 |
Previous Article | Next Article 
The Journal of Neuroscience, September 1, 2000, 20(17):6333-6339
Cbln3, a Novel Member of the Precerebellin Family that Binds
Specifically to Cbln1
Zhen
Pang,
Jian
Zuo, and
James I.
Morgan
Department of Developmental Neurobiology, St. Jude Children's
Research Hospital, Memphis, Tennessee 38105
 |
ABSTRACT |
Precerebellin (Cbln1) is the precursor of the brain-specific
hexadecapeptide cerebellin. Although cerebellin has properties of a
conventional neuropeptide, its function is controversial because Cbln1
has structural features characteristic of circulating atypical
collagens. Cbln1 is related to the three subunits of the complement C1q
complex. Therefore, we hypothesized that Cbln1 participated in
analogous heteromeric complexes with precerebellin-related proteins.
Using LexA-Cbln1 as bait in a yeast two-hybrid screen, we isolated a
cDNA encoding a novel Cbln1-related protein, designated Cbln3. The gene
encoding cbln3 had the same intron-exon structure as
cbln1 but mapped to a different mouse chromosome (14). The deduced amino acid sequence of Cbln3 was 55% identical to Cbln1 and
also contained a C1q signature domain and signal sequence for
secretion. In addition to binding avidly to Cbln3, Cbln1 also formed
homomeric complexes. In contrast, Cbln3 homomeric association was weak.
These interactions exhibited specificity because C1qB bound to neither
Cbln1 nor Cbln3. Like cbln1, cbln3 was expressed in the cerebellum and dorsal cochlear nucleus in which it was detected
in granule neurons. Because Cbln1 and Cbln3 are coexpressed in the
brain and interact avidly, they may function as a secreted heteromeric
complex in vivo.
Key words:
cerebellum; dorsal cochlear nucleus; granule cells; yeast
two-hybrid; C1q signature domain; gene mapping
 |
INTRODUCTION |
Cerebellin is a brain-specific
hexadecapeptide (Slemmon et al., 1984 ) that is
structurally conserved from chicken to man (Slemmon et al.,
1984 ; Morgan et al., 1988 ; Yiangou et
al., 1989 ). This neuropeptide is most abundant in the
cerebellum and dorsal cochlear nucleus (DCoN), although it can be
detected in other brain regions at relatively low levels
(Mugnaini and Morgan, 1987 ; Burnet et al.,
1988 ; Morgan et al., 1988 ). Antibodies against
cerebellin specifically stain Purkinje cells in the cerebellum and
cartwheel neurons in the DCoN (Slemmon et al., 1985 ;
Mugnaini and Morgan, 1987 ). Because neurons within the
DCoN and cerebellum have similar lineages and the two brain regions
have analogous organization, we suggested that cerebellin functioned as
a conventional neuropeptide in these structures (Mugnaini and
Morgan, 1987 ). Indeed, cerebellin is enriched in the
synaptosomal fraction (Slemmon et al., 1984 ) and is
released in a calcium-dependent manner after depolarization (Burnet et al., 1988 ). Furthermore, cerebellin can
elicit norepinephrine secretion from the adrenal gland
(Mazzocchi et al., 1999 ; Albertin et al.,
2000 ). However, the precise function of cerebellin is controversial.
Like many neuropeptides, cerebellin is derived from a precursor, named
precerebellin or Cbln1 (Urade et al., 1991 ). Although precerebellin has no collagen motif, the C-terminal two-thirds of the
protein shows significant structural similarity to the globular
(noncollagen) domains of several atypical collagens, including the
complement C1q subunits (Urade et al., 1991 ). Such proteins are not typically thought to undergo selective processing to
yield neuroactive peptides. Rather, the globular domains of the
atypical collagens are important for the appropriate alignment of three
polypeptide subunits that permits the subsequent formation of the
collagen triple helix (Brass et al., 1991 ). Because most of the C1q signature domain proteins exist as homomeric or heteromeric complexes, we hypothesized that Cbln1 may be part of a protein complex
that consisted of related polypeptides. Indeed, a protein (Cbln2)
similar to Cbln1 has been identified (Wada and Ohtani, 1991 ; Kavety et al., 1994 ), indicating the
existence of a precerebellin gene family. However, the expression
pattern of cbln2 is different from that of cbln1,
implying that they could not participate in heteromeric complexes. For
example, whereas cbln1 is expressed at high levels in the
adult cerebellum, cbln2 is nearly undetectable (Wada
and Ohtani, 1991 ). In contrast, cbln2 is expressed
at relatively high levels in extracerebellar brain areas and in the
fetal nervous system, whereas cbln1 is either absent or only
expressed at very low levels (Urade et al., 1991 ;
Wada and Ohtani, 1991 ). Therefore, we hypothesized that
additional Cbln1-related proteins existed that bound to Cbln1.
Here we report the cloning of Cbln3, a third member of the
precerebellin family. This protein was isolated through its binding to
LexA-Cbln1 in a yeast two-hybrid screen. Not only did Cbln3 bind to
Cbln1 but the two were also coexpressed at high levels in the
cerebellum and DCoN. This casts doubt on the role of cerebellin as a
classical neuropeptide modulator. Rather, these findings suggest that
the precerebellins are secreted proteins that function as heteromeric complexes.
 |
MATERIALS AND METHODS |
Yeast two-hybrid cDNA library screening and analysis of
protein-protein interactions. A mouse cerebellar cDNA library
(Kurschner and Morgan, 1995 ) was constructed in the
yeast Escherichia coli shuttle vector pSD10a that carries
the yeast URA3 gene as selectable marker (Dalton and Treisman,
1992 ). This permits the production of cDNA-encoded proteins as
fusions to the transactivation domain of the VP16 protein of the
Herpes simplex virus. A LexA-Cbln1 fusion protein was used
as bait to screen the cerebellar VP16 fusion library in yeast. Because
the signal peptide is likely processed from Cbln1 to yield the mature
protein, the first 10 amino acids of precerebellin were deleted. This
truncated cDNA was cloned into the Y.LexA vector that carries the yeast
TRP1 gene as a selectable marker (a gift from Dr. Steven Dalton,
University of Adelaide, Adelaide, Australia). The expression of
LexA-Cbln1 and the VP16 fusions was under the control of a GAL10-CYC1
hybrid promoter, which rendered expression galactose-inducible and
glucose-repressible.
