Previous Article | Next Article 
The Journal of Neuroscience, September 1, 2000, 20(17):6394-6403
The Polyglutamine Expansion in Spinocerebellar Ataxia Type 6 Causes a 
Subunit-Specific Enhanced Activation of P/Q-Type Calcium
Channels in Xenopus Oocytes
Sophie
Restituito1,
Randall M.
Thompson2,
Jacob
Eliet1,
Robert S.
Raike2, 3,
Maureen
Riedl3,
Pierre
Charnet1, and
Christopher M.
Gomez2
1 Centre de Recherches de Biochimie
Macromoléculaire, Centre National de la Recherche Scientifique
Unité Propre de Recherche 1086, Montpellier, France
34293, and 2 Center for Clinical and Molecular
Neurobiology, Departments of Neurology and Neuroscience, and
3 Department of Neuroscience, University of Minnesota,
Minneapolis, Minnesota 55455
 |
ABSTRACT |
Spinocerebellar ataxia type 6 (SCA6) is a dominantly inherited
degenerative disorder of the cerebellum characterized by nearly selective and progressive death of Purkinje cells. The underlying mutation in SCA6 consists of an expansion of a trinucleotide CAG repeat
in the 3' region of the gene, CACNA1A, encoding the 
1A subunit of the neuronal P/Q-type voltage-gated calcium channel. Although it is known that this mutation results in an expanded tract of
glutamine residues in some 1A splice forms, the
distribution of these splice forms and the role of this mutation in the
highly selective Purkinje cell degeneration seen in SCA6 have yet to be
elucidated. Using specific antisera we demonstrate that the pathological expansion in SCA6 can potentially be expressed in multiple
isoforms of the 1A subunit, and that these isoforms are
abundantly expressed in the cerebellum, particularly in the Purkinje
cell bodies and dendrites. Using 1A subunit chimeras expressing SCA6 mutations, we show that the SCA6 polyglutamine expansion shifts the voltage dependence of channel activation and rate
of inactivation only when expressed with 
4
subunits and impairs normal G-protein regulation of P/Q channels. These findings suggest the possibility that SCA6 is a channelopathy, and that
the underlying mutation in SCA6 causes Purkinje cell degeneration
through excessive entry of calcium ions.
Key words:
calcium channel; cerebellar ataxia; polyglutamine
tract; Purkinje cell; subunit; neurodegenerative disease; channelopathy
| |
INTRODUCTION |
Spinocerebellar ataxia type 6 (SCA6)
is a dominantly inherited neurodegenerative disorder characterized by
progressive gait ataxia, dysarthria, and incoordination caused by
progressive cerebellar atrophy (Zhuchenko et al., 1997
). Neuronal loss
in SCA6 is limited almost exclusively to Purkinje cells (Gomez et al.,
1997a; Sasaki et al., 1998; Takahashi et al., 1998; Ishikawa et al.,
1999a). The underlying mutation in SCA6 consists of an expansion of a trinucleotide CAG repeat (CAG21-33) in exon 47 of the gene, CACNA1A, encoding the 1A subunit of the neuronal
P/Q-type voltage-gated calcium channel (VGCC) (Zhuchenko et al., 1997;
Yabe et al., 1998). The CAG repeat is in frame only in some splice
forms of 1A where it codes for a polyglutamine
tract in the C terminus (Zhuchenko et al., 1997). Nevertheless, from a
genetic standpoint SCA6 belongs to the class of neurodegenerative
disorders in which the pathological mutation encodes a protein
possessing an expanded polyglutamine tract (Anonymous, 1993; Orr et
al., 1993; Kawaguchi et al., 1994; David et al., 1997). These disorders
are thought to result from the intranuclear accumulation of
ubiquitinated aggregates of the expanded polyglutamine proteins and to
have little to do with the function of the native protein (Paulson et
al., 1997; Skinner et al., 1997; Becher et al., 1998; Cummings et al.,
1998; Li and Li, 1998). Recently nonubiquitinated, intracytoplasmic
aggregations of 1A subunits have been detected
in brains of SCA6 patients using antisera to the
1A subunit, suggesting a role for aggregates in SCA6 that may differ from that in other disorders (Ishikawa et al.,
1999b).
Other episodic or progressive neurological or muscle disorders arise as
a direct result of the pathological change in ion channel function
produced by mutations in the gene encoding the channel protein (Barchi,
1998; Boonyapisit et al., 1999; Cooper and Jan, 1999). Missense
mutations or mutations that predict a truncated protein have been found
in the CACNA1A gene in families with episodic or progressive ataxia and
hemiplegic migraine (Ophoff et al., 1996; Yue et al., 1997; Denier et
al., 1999; Jen, 1999; Tournier, 1999) and in several mouse neurological
mutants (Fletcher et al., 1996; Dove et al., 1998; Wakamori et al.,
1998; Mori et al., 1999; Wakamori et al., 1999; Zwingman et al., 1999).
Thus, rather than relating to the ability of the mutant proteins to form aggregates, the pathogenesis of SCA6 may relate to the effect of
the mutation on the function of the P/Q-type calcium channel, making
SCA6 a member of the class of disorders called "channelopathies." This distinction may be artificial, however, because the processes of
aggregate formation and ion channel disturbance may be causally related.
Using antisera specific for the alternatively spliced exon 47, along
with chimeric 1A subunits expressing the SCA6
mutation, we investigated whether there is restricted expression of
exon 47-encoded P/Q-type channels and the functional consequences of the SCA6-associated mutation. We show here that (1) the pathological expansion can be potentially expressed in multiple isoforms of the
1A subunit; (2) the exon 47-encoded polyQ
tract is abundantly expressed in Purkinje cells; and (3) heterologous
expression of chimeric 1A cDNA harboring
wild-type or SCA6-associated polyglutamine tract in exon 47, together
with putative cerebellar auxiliary subunits
(2-
and 2,
3, or 4), reveals a
subunit-specific alteration in the electrophysiological properties
of SCA6-mutant P/Q channels.
| |
MATERIALS AND METHODS |
Preparation of antipeptide antisera. Rabbits
were immunized with the bovine thyroglobulin-conjugated peptides CT1
(STSGTSTPRRGRRQLPA), corresponding to a sequence 24 amino acids
N-terminal to the polyQ tract in the long isoform of the
1A subunit (Zhuchenko et al., 1997), and 2L2
(SELQQREHAPPREHA), which is the mouse homolog of CNA3 (Sakurai et al.,
1996) (differing from rat in two amino acids). Peptides were conjugated
to bovine thyroglobulin (Sigma, St. Louis, MO) using glutaraldehyde.
