 |
Previous Article | Next Article 
The Journal of Neuroscience, August 15, 2000, 20(16):5989-5996
The Ets Transcription Factor GABP Is Required for Postsynaptic
Differentiation In Vivo
Alexandre
Briguet and
Markus A.
Ruegg
Department of Pharmacology/Neurobiology, Biozentrum, University of
Basel, CH-4056 Basel, Switzerland
 |
ABSTRACT |
At chemical synapses, neurotransmitter receptors are concentrated
in the postsynaptic membrane. During the development of the
neuromuscular junction, motor neurons induce aggregation of acetylcholine receptors (AChRs) underneath the nerve terminal by the
redistribution of existing AChRs and preferential transcription of the
AChR subunit genes in subsynaptic myonuclei. Neural agrin, when
expressed in nonsynaptic regions of muscle fibers in
vivo, activates both mechanisms resulting in the assembly of a
fully functional postsynaptic apparatus. Several lines of evidence
indicate that synaptic transcription of AChR genes is primarily
dependent on a promoter element called N-box. The Ets-related
transcription factor growth-associated binding protein (GABP)
binds to this motif and has thus been suggested to regulate synaptic
gene expression. Here, we assessed the role of GABP in synaptic gene
expression and in the formation of postsynaptic specializations
in vivo by perturbing its function during postsynaptic
differentiation induced by neural agrin. We find that neural
agrin-mediated activation of the AChR subunit promoter is
abolished by the inhibition of GABP function. Importantly, the number
of AChR aggregates formed in response to neural agrin was strongly
reduced. Moreover, aggregates of acetylcholine esterase and utrophin,
two additional components of the postsynaptic apparatus, were also
reduced. Together, these results are the first direct in
vivo evidence that GABP regulates synapse-specific gene
expression at the neuromuscular junction and that GABP is required for
the formation of a functional postsynaptic apparatus.
Key words:
GABP; transcription; dominant-negative; neuromuscular
junction; synapse; acetylcholine receptor
 |
INTRODUCTION |
Chemical synapses are highly
specialized subcellular structures destined for communication between
cells in the nervous system. To warrant efficient signal transmission,
neurotransmitter receptors are clustered underneath the nerve terminal.
Motor neuron-induced differentiation of the postsynaptic apparatus, and
in particular clustering of the acetylcholine receptors (AChRs), is
based on at least two different mechanisms. First, existing molecules
are reorganized to accumulate underneath the nerve terminal. Second, transcription of synaptic genes is restricted to the myonuclei underlying the presynaptic nerve terminal. The signals for activating both mechanisms are derived from motor neurons (Sanes and Lichtman, 1999 ). Recent evidence strongly suggests that certain splice variants of the large heparan sulfate proteoglycan agrin are sufficient to
activate both mechanisms (for review, see Ruegg and Bixby, 1998 ).
Clustering of existing molecules is mediated directly by the binding of
neural agrin to a receptor complex combining the muscle-specific
receptor tyrosine kinase (MuSK) (Glass et al., 1996 ). Alterations in
gene transcription in turn are thought to be an indirect effect of
agrin affecting activation of a second signaling system, including the
neuregulins and their receptors, the erbB receptors (Fischbach and
Rosen, 1997 ; Meier et al., 1998b ; Rimer et al., 1998 ).
Expression of synaptic genes in the polynucleated muscle fiber changes
during development. First, as myoblasts fuse, most of these genes are
transcribed throughout the myofiber in a tissue-specific manner as part
of the myogenic program driven by basic helix-loop-helix (bHLH)
transcription factors of the MyoD family (for review, see Edmondson and
Olson, 1993 ). Upon innervation and initiation of electrical activity,
transcription of synaptic genes is downregulated throughout the
myofiber (Eftimie et al., 1991 ; Witzemann and Sakmann, 1991 ; Buonanno
et al., 1992 ; Huang et al., 1992 ; Neville and Schmidt, 1992 ; Huang et
al., 1993 ; Mendelzon et al., 1994 ; Merlie et al., 1994 ). At synaptic
sites, expression of many synaptic genes, including AChR , , ,
and subunits (Goldman and Staple, 1989 ; Brenner et al., 1990 ),
rapsyn, N-CAM (Moscoso et al., 1995 ), and MuSK (Bowen et al.,
1998 ), is maintained. Moreover, transcription of the AChR subunit
(Brenner et al., 1990 ) and expression of the laminin 2 chain (Patton
et al., 1997 ) are selectively initiated upon innervation. Persistent
transcription of synaptic genes in subsynaptic myonuclei implies the
existence of mechanisms that are able to locally activate gene
transcription in electrically active myofibers.
Activation of gene transcription by bHLH transcription factors requires
the E-box promoter element (Weintraub, 1993 ; Duclert and Changeux,
1995 ). However, synapse-specific gene expression is independent of this
motif (Duclert et al., 1993 ; Chu et al., 1995 ). Efforts to map the
motif necessary for the synaptic gene expression have led to the
identification of the N-box (Koike et al., 1995 ). In cultured muscle
cells, this N-box motif (CCGGAA) is necessary for neuregulin-induced
upregulation of the genes encoding AChR and subunits (Duclert
et al., 1996 ), utrophin (Gramolini et al., 1999 ; Khurana et al., 1999 ),
and acetylcholine esterase (AChE) (Chan et al., 1999 ). The
transcription factor that binds to this motif is the Ets-related
growth-associated binding protein (GABP) (Fromm and Burden,
1998 ; Schaeffer et al., 1998 ). Cotransfection of dominant-negative
mutants of GABP inhibits neuregulin-induced expression of reporter
constructs of the AChR and the AChR promoter in cultured muscle
cells (Schaeffer et al., 1998 ). GABP is an ubiquitously expressed
transcription factor composed of two subunits, GABP and GABP
(LaMarco et al., 1991 ). The GABP subunit, a member of the Ets
family of transcription factors, mediates DNA binding (Thompson et al.,
1991 ). The GABP subunit has no intrinsic DNA-binding property but
has an N-terminal domain that mediates highly specific interaction with
GABP (Thompson et al., 1991 ; Brown and McKnight, 1992 ; Batchelor et
al., 1998 ). In addition, the C-terminal part of GABP is required for
GABP-induced transcriptional activation (Sawa et al., 1996 ). Because
GABP binds to the N-box and the N-box is involved in the synaptic
expression of the AChR and subunits, utrophin, and the AChE
gene, it has been proposed that GABP may serve as the transcriptional
activator for synaptic gene expression. To test this hypothesis, it is
necessary to study the role of GABP during postsynaptic differentiation in vivo. This is particularly important because muscle
fibers are electrically active and electrical activity strongly
influences transcription of synaptic genes. Here, we induce
postsynaptic differentiation in innervated muscle fibers by ectopic
expression of neural agrin and investigate the function of GABP during
this process.
 |
MATERIALS AND METHODS |
Constructs. The expression construct
encoding full-length chick agrin cAgrin7A4B8 has
been described previously (Denzer et al., 1995 ). The NLS-GFP
construct encoding green fluorescent protein (GFP) with a nuclear
localization sequence (NLS) has been described by Jones et al. (1999) .