The budding yeast Saccharomyces cerevisiae strain S260
(URA3 TRP1 ), which contains a
genomic lexA-operator-lacZ reporter gene
integrated into the URA3 locus (Kurschner and Morgan,
1996 ), was first transformed with the
lexA-cbln1 construct. Transformants that survived
on tryptophan-deficient medium were then transformed with the plasmid library DNA, plated onto Hybond-N filters (Amersham Pharmacia Biotech,
Arlington Heights, IL), and selected on Trp
Ura plates. Filters with cotransformed colonies
were transferred to galactose medium to induce the expression of the
fusion proteins. LacZ-positive colonies were identified in a
-galactosidase assay in which
5-bromo-4-chloro-3-indolyl- -D-galactopyranosidase
was used as substrate (Breeden and Nasmyth, 1985 ;
Dalton and Treisman, 1992 ). Positive colonies were
streaked out, and the activation of the reporter gene was confirmed.
Plasmids were rescued by transforming ElectroMax E. coli
competent cells (Life Technologies, Gaithersburg, MD) with total
yeast DNA extracts. Protein interaction was further confirmed by
cotransformation of the yeast with purified plasmid DNA. The cDNA
inserts were sequenced using automated DNA sequencing.
DNA sequencing. Sequencing reactions were performed by the
Center for Biotechnology at St. Jude Children's Research Hospital on
template DNA using dye-terminator cycle sequencing-ready reaction kits
with AmpliTag DNA polymerase FS (Perkin-Elmer/Applied Biosystems, Inc.,
Foster City, CA) and synthetic oligonucleotides. Samples were
electrophoresed, detected, and analyzed on a Perkin-Elmer/Applied Biosystems, Inc. model 373 DNA sequencer.
5' Rapid amplification of cDNA ends and reverse
transcription-PCR. To obtain additional sequence from the
5' end of cbln3 mRNA, 5' rapid amplification of cDNA ends
(RACE) (Frohman et al., 1988 ) was performed on adult
mouse cerebellum total RNA using the Gibco 5' RACE System, version 2.0 (Life Technologies). The first-strand cDNA was synthesized using a
gene-specific antisense oligonucleotide (GSP1a,
GGAAGCAGCACAGAGCTTG). Two other gene-specific primers (GSP1b,
ACCACGTGGAATCGGAAGCTG and GSP2, ACGAAGCAGCCCGAGGTCCGATC) in
combination with the 5' abridged universal amplification primer were
used for two consecutive rounds of nested PCR. The PCR products were
separated in agarose gels, extracted using the GIAquick Gel Extraction
Kit (Qiagen, Hilden, Germany), cloned into pBluescript KS( )
(Stratagene, La Jolla, CA), and sequenced. The longest cDNA sequence
assembled from the 5' RACE product and cDNA isolated from the library
was deposited in GenBank (accession number AF218379). Based on the new
sequence information, cDNAs corresponding to the full-length protein
and the predicted mature protein were amplified and cloned into the
pSD10a and Y.Lex vectors for interaction analysis.
Northern blot analysis. Total RNA from various mouse tissues
at different developmental stages was extracted using RNAzol B
(TEL-TEST, Friendswood, TX). RNA (10 µg/sample) was denatured and separated in 1% agarose gels containing 0.41 M
formaldehyde and 1× 4-morpholinepropanesulfonic acid (MOPS)
running buffer (MOPS 0.02 M, sodium acetate 8 mM, and EDTA 1 mM; pH 7.0). RNAs were
transferred onto Hybond-N membranes (Amersham Pharmacia Biotech) using
a downward alkaline blotting system (Chomczynski, 1992 ) and fixed to the membrane by UV-cross-linking. 32P-labeled
probes were synthesized using the Megaprime DNA labeling system
(Amersham Pharmacia Biotech). The 5' RACE product (371 bp) of
cbln3 and a 324 bp cDNA fragment corresponding to
nucleotides 147-471 of cbln1 (GenBank accession number
164680) (Kavety and Morgan, 1998 ) were used as
templates. Hybridization was performed using the QuikHyb hybridization
solution (Stratagene) according to the instructions of the
manufacturer. After hybridization and washing, blots were
exposed to Kodak X-OMAT AR film (Eastman Kodak, Rochester, NY) for
autoradiography. To control for sample loading, blots were stripped and
rehybridized with probes specific for the mouse
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (GenBank accession
number W34118) and the mouse -actin (GenBank accession number
AA138737).
In situ hybridization. Postnatal, adult, and time-pregnant
(for embryonic tissue) mice were perfused transcardinally with 4%
paraformaldehyde under pentobarbital anesthesia. Brains were dissected,
post-fixed at 4°C for 4 hr, and cryoprotected in 25% sucrose in 0.1 M phosphate buffer at 4°C until used. For sectioning, brains were mounted in tissue freezing medium (Triangle Biomedical Sciences) at 54°C and warmed to 23°C. Frozen sections were cut at 12.5 µm on a cryostat and thaw mounted onto Fisherbrand Superfrost Plus microscope slides and kept at 20°C until used. In
situ hybridization was performed following the protocol described
by Simmons et al. (1989) with slight modifications
(Soares et al., 1998 ). Slides were hybridized at 55°C
for 12-16 hr with 33P-labeled sense or antisense
riboprobes (106 cpm/slide), which were synthesized
in the presence of 33P-UTP via in vitro
transcription using T3 or T7 RNA polymerases (Roche, Indianapolis, IN).