The conjugated peptide (1 mg/ml) was emulsified with an equal volume of
Freund's complete adjuvant (Difco, Detroit, MI) and injected into four
New Zealand White rabbits. Subsequent injections were performed every 2 weeks using an equal volume of conjugated peptide and Freund's
incomplete adjuvant. Rabbit sera were screened for antibody activity 1 week after the fourth and each subsequent injection.
Western blotting. pQE31-mCT (a gift from Colin Fletcher,
Mammalian Genetics Laboratory) consists of a 510 bp Msp
fragment beginning from codon 15 of exon 47 of the mouse
1A gene to 79 bases past the second stop codon
in exon 47 inserted into the 6xHis vector pQE31 (Qiagen, Hilden,
Germany). To perform immunoblots on bacterial proteins, bacterial cell
lysates from Escherichia coli transformed with pQE31-mCT
were eluted from nickel-nitrilotriacetic acid (NTA) columns
according to the manufacturer's instructions (Qiagen). Eluted proteins
were separated by SDS-PAGE and electrotransferred to nitrocellulose membranes.
To prepare crude membrane extracts, 0.1-0.2 gm of mouse cerebellum or
forebrain was homogenized for 5 sec on ice in 2 ml of extraction buffer
[Tris-buffered saline (TBS), pH 7.4, 1% Triton X-100, 10 mM EDTA, 10 mM EGTA, 50 µg/ml antipain, 2 µg/ml aprotinin 2, 50 µg/ml chymotrypsin, 0.5 µg/ml leupeptin,
0.7 µg/ml pepstatin (Roche Molecular Biochemicals, Mannheim,
Germany), 0.1 mg/ml calpain inhibitor I, and 0.05 mg/ml calpain
inhibitor II ] at a speed of 7 in a tissue homogenizer
(Polytron; Brinkman, Westbury, NY) and centrifuged 150,000 × g for 1 hr at 4°C in an SW28 rotor (Beckman Instruments,
Palo Alto, CA). Ten micrograms of affinity-purified antipeptide
antibody were added to 1 ml of supernatant, followed by 50 µl of
washed staphylococcal protein A-agarose (Life Technologies, Gaithersburg, MD). After shaking gently overnight at 4°C on a tilting
mixer, the complexes were centrifuged at 1300 × g and washed three times with 600 µl of TBS and 1% Triton X-100 and once
with 200 µl of 10 mM Tris, pH 7.4, and 1%
Triton X-100. The proteins were denatured and extracted from the pellet
by incubation at 70°C for 10 min in 20 µl of load buffer (190 mM Tris, pH 6.8, 30 mM DTT,
7.5% SDS, 15% sucrose, and 0.01% bromphenol blue), subjected to
SDS-PAGE electrophoresis in 6% gels, and electrotransferred at 24 V to
nitrocellulose membranes (0.45 µM) for 3 hr in
prechilled transfer buffer. Membranes were blocked overnight at 4°C
in block solution (TBS, 0.5% Tween 20, 5% dry milk, and 0.5% normal
goat serum).
For immunoblotting membranes were reacted with primary antibody at 0.01 mg/ml from 2 hr to overnight at 4°C and washed three times for 10 min
each in block solution. Membranes were reacted with horseradish
peroxidase-conjugated goat anti-rabbit Ig (Amersham Pharmacia Biotech,
Arlington Heights, IL) diluted 1:6000 in block solution at room
temperature for 2 hr, washed three times for 10 min each in block
solution (minus proteins), and washed twice for 30 min each in TBS. To
generate chemiluminescent signal, membranes were incubated 4 min in
chemiluminescent substrate (Supersignal; Pierce, Rockford, IL), blotted
dry, and exposed to film. To strip membranes for reprobing, blots were
incubated in a solution of 100 mM -mercaptoethanol, 60 mM Tris, pH 8, and 2% SDS at 55°C with gentle rocking
and then rinsed in TBS.
Immunohistochemical localization. Male adult Sprague Dawley
rats (100-150 gm; Harlan, Madison, WI) were anesthetized with an
overdose of a sodium pentobarbital (60 mg/kg) and fixed by transcardial
perfusion with calcium-free Tyrode's solution followed by fixative
(4% paraformaldehyde and 0.2% picric acid in 0.1 M phosphate buffer, pH 6.9) and finally with 10% sucrose in PBS, pH 7.2. The brain was dissected and stored overnight in 10% sucrose at 4°C.
Tissue sections were cut on a cryostat at 14 µm thickness and mounted
onto gel-subbed slides. Slides were incubated for 10 min at 92°C in
antigen retrieval solution, pH 7.0 (provided by Alex Kalyuzhny, R & D
Systems, Minneapolis, MN), rinsed in PBS, and immediately prepared for
immunostaining. Sections were preincubated in a humidified chamber in
blocking buffer (0.3% Triton X-100, 1% BSA, and 1% normal donkey
serum in PBS) for 30 min at room temperature and then incubated in
primary antibody [anti-CT1, 1:500; anti-2L1 (CNA1), 1:500 (Alomone
Labs, Jerusalem, Israel); anti-calbindin, 1:500 (Sigma); and
anti-NF200, 1:1500 (Sigma)] overnight at 4°C. After thorough rinsing
in PBS, sections were incubated in species-specific secondary antibody
(Cy3-conjugated, 1:200; Jackson ImmunoResearch, West Grove, PA) for
1 hr at room temperature. Absorption controls were performed
by preincubating the primary antisera with the peptide used in raising
the antiserum at a concentraion of 10 µM. Images were
obtained using the BioRad MRC-1000 confocal imaging system (BioRad
Microscience Division, Cambridge, MA) and printed using a Fuji (Tokyo,
Japan) Pictography 3000 printer.