The GABP and GABP cDNAs were amplified by PCR from a C2C12 mouse
muscle cells cDNA library using the following primers: sGABP , 5'
GGAATTCGTCTTCAACCATGACTA 3'; asGABP , 5' TGCATGCATGGTCCTAGGTCTCAAATC
3'; sGABP , 5' GGAATTCGAAGCTTTTCCAGATGT 3'; and asGABP , 5'
TGCATGCATGTTCATGGCAGCTAAAC 3'. The PCR products were cloned into pcDNA1
(Invitrogen, Carlsbad, CA) opened with EcoRI and
EcoRV. The dominant-negative construct of GABP
(GABP DN) was generated by PCR using
primers 5' GGAATTCGAAGCTTTTCCAGATGT 3' (sGABP ) and 5'
CTATCATTCTGCACATTCCACCC 3' (asGABP DN)
and cloning the PCR product into pcDNA1 opened with EcoRI
and EcoRV. The GABP _myc construct was made
by PCR using primers 5' GGAATTCGTCTTCAACCATGACTA 3' (sGABP ) and 5'
GCTCTAGAAATCTCTTTGTCTGCCTGT 3' (asGABP XbaI) and cloning
the PCR product into the EcoRI and XbaI sites of
p_myc, a pcDNA1-based vector that includes five copies of
the myc epitope (Meier et al., 1998a ). The NLS-LacF plasmid was
constructed by cloning a SalI-SphI fragment of
the pnlacF plasmid (Lanford et al., 1988 ) into pcDNA1
opened with XhoI and SphI. The AChR subunit
reporter construct has been described previously (Jones et al., 1996 ).
Plasmids were purified using a Nucleobond AX 500 kit (Macherey-Nagel,
Düren, Germany). PCR and DNA manipulations for cloning
were performed according to standard protocols. All constructs were
verified by DNA sequencing.
Transfection of GABP constructs in COS-7 cells. COS-7 cells
(Gluzman, 1981 ) were transiently transfected with GABP expression constructs using the Fugene 6 transfection reagent (Roche Diagnostics, Rotkreuz, Switzerland). The cells were then processed for intracellular anti-myc staining as follows. After washing with PBS, the cells were
fixed for 30 min at room temperature with 4% paraformaldehyde and 11%
sucrose in 0.1 M potassium phosphate buffer, pH
7.2. After rinsing with PBS and 20 mM glycine in
PBS, cells were permeabilized with PBS containing 0.1% saponin (PBSS)
and 10% normal goat serum (NGS) for 20 min at room temperature. The
cells were then incubated with the anti-myc monoclonal antibody 9E10
(Evan et al., 1985 ) diluted to 1 µg/ml in PBSS and 10% NGS. After
four washes with PBSS, cells were incubated with a Cy3-conjugated goat
anti-mouse IgG (Molecular Probes, Eugene, OR), diluted to 0.5 µg/ml
in PBSS and 10% NGS for 1 hr at room temperature. After washing,
cultures were mounted on glass coverslips with citifluor (Plano) and
examined with a microscope equipped with epifluorescence (Leica,
Nussloch, Germany).
Injection of cDNA into muscle fibers. The expression
plasmids were injected into single muscle fibers of young adult rats (120 gm) as described previously (Jones et al., 1997 ; Meier et al.,
1997 ). In the AChR subunit reporter experiment, the NLS-LacF construct and the AChR reporter were injected at 100 ng/µl, the agrin construct was injected at 4 ng/µl, and the
GABP DN construct was injected at 50 ng/µl. The total amount of plasmid injected was kept constant in each
experiment by complementing with pcDNA1 vector (Invitrogen). Two weeks
after injection, the soleus muscle was taken out and frozen in liquid
nitrogen, the injected region was homogenized in 500 µl reporter
lysis buffer (Promega, Madison, WI), and luciferase activity was
measured using the luciferase assay system (Promega). Reporter gene
activity was normalized to the -galactosidase activity derived from
the coinjected NLS-LacF plasmid. In all remaining experiments, the agrin construct was injected at 4 ng/µl, the NLS-GFP construct at 50 ng/µl, and the NLS-LacF construct or the
GABP DN construct at 50 ng/µl.
Immunohistochemistry and antibodies. To visualize AChRs, the
entire soleus muscle was bathed for 1 hr at 4°C in
L-15 medium (Life Technologies, Gaithersburg, MD)
containing 1 µg/ml alexa_ -bungarotoxin or
rhodamine_ -bungarotoxin (Molecular Probes). For the
utrophin staining, 14-µm-thick frozen cross-sections were first fixed
with 1% paraformaldehyde for 5 min, washed briefly with PBS,
and preincubated for 15 min in PBS supplemented with 5% horse serum,
1% bovine serum albumin, and 0.01% Triton X-100. Sections were
incubated overnight at 4°C with the anti-utrophin monoclonal antibody
NCL-DRP2 (Novocastra, Newcastle upon Tyne, UK) diluted 1:200 in PBS,
5% horse serum, 1% bovine serum albumin, and 0.01% Triton X-100. For
detection, Cy3-conjugated goat anti-mouse IgG was used.
Acetylcholinesterase was detected on cross-sections according to
Pestronk and Drachman (1978) . Whole-mount preparations were examined
with a confocal microscope (Leica) and cross-sections with a microscope
equipped with epifluorescence (Leica).
Quantification. Quantification of AChR clustering is
presented as the number of fibers that are AChR cluster-positive on
each consecutive cross-section made across entire injection sites. Cross-sections were preferred to whole-mount preparations for the
evaluation because they allow to attribute clusters to individual fibers unequivocally. A muscle fiber was defined cluster-positive when a clear and sharp rhodamine_ -bungarotoxin
staining was detected on its membrane. A given muscle fiber was defined
cluster-positive independently of the size or of the number of the AChR clusters.
 |
RESULTS |
A dominant-negative mutant of GABP abrogates activation of the
AChR subunit promoter in vivo
Transcriptional activation of genes by GABP requires
heterodimerization of GABP and GABP . Whereas the subunit
contains the DNA-binding domain (Fig.
1A, Ets
domain), GABP provides the signals for nuclear localization
and transactivation of gene transcription. The N-terminal region of the
subunit contains Notch/ankyrin-like repeats that mediate
heterodimerization. To generate a dominant-negative mutant of GABP
(GABP DN), we deleted the 52 most C-terminal amino acids
(aa) of the subunit. This region contains a leucine-zipper-like
structure that is necessary for transcriptional activation and for
homodimerization (Fig. 1A). A similar deletion
construct has been shown to act as a dominant-negative for
GABP-mediated transcription in cultured chick muscle cells (Schaeffer
et al., 1998 ). To test whether GABP DN still dimerizes
with the GABP subunit, which is requisite for its acting as a
dominant-negative mutant, we transfected COS cells with
GABP DN and a myc-tagged GABP construct. Whereas
GABP -myc, when transfected alone, was localized in the cytoplasm
(Fig. 1B, left), most of the subunit was localized in the cell nucleus when GABP DN
was cotransfected (Fig. 1B,
right). Thus, GABP DN oligomerizes with
GABP and translocates the protein complex into the cell nucleus.

View larger version (64K):
[in this window]
[in a new window]
|
Figure 1.