The templates were linearized with pBluescript KS containing a 166 bp
cDNA fragment corresponding to codons 30-84 of cbln3 in two
different orientations. Sense probes served as specificity controls.
After hybridization, ribonuclease A treatment and high-stringency
washes, slides were exposed to x-ray film and then to autoradiography
emulsion (NTB2; Eastman Kodak) for 3-5 d. After development of the
emulsion, sections were counterstained with cresyl violet, dehydrated,
and cover-slipped for microscopic observation.
Genomic DNA cloning and sequencing. A bacteriophage P1-based
mouse genomic DNA library was subjected to PCR screening (Genome Systems, St. Louis, MO). Primers used were GSP2 as described and GSP3
(GGGAGTGCCTGGTGGTCTGTGAG) corresponding to codons 34-42 of cbln3. DNA from two positive clones was analyzed by Southern
hybridization after digestion with several restriction endonucleases.
The downward transfer to Hybond-N membrane was performed according to
Chomczynski (1992) . Two PCR-amplified genomic fragments
were used as probes. The 5' probe, amplified using GSP2 and GSP3 as
primers, spans intron 1 of cbln3. The 3' probe, amplified
with GSP4 (CTTCCCACTCTGAGGACCCAAG) and GSP5 (CCAAATAGCGCTGAGCAGGAAG),
is in the 3' untranslated region of cbln3. Hybridization was
performed in QuikHyb (Stratagene). After a high-stringency wash at
60°C in a solution containing 0.2× SSC and 0.1% SDS, the membrane
was exposed to Kodak X-OMAT AR film. A 5.5 kb EcoRI fragment
encompassing the cbln3 coding sequence was identified on the
Southern blots and cloned into pBluescript KS. Sequence analysis was
conducted after subcloning and, sometimes, using gene-specific
oligonucleotide as primers. Sequence data was deposited in GenBank
(accession number AF218380).
Gene mapping. The Jackson Laboratory (Bar Harbor, ME)
interspecific backcross panel (C57BL/6JEi × SPRET/Ei)F1 × SPRET/Ei called Jackson BSS (Rowe et al., 1994 ) was used
to determine the chromosomal localization of cbln3 in the
mouse. Two PCR primers were chosen to amplify a 200 bp genomic DNA that
showed polymorphism between C57BL/6J and Mus spretus.
The 5' primer, GSP4, spans the stop codon (TGA) of cbln3,
and the 3' primer GSP6 (GTCTAGAGGTTCCGTAGCTCTG) is located 200 bp
downstream and corresponds to a sequence in the 3' untranslated and
alternatively spliced region. Genomic DNA (10 ng/reaction) from
different animals was amplified under the following conditions: 94°C
for 5 min; 35 cycles of 94°C for 30 sec, 56°C for 30 sec, and
72°C for 30 sec; and 72°C for 10 min. The identity of the PCR
products was confirmed by DNA sequencing. To detect single-strand
conformation polymorphism, PCR products were labeled with
[ -32P]dATP and 3 µl of PCR products were denatured
in 9 µl of 95% formamide, 10 mM NaOH, 20 mM
EDTA, 0.05% bromophenol blue, and 0.05% xylene cyanol FF first at
95°C for 5 min and then at 4°C for 5 min, before loading on a 0.5×
mutation detection electrophoresis gel (FMC BioProducts, Rockland,
ME) and running at 5 W for 16 hr at 4°C in 0.6× Tris
borate-EDTA.
 |
RESULTS |
Cloning of cbln3
A yeast two-hybrid screen was used to isolate candidate proteins
that physically interacted with Cbln1. A mouse cerebellar cDNA library
that produces VP16-fusion proteins was screened using LexA-Cbln1 as
bait. Of 11 positive clones that were isolated and sequenced, five
encoded Cbln1 itself. This indicated that Cbln1 was capable of
homomeric interaction. Two other overlapping clones contained an
open-reading frame corresponding to a novel polypeptide that was
similar to both Cbln1 and Cbln2 (Fig. 1).
The rest of the coding sequence along with 45 nucleotides of the 5'
untranslated sequence was obtained by 5' RACE. This protein, designated
Cbln3, is predicted to consist of 197 amino acids, with a calculated molecular weight of 21.1 kDa and an isoelectric point of 6.35. The
first 21 residues resemble a typical signal peptide. Overall, Cbln3 is
55.1% identical and 67.6% similar to mouse Cbln1 and 49.1% identical
and 61.7% similar to rat Cbln2. In the cerebellin motif, Cbln3 is
quite different from Cbln1 and Cbln2, the latter two being identical
except for one amino acid. Therefore, Cbln3 is not the precursor for
cerebellin. Notably, many of the aromatic amino acid residues that are
highly conserved among C1q signature domain-containing proteins are
also conserved in Cbln3.

View larger version (65K):
[in this window]
[in a new window]
|
Figure 1.
Amino acid sequence alignment of
precerebellin-related proteins. The sequence alignment for mouse Cbln1
(mcbln1), rat Cbln2 (rcbln2), and mouse Cbln3
(mcbln3) was generated using PILEUP (GCG Wisconsin Package).
Because only an incomplete mouse cbln2 clone has been
isolated (Kavety et al., 1994 ), the rat Cbln2 sequence
was used to provide a complete comparison of structure. Residues that
are identical in all three family members are shaded.
Asterisks and pound signs indicate identical and highly
conserved residues, respectively, found in the C1q signature domain.