Assembly of 1A chimeras. Rabbit-human
chimeric 1A subunits were assembled using an
overlap PCR strategy with human and rabbit cDNA and human genomic DNA
as template. All amplifications were performed using a thermostable
polymerase mixture that reduces errors by a proofreading function
(Advantage PCR; Clontech, Cambridge, UK). Each amplified component was
subcloned into the plasmid vector pGEMT (Promega, Madison, WI), and its
sequence was verified by nucleotide sequence analysis. PCR was used to
obtain cDNA correctly spliced for translation of exon 47 from the 3'
region of the human wild-type 1A
subunit. A 150 bp product was amplified from pooled cDNA
constructed from a human cerebellar RNA (Marathon Ready cDNA; Clontech) using forward primer A (AGCGCTGGTCCCGCTCGCCCAGCG),
corresponding to a conserved sequence near the 3' end of exon 46, and
reverse primer B (GGGGGTCTGGGGGAGCTGGC), corresponding to a position 66 bp upstream of the CAG repeat. A clone, pTail-U, was selected that contained the added five-nucleotide GGCAG sequence. The 680 bp
lower half of the cDNA tail was amplified using forward primer C
(GCCAGCTCCCCCAGACCCCC), complementary to primer B, and reverse primer D
(CGATGATTGGTGCTAAGCCCGGGCGAGG), corresponding to the end of the human
1A subunit cDNA, and subcloned (pTail-Ln).
This region contains the polymorphic CAG repeat, which was identified as a CAG13 allele in the human cDNA by dideoxy sequence analysis (pTail-L13). Distinct pathological CAG repeat alleles of 22, 26, and 30 repeats were amplified from genomic DNA of SCA6 patients using forward
primer C (GCCAGCTCCCCCAGACCCCC) and reverse primer S-5-R1
(TGGGTACCTCCGAGGGCCGCTGGTG) (Zhuchenko et al., 1997) and inserted in
place of the CAG13 allele in pTail-L13 by a unique KpnI
restriction site. Full-length cDNA tails, ~800 bp in length and
containing each allele, were assembled by overlap PCR using primers A
and D and templates pTail-U and pTail-Ln and subcloned to generate
pCT(CAG)n. Except for the different length of the CAG repeat stretch,
the 3' cDNA, pCT(CAG)n, sequence is 100% identical to the published
region of the human 1A cDNA clone and consists of 29 bp of exon 46 and the entire exon 47 (Ophoff et al., 1996; Zhuchenko et al., 1997).
The pCT(CAG)n tails were attached to the functional rabbit
1A subunit cDNA, BI-1 (psp72 plasmid backbone,
a gift from Y. Mori; Mori et al., 1991), by means of overlap PCR,
followed by restriction digestion and ligation. The full-length
CT(CAG)n tails were amplified using primers A and D and each pCT(CAG)n
as template. A 685 bp 3' region (BI-1-CT), corresponding to the 3' end
of the rabbit BI-1 cDNA, was amplified using forward primer E
(CCATCCTGGGTGACCCAGCG) and reverse primer F (complementary to primer
A). The 1470 bp overlap PCR product consisting of the product, BI-1-CT,
conjoined to CT(CAG)n was then produced by PCR using primers E and D
and BI-1-CT and CT(CAG)n as templates. This chimeric rabbit human 3'
cDNA PCR product was then substituted for the rabbit BI-1 3' region by
means of the common restriction site BstEII. The proper assembly of the final chimeric products was confirmed by dideoxy nucleotide sequence analysis. RNA was transcribed in vitro
from the BamHI-linearized 1A chimeras.
Electrophysiological recordings. Xenopus oocyte
preparation and injection (20-40 nl of 1 plus
2- plus cRNA at 0.3 ng/nl) were
performed as described elsewhere (Cens et al., 1999). For the G-protein
study a mixture of G0 and µ-opioid receptor cRNA, both at 1 µg/µl, was injected with three volumes of the
Ca2+ channel cRNA. The µ-opioid receptor
cDNA in the plasmid pBluescript (Stratagene, La Jolla, CA) was
linearized with XbaI; the G0 cDNA (gifts from C. Labarea
and L. Yue, Caltech) in pGEM was linearized with NheI; and
both were transcribed with T7 polymerase. Oocytes were then incubated
for 2-7 d at 19°C under gentle agitation before recording.
Whole-cell Ba2+ currents were recorded
under two-electrode voltage clamp using the GeneClamp 500 amplifier
(Axon Instruments, Burlingame, CA). Current and voltage electrodes
(resistance <1 M
) were filled with electrode solution (2.8 M CsCl and 10 mM BAPTA,
adjusted to pH 7.2 with CsOH). Ba2+
current recordings were performed after injection of BAPTA solution [one or two 40-70 msec injections at 1 bar, 100 mM BAPTA-free acid (Sigma), 10 mM CsOH, and 10 mM HEPES,
pH 7.2]. The composition of the recording solution was 10 mM BaOH, 20 mM TEAOH, 50 mM
N-methyl-D-glucamine, 2 mM CsOH, and 10 mM HEPES,
adjusted to pH 7.2 with methanesulfonic acid. Only oocytes expressing
Ba2+ currents with amplitudes in the range
of 0.5-3 µA were analyzed to ensure sufficient resolution and avoid
voltage-clamp problems. Currents were filtered and digitized using a
DMA-Tecmar labmaster and subsequently stored on a personal computer by
using version 6.02 of the pClamp software (Axon Instruments).
