
Margittai M,
Pabst S,
Jahn R
(1999)
Mixed and non-cognate SNARE complexes.
J Biol Chem
274:15440-15446[Abstract/Free Full Text].
-
Fischer von Mollard G,
Stevens TH
(1998)
A Human homolog can functionally replace the yeast v-SNARE Vti1p in two vesicle transport pathways.
J Biol Chem
273:2624-2630[Abstract/Free Full Text].
-
Fischer von Mollard G,
Stevens TH
(1999)
The Saccharomyces cerevisiae v-SNARE Vti1p is required for multiple membrane transport pathways to the vacuole.
Mol Biol Cell
10:1719-1732[Abstract/Free Full Text].
-
Fischer von Mollard G,
Stahl B,
Walch-Solimena C,
Takei K,
Daniels L,
Khokhlatchev A,
De Camilli P,
Südhof TC,
Jahn R
(1994)
Localization of rab5 to synaptic vesicles identifies endosomal intermediate in synaptic recycling pathway.
Eur J Cell Biol
65:319-326[ISI][Medline].
-
Fischer von Mollard G,
Nothwehr SF,
Stevens TH
(1997)
The yeast v-SNARE Vti1p mediates two vesicle transport pathways through interactions with the t-SNAREs Sed5p and Pep12p.
J Cell Biol
137:1511-1524[Abstract/Free Full Text].
-
Grote E,
Hao JC,
Bennett MK,
Kelly RB
(1995)
A targeting signal in VAMP regulating transport to synaptic vesicles.
Cell
81:581-589[ISI][Medline].
-
Hannah M,
Weiss U,
Huttner WB
(1998)
Differential extraction of proteins from paraformaldehyde-fixed cells: lessons from synaptophysin and other membrane proteins.
Methods
16:170-181[ISI][Medline].
-
Hannah MJ,
Schmidt AA,
Huttner WB
(1999)
Synaptic vesicle biogenesis.
Annu Rev Cell Dev Biol
15:733-798[ISI][Medline].
-
Hanson PI,
Otto H,
Barton N,
Jahn R
(1995)
The N-ethylmaleimide-sensitive fusion protein and alpha-SNAP induce a conformational change in syntaxin.
J Biol Chem
270:16955-16961[Abstract/Free Full Text].
-
Holthuis JCM,
Nichols BJ,
Dhruvakumar S,
Pelham HRB
(1998)
Two syntaxin homologues in the TGN/endosomal system in yeast.
EMBO J
17:113-126[ISI][Medline].
-
Huttner WB,
Schiebler W,
Greengard P,
De Camilli P
(1983)
Synapsin I (protein I) a nerve terminal specific phosphoprotein. Its association with synaptic vesicles studied in a highly purified synaptic vesicle preparation.
J Cell Biol
96:1374-1388[Abstract/Free Full Text].
-
Jahn R,
Sudhof T
(1999)
Membrane fusion and exocytosis.
Annu Rev Biochem
68:863-911[ISI][Medline].
-
Jahn R,
Schiebler W,
Ouitmet C,
Greengard P
(1985)
A 38,000-dalton membrane protein (p38) present in synaptic vesicles.
Proc Natl Acad Sci USA
82:4137-4141[Abstract/Free Full Text].
-
Lupashin VV,
Pokrovskaya ID,
McNew JA,
Waters MG
(1997)
Characterization of a novel yeast SNARE protein implicated in Golgi retrograde traffic.
Mol Biol Cell
8:2659-2676[Abstract/Free Full Text].
-
Matteoli M,
Takei K,
Cameron R,
Hurlbut P,
Johnston PA,
Südhof TC,
Jahn R,
De Camilli P
(1991)
Association of rab3A with synaptic vesicles at late stages of the secretory pathway.
J Cell Biol
115:625-633[Abstract/Free Full Text].
-
Maycox PR,
Link E,
Reetz A,
Morris SA,
Jahn R
(1992)
Clathrin-coated vesicles in nervous tissue are involved primarily in synaptic vesicle recycling.
J Cell Biol
118:1379-1388[Abstract/Free Full Text].
-
Miller TM,
Heuser JE
(1984)
Endocytosis of synaptic vesicle membrane at the frog neuromuscular junction.
J Cell Biol
98:685-698[Abstract/Free Full Text].
-
Mugnaini E,
Dahl AL
(1983)
Zinc-aldehyde fixation for light-microscopic immunocytochemistry of nervous tissues.
J Histochem Cytochem
31:1435-1438[Abstract].
-
Murthy VN,
Stevens CF
(1998)
Synaptic vesicles retain their identity through the endocytic cycle.
Nature
392:497-501[Medline].
-
Poirier M,
Hao J,
Malkus P,
Chan C,
Moore M,
King D,
Bennett M
(1998)
Protease resistance of syntaxin.SNAP-25.VAMP complexes. Implications for assembly and structure.
J Biol Chem
273:11370-11377[Abstract/Free Full Text].
-
Prekeris R,
Klumperman J,
Chen YA,
Scheller RH
(1998)
Syntaxin 13 mediates cycling of plasma membrane proteins via tubulovesicular recycling endosomes.
J Cell Biol
143:957-971[Abstract/Free Full Text].
-
Prekeris R,
Yang B,
Oorschot V,
Klumperman J,
Scheller RH
(1999)
Differential roles of syntaxin 7 and syntaxin 8 in endosomal trafficking.
Mol Biol Cell
10:3891-3908[Abstract/Free Full Text].
-
Rosenmund C,
Feltz A,
Westbrook G
(1995)
Synaptic NMDA receptor channels have a low open probability.
J Neurosci
15:2788-2795[Abstract].
-
Rossi G,
Salminen A,
Rice L,
Brunger A,
Brennwald P
(1997)
Analysis of a yeast SNARE complex reveals remarkable similarity to the neuronal SNARE complex and a novel function for the C-terminus of the SNAP-25 homolog, Sec9.
J Biol Chem
272:16610-16617[Abstract/Free Full Text].
-
Rothman J
(1994)
Mechanism of intracellular protein transport.
Nature
372:55-63[Medline].
-
Schmidt A,
Huttner WB
(1998)
Biogenesis of synaptic-like microvesicles in perforated PC12 cells.
Methods
16:160-169[ISI][Medline].
-
Shi G,
Faúndez V,
Roos J,
Dell'Angelica EC,
Kelly RB
(1998)
Neuroendocrine synaptic vesicles are formed in vitro by both clathrin-dependent and clathrin-independent pathways.
J Cell Biol
143:947-955[Abstract/Free Full Text].
-
Simonsen A,
Gaullier JM,
D'Arrigo A,
Stenmark H
(1999)
The rab5 effector EEA1 interacts directly with syntaxin 6.
J Biol Chem
274:28857-28860
|