Structure of GABP and subunits and
expression in COS-7 cells. A, Scheme of the and subunits of GABP and the dominant-negative construct. The black
region (aa 318-399) indicates the Ets-related DNA binding
domain of GABP . The region between aa 318-454 is necessary for the
binding to GABP . In GABP , the gray region (aa
1-130) represents four tandem repeats of a Notch/ankyrin motif
required for heterodimerization with GABP . The black
bar indicates the approximate location of a nuclear
localization sequence. The hatched region (aa 341-370)
represents the transactivation domain. In the dominant-negative mutant
(GABP DN) used in this study, the last 52 amino acids of
GABP were deleted. B, Intracellular anti-myc staining
of COS cells transfected with myc-tagged GABP
constructs. GABP is localized in the cytoplasm
(left). Upon cotransfection with GABP DN,
GABP accumulates in the cell nucleus (right). This
indicates that the truncated GABP DN protein dimerizes
with the subunit and translocates into the cell nucleus. Scale bar,
20 µm.
|
|
It has been demonstrated previously that expression of neural agrin in
extrasynaptic regions of muscle fibers induces the formation of ectopic
postsynaptic-like apparatus with mature functional properties,
including upregulation of AChR mRNA (Cohen et al., 1997 ; Jones et
al., 1997 ; Meier et al., 1997 ; Rimer et al., 1997 ). Thus, this model
system is suitable for assessing the function of candidate genes in the
development of postsynaptic specializations in vivo. In
particular, it allows the study of mechanisms locally activating the
transcription of synaptic genes in innervated muscle fibers. We
therefore used this paradigm to determine whether GABP is responsible
for the upregulation of the AChR subunit during postsynaptic
differentiation. To this aim, we tested whether GABP DN
was able to block induction of the AChR subunit expression using a
reporter construct in which a promoter fragment of the mouse AChR
subunit gene drives the expression of a luciferase gene (Fig.
2A). This reporter
construct is activated by substrate-bound agrin and by neuregulin in a
mouse muscle cell line (Jones et al., 1996 ). The subunit reporter
construct was injected into extrasynaptic regions of 30 individual
innervated myofibers of the rat soleus muscle together with a construct
in which -galactosidase is expressed under the control of the
cytomegalovirus promoter (NLS-LacF). Luciferase activity was measured 2 weeks later in homogenates of the injected muscles and normalized to
the -galactosidase activity derived from the NLS-LacF construct. The
normalized luciferase activity measured in muscles injected with the
AChR subunit reporter alone was set as 100% (Fig.
2B, first column). Coinjection of
an expression plasmid encoding full-length neural agrin
(cAgrin7A4B8) (Denzer et al., 1995 ) increased the
expression of the reporter more than threefold (Fig.
2B, second column). Upon
coinjection of GABP DN, luciferase activity dropped to
the level of the noninduced situation (Fig. 2B,
third column). These results show that upregulation of
the AChR gene by neural agrin in vivo requires a
functional GABP / complex, and they suggest that the basal
activity of the AChR promoter does not depend on GABP. Indeed, an
AChR promoter construct in which the N-box is mutated shows the same
basal activity as the wild-type promoter in innervated muscle fibers
(A. Briguet, A. Abicht, M. A. Ruegg, and H. Lochmüller,
unpublished observation). Moreover, GABP-dependent induction of gene
transcription by neural agrin is specific for the AChR promoter
because we did not observe any alterations in the level of expression
of a luciferase reporter driven by a 1.3 kb fragment of the muscle
creatine kinase (MCK) promoter (Jaynes et al., 1986 ). In these
experiments, normalized expression of the MCK reporter was 100%
(reporter alone), 88% (reporter plus
cAgrin7A4B8), and 87% (reporter plus
cAgrin7A4B8 plus GABP DN).

View larger version (15K):
[in this window]
[in a new window]
|
Figure 2.
Agrin induces the expression of an AChR subunit
reporter construct via a GABP-dependent mechanism in
vivo. A, Diagram of the AChR subunit reporter
construct used in this study. A fragment of the subunit gene
(gray) extending 216 bp upstream from the
transcription start site drives the expression of a luciferase gene.
This fragment contains two E-boxes (E), putative
binding sites for basic helix-loop-helix myogenic factors, and one
N-box (N). B, In each individual
experiment, luciferase activity of the AChR reporter construct
injected alone was set as 100% (first column).
Coinjection of expression constructs encoding full-length neural agrin
(cAgrin7A4B8) increases luciferase activity more
than threefold (second column; p < 0.01). This increase is abolished by expression of the
dominant-negative mutant of GABP (third column;
p < 0.01). Data represent mean ± SDs of
three independent injections (3 injected rats). Note that, in each
individual injection, luciferase activity was normalized to the
-galactosidase activity derived from the coinjected NLS-LacF
construct. The effect of neural agrin and GABP DN is
specific for the AChR promoter because a muscle creatine kinase
promoter construct was not affected by either condition (reporter
alone, 100%; reporter plus cAgrin7A4B8, 88.3%;
reporter plus cAgrin7A4B8 plus GABP DN,
87.2%).
|
|
GABP DN prevents the induction of ectopic
postsynaptic structures in innervated muscle fibers
To address the question whether a functional GABP / complex
is required for the formation of agrin-induced postsynaptic structures in vivo, we examined next the influence of the
dominant-negative construct of GABP on the induction of ectopic AChR
clusters. In control experiments, cDNA encoding full-length neural
chick agrin (cAgrin7A4B8) was injected together
with an expression construct for nuclear-targeted -galactosidase
(NLS-LacF) to adjust the amount of protein synthesized by the injected
fiber. To identify the injected muscle fibers, a third construct
encoding nuclear-targeted GFP (NLS-GFP) was always included. Two weeks
after injection, ectopic postsynaptic specializations were visualized
using rhoda-mine-labeled -bungarotoxin
(Rh bgt). As shown in Figure
3A, control-injected muscle
fibers expressed many AChR clusters. Myonuclei often aggregated underneath such AChR clusters (arrowheads), indicating that
these ectopic postsynaptic structures show also signs of synaptic
maturation (Jones et al., 1997 ). In muscle fibers injected with the
dominant-negative GABP mutant, no or only a few AChR clusters were
associated with the injected fibers (Fig. 3B,
GABP DN). Under these and control
conditions, neural agrin is able to diffuse to adjacent fibers;
therefore, we often observed AChR clusters in nearby, noninjected
muscle fibers (Fig. 3, asterisks).

View larger version (64K):
[in this window]
[in a new window]
|
Figure 3.
Whole-mount confocal views of
cDNA-injected muscle fibers. A, Two representative
examples of control muscle fibers that were injected with a construct
encoding NLS-LacZ, full-length neural agrin and NLS-GFP. The injected
fibers are identified by the presence of GFP-positive nuclei
(GFP). AChR clusters are stained with
rhodamine_ -bungarotoxin
(Rh_ -bgt). Many
injected fibers form AChR clusters in response to neural agrin and
aggregates of GFP-positive nuclei are found underneath the AChR
clusters (arrowheads). B, Two
representative examples of muscle fibers expressing the
dominant-negative mutant of GABP , neural agrin, and NLS-GFP.
GFP-positive muscle fibers are devoid of AChR clusters and aggregates
of myonuclei. Note that, in neighboring noninjected muscle fibers, AChR
aggregates were formed (asterisks). The fluorescence
spots that appear in both channels are unspecific staining. Scale bar,
50 µm.
|
|
To quantify the effect of GABP DN on
AChR clustering, we made consecutive cross-sections through the entire
injection sites and determined the number of GFP-positive fibers
(GFP), the number of GFP-positive fibers that expressed AChR
clusters (C/GFP) and the total number of fibers with AChR
clusters (Ctot), on individual sections (Fig.
4A,B).
Cross-sections were used for this quantification because only this
method allows to assign AChR clusters unequivocally to individual
injected or neighboring, noninjected muscle fibers (see Fig.