Ba2+ currents, recorded during a typical
test pulse from 
80 to +10 mV of 2.5 sec duration, were well fitted
using a biexponential function: i(t) =
(A1* exp((t K)/
1)+ A2
* exp((t K)/2)) + C, where
t is the time, K is the zero time,
A1, A2,
1, and 2 are the
amplitudes and time constants, respectively, of the two exponential
components, and C is the fraction of noninactivating current. Current amplitudes and inactivation time constants were measured using Clampfit (pClamp version 6.02; Axon Instruments). Pseudo-steady-state inactivation curves (2.5 sec of conditioning depolarization) were fitted using the equation
I/Imax = R + (1 R)/(1 + exp((V V0.5)/k)), and
I-V curves were fitted using the equation
I/Imax = g *
(V Erev)/[1 + exp((V V0.5)/k)], where
g is a normalized conductance,
Erev is the extrapolated reversal
potential for Ba2+, k is the
slope factor, V0.5 is the potential
for half-inactivation or activation, V is the
conditioning depolarization for inactivation curves or the membrane
potential used to record current for I-V curves, and
R is the proportion of noninactivating current. All values
are presented as the mean ± SD. The significance of the difference between two means was tested using the Student's
t test (p < 0.05). All chemicals
were from Sigma. D-Ala2, N-Me-Phe4, Gly-ol5 (DAMGO) was purchased from Research Biochemicals (Natick, MA)
and prepared daily at the desired concentration (10 µM).
| |
RESULTS |
The long exon 47 1A sequence is highly expressed in
multiple 1A isoforms in cerebellum
To investigate the distribution of exon 47-encoded
1A polypeptides and to determine whether their
restricted expression could explain the cell selectivity of the
neurodegeneration in SCA6, we generated antisera specific for this
domain and characterized their reactivity to proteins
immunoprecipitated with other anti-1A antisera
defined in Figure 1A.
The C-terminal antiserum reacted with a highly conserved epitope, CT1,
24 residues N-terminal to the predicted polyglutamine tract in the
human 1A and present in the mouse and rabbit C
terminus (Zhuchenko et al., 1997). Figure 1B
demonstrates reactivity of the anti-CT1 antibody to a 6xHis-tagged fusion protein constructed from the mouse cDNA encoding the C terminus
inserted into the 6xHis vector pQE31. The anti-CT1 antiserum reacted with a single species present in transfected bacterial proteins
eluted from a Ni-NTA-agarose column (lanes 2, 4).
The protein detected corresponds well to the predicted molecular
weight of 12 kDa and was also detected by antiserum to the RGS-6xHis tag (lane 1). Binding to the CT1 epitope was blocked by
incubation in CT1 peptide (lane 3).
View larger version (42K):
[in this window]
[in a new window]
|
Figure 1.
A, Diagram of
1A subunit. The gray bar represents the
1A subunit. The approximate positions of the four repeat
domains (I-IV) and the C terminus (C
term) are indicated on the line above. The
positions of the cytoplasmic loop domains
LI-II, LII-III, and
LIII-IV and the extended exon 47 (heavy
line) are indicated below the line. The primary interaction
domain (in the LI-II domain), the
4 interaction domain (in the C terminus), and the
G-protein - interaction domain (in the C terminus) are indicated
as white ovals on the gray bar within the
indicated domains. The polyglutamine tract (Qn) is
located within the elongated exon 47 region. The epitopes for 2L1 and
2L2 (black arrows) are indicated as black
boxes within the LI-II domain. The epitope for CT1
(black arrow) is within the extended exon 47 region
immediately adjacent to the polyglutamine tract
(Qn). The sites of other G-protein and
Ca2+-calmodulin kinase interaction domains have been
excluded for clarity of presentation. B, Antibody to
exon 47-encoded peptide reacts with recombinant mouse 1A
fusion proteins. The mouse C terminus 6xHis-tagged fusion protein was
subjected to 10% SDS-PAGE, transferred to a nitrocellulose membrane,
and probed with antibody to the RGS-6xHis tag (lane 1).
The blot was subsequently stripped and reprobed with rabbit antibody to
the CT1 (lane 2). A single prominent band is seen at the
predicted size of 12 kDa in both reactions. Preincubation of the
membrane with an excess of CT1 peptide (lane
3) blocked binding of anti-CT1 compared with no peptide in
same experiment (lane 4). C,
Multiple 1A isoforms express the long exon 47 sequence.
Shown are immunoblots of immunoprecipitated proteins from membrane
extracts of mouse forebrain (FB, lane 1) and cerebellum
(lanes 2-9). For immunoprecipitation, 2% Triton X-100
extracts were treated with affinity-purified rabbit antibody to CT1
peptide (anti-CT1), anti-2L1 (CNA1), or anti-2L2 (CNA3), followed by
staphylococcal protein A-agarose, as indicated (Pcp Ab),
and separated by electrophoresis in 6% polyacrylamide gels. Blots
(Blot Ab) were incubated with anti-CT1 and
peroxidase-conjugated anti-rabbit Ig and developed with SuperSignal
(Pierce). This blot was then stripped and reincubated with anti-2L1 and
treated as above. On the CT1 blot, isoforms ranging from
<140 to 250 kDa can be identified. The exon 47-positive isoforms in
forebrain (lane 1) appear identical to, although less
abundant than, those in cerebellum (lane 2). The
anti-CT1 antiserum (lane 4) is less efficient at
precipitating the high molecular weight isoforms than are anti-2L1 and
anti-2L2 (lanes 2, 3), although the CT1 epitope is
apparently detected on these polypeptides when precipitated by anti-2L1
or anti-2L2 (lanes 2, 3). Reprobing of the
anti-CT1-probed immunoblot of cerebellar proteins with anti-2L1 after
stripping (lanes 5-7) reveals the same bands at
160, 220, and 250 kDa. Detection of these proteins is completely
inhibited when the anti-CT1 antiserum is preincubated with CT1 peptide
(lanes 8, 9). Exposure times: lane 1, 1 min; lanes 2-5, 1-2 sec; lane 6, 15 sec; lane 7, 5 min; lanes 8 and
9, 2 min.
|
|
To identify brain 1A polypeptides, we analyzed
proteins immunoprecipitated from detergent extracts (Fig.
1C) of forebrain (lane 1) or cerebellum
(lanes 2-9) by SDS-PAGE and immunoblotting using
antipeptide antibodies. In lanes 1-4,
1A polypeptides were immunoprecipitated using
antibody to 2L1, 2L2, and CT1 and reacted with anti-CT1 antibody. 2L1,
equivalent to CNA1 (Westenbroek et al., 1995), and 2L2, the mouse
homolog of CNA3 (Sakurai et al., 1995, 1996), correspond to sequences
found in the LII-III cytoplasmic loop of
1A. Although much less abundant in
immunoprecipitates from other regions, CT1 antiserum appeared to detect
the same pattern of isoform sizes in forebrain (lane 1) and
spinal cord (data not shown). Lanes 5-7 correspond to
lanes 2-4 after the blot was stripped and reacted with
antibody to 2L1 (CNA1). As has been noted previously for
lectin-purified 1A polypeptides, anti-2L1
reacts with polypeptides ranging in size from <160 to >200 kDa
(lane 5). The larger sizes isolated than seen previously may
relate to the simple one-step extraction procedure. Surprisingly, rather than reacting with a single 1A isoform,
the anti-CT1 antiserum binds to a range of polypeptides precipitated by
anti-2L1 (lanes 1, 2) that is similar to the pattern
recognized by 2L1 (lane 5).