The cerebellin peptide motif is contained within the boxed
area.
|
|
Protein-protein interactions measured using a yeast
two-hybrid assay
Results from the cDNA library screening suggested that Cbln1 bound
to itself and to truncated Cbln3. To determine whether full-length
Cbln3 exhibited homomeric or heteromeric binding, protein-protein
interactions were studied in the yeast two-hybrid system. cDNAs
corresponding to the full-length and the predicted mature Cbln3
polypeptides were cloned into both Y.LexA and pSD10a vectors. As shown
in Table 1, both full-length and mature
Cbln3 interacted with Cbln1. However, unlike Cbln1, Cbln3 only
displayed marginal homomeric binding. To establish the specificity of
these precerebellin interactions, the globular domain of the distantly related C1q B-chain was cloned and tested for its ability to undergo homomerization and to bind to Cbln3. Although C1qB did self-associate, as predicted, it did not bind to Cbln3. Together, these data suggest that Cbln3 preferentially forms heteromers with Cbln1.
Expression profiles of cbln1 and cbln3
Previous studies have shown that cbln1 and
cbln2 exhibit different expression profiles in the rat
(Urade et al., 1991 ; Wada and Ohtani,
1991 ), suggesting that they cannot interact in vivo. To qualify Cbln3 as a natural partner for Cbln1, it is necessary to
demonstrate that they are coexpressed. Therefore, the expression of
cbln1 and cbln3 was determined in the mouse by
Northern blot analysis.
As shown in Figure 2, in adult mice
cbln3 was highly expressed in cerebellum but was
undetectable in forebrain, spinal cord, and a range of non-neural
organs. The same result was obtained for cbln1, except that
low levels of cbln1 transcripts were also detected in
forebrain and spinal cord (Fig. 2A). During
development, the expression of cbln3 generally paralleled
that of cbln1 in the cerebellum. However, cbln3
was not expressed until postnatal day 7 (P7), whereas
cbln1 was already present at low to moderate levels before
P7 in cerebellum as well as in the forebrain (Fig. 2B). These data indicated that cbln1 and
cbln3 were coexpressed in the adult cerebellum, although
cbln3 expression was more restricted.

View larger version (43K):
[in this window]
[in a new window]
|
Figure 2.
Northern blot analysis of cbln1 and
cbln3 expression. A, Distribution of
cbln1 and cbln3 transcripts in different adult
tissues and organs. B, Expression of cbln1 and
cbln3 in the mouse brain during development. For E12.5,
E15.5, and P0 (the day of birth), whole brains were used. For postnatal
(P) time points, cerebellum (b) and the
rest of the brain (a) were analyzed separately. Adult mice
were 2 months old. GAPDH and -actin probes were used as controls for
RNA loading and transfer after stripping of the blots.
|
|
In situ hybridization
The precise location of cbln3 expression in the brain
was determined by in situ hybridization. Whereas the
cbln3 sense probe generated no signal above background (Fig.
3B), the antisense probe gave
robust hybridization in the cerebellum (Fig. 3D,F). In the adult, the internal granule cell layer (IGL) was the predominant site of cbln3 expression (Fig. 3F). Grain
density over Purkinje neurons was indistinguishable from background,
suggesting that they did not express cbln3. In sections from
a P8 mouse, no expression of cbln3 was observed in the
external granule layer (EGL) (Fig. 3D). This region contains
proliferating granule cell progenitors and postmitotic, premigratory
granule cells. In contrast, granule cells that had ceased division and
migrated into the IGL did express cbln3 (Fig.
3D). Consistent with Northern blot analyses, there was no
specific hybridization signal for cbln3 in embryonic day 12.5/E7 (E12.5), E15.5, or P1 mice (data not shown). However, in
situ hybridization revealed that cbln3 was expressed in
the adult DCoN (Fig. 3H). Thus, the two brain regions
that have the highest levels of cbln1 mRNA, and cerebellin
peptide also expressed the highest levels of cbln3 mRNA.

View larger version (118K):
[in this window]
[in a new window]
|
Figure 3.
In situ hybridization of cbln3 in mouse
cerebellum and dorsal cochlear nucleus. Saggital sections of a P8 mouse
brain (A-D) and coronal sections of an adult mouse
cerebellum (E, F) and dorsal cochlear nucleus
(G, H) were labeled with a sense (A, B) or
antisense (C-H) riboprobe specific for
cbln3. Both bright-field (A, C, E, G) and
dark-field (B, D, F, H) views were acquired using a
digital camera. ML, Molecular layer; PCL,
Purkinje cell layer; IV, fourth ventricle; VIII;
nucleus of the VIII cranial nerve; EGL, external granule
layer; IGL, internal granule layer; DCoN, dorsal
cochlear nucleus. Scale bar: A-F, 50 µm; G, H,
250 µm.
|
|
Genomic structure and chromosomal location
of cbln3
To study the genomic structure of cbln3, a PAC clone
was isolated, from which a 5.5 kb EcoRI fragment that
hybridized with cbln3 probes was subcloned. Sequence
analysis revealed a gene with three coding exons separated by two small
introns of 325 and 289 bp, respectively (Fig.
4). The relative positions of these introns, between codons CAG (Gln) and GTA/G (Val) in cbln3
are the same as in cbln1 (Kavety et al.,
1994 ). There was no alternative ATG between the predicted start
codon and the nearest in-frame stop codon.

View larger version (6K):
[in this window]
[in a new window]
|
Figure 4.
Structure and physical map of the cbln3
gene. A 5.54 kb EcoRI fragment from a mouse genomic PAC
clone was identified by Southern hybridization as described in
Materials and Methods. This fragment was then subcloned and sequenced
(GenBank accession number AF218380). The coding sequences are
represented by the black boxes. The first intron is located
between codons 92 and 93, and the second between codons 132 and 133. The cleavage sites for restriction endonucleases EcoRI,
KpnI, NcoI, NotI, PmeI,
SpeI, and XbaI were identified using the MAP
program in the GCG Wisconsin Package.