4C as an example). Figure 4, A and B,
shows the counts for one muscle from control (Fig.
4A) and
GABP DN-injected (Fig.
4B) animals. In the examples shown in Figure 4, A and B, the injection sites extended over 50 consecutive, 14-µm-thick cross-sections. Although the number of
GFP-positive fibers was approximately the same in both cases (15-17 vs
16-19), the total number of fibers with AChR clusters and the number
of GFP-positive muscle fibers with AChR clusters clearly decreased in
muscle injected with the dominant-negative GABP construct. To
compare the proportion of injected fibers that developed AChR clusters
in the control injection versus the
GABP DN injection, we summed the numbers
obtained on individual cross-sections throughout the injection sites
and set the number of injected fibers (GFP-positive) as 100%. The
counts obtained from three control and three
GABP DN injections are listed in Table
1. Whereas in the controls 29.6 ± 3.4% of the injected muscle fibers developed AChR clusters, in the
GABP DN injections only 12.3 ± 1.6% of the injected muscle fibers developed AChR clusters. The number
of adjacent, noninjected muscle fibers that formed AChR clusters was
not significantly different in the GABP DN-injected compared with the
control-injected muscles. This shows that the capability of neural
agrin to induce AChR clustering remained unaffected in the noninjected
muscle fibers. In summary, these experiments show that GABP function is
required to form clusters of AChRs in innervated muscle fibers.

View larger version (36K):
[in this window]
[in a new window]
|
Figure 4.
Quantification of the influence of
GABP DN on AChR clustering. A,
B, Quantitative assessment of the effect of
GABP DN in one individual cDNA injection experiment.
Histograms of the number of GFP-positive fibers that formed AChR
clusters (C/GFP; yellow bars),
GFP-positive muscle fibers (GFP; green
line), and the total number of fibers that formed AChR
aggregates (Ctot; red line) counted on
14-µm-thick consecutive cross-sections through the entire injection
sites. For illustration, a camera lucida drawing of section 37 (#37) is shown in A. In this
particular section, 16 GFP-positive muscle fibers (GFP)
were counted, and seven fibers formed AChR clusters
(Ctot). Five of these fibers were also GFP-positive
(C/GFP). Scale bar, 50 µm. C,
Confocal views of cross-sections of a control-injected muscle fiber
(left) and a GABP DN-injected muscle fiber
(right). Injected fibers are identified by the
expression of GFP (green). In the control, AChR
clusters (red) are associated with myofibers containing
GFP-positive nuclei. In contrast, in the GABP DN-injected
muscle, AChR clusters are found in adjacent, GFP-negative myofibers.
Scale bar, 20 µm.
|
|
Utrophin and AChE aggregates are also reduced in muscle fibers that
express GABP DN
The previous experiments suggest that GABP-mediated
transcriptional activation is required for agrin-induced clustering of AChRs and that the AChR subunit is one postsynaptic molecule locally
upregulated by GABP during postsynaptic differentiation. To determine
whether clustering of other components of the postsynaptic apparatus
also depends on GABP, we analyzed the distribution of two other
synaptic molecules: AChE and utrophin. AChE is an enzyme concentrated
in the synaptic basal lamina of the muscle fibers. Whereas the
association of other synaptic proteins with the postsynaptic apparatus
requires the continuous presence of the AChRs, the localization of AChE
to the neuromuscular junction (NMJ) persists even if AChRs are lost
(Missias et al., 1997 ). Moreover, in rapsyn-deficient mice, AChE
aggregates form underneath the nerve terminal, although AChR clusters
fail to form in the postsynaptic membrane (Gautam et al., 1995 ). AChE
could therefore have formed aggregates devoid of AChRs in myofibers
injected with GABP DN. Utrophin is an
intracellular protein tightly associated with AChRs at the NMJ.
However, mice deficient in utrophin still develop a postsynaptic
apparatus, including aggregates of AChRs (Grady et al., 1997 ).
Therefore, GABP DN-mediated perturbation
of synaptic gene transcription may have led to the formation of AChR
clusters devoid of utrophin. As shown in Figure
5, the number of utrophin and AChE
aggregates was also decreased in the
GABP DN injection. Both utrophin (Fig.
5A,B) and AChE (Fig. 5C)
were always associated with AChR clusters in control-injected and
GABP DN-injected muscle fibers. Thus,
interfering with GABP function inhibits the formation of the entire
postsynaptic apparatus but does not affect the molecular composition of
the postsynaptic structures per se.

View larger version (44K):
[in this window]
[in a new window]
|
Figure 5.
Distribution of utrophin and AChE in
GABP DN-injected muscles. A,
B, The distribution of utrophin was examined by
immunostaining and compared with that of AChRs on cross-sections made
through the injected muscle fibers. The evaluation was made as
described in Figure 4. Utrophin and AChR clusters colocalized on each
cross-section, throughout the injection site, in the control as well as
in the GABP DN situation. C/GFP,
GFP-positive fibers that have AChR clusters; U/GFP,
GFP-positive fibers that have utrophin clusters; GFP,
GFP-positive (injected) fibers; Ctot, total number of
fibers having AChR clusters. C, The distribution of AChE
was examined by choline esterase staining and compared with that of
AChRs stained with alexa -bungarotoxin
(green). Both proteins colocalized on each
analyzed cross-section. Scale bar, 20 µm.
|
|
 |
DISCUSSION |
Two distinct mechanisms contribute to the formation and
maintenance of postsynaptic specializations at the neuromuscular
junction. First, molecules expressed by noninnervated muscle fibers are clustered underneath the motor nerve terminal and assemble into an
intricate network of proteins. Second, synaptic genes are
preferentially transcribed in subsynaptic myonuclei. Studies on
cultured myotubes suggested that neural agrin is responsible for the
aggregation of existing molecules (Wallace, 1988 ), whereas ARIA, a
member of the neuregulins, increases AChR synthesis (Fischbach and
Rosen, 1997 ). However, studies in vivo have provided strong
evidence that both mechanisms are triggered by the sole action of
neural agrin (Cohen et al., 1997 ; Jones et al., 1997 ; Meier et al.,
1997 ; Rimer et al., 1997 ). The requirement of neural agrin for
activating gene transcription is supported by the finding that mice
deficient of agrin or its signaling receptor MuSK do not express AChR
subunits in distinct myonuclei (DeChiara et al., 1996 ; Gautam et al.,
1996 ). Several lines of evidence strongly suggest that the function of neural agrin in regulating gene transcription at the NMJ involves the neuregulins and their cognate receptors, the erbB receptors (Meier
et al., 1998b ). Indeed, mice in which one allele of the neuregulin-1
gene has been deleted are myasthenic as a result from a decrease in
postsynaptic AChR density (Sandrock et al., 1997 ). In addition, the
neuregulin-induced increase in AChR subunit expression is inhibited by
erbB kinase inhibitor in cultured muscle cells (Si and Mei, 1999 ).
These data strongly suggest a role of neuregulin/erbB-signaling in the
formation and maintenance of postsynaptic specializations.