Anti-2L2 (equivalent to CNA3), which reacts with a subset of
CNA1-expressing 1A isoforms (Sakurai et al.,
1995, 1996), immunoprecipitates several polypeptides that also bear the
CT1 epitope (Fig. 1C, lane 3). The anti-CT1 antisera was
less efficient at precipitating the 1A
polypeptides. Moreover, both this antibody and the anti-2L2 (CNA3)
precipitate 140 kDa isoforms apparently lacking the 2L1 (CNA1) epitope
(lanes 3, 4). These results are consistent with those
of Northern blot analysis (Zhuchenko et al., 1997) of cerebellar 1A transcripts and studies of other
1 subunits (Sakurai et al., 1995; Lin et al.,
1997) and further indicate that alternative splicing leads to a great
diversity of 1A isoforms. Thus, the extended
exon 47 sequence, which in humans encodes the polyglutamine tract, is
present on multiple 1A isoforms.
The long exon 47 1A sequence is expressed heavily in
cerebellar Purkinje cells and in neurons throughout the nervous
system
To investigate the sites of expression of the long exon 47 1A isoforms, we studied the pattern of
anti-CT1 binding by immunohistochemistry (Fig.
2) and compared this with the pattern
seen with anti-2L1(CNA1). In the cerebellum anti-CT1 stained the
Purkinje cell soma and dendrites intensely (Fig.
2A,B,I,J). Staining was also seen in a smaller
population of cells in the molecular layer and more faintly in the
granule cell layer. This pattern was similar to that seen in human
cerebellar cortex using RNA probes consisting of the exon 46-47
sequence (Ishikawa et al., 1999b). The prominent immunoreactivity
within Purkinje cell bodies and proximal dendrites is highly
reminiscent of those patterns seen with other antisera to
1A subunits, including anti-CNA1 (Westenbroek
et al., 1995; Sakurai et al., 1996). In our hands anti-CNA1 (2L1 in the
current nomenclature) strongly stained the Purkinje cells, but the
dendritic staining was less prominent, presumably because of
differences in fixation, antigen retrieval method, and antiserum lot
(Fig. 2D). Immunostaining by both anti-CT1 (Fig.
2C) and anti-2L1 (data not shown) were blocked by
preincubation in the specific peptide.
View larger version (93K):
[in this window]
[in a new window]
|
Figure 2.
The long exon 47-encoded 1A splice
form is abundant in cerebellar Purkinje cells and is present in other
neocortical neurons. Confocal images of rat cerebellum (A-D, I,
J), neocortex (E, F), and piriform
cortex (G, H) are from sections immunolabeled
with anti-CT1 (A-C, E, G, I, J) or anti-2L1
(equivalent to CNA1; Sakurai et al., 1996; D, F,
H) and double-labeled with anti-calbindin
(I) or anti-NF200
(J). Anti-CT1 labels the Purkinje cell soma and
dendrites intensely (A, B, I, J). Higher
magnification reveals punctate staining within the cell body and
primary dendrite of these neurons (B) that
co-localizes with calbindin in the cerebellum
(I). Anti-CT1 also stains a small
population of cells in the molecular layer of the cerebellum (A,
I, J). Staining is blocked by preabsorption of the
anti-CT1 with CT1 peptide (C). In the cerebellar
cortex the anti-2L1 antibody shows a similar pattern of staining in the
Purkinje cells, although the dendrites are stained less intensely
(D). In neocortex anti-CT1
(E) and anti-2L1 (F)
labeled cortical neurons. In other areas, such as piriform cortex,
cortical neurons were labeled by anti-2L1
(H), whereas there was no staining by
anti-CT1 (G). Staining by anti-2L1 was blocked by
preincubation in 2L1 peptide (data not shown).
Co-localization of anti-CT1 (red) and calbindin
(green) confirmed the localization of CT1
antigen to Purkinje cells and proximal dendrites, as well as what
appear to be interneurons in the molecular layer (I,
J). This is confirmed by the absence of co-localization
between CT1 (red) and NF200 (J,
green). Scale bars: A, C-J, 100 µm;
B, 40 µm.
|
|
The pattern of immunostaining with anti-CT1 differs from that of
anti-2L1 (CNA1) regionally. Some areas, such as regions of the
neocortex, were labeled by both antisera with patterns similar to those
seem in cerebellum (Figure 2E,F). In contrast,
numerous other areas, such as the thalamus, the preoptic area, and the piriform cortex, exhibited no immunostaining by anti-CT1 (Fig. 2G), yet neurons of these areas were clearly labeled by
anti-2L1 (Fig. 2H).
In co-localization studies there was strong overlap of the CT1 staining
with that of calbindin in Purkinje cells, including in their primary
dendrites and terminals (Fig. 2I). When double labeling was performed using anti-NF200, which labels basket cell fibers intensely, staining with anti-CT1 appeared to be confined to
Purkinje cells and some interneurons but was not present in terminals
that project to the Purkinje cell layer (Fig. 2J).
These findings indicate that the long exon 47-encoded sequence (which encodes the SCA6-associated polyQ tract) is expressed abundantly in
Purkinje cell bodies and dendrites and in some interneurons of the
cerebellar cortex. Although these findings cannot account for the
absolute selectivity of Purkinje cell death in SCA6, the prominent
expression of the expanded polyQ tract in these cells may be a
contributing factor to their selective degeneration (Gomez et al.,
1997a; Sasaki et al., 1998; Ishikawa et al., 1999a).
Polyglutamine expansions alter activation and inactivation kinetics
of P/Q channels
To investigate the effect of the polyglutamine expansion on VGCC
function, we expressed chimeric lA cDNA with
five different C-terminal configurations in Xenopus oocytes.