|
|
One approach to elucidate the function of cbln3 is to
identify pathological phenotypes in mice that carry naturally occurring mutations in this gene. Therefore, we first determined the chromosomal localization of cbln3 in the mouse genome. We took advantage
of an established gene mapping panel, the Jackson BSS backcross
(Rowe et al., 1994 ), that consists of 94 offspring of a
backcross between two distantly related mouse strains, Mus musculus
(C57BL/6) and M. spretus. First, a DNA polymorphism was identified in
the 3' UTR of the cbln3 gene using single-strand
conformation polymorphism between the two strains (Treadaway and
Zuo, 1998 ). Subsequently, we determined the pattern of
segregation of the two strains at the cbln3 locus in the
Jackson BSS panel. An identical pattern of segregation is expected for
genes that are located in a closely linked genomic segment, whereas a
nonconcordant (or unrelated) pattern of segregation is expected for
genes that are located on different chromosomes or far apart on the
same chromosome. By comparing the pattern obtained from the
cbln3 gene with other known markers in the genome, we were
able to place cbln3 in the vicinity of six other markers on
chromosome 14 (Fig. 5). The DNA marker
D14Mit5 displays an identical segregation pattern to
cbln3, suggesting that D14Mit5 and
cbln3 are extremely close. All but 3 of 94 backcrosses
showed a linkage between otx2 and cbln3,
indicating that these genes are separated by ~3 centimorgan (cM). Two
independent primer pairs (cbln3-1/2 and
cbln3-3/4) derived from cbln3 were used to screen
the Jackson BSS backcross. The mapping results were identical for both
sets of primers (data not shown). Using a similar strategy, we also
confirmed the position of cbln1 on mouse chromosome 8 (data
not shown).

View larger version (20K):
[in this window]
[in a new window]
|
Figure 5.
Chromosomal location of cbln3.
Top, Map figure from the Jackson BSS backcross showing part
of chromosome 14. The map is depicted with the centromere toward the
top. A 3 cM scale bar is shown to the right. Loci
mapping to the same position are listed in alphabetical order. Raw data
from The Jackson Laboratory were obtained from
http://www.jax.org/resources/documents/cmdata. Bottom,
Haplotype figure from the Jackson BSS backcross showing part of
chromosome 14 with loci linked to cbln3. Loci are listed in
order with the most proximal at the top. The black
boxes represent the C57BL6/JEi allele, and the white
boxes represent the SPRET/Ei allele. The number of animals with
each haplotype is given at the bottom of each
column of boxes. The percent recombination
between adjacent loci is given to the right, with the SE for
each recombination (R).
|
|
 |
DISCUSSION |
Here we describe the cloning and characterization of
cbln3, a new member of the precerebellin family. The
structural similarities between Cbln1 and Cbln3 and their coexpression
in the cerebellum and DCoN suggest that they serve related or identical
functions. Furthermore, the demonstration that Cbln3 interacts
selectively with Cbln1 indicates that, like some members of the
atypical collagen superfamily, these proteins form a heteromeric
complex. Because both Cbln1 and Cbln3 possess signal sequences for
secretion, it is further hypothesized that the precerebellin-containing
complexes are either released into the extracellular milieu or undergo
intercellular trafficking.
Based on protein sequence comparisons, cbln1 is more closely
related to cbln2 than to cbln3. Within the region
of the proteins that contain the cerebellin peptide motif, there is
only a single amino acid difference between Cbln1 and Cbln2. In
contrast, in Cbln3 only 7 of 16 amino acids are identical to
cerebellin. Nevertheless, the three molecules constitute a small gene
family that is part of a larger superfamily that contains collagens and
collagen-like proteins. This is exemplified by the presence of
conserved aromatic amino acids within all three precerebellins that
conform to a consensus motif sometimes referred to as the C1q signature
domain or aromatic zipper (Smith et al., 1994 ). This
region typically spans about 130 amino acids and is located at the C
terminus of the protein. In the case of the precerebellins, this domain
begins within the cerebellin motif and extends to the C terminus.
Noticeably, although multiple clones encoding Cbln1 and Cbln3 were
obtained in the two-hybrid screen, in all cases the C1q signature
domain was intact. For example, of the five cbln1 clones
isolated, four encoded full-length protein and one lacked 54 amino
acids at the N terminus. Similarly, the two cbln3 clones
lacked 29 and 35 amino acids from the N terminus, respectively. This
suggested that integrity of the C1q signature domains in Cbln1 and
Cbln3 is required for homomeric and heteromeric binding.
The precerebellins are related to a superfamily of atypical collagens
that include collagens type VIII and X (Muragaki et al.,
1992 ; Elima et al., 1993 ), the A, B, and C
subunits of the complement C1q complex (Petry et al.,
1989 , 1992 ),
hibernation-associated serum proteins (Takamatsu et al.,
1993 ), and a saccule-specific collagen (Davis et al.,
1995 ). Within the atypical collagens, the globular (C1q
signature) domain is responsible for the initial assembly of trimeric
complexes. This initial interaction brings the subunits into correct
alignment, thereby permitting the single collagen domain in each
subunit to associate in a triple helix (Brass et al.,
1991 ). In some cases, such as collagen X, the trimer consists
of three identical chains. However, in other instances, such as C1q,
the complex is composed of three distinct subunits. Therefore,
individual globular head groups not only align protomers but also
discriminate different molecular entities to ensure the correct subunit
stoichiometry in the complex. The precerebellins are capable of forming
homomeric and heteromeric complexes. Thus, Cbln1 can oligomerize and
bind to Cbln3. In contrast, although Cbln3 binds avidly to Cbln1, its
homomeric interaction is weak. Therefore, we hypothesize that the
function of Cbln3 is dependent on its incorporation into a complex with
Cbln1. Furthermore, because this complex is most likely a trimer, there
may be yet another member of the precerebellin family to be identified.