The evidence that the Ets-related transcription factor GABP is a
downstream target of agrin and of neuregulin is so far solely based on
experiments using cultured muscle cells. Moreover, Sapru et al. (1998)
have shown that overexpression of Ets-2, another Ets transcription
factor expressed in muscle, is able to activate transcription of an
AChR reporter construct in cultured muscle cells. To investigate the
involvement of GABP in regulating gene transcription at the NMJ
in vivo, we have used the paradigm of injecting cDNA
constructs encoding neural agrin into extrasynaptic regions of
innervated muscle fibers, an experimental approach that reiterates the
events occurring in the motor neuron-induced development of
postsynaptic structures. We found that a dominant-negative mutant of
GABP blocks (1) the upregulation by agrin of the AChR subunit
gene and (2) the formation of postsynaptic structures. Thus, our data
are the first in vivo evidence that GABP is required for the
local activation of gene transcription in subsynaptic myonuclei. These
data, together with the strong evidence that the N-box motif is
important for synaptic expression of the AChR and subunits
(Koike et al., 1995 ; Duclert et al., 1996 ), utrophin (Gramolini et al.,
1999 ; Khurana et al., 1999 ), and AChE (Chan et al., 1999 ), make GABP a
key transcription factor for the regulation of gene transcription at
the NMJ.
Our findings are of particular interest because GABP is an ubiquitously
expressed transcription factor that has been implicated in many
different processes, such as regulation of cytochrome oxidase genes
(Carter and Avadhani, 1994 ; Sucharov et al., 1995 ) and induction of
interleukin-2 during T-cell activation (Hoffmeyer et al., 1998 ).
The broad range of GABP function and the fact that several Ets-related
transcription factors have been identified, some of which have similar
specificities like GABP, may hamper the chance to gain insights into
GABP function at the NMJ by conventional knock-out techniques. Because
we interfere locally and at a precise time point with GABP function,
these pleiotropic effects do not affect our results. Thus, the system
used here can be made highly specific and can be used to test the role
of several other candidate genes in forming postsynaptic structures at
the NMJ. In our study, we specifically interfere with GABP
function because the dominant-negative GABP interacts with the DNA
target only indirectly by its binding to the GABP subunit (Brown and
McKnight, 1992 ). This binding is highly specific and of high
affinity (Kd of 7.8 ± 0.63 × 10 10 M) (Suzuki
et al., 1998 ). Therefore, the dominant-negative GABP will not
interfere with the function of other Ets transcription factors
recognizing similar sequences on the DNA.
Blocking GABP function inhibits the development of the entire
postsynaptic apparatus
We show that the total number of postsynaptic-like apparatus
induced by neural agrin is reduced in muscle fibers expressing a
dominant-negative GABP . Whereas ~30% of the injected muscle fibers developed postsynaptic structures in the control situation, only
~12% of the GABP DN-injected fibers
developed postsynaptic structures (Table 1). Experimental and
biological circumstances could account for the appearance of
these remaining specializations on the
GABP DN-expressing fibers. First,
although GABP DN blocks the induction by
agrin of synaptic gene expression, a remaining basal level of
transcription independent of GABP may allow the synthesis of an amount
of synaptic components sufficient to form some postsynaptic
specializations. Second, injury caused to the muscle fibers by the
injection procedure may activate myogenic transcription factors that
are known to drive the expression of synaptic genes during
preinnervation stages of development. Third, the amount of
GABP DN may not be high enough to
inhibit expression of synaptic genes completely. This is of particular
importance at distances far from the injection site. There, the
concentration of agrin may still by high because agrin is secreted from
the injected muscle fiber and accumulates in the muscle cell basal
lamina. In contrast, the effect of
GABP DN is critically dependent
on the intracellular concentration of the dominant-negative acting construct.
Whenever we found AChR clusters in
GABP DN-expressing muscle fibers, they
always included other components of the postsynaptic apparatus.
Reciprocally, these other components never formed aggregates devoid of
AChRs. For example, utrophin and AChE were always associated with the
ectopic AChR clusters, as it is the case at normal NMJs (Fig. 5). This
suggests that GABP DN inhibits the
formation of the entire postsynaptic apparatus without affecting the
mechanism governing the assembly of postsynaptic proteins into a
complex per se. There are two distinct possibilities to explain this
phenomenon. First, GABP may be involved in the regulation of all genes
preferentially expressed at the NMJ. We think that this possibility is
rather unlikely. Second, interfering with the expression of some of the
key components of the postsynaptic apparatus may preclude the
development of the entire complex. This latter possibility is
accredited by the profound perturbation of synaptic protein
distribution observed in mice in which single components of the
postsynaptic apparatus were knocked-out. For example, animals deficient
of AChR subunit gene show degeneration of the entire postsynaptic
apparatus because of the failure of these animals to assemble
enough functional AChRs (Missias et al., 1997 ). Moreover, in
rapsyn-deficient mice, all of the components normally concentrated in
the postsynaptic membrane and cytoskeleton fail to aggregate underneath
the motor nerve terminal, except the receptor tyrosine kinase
MuSK (Gautam et al., 1995 ; Apel et al., 1997 ). However, in these mice,
AChR subunit genes remain selectively transcribed in synaptic
myonuclei. Thus, absence of rapsyn is sufficient to prevent the
assembly of the entire postsynaptic complex but does not interfere with
local induction of synaptic gene transcription. These experiments
support the view that removal of one single component can destabilize
the entire postsynaptic complex, although synthesis of other components
is unaffected. To distinguish between the possibilities of GABP
regulating all synaptic genes or activating the transcription of few
essential components of the postsynaptic apparatus, it will be
necessary to investigate the influence of GABP on the expression of the other synaptic genes at the mRNA level.
Role of GABP in the maintenance of adult
postsynaptic structures
The adult postsynaptic apparatus is a very stable structure that
is linked to both the extracellular basal lamina and the cytoskeleton.
Moreover, in adult NMJs, AChRs have an increased half-life of ~10 d
(Levitt et al., 1980 ). It will therefore be interesting to investigate
whether GABP is also required for the maintenance of adult postsynaptic
structures. A role of GABP in the maturation and the maintenance of the
postsynaptic apparatus is supported by the fact that single base pair
mutations in the N-box of the AChR subunit promoter are associated
with a particular form of congenital myasthenic syndromes (Nichols et
al., 1999 ; Ohno et al., 1999 ). Thus, failure to activate synaptic
transcription of the AChR subunit may cause a decrease of AChR
density and a subsequent impairment of neuromuscular transmission. In
line with this, in the muscle biopsy of one patient with a 1 bp
mutation in the N-box, the number of endplate AChRs quantified by
125I- -bungarotoxin binding is reduced
(Nichols et al., 1999 ). We are currently investigating whether this
mutation in the promoter affects its responsiveness to neural agrin
in innervated muscle fibers.
 |
FOOTNOTES |
Received March 6, 2000; revised May 1, 2000; accepted May 11, 2000.
This work was supported by the Swiss National Science Foundation Grant
31-51013.97 and the Schweizerische Stiftung für die Erforschung
der Muskelkrankheiten. We are grateful to Dr. H.-R. Brenner, who helped
us in the initial stages of this work and granted us access to the cDNA
injection setup. We thank Maya Enz for taking care of the rats. The
AChR -subunit reporter construct was a gift from Dr. Graham Jones,
and the NLS-GFP construct was a gift from Dr. Said Hashemolhosseini. We
also thank Dr. Gabriela Bezakowa and Dr. Thomas Meier for critical
reading of this manuscript.
Correspondence should be addressed to Dr. Markus A. Ruegg, Department
of Pharmacology/Neurobiology, Biozentrum, University of Basel,
Klingelbergstrasse 70, CH-4056 Basel, Switzerland. E-mail: markus-a.ruegg{at}unibas.ch.
 |
REFERENCES |
-
Apel ED,
Glass DJ,
Moscoso LM,
Yancopoulos GD,
Sanes JR
(1997)
Rapsyn is required for MuSK signalling and recruits synaptic components to a MuSK-containing scaffold.