The chimeric 1A cDNAs were assembled from the
rabbit BI-1 cDNA (Mori et al., 1991) containing part of the sequence of
the predicted rabbit exon 46 and the human cDNA encoding the last 29 amino acids of exon 46 and all of exon 47. Separate clones were derived
from PCR-amplified genomic DNA containing the wild-type allele with
13 glutamine residues (Q-13) or the SCA6-associated alleles with
22, (Q-22), 26 (Q-26), or 30 (Q-30) glutamine residues. RNA transcribed
from the BI-1 plasmid or from plasmids bearing chimeric
1A subunits was co-injected with in
vitro-transcribed RNA encoding 2- and either 2, 3, or
4 subunits. All five
1A subunits yielded qualitatively normal
voltage-activated currents.
We studied the effect of the wild-type and different polyQ
SCA6-associated mutant alleles on P/Q channel activation and
inactivation using a paired pulse protocol. Results are summarized in
Table 1 and Figure
3. Oocytes expressing the Q-30
1A chimera and 4 subunits had a significant shift of the point of half-maximal activation, EA0.5, (EA0.5Q-30/
4 = 7 ± 4; n = 12; vs
EA0.5Q-13/4 = 0 ± 5;
n = 7; p = 0.005; Fig. 3A).
The oocytes expressing Q-26 and 4 subunits
also appeared to have a hyperpolarizing shift, although the change was
not statistically significant. In contrast, there was no shift in EA0.5
when the same experiment was performed for the
1A chimeras co-expressed with
2 subunits
(EA0.5Q-30/2 = 11 ± 5;
n = 13; vs EA0.5Q-13/2 = 9 ± 4; n = 12; Fig. 3B) or
3 subunits
(EA0.5Q-30/3 = 4 ± 2;
n = 10; vs EA0.5Q-13/3 = 4 ± 4; n = 14; data not shown).
View larger version (36K):
[in this window]
[in a new window]
|
Figure 3.
A, I-V and
inactivation properties of polyQ mutants co-expressed with
2- and 4. Left, Current
traces recorded during a two-pulse protocol. The first pulse had a
duration of 2.5 sec and amplitudes of 30, 10, 10, and 30 mV,
whereas the second pulse had a duration of 400 msec and an amplitude of
+10 mV. From top to bottom, current
traces recorded from oocytes expressing the BI-1, Q-13, Q-22, Q-26, or
Q-30 chimeric 1A subunit together with the
2- and the 4 subunit. Calibration, 0.5 µA. Right, Inactivation and normalized
I-V curves averaged from recordings performed on 5-12
oocytes of each combination. Bottom, Midpoint of
activation (Va0.5, left), and
midpoint of inactivation (Vi0.5,
right) calculated from recordings of each
Ca2+ channel subunit combination. Note that although
polyQ expansion did not modify the steady-state inactivation curves,
I-V curves were significantly
(p < 0.05) shifted toward negative
potential for the Q-30 mutation. B, I-V
and inactivation properties of polyQ mutants co-expressed with
2- and 2. Recording conditions and
analysis were identical to those in A, except that the
2 subunit was expressed in place of the 4
subunit. Calibration, 0.5 µA. Note that in this case, no significant
change was noticed in the I-V curves.
|
|
We studied the time course of inactivation of P/Q channels during 2.5 sec voltage steps of 10 mV. Figure
4A shows normalized traces of P/Q channels expressing the BI-1 isoform or the long 1A chimeras expressing Q-13, Q-22, Q-26, and
Q-30 alleles in the presence of 2 or
4 subunits. Currents recorded in oocytes expressing the Q-30 allele 1A channel in the
presence of the 4 subunit were visibly
prolonged, whereas channels expressing the
Q-30/2 combination were no different from the
other 1A alleles. To compare the inactivation
of each subunit combination quantitatively, we determined the percent
of noninactivating current as the ratio of the residual current at the
end of the pulse to the peak current at the beginning of the pulse
(Fig. 4B). Q-30/4 channels
inactivate significantly more slowly than the other channels.
View larger version (28K):
[in this window]
[in a new window]
|
Figure 4.
PolyQ expansions in 1A subunit
cause delayed inactivation. A, Superimposed
current traces recorded from oocytes expressing BI-1, Q-13, or Q-30
1A subunit and 2- and 4
(left) or 2 (right). The
voltage-clamp protocol (2.5 sec duration) is shown on
top. All traces are scaled at the same amplitude to
facilitate kinetic comparison. B, The speed of
inactivation of each combination was quantitated by dividing the
current at the end of the pulse by the peak current (percent
noninactivating). Note that when co-expressed with the 4
subunit, the Q-30 mutant inactivated significantly slower than the
other mutants. This effect is not seen when co-expressed with the
2 subunit.
|
|
A kinetic analysis of the inactivation phases has shown that the time
course of inactivation can be fit to two exponents, fast and slow. Only
the fast component is affected by the expanded polyQ
(fastQ-30/4 = 166.4 ± 27.1;
n = 7; vs fastQ-13/4 = 135.5 ± 13.5; n = 7; p = 0.005; Fig. 5A). The fast
component of the Q-30 channels also appears to be prolonged in the
2-expressing channels
(fastQ-30/2 = 205.8 ± 114.9;
n = 10; vs
fastBI-1/2 = 125.8 ± 114.9;
n = 4; p = 0.005). In the
2 channels the slow component represents
~99% of the current decay. This accounts for the lack of effect of
the polyQ expansion on inactivation in
2-expressing oocytes. In
4-expressing channels, however, the slow
component represents ~30% of the current decay. The increase in
fast in Q-30/4 channels leads to the slowed
inactivation.
View larger version (29K):
[in this window]
[in a new window]
|
Figure 5.