Some of the atypical collagens are components of the extracellular
matrix. For example, collagen type X assembles into a lattice structure
in which the globular head groups associate with each other to form the
nodules while the collagen helices form the interstices (Kwan et
al., 1991 ). However, other superfamily members, such as the
hibernation proteins and the complement C1q complex, circulate in the
blood and may bind to membrane receptors. Because none of the
precerebellins contain a collagen motif, it seems unlikely that they
are conventional components of the extracellular matrix. Recently, the
crystal structure of the C1q signature domain of another superfamily
member, ACRP30/adipoQ, was solved (Shapiro and Scherer,
1998 ). This protein is synthesized by adipose tissue but is
released into the plasma. Remarkably, ACRP30 was found to have a
similar three-dimensional structure to tumor necrosis factor-
(TNF ). This is despite the fact that TNF is not an atypical
collagen, and only a few of the amino acids in the C1q signature domain
are conserved in TNF . However, these and additional amino acids are
conserved between TNF and the precerebellins. Therefore, it is
conceivable that the precerebellin complexes interact with a membrane
receptor and activate an intracellular signal transduction cascade in a
manner analogous to TNF .
The levels of cerebellin are much reduced in strains of mutant mice
that have developmental anomalies that involve a loss of cerebellar
granule neurons (Morgan et al., 1988 ; Slemmon et al., 1988 ). In addition, cerebellin is depleted in cerebella
from patients that died of olivopontocerebellar atrophy and Shy-Drager syndrome (Mizuno et al., 1995 ). However, to date
cerebellin has not been causally linked to any neurological disorder.
Furthermore, the position of cbln1 on mouse chromosome 8 (syntenic with human 19p13.2) has not been linked to known disorders in
mice or man (Kavety et al., 1994 ). The observation that
cerebellin levels are reduced in several multiple systems atrophy
disorders that impact the cerebellum may simply be a reflection of loss
of the neurons that generate the peptide. The complex hereditary
patterns of these diseases and their variable phenotypes have made it
difficult to identify the gene mutations involved. However, one of the
precerebellin genes could potentially contribute to the pathobiology of
such disorders.
cbln1, cbln2, and cbln3 are
independent genes that map to the mouse chromosomes 8, 18, and 14, respectively. Given their levels of homology, these genes have probably
arisen by gene duplication, as also suggested by their identical
intron-exon organization. Two potentially relevant mouse mutations,
agitans (ag) and wabbler-lethal (wl), map to chromosome 14, near the
hairless locus (hr). Both mutations exhibit
degeneration in many parts of the nervous system, including the
cerebellum (Hoecker et al., 1954 ; Luse et al.,
1967 ; Carroll et al., 1992 ). The
agitans mutant mouse is probably extinct, but ag
homozygotes were reported to exhibit retarded growth, generalized tremor, and ataxia (Hoecker et al., 1954 ). Furthermore,
Purkinje cell atrophy was noted in some regions of the cerebellum of
ag homozygotes. Therefore, cbln3 may be a
candidate for ag.
Although they are coexpressed in the cerebellum and DCoN in adult mice,
cbln1 but not cbln3 is also expressed in the
forebrain and in the developing nervous system. Thus, if the
precerebellins function as heteromers, this would imply that Cbln1 must
be partnered with another family member in some regions of the fetal
and adult brain. Cbln2 is expressed in the cerebellum during early
development and is present outside the cerebellum in the adult
(Wada and Ohtani, 1991 ). Thus, the pattern of
cbln2 expression is complementary to that of
cbln3 but overlaps that of cbln1. Therefore, it
is possible that Cbln1 may partner with Cbln2 in early development and
in areas of the adult brain in which Cbln3 is not expressed. In the
case of the cerebellum, there may also be a switch from Cbln1-Cbln2
complexes in fetal life to Cbln1-Cbln3 complexes in the neonate and
adult. Moreover, because Cbln3 is generated by granule neurons of the
IGL, this switch must occur at the time that the cells move from the
premigratory zone of the EGL to their final position.
The biological function of cerebellin in the CNS is still unknown. The
calcium-dependent release of the peptide from cerebellar synaptosomes
and its effect on secretion from the adrenal gland suggests a function
similar to conventional neuropeptide modulators. However, the present
data suggest that the function of Cbln1 is exerted through a complex
composed of several precerebellins. Nevertheless, the precise cleavage
of Cbln1 to yield the cerebellin peptide in many diverse species
suggests that this processing may be of functional relevance and not
just a fortuitous event. For example, TNF , which shares structural
similarities with C1q signature domain proteins, is released from the
cell membrane after specific cleavage by a disintegrin
metalloproteinase (Black et al., 1997 ). Thus,
proteolytic processing of precerebellins might contribute to their
release. Alternatively, processing may occur in the target cell, in
which case the peptide may fulfill a role in transcellular signaling.
Currently gene-targeting experiments are being conducted to investigate
these possibilities.
 |
FOOTNOTES |
Received April 14, 2000; revised June 6, 2000; accepted June 9, 2000.
This work was supported in part by National Institutes of Health Cancer
Center CORE Grant P30 CA21765 and the American Lebanese Syrian
Associated Charities. We thank Dr. Connie Kurschner for the cerebellar
cDNA library, Dr. Balaji Kavety for the LexA-cbln1 construct, Nichola
Wigle, Karen Forbes, and Jason Treadaway for technical support, and
Carol Jacks for assistance in manuscript preparation.
Correspondence should be addressed to Dr. James I. Morgan, Department
of Developmental Neurobiology, St. Jude Children's Research Hospital,
332 North Lauderdale Street, Memphis, TN 38105. E-mail: jim.morgan{at}stjude.org.
Dr. Pang's present address: Merck & Co., Inc., Metabolic Disorders,
MRL, P.O. Box 2000, R80T-150, Rahway, NJ 07065.
 |
REFERENCES |
-
Albertin G,
Malendowicz LK,
Macchi C,
Markowska A,
Nussdorfer GG
(2000)
Cerebellin stimulates the secretory activity of the rat adrenal gland: in vitro and in vivo studies.
Neuropeptides
34:7-11[Web of Science][Medline].