Neuron
18:623-635[Web of Science][Medline].
-
Batchelor AH,
Piper DE,
de la Brousse FC,
McKnight SL,
Wolberger C
(1998)
The structure of GABPalpha/beta: an ETS domain- ankyrin repeat heterodimer bound to DNA.
Science
279:1037-1041[Abstract/Free Full Text].
-
Bowen DC,
Park JS,
Bodine S,
Stark JL,
Valenzuela DM,
Stitt TN,
Yancopoulos GD,
Lindsay RM,
Glass DJ,
DiStefano PS
(1998)
Localization and regulation of MuSK at the neuromuscular junction.
Dev Biol
199:309-319[Web of Science][Medline].
-
Brenner HR,
Witzemann V,
Sakmann B
(1990)
Imprinting of acetylcholine receptor messenger RNA accumulation in mammalian neuromuscular synapses.
Nature
344:544-547[Medline].
-
Brown TA,
McKnight SL
(1992)
Specificities of protein-protein and protein-DNA interaction of GABP alpha and two newly defined ets-related proteins.
Genes Dev
6:2502-2512[Abstract/Free Full Text].
-
Buonanno A,
Apone L,
Morasso MI,
Beers R,
Brenner HR,
Eftimie R
(1992)
The MyoD family of myogenic factors is regulated by electrical activity: isolation and characterization of a mouse Myf-5 cDNA.
Nucleic Acids Res
20:539-544[Abstract/Free Full Text].
-
Carter RS,
Avadhani NG
(1994)
Cooperative binding of GA-binding protein transcription factors to duplicated transcription initiation region repeats of the cytochrome c oxidase subunit IV gene.
J Biol Chem
269:4381-4387[Abstract/Free Full Text].
-
Chan RY,
Boudreau-Lariviere C,
Angus LM,
Mankal FA,
Jasmin BJ
(1999)
An intronic enhancer containing an N-box motif is required for synapse- and tissue-specific expression of the acetylcholinesterase gene in skeletal muscle fibers.
Proc Natl Acad Sci USA
96:4627-4632[Abstract/Free Full Text].
-
Chu GC,
Moscoso LM,
Sliwkowski MX,
Merlie JP
(1995)
Regulation of the acetylcholine receptor
-subunit gene by recombinant ARIA: an in vitro model for transynaptic gene regulation.
Neuron
14:329-339[Web of Science][Medline]. -
Cohen I,
Rimer M,
Lomo T,
McMahan UJ
(1997)
Agrin-induced postsynaptic apparatus in skeletal muscle fibers in vivo.
Mol Cell Neurosci
9:237-253[Web of Science][Medline].
-
DeChiara TM,
Bowen DC,
Valenzuela DM,
Simmons MV,
Poueymirou WT,
Thomas S,
Kinetz E,
Compton DL,
Rojas E,
Park JS,
Smith C,
DiStefano PS,
Glass DJ,
Burden SJ,
Yancopoulos GD
(1996)
The receptor tyrosine kinase MuSK is required for neuromuscular junction formation in vivo.
Cell
85:501-512[Web of Science][Medline].
-
Denzer AJ,
Gesemann M,
Schumacher B,
Ruegg MA
(1995)
An amino-terminal extension is required for the secretion of chick agrin and its binding to extracellular matrix.
J Cell Biol
131:1547-1560[Abstract/Free Full Text].
-
Duclert A,
Changeux JP
(1995)
Acetylcholine receptor gene expression at the developing neuromuscular junction.
Physiol Rev
75:339-368[Free Full Text].
-
Duclert A,
Savatier N,
Changeux JP
(1993)
An 83-nucleotide promoter of the acetylcholine receptor epsilon-subunit gene confers preferential synaptic expression in mouse muscle.
Proc Natl Acad Sci USA
90:3043-3047[Abstract/Free Full Text].
-
Duclert A,
Savatier N,
Schaeffer L,
Changeux JP
(1996)
Identification of an element crucial for the sub-synaptic expression of the acetylcholine receptor epsilon-subunit gene.
J Biol Chem
271:17433-17438[Abstract/Free Full Text].
-
Edmondson DG,
Olson EN
(1993)
Helix-loop-helix proteins as regulators of muscle-specific transcription.
J Biol Chem
268:755-758[Free Full Text].
-
Eftimie R,
Brenner HR,
Buonanno A
(1991)
Myogenin and MyoD join a family of skeletal muscle genes regulated by electrical activity.
Proc Natl Acad Sci USA
88:1349-1353[Abstract/Free Full Text].
-
Evan GI,
Lewis GK,
Ramsay G,
Bishop JM
(1985)
Isolation of monoclonal antibodies specific for human c-myc proto-oncogene product.
Mol Cell Biol
5:3610-3616[Abstract/Free Full Text].
-
Fischbach GD,
Rosen KM
(1997)
ARIA: a neuromuscular junction neuregulin.
Annu Rev Neurosci
20:429-458[Web of Science][Medline].
-
Fromm L,
Burden SJ
(1998)
Synapse-specific and neuregulin-induced transcription require an ets site that binds GABPalpha/GABPbeta.
Genes Dev
12:3074-3083[Abstract/Free Full Text].
-
Gautam M,
Noakes PG,
Mudd J,
Nichol M,
Chu GC,
Sanes JR,
Merlie JP
(1995)
Failure of postsynaptic specialization to develop at neuromuscular junctions of rapsyn-deficient mice.
Nature
377:232-236[Medline].
-
Gautam M,
Noakes PG,
Moscoso L,
Rupp F,
Scheller RH,
Merlie JP,
Sanes JR
(1996)
Defective neuromuscular synaptogenesis in agrin-deficient mutant mice.
Cell
85:525-535[Web of Science][Medline].
-
Glass DJ,
Bowen DC,
Stitt TN,
Radziejewski C,
Bruno J,
Ryan TE,
Gies DR,
Shah S,
Mattsson K,
Burden SJ,
DiStefano PS,
Valenzuela DM,
DeChiara TM,
Yancopoulos GD
(1996)
Agrin acts via a MuSK receptor complex.
Cell
85:513-523[Web of Science][Medline].
-
Gluzman Y
(1981)
SV40-transformed simian cells support the replication of early SV40 mutants.
Cell
23:175-182[Web of Science][Medline].
-
Goldman D,
Staple J
(1989)
Spatial and temporal expression of acetylcholine receptor RNAs in innervated and denervated rat soleus muscle.
Neuron
3:219-228[Web of Science][Medline].
-
Grady RM,
Merlie JP,
Sanes JR
(1997)
Subtle neuromuscular defects in utrophin-deficient mice.
J Cell Biol
136:871-882[Abstract/Free Full Text].
-
Gramolini AO,
Angus LM,
Schaeffer L,
Burton EA,
Tinsley JM,
Davies KE,
Changeux JP,
Jasmin BJ
(1999)
Induction of utrophin gene expression by heregulin in skeletal muscle cells: role of the N-box motif and GA binding protein.
Proc Natl Acad Sci USA
96:3223-3227[Abstract/Free Full Text].
-
Hoffmeyer A,
Avots A,
Flory E,
Weber CK,
Serfling E,
Rapp UR
(1998)
The GABP-responsive element of the interleukin-2 enhancer is regulated by JNK/SAPK-activating pathways in T lymphocytes.