Inactivation kinetics of polyQ mutants
co-expressed with 2- and 4 or
2. A, Kinetic analysis of the
inactivation phase of the different polyQ mutants co-expressed with
2- and 4 or 2. In each
case the inactivation phase could be described by two exponential
components, -f and -s. However, although 1A mutant
Ca2+ channels co-expressed with 4 had
a slow component (-s) accounting for ~70% (no statistical
differences among the different mutants) of the inactivation phase,
this component represented 99% of the inactivation when the
2 subunit was expressed. The only effect of the polyQ
mutation (Q-30) was to increase the fast phase of inactivation (-f),
leaving the slow phase (-s) unaffected (whether 2 or
4 was expressed). B, Calculating the
integral of the current traces recorded from oocytes expressing either
the Q-13 or Q-30 1A subunit plus 2-
and 4 shows that, for a current
of a given amplitude, the pathological expansion increased
significantly (p < 0.05) the quantity of
Ca2+ entering into the cell.
|
|
Although the effect on inactivation was statistically significant, it
was important to estimate the potential impact of such a change in
channel kinetics on the intracellular ionic milieu. Figure
5B compares the proportion of
Ca2+ entering the cell with a given
activation of P/Q channels of each type, as determined by the integral
of the current traces over time. With a single event a significantly
greater amount of Ca2+ enters the cell
through Q-30/4 channels than through wild-type or 2 channels.
During normal cellular activity the effect of a reduced threshold for
P/Q channel activation in SCA6 Purkinje cells might potentially be
blunted if the mutation also reduced channel reactivation. Therefore,
we studied the effect of the elongated 1A C
terminus with normal and expanded polyQ tract on recovery from
inactivation. To assess reactivation, the currents evoked by test
pulses delivered at varying intervals after a conditioning pulse (2.5 sec at 10 mV) were plotted as a function of pulse interval. Figure
6A shows typical
current traces for oocytes expressing BI-1 plus
2- plus 4. The
recovery time course was not significantly affected by 1A chimeras Q-13, Q-22, Q-26, and Q-30.
Furthermore, because calcium channel activation occurs repetitively, we
investigated the effect of the modified P/Q channel C termini on the
response to repetitive stimulation (Fig. 6B).
Ba2+ currents were recorded during
stimulation (10 mV, 1 Hz), and the peak amplitude was plotted as a
function of stimulus number. Current decay was assessed by determining
the ratio of the amplitude of the 1st response to that of the 10th
response
(I1/I10).
No statistical differences in
I1/I10
(at the p = 0.05 level) were noted between
current decay in BI-1 and normal (Q-13) or pathological (Q-22, Q-26,
and Q-30) chimeric 1A subunits expressed with
2- and either 4 or
2.
View larger version (29K):
[in this window]
[in a new window]
|
Figure 6.
PolyQ expansions do not affect recovery from
inactivation or response to repetitive stimulation. A,
Recovery from inactivation was recorded during test pulses applied at
various times after the conditioning pulse (2.5 sec duration). Peak
currents were normalized and plotted against time. Typical current
traces recorded from oocytes expressing BI-1 plus 2-
and 4 are shown. Recovery time courses are not
significantly affected by Q-13, Q-22, Q-26, and Q-30. B,
PolyQ expansion did not affect current decay during stimulation at 1 Hz. After a period of rest (>20 sec), a train of depolarization (1 Hz,
+10 mV) was applied, and successive Ba currents were recorded. Peak
current amplitudes recorded for each pulse were then plotted against
pulse number as exemplified at the top for an oocyte
expressing Q-13 plus 2- and 4. Current
decay during this train was then quantified by dividing peak current
recorded at the 1st pulse by peak current recorded at the 10th pulse
(I1/I10). No statistical differences in I1/I10 (at
p = 0.05 level) were noted between BI-1 and normal
(Q-13) and pathological (Q-22, Q-26, and Q-30) chimeric
1A subunit expressed with 2- and
either 4 or 2.
|
|
G-protein regulation of the long exon 47 1A subunit
is abolished by the expanded polyQ tract
There are at least two recognized G-protein interaction domains on
1A subunits, one in the cytoplasmic loop
between repeat domains I and II (LI-II),
adjacent to the primary subunit interaction domain (De et al.,
1997), and a second in the C terminus N-terminal to the putative polyQ
tract (Qin et al., 1997; Furukawa et al., 1998; Simen and Miller,
1998). Because the 4 subunit also interacts
with the 1A subunit C terminus (Walker et al., 1998), we sought to determine whether G-protein regulation of the long
exon 47 1A isoform differed from that of the
BI-1 isoform or whether this regulation was perturbed by the presence
of an expanded polyglutamine tract.
To investigate G-protein regulation, we used the activity of the G
protein-coupled µ-opioid receptor. We co-injected in
vitro-transcribed cRNAs for the µ-opioid receptor and Go cDNA
together with combinations of Ca2+ channel
subunits, including normal or mutated 1A
subunit and 2- and
4 subunits. We tested the effect of perfusion
of the µ-opiod agonist DAMGO on Ba2+
currents evoked by consecutive pulses (50 msec at 0 mV) every 3 sec. Figure 7A shows
typical current traces and time course of inhibition and recovery for a
single subunit combination. To quantitate the extent of regulation, we
calculated the degree of inhibition at the steady state of DAMGO (Fig.
7B). We found that addition of the sequence encoded by the
wild-type extended 47 (Q-13 clone) conferred a greater degree of
G-protein regulation than seen with the BI-1 isoform without the exon
47 extension. Similar findings were obtained with Q22 chimera. In
contrast, the G protein regulation conferred by the long exon 47 sequence appeared to be abolished in the Q26 and Q30 chimeric
1A subunits. Thus, the wild-type long exon 47 1A subunit is sensitive to G-protein regulation, which is in turn impaired by the expanded polyQ tract in
SCA6.
View larger version (26K):
[in this window]
[in a new window]
|
Figure 7.
G-protein regulation of mutant 1A
Ca2+ channels. A, Combinations of
Ca2+ channel subunits including normal or mutated
1A subunit and 2- and
4 subunits were co-injected with the µ-opioid receptor
and Go cDNA. Currents were recorded during test pulses of 50 msec to
0 mV (every 3 sec), and G-protein-dependent regulation was assessed by
perfusing the µ-opioid agonist DAMGO (10 µM). Typical
current traces and time course of inhibition and recovery are shown.