-
Black RA,
Rauch CT,
Kozlosky CJ,
Peschon JJ,
Slack JL,
Wolfson MF,
Castner BJ,
Stocking KL,
Reddy P,
Srinivasan S,
Nelson N,
Boiani N,
Schooley KA,
Gerhart M,
Davis R,
Fitzner JN,
Johnson RS,
Paxton RJ,
March CJ,
Cerretti DP
(1997)
A metalloproteinase disintegrin that releases tumour-necrosis factor-alpha from cells.
Nature
385:729-733[Medline].
-
Brass A,
Kadler KE,
Thomas JT,
Grant ME,
Boot-Handford RP
(1991)
The aromatic zipper: a model for the initial trimerization event in collagen folding.
Biochem Soc Trans
19:365S[Medline].
-
Breeden L,
Nasmyth K
(1985)
Regulation of the yeast HO gene.
Cold Spring Harb Symp Quant Biol
50:643-650[Abstract/Free Full Text].
-
Burnet PW,
Bretherton-Watt D,
Ghatei MA,
Bloom SR
(1988)
Cerebellin-like peptide: tissue distribution in rat and guinea-pig and its release from rat cerebellum, hypothalamus and cerebellar synaptosomes in vitro.
Neuroscience
25:605-612[Web of Science][Medline].
-
Carroll EW,
Curtis RL,
Sullivan DA,
Melvin JL
(1992)
Wallerian degeneration in the optic nerve of the wabbler-lethal (wl/wl) mouse.
Brain Res Bull
29:411-418[Web of Science][Medline].
-
Chomczynski P
(1992)
One-hour downward alkaline capillary transfer for blotting of DNA and RNA.
Anal Biochem
201:134-139[Web of Science][Medline].
-
Dalton S,
Treisman R
(1992)
Characterization of SAP-1, a protein recruited by serum response factor to the c-fos serum response element.
Cell
68:597-612[Web of Science][Medline].
-
Davis JG,
Oberholtzer JC,
Burns FR,
Greene MI
(1995)
Molecular cloning and characterization of an inner ear-specific structural protein.
Science
267:1031-1034[Abstract/Free Full Text].
-
Elima K,
Eerola I,
Rosati R,
Metsaranta M,
Garofalo S,
Perala M,
De Crombrugghe B,
Vuorio E
(1993)
The mouse collagen X gene: complete nucleotide sequence, exon structure and expression pattern.
Biochem J
289:247-253.
-
Frohman MA,
Dush MK,
Martin GR
(1988)
Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer.
Proc Natl Acad Sci USA
85:8998-9002[Abstract/Free Full Text].
-
Hoecker G,
Martinez A,
Markovic S,
Pizzaro O
(1954)
Agitans, a new mutation in the house mouse with neurological effects.
J Heredity
45:10-14[Abstract/Free Full Text].
-
Kavety B,
Morgan JI
(1998)
Characterization of transcript processing of the gene encoding precerebellin-1.
Brain Res Mol Brain Res
63:98-104[Medline].
-
Kavety B,
Jenkins NA,
Fletcher CF,
Copeland NG,
Morgan JI
(1994)
Genomic structure and mapping of precerebellin and a precerebellin-related gene.
Brain Res Mol Brain Res
27:152-156[Medline].
-
Kurschner C,
Morgan JI
(1995)
The maf proto-oncogene stimulates transcription from multiple sites in a promoter that directs Purkinje neuron-specific gene expression.
Mol Cell Biol
15:246-254[Abstract].
-
Kurschner C,
Morgan JI
(1996)
Analysis of interaction sites in homo- and heteromeric complexes containing Bcl-2 family members and the cellular prion protein.
Brain Res Mol Brain Res
37:249-258[Medline].
-
Kwan AP,
Cummings CE,
Chapman JA,
Grant ME
(1991)
Macromolecular organization of chicken type X collagen in vitro.
J Cell Biol
114:597-604[Abstract/Free Full Text].
-
Luse SA,
Chenard C,
Finke EH
(1967)
The wabbler-lethal mouse. An electron microscopic study of the nervous system.
Arch Neurol
17:153-161[Abstract/Free Full Text].
-
Mazzocchi G,
Andreis PG,
De Caro R,
Aragona F,
Gottardo L,
Nussdorfer GG
(1999)
Cerebellin enhances in vitro secretory activity of human adrenal gland.
J Clin Endocrinol Metab
84:632-635[Abstract/Free Full Text].
-
Mizuno Y,
Takahashi K,
Totsune K,
Ohneda M,
Konno H,
Murakami O,
Satoh F,
Sone M,
Takase S,
Itoyama Y,
Mouri T
(1995)
Decrease in cerebellin and corticotropin-releasing hormone in the cerebellum of olivopontocerebellar atrophy and Shy-Drager syndrome.
Brain Res
686:115-118[Web of Science][Medline].
-
Morgan JI,
Slemmon JR,
Danho W,
Hempstead J,
Berrebi AS,
Mugnaini E
(1988)
Cerebellin and related postsynaptic peptides in the brain of normal and neurodevelopmentally mutant vertebrates.
Synapse
2:117-124[Web of Science][Medline].
-
Mugnaini E,
Morgan JI
(1987)
The neuropeptide cerebellin is a marker for two similar neuronal circuits in rat brain.
Proc Natl Acad Sci USA
84:8692-8696[Abstract/Free Full Text].
-
Muragaki Y,
Shiota C,
Inoue M,
Ooshima A,
Olsen BR,
Ninomiya Y
(1992)
alpha I(VIII)-collagen gene transcripts encode a short-chain collagen polypeptide and are expressed by various epithelial, endothelial and mesenchymal cells in newborn mouse tissues.
Eur J Biochem
207:895-902[Web of Science][Medline].
-
Petry F,
Reid KB,
Loos M
(1989)
Molecular cloning and characterization of the complementary DNA coding for the B-chain of murine C1q.
FEBS Lett
258:89-93[Web of Science][Medline].