J Biol Chem
273:10112-10119[Abstract/Free Full Text].
-
Huang CF,
Tong J,
Schmidt J
(1992)
Protein kinase C couples membrane excitation to acetylcholine receptor gene inactivation in chick skeletal muscle.
Neuron
9:671-678[Web of Science][Medline].
-
Huang CF,
Neville CM,
Schmidt J
(1993)
Control of myogenic factor genes by the membrane depolarization/protein kinase C cascade in chick skeletal muscle.
FEBS Lett
319:21-25[Web of Science][Medline].
-
Jaynes JB,
Chamberlain JS,
Buskin JN,
Johnson JE,
Hauschka SD
(1986)
Transcriptional regulation of the muscle creatine kinase gene and regulated expression in transfected mouse myoblasts.
Mol Cell Biol
6:2855-2864[Abstract/Free Full Text].
-
Jones G,
Herczeg A,
Ruegg MA,
Lichtsteiner M,
Kröger S,
Brenner HR
(1996)
Substrate-bound agrin induces expression of acetylcholine receptor
-subunit gene in cultured mammalian muscle cells.
Proc Natl Acad Sci USA
93:5985-5990[Abstract/Free Full Text]. -
Jones G,
Meier T,
Lichtsteiner M,
Witzemann V,
Sakmann B,
Brenner HR
(1997)
Induction by agrin of ectopic and functional postsynaptic-like membrane in innervated muscle.
Proc Natl Acad Sci USA
94:2654-2659[Abstract/Free Full Text].
-
Jones G,
Moore C,
Hashemolhosseini S,
Brenner HR
(1999)
Constitutively active MuSK is clustered in the absence of agrin and induces ectopic postsynaptic-like membranes in skeletal muscle fibers.
J Neurosci
19:3376-3383[Abstract/Free Full Text].
-
Khurana TS,
Rosmarin AG,
Shang J,
Krag TO,
Das S,
Gammeltoft S
(1999)
Activation of utrophin promoter by heregulin via the ets-related transcription factor complex GA-binding protein alpha/beta.
Mol Biol Cell
10:2075-2086[Abstract/Free Full Text].
-
Koike S,
Schaeffer L,
Changeux JP
(1995)
Identification of a DNA element determining synaptic expression of the mouse acetylcholine receptor ë-subunit gene.
Proc Natl Acad Sci USA
92:10624-10628[Abstract/Free Full Text].
-
LaMarco K,
Thompson CC,
Byers BP,
Walton EM,
McKnight SL
(1991)
Identification of Ets- and notch-related subunits in GA binding protein.
Science
253:789-792[Abstract/Free Full Text].
-
Lanford RE,
White RG,
Dunham RG,
Kanda P
(1988)
Effect of basic and nonbasic amino acid substitutions on transport induced by simian virus 40 T-antigen synthetic peptide nuclear transport signals.
Mol Cell Biol
8:2722-2729[Abstract/Free Full Text].
-
Levitt TA,
Loring RH,
Salpeter MM
(1980)
Neuronal control of acetylcholine receptor turnover rate at a vertebrate neuromuscular junction.
Science
210:550-551[Abstract/Free Full Text].
-
Meier T,
Hauser DM,
Chiquet M,
Landmann L,
Ruegg MA,
Brenner HR
(1997)
Neural agrin induces ectopic postsynaptic specializations in innervated muscle fibers.
J Neurosci
17:6534-6544[Abstract/Free Full Text].
-
Meier T,
Marangi PA,
Moll J,
Hauser DM,
Brenner HR,
Ruegg MA
(1998a)
A minigene of neural agrin encoding the laminin-binding and acetylcholine receptor-aggregating domains is sufficient to induce postsynaptic differentiation in muscle fibres.
Eur J Neurosci
10:3141-3152[Web of Science][Medline].
-
Meier T,
Masciulli F,
Moore C,
Schoumacher F,
Eppenberger U,
Denzer AJ,
Jones G,
Brenner HR
(1998b)
Agrin can mediate acetylcholine receptor gene expression in muscle by aggregation of muscle-derived neuregulins.
J Cell Biol
141:715-726[Abstract/Free Full Text].
-
Mendelzon D,
Changeux JP,
Nghiem HO
(1994)
Phosphorylation of myogenin in chick myotubes: regulation by electrical activity and by protein kinase C. Implications for acetylcholine receptor gene expression.
Biochemistry
33:2568-2575[Medline].
-
Merlie JP,
Mudd J,
Cheng TC,
Olson EN
(1994)
Myogenin and acetylcholine receptor alpha gene promoters mediate transcriptional regulation in response to motor innervation.
J Biol Chem
269:2461-2467[Abstract/Free Full Text].
-
Missias AC,
Mudd J,
Cunningham JM,
Steinbach JH,
Merlie JP,
Sanes JR
(1997)
Deficient development and maintenance of postsynaptic specializations in mutant mice lacking an "adult" acetylcholine receptor subunit.
Development
124:5075-5086[Abstract].
-
Moscoso LM,
Merlie JP,
Sanes JR
(1995)
N-CAM, 43K-rapsyn, and S-laminin mRNAs are concentrated at synaptic sites in muscle fibers.
Mol Cell Neurosci
6:80-89[Web of Science][Medline].
-
Neville CM,
Schmidt J
(1992)
Expression of myogenic factors in skeletal muscle and electric organ of Torpedo californica.
FEBS Lett
305:23-26[Web of Science][Medline].
-
Nichols P,
Croxen R,
Vincent A,
Rutter R,
Hutchinson M,
Newsom-Davis J,
Beeson D
(1999)
Mutation of the acetylcholine receptor epsilon-subunit promoter in congenital myasthenic syndrome.
Ann Neurol
45:439-443[Web of Science][Medline].
-
Ohno K,
Anlar B,
Engel AG
(1999)
Congenital myasthenic syndrome caused by a mutation in the Ets-binding site of the promoter region of the acetylcholine receptor epsilon subunit gene.
Neuromuscul Disord
9:131-135[Web of Science][Medline].
-
Patton BL,
Miner JH,
Chiu AY,
Sanes JR
(1997)
Distribution and function of laminins in the neuromuscular system of developing, adult, and mutant mice.
J Cell Biol
139:1507-1521[Abstract/Free Full Text].
-
Pestronk A,
Drachman DB
(1978)
A new stain for quantitative measurement of sprouting at neuromuscular junctions.
Muscle Nerve
1:70-74[Web of Science][Medline].
-
Rimer M,
Mathiesen I,
Lomo T,
McMahan UJ
(1997)
-AChR/ -AChR switch at agrin-induced postsynaptic-like apparatus in skeletal muscle.
Mol Cell Neurosci
9:254-263[Web of Science][Medline]. -
Rimer M,
Cohen I,
Lomo T,
Burden SJ,
McMahan UJ
(1998)
Neuregulins and erbB receptors at neuromuscular junctions and at agrin- induced postsynaptic-like apparatus in skeletal muscle.
Mol Cell Neurosci
12:1-15[Web of Science][Medline].
-
Ruegg MA,
Bixby JL
(1998)
Agrin orchestrates synaptic differentiation at the vertebrate neuromuscular junction.
Trends Neurosci
21:22-27[Web of Science][Medline].
-
Sandrock Jr AW,
Dryer SE,
Rosen KM,
Gozani SN,
Kramer R,
Theill LE,
Fischbach GD
(1997)
Maintenance of acetylcholine receptor number by neuregulins at the neuromuscular junction in vivo.
Science
276:599-603[Abstract/Free Full Text].
-
Sanes JR,
Lichtman JW
(1999)
Development of the vertebrate neuromuscular junction.
Annu Rev Neurosci
22:389-442[Web of Science][Medline].
-
Sapru MK,
Florance SK,
Kirk C,
Goldman D
(1998)
Identification of a neuregulin and protein-tyrosine phosphatase response element in the nicotinic acetylcholine receptor epsilon subunit gene: regulatory role of an Rts transcription factor.
Proc Natl Acad Sci USA
95:1289-1294[Abstract/Free Full Text].
-
Sawa C,
Goto M,
Suzuki F,
Watanabe H,
Sawada J,
Handa H
(1996)
Functional domains of transcription factor hGABP beta1/E4TF1-53 required for nuclear localization and transcription activation.
Nucleic Acids Res
24:4954-4961[Abstract/Free Full Text].
-
Schaeffer L,
Duclert N,
Huchet-Dymanus M,
Changeux JP
(1998)
Implication of a multisubunit Ets-related transcription factor in synaptic expression of the nicotinic acetylcholine receptor.
EMBO J
17:3078-3090[Web of Science][Medline].
-
Si J,
Mei L
(1999)
ERK MAP kinase activation is required for acetylcholine receptor inducing activity-induced increase in all five acetylcholine receptor subunit mRNAs as well as synapse-specific expression of acetylcholine receptor varepsilon-transgene.
Brain Res Mol Brain Res
67:18-27[Medline].
-
Sucharov C,
Basu A,
Carter RS,
Avadhani NG
(1995)
A novel transcriptional initiator activity of the GABP factor binding ets sequence repeat from the murine cytochrome c oxidase Vb gene.
Gene Expr
5:93-111[Web of Science][Medline].
-
Suzuki F,
Goto M,
Sawa C,
Ito S,
Watanabe H,
Sawada J,
Handa H
(1998)
Functional interactions of transcription factor human GA-binding protein subunits.
J Biol Chem
273:29302-29308[Abstract/Free Full Text].
-
Thompson CC,
Brown TA,
McKnight SL
(1991)
Convergence of Ets- and notch-related structural motifs in a heteromeric DNA binding complex.
Science
253:762-768[Abstract/Free Full Text].
-
Wallace BG
(1988)
Regulation of agrin-induced acetylcholine receptor aggregation by Ca++ and phorbol ester.
J Cell Biol
107:267-278[Abstract/Free Full Text].
-
Weintraub H
(1993)
The MyoD family and myogenesis: redundancy, networks, and thresholds.
Cell
75:1241-1244[Web of Science][Medline].
-
Witzemann V,
Sakmann B
(1991)
Differential regulation of MyoD and myogenin mRNA levels by nerve induced muscle activity.
FEBS Lett
282:259-264[Web of Science][Medline].
Copyright © 2000 Society for Neuroscience 0270-6474/00/20165989-08$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
L. Xu and M. Komatsu
Promoter Cloning and Characterization of the Anti-vascular Proliferation Gene, R-ras: ROLE OF ETS- AND SP-BINDING MOTIFS
J. Biol. Chem.,
January 30, 2009;
284(5):
2706 - 2718.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Lu, C. Tian, G. Danialou, R. Gilbert, B. J. Petrof, G. Karpati, and J. Nalbantoglu
Targeting Artificial Transcription Factors to the Utrophin A Promoter: EFFECTS ON DYSTROPHIC PATHOLOGY AND MUSCLE FUNCTION
J. Biol. Chem.,
December 12, 2008;
283(50):
34720 - 34727.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Bandi, M. Jevsek, T. Mars, M. Jurdana, E. Formaggio, M. Sciancalepore, G. Fumagalli, Z. Grubic, F. Ruzzier, and P. Lorenzon
Neural agrin controls maturation of the excitation-contraction coupling mechanism in human myotubes developing in vitro
Am J Physiol Cell Physiol,
January 1, 2008;
294(1):
C66 - C73.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Jaworski, C. L. Smith, and S. J. Burden
GA-Binding Protein Is Dispensable for Neuromuscular Synapse Formation and Synapse-Specific Gene Expression
Mol. Cell. Biol.,
July 1, 2007;
27(13):
5040 - 5046.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. A. O'Leary, P. G. Noakes, N. A. Lavidis, I. Kola, P. J. Hertzog, and S. Ristevski
Targeting of the ETS Factor Gabp{alpha} Disrupts Neuromuscular Junction Synaptic Function
Mol. Cell. Biol.,
May 1, 2007;
27(9):
3470 - 3480.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Handschin, Y. M. Kobayashi, S. Chin, P. Seale, K. P. Campbell, and B. M. Spiegelman
PGC-1{alpha} regulates the neuromuscular junction program and ameliorates Duchenne muscular dystrophy
Genes & Dev.,
April 1, 2007;
21(7):
770 - 783.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Tsuchimochi, N. Yagishita, S. Yamasaki, T. Amano, Y. Kato, K.-i. Kawahara, S. Aratani, H. Fujita, F. Ji, A. Sugiura, et al.
Identification of a Crucial Site for Synoviolin Expression
Mol. Cell. Biol.,
August 15, 2005;
25(16):
7344 - 7356.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Ruegg
Organization of synaptic myonuclei by Syne proteins and their role during the formation of the nerve-muscle synapse
PNAS,
April 19, 2005;
102(16):
5643 - 5644.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Sunesen, M. Huchet-Dymanus, M. O. Christensen, and J.-P. Changeux
Phosphorylation-Elicited Quaternary Changes of GA Binding Protein in Transcriptional Activation
Mol. Cell. Biol.,
November 15, 2003;
23(22):
8008 - 8018.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. C. Y. Choi, N. L. Siow, A. W. M. Cheng, K. K. Y. Ling, E. K. K. Tung, J. Simon, E. A. Barnard, and K. W. K. Tsim
ATP Acts via P2Y1 Receptors to Stimulate Acetylcholinesterase and Acetylcholine Receptor Expression: Transduction and Transcription Control
J. Neurosci.,
June 1, 2003;
23(11):
4445 - 4456.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Lacazette, S. Le Calvez, N. Gajendran, and H. R. Brenner
A novel pathway for MuSK to induce key genes in neuromuscular synapse formation
J. Cell Biol.,
May 26, 2003;
161(4):
727 - 736.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. E. Schweppe, A. A. Melton, K. S. Brodsky, L. D. Aveline, K. A. Resing, N. G. Ahn, and A. Gutierrez-Hartmann
Purification and Mass Spectrometric Identification of GA-binding Protein (GABP) as the Functional Pituitary Ets Factor Binding to the Basal Transcription Element of the Prolactin Promoter
J. Biol. Chem.,
May 2, 2003;
278(19):
16863 - 16872.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Abicht, R. Stucka, C. Schmidt, A. Briguet, S. Hopfner, I.-H. Song, D. Pongratz, W. Muller-Felber, M. A. Ruegg, and H. Lochmuller
A newly identified chromosomal microdeletion and an N-box mutation of the AChR{epsilon} gene cause a congenital myasthenic syndrome
Brain,
May 1, 2002;
125(5):
1005 - 1013.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. J. Blake, A. Weir, S. E. Newey, and K. E. Davies
Function and Genetics of Dystrophin and Dystrophin-Related Proteins in Muscle
Physiol Rev,
April 1, 2002;
82(2):
291 - 329.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|