-
Petry F,
Reid KB,
Loos M
(1992)
Isolation, sequence analysis and characterization of cDNA clones coding for the C chain of mouse C1q. Sequence similarity of complement subcomponent C1q, collagen type VIII and type X and precerebellin.
Eur J Biochem
209:129-134[Web of Science][Medline].
-
Rowe LB,
Nadeau JH,
Turner R,
Frankel WN,
Letts VA,
Eppig JT,
Ko MS,
Thurston SJ,
Birkenmeier EH
(1994)
Maps from two interspecific backcross DNA panels available as a community genetic mapping resource.
Mamm Genome
5:253-274[Web of Science][Medline]. [Erratum (1994) 5:463]
-
Shapiro L,
Scherer PE
(1998)
The crystal structure of a complement-1q family protein suggests an evolutionary link to tumor necrosis factor.
Curr Biol
8:335-338[Web of Science][Medline].
-
Simmons DM,
Arriza JL,
Swanson LW
(1989)
A complete protocol for in situ hybridization of messenger RNAs in the brain and other tissues with radio-labeled single-stranded RNA probes.
J Histotechnol
12:169-181.
-
Slemmon JR,
Blacher R,
Danho W,
Hemstead JL,
Morgan JI
(1984)
Isolation and sequencing of two cerebellum-specific peptides.
Proc Natl Acad Sci USA
81:6866-6870[Abstract/Free Full Text].
-
Slemmon JR,
Danho W,
Hempstead JL,
Morgan JI
(1985)
Cerebellin: a quantifiable marker for Purkinje cell maturation.
Proc Natl Acad Sci USA
82:7145-7148[Abstract/Free Full Text].
-
Slemmon JR,
Goldowitz D,
Blacher R,
Morgan JI
(1988)
Evidence for the transneuronal regulation of cerebellin biosynthesis in developing Purkinje cells.
J Neurosci
8:4603-4611[Abstract].
-
Smith KF,
Harris PI,
Chapman D,
Reid KBM,
Perkins SJ
(1994)
The b-sheet secondary structure of the trimeric globular domain of C1q of complement and collagen types VIII and X by Fourier-transform infrared spectroscopy and averaged structure predictions.
Biochem J
301:249-256.
-
Soares HD,
Morgan JI,
McKinnon PJ
(1998)
Atm expression patterns suggest a contribution from the peripheral nervous system to the phenotype of ataxia-telangiectasia.
Neuroscience
86:1045-1054[Web of Science][Medline].
-
Takamatsu N,
Ohba K,
Kondo J,
Kondo N,
Shiba T
(1993)
Hibernation-associated gene regulation of plasma proteins with a collagen-like domain in mammalian hibernators.
Mol Cell Biol
13:1516-1521[Abstract/Free Full Text].
-
Treadaway J,
Zuo J
(1998)
Mapping of the mouse glutamate receptor
1 subunit (Grid1) to chromosome 14.
Genomics
54:359-360[Web of Science][Medline]. -
Urade Y,
Oberdick J,
Molinar-Rode R,
Morgan JI
(1991)
Precerebellin is a cerebellum-specific protein with similarity to the globular domain of complement C1q B chain.
Proc Natl Acad Sci USA
88:1069-1073[Abstract/Free Full Text].
-
Wada C,
Ohtani H
(1991)
Molecular cloning of rat cerebellin-like protein cDNA which encodes a novel membrane-associated glycoprotein.
Brain Res Mol Brain Res
9:71-77[Medline].
-
Yiangou Y,
Burnet P,
Nikou G,
Chrysanthou BJ,
Bloom SR
(1989)
Purification and characterisation of cerebellins from human and porcine cerebellum.
J Neurochem
53:886-889[Web of Science][Medline].
Copyright © 2000 Society for Neuroscience 0270-6474/00/20176333-07$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
W. Kakegawa, T. Miyazaki, K. Kohda, K. Matsuda, K. Emi, J. Motohashi, M. Watanabe, and M. Yuzaki
The N-Terminal Domain of GluD2 (GluR{delta}2) Recruits Presynaptic Terminals and Regulates Synaptogenesis in the Cerebellum In Vivo
J. Neurosci.,
May 6, 2009;
29(18):
5738 - 5748.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. W. Wong, S. A. Krawczyk, C. Kitidis-Mitrokostas, G. Ge, E. Spooner, C. Hug, R. Gimeno, and H. F. Lodish
Identification and characterization of CTRP9, a novel secreted glycoprotein, from adipose tissue that reduces serum glucose in mice and forms heterotrimers with adiponectin
FASEB J,
January 1, 2009;
23(1):
241 - 258.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Ito-Ishida, E. Miura, K. Emi, K. Matsuda, T. Iijima, T. Kondo, K. Kohda, M. Watanabe, and M. Yuzaki
Cbln1 Regulates Rapid Formation and Maintenance of Excitatory Synapses in Mature Cerebellar Purkinje Cells In Vitro and In Vivo
J. Neurosci.,
June 4, 2008;
28(23):
5920 - 5930.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Bao, Z. Pang, M. A. Morgan, J. Parris, Y. Rong, L. Li, and J. I. Morgan
Cbln1 Is Essential for Interaction-Dependent Secretion of Cbln3
Mol. Cell. Biol.,
December 15, 2006;
26(24):
9327 - 9337.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. F. Bonaldo, T. B. Bair, T. E. Scheetz, E. Snir, I. Akabogu, J. L. Bair, B. Berger, K. Crouch, A. Davis, M. E. Eyestone, et al.
1274 Full-Open Reading Frames of Transcripts Expressed in the Developing Mouse Nervous System
Genome Res.,
October 1, 2004;
14(10b):
2053 - 2063.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. C. Airey, L. Lu, and R. W. Williams
Genetic Control of the Mouse Cerebellum: Identification of Quantitative Trait Loci Modulating Size and Architecture
J. Neurosci.,
July 15, 2001;
21(14):
5099 - 5109.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|