B, G-protein inhibition was quantitated by calculating
the degree of inhibition at the steady-state effect of DAMGO. No
statistical differences were found between the BI-1 and the mutated
subunits presenting various degrees of polyQ expansion (Q-13, Q-22,
Q-26, and Q-30).
|
|
| |
DISCUSSION |
The discovery of the genetic basis of SCA6 was accompanied by the
recognition of a novel splice form of the 1A
subunit expressing a previously unrecognized reading frame of exon 47 of the gene CACNA1A (Zhuchenko et al., 1997). In the human gene this
exon encodes the polymorphic polyglutamine tract that is expanded in SCA6 (Zhuchenko et al., 1997). Because the distribution and properties of 1A subunits expressing this novel sequence
were unknown, and because of its importance in the disease, we studied
the pattern of 1A polypeptide isoforms and
tissue distribution of the exon 47-encoded sequence. Our immunoblot and
immunohistochemical analysis indicates that exon 47 is frequently
translated, is present on multiple 1A isoforms, and is expressed
heavily in Purkinje cells and in lesser amounts throughout the CNS.
Therefore, although restricted expression of the extended sequence of
exon 47 cannot completely account for the selectivity of the Purkinje
cell death in SCA6, its abundance in these cells may play an important role.
Expansion of the polyQ tract in the C terminus of the
1A subunit has three discrete effects when P/Q
channels are expressed in oocytes: (1) the voltage dependence of
channel activation evoked by 10 mV steps is shifted in the
hyperpolarizing direction; (2) the rate of inactivation during a 10 mV
pulse is slowed; and (3) regulation by G-proteins conferred
by the C terminus is abolished. The first two of these effects exhibit
a subunit dependence and are not seen when the chimeric subunits
are co-expressed with 2 or
3 subunits. These studies support the model of
SCA6 as a channelopathy.
The findings in this study are distinct from those of other groups.
Matsuyama et al. (1999) have found that expression of recombinant
1A subunits encoding a Q-30 or Q-40
(exaggerated) polyglutamine tract caused reduced current density and an
8 mV shift in the voltage dependence of inactivation in the
hyperpolarizing direction. The net effect of this change would be to
reduce the number of channels available for activation. Recent studies
using an 1A subunit with a tagged epitope in a
similar system showed an increased current density and
increased level of expression (Piedras-Renteria et al., 1999). In both
studies there was a small shift in the voltage dependence of activation
in the hyperpolarizing direction that did not reach statistical
significance for either spontaneous (Q-27 or Q-30) or exaggerated (not
found in humans, Q-40 or Q-72) alleles.
At least three explanations may account for these different findings.
(1) In the present study 1A subunit alleles
were co-expressed with 2,
3, or 4 subunits,
whereas the 1a (the muscle-specific) and
1b isoforms were used in the other studies
(Matsuyama et al., 1999; Piedras-Renteria et al., 1999). The clear
dependence of the SCA6 effect on subunit subtype in our study
further indicates the importance of an auxiliary subunit subtype in
shaping P/Q channel activity and may account for the different
findings. (2) In this study, the use of the Xenopus oocyte
expression system rather than mammalian cells may have led to distinct
or more robust responses. It will be important to determine whether the
recordings in oocytes represent an exaggeration of the effect in
vivo or whether the recordings in mammalian cells with distinct
subunit subtypes exhibit the same effect. (3) In the present study
the 3' portion of the correctly spliced human 46-47 cDNA (with the polyQ allele substituted) was added to the cDNA encoding the rabbit BI-1 isoform of the 1A subunit rather than
inserting the polyglutamine tract directly into the rabbit in frame 3'
untranslated region (UTR) (Matsuyama et al., 1999). Thus, the chimeric
1A subunits in the present study possess 253 amino acids encoded by human exons 46 and 47. Although the rabbit BI-1
3' UTR encodes a sequence 90% identical to the human extended
1A isoform, subtle differences may be
important (Zhuchenko et al., 1997).
The C terminus of the 1A subunit in P/Q
channels participates in subunit interactions and
Ca2+-calmodulin-mediated regulation and
contains an interaction domain for G-protein regulation. (Qin et al.,
1997; Furukawa et al., 1998; Simen and Miller, 1998). The sequence
encoded by the entire exon 47 nearly doubles the length of the C
terminus of the 1A subunit by the addition of
246 amino acids (Zhuchenko et al., 1997). Although this exon encodes
the polymorphic polyglutamine tract and SCA6-associated expanded polyQ
alleles, the wild-type Q-13 and mildly expanded Q-22 alleles appear to
have no effect on P/Q channel activation or inactivation. On the other
hand, chimeric Q-13 and Q-22 1A subunits are
more susceptible to inhibition by G-protein than is BI-1, as
demonstrated by the inhibitory effect of the opioid agonist DAMGO when
channels were co-expressed with the µ-opioid receptor. This may
account for some differences in disease severity and disease phenotype
associated with different CAG repeat sizes (Kaseda et al., 1999).
Curiously, the larger expanded alleles, Q-26 and Q-30, appear to
interfere with the regulatory role of the C terminus. This provides a
second aspect of the molecular phenotype of the mutant P/Q channels in
SCA6 and may explain the differences found in the activation properties of the different alleles.
The dependence of subunit subtype in determining the phenotype of
the SCA6 mutation is a plausible finding. subunits have a prominent
effect on gating of VGCC (De and Campbell, 1995; Cens et al., 1999).
subunit subtypes diverge greatly in primary structure in their C
termini, and the 4 subunit has a unique C
terminus interaction with the 1A subunit C
terminus (Walker et al., 1998). The expanded polyglutamine tract in the
SCA6-associated 1A subunit may alter channel
gating by interfering with this 4-specific interaction with the 1A C terminus.
Among several allelic mouse neurological mutants affecting CACNA1A, the
recessively inherited tgla
(leaner) mouse bears the greatest similarity to SCA6.
Homozygous tgla mice develop
dystonia, severe ataxia, and absence seizures after weaning (Fletcher
et al., 1996). They develop Purkinje cell degeneration, but it is
confined to parasagittal striped domains overlapping the pattern of
zebrin expression in the cerebellar cortex (Fletcher et al., 1996). The
tgla mutation disrupts the C
terminus of the 1A subunit and presumably interactions with the 4 subunit, G-protein
, and Ca2+-calmodulin kinase
(Furukawa et al., 1998; Walker et al., 1998; Lee et al., 1999).
Cultured tgla Purkinje cells
have reduced Ca2+ current density, a
molecular phenotype that is replicated in recombinant expression
studies, as well as an increase in the noninactivating component of
calcium currents (Wakamori et al., 1998).
In SCA6, Purkinje cell degeneration is not confined to parasagittal
zones (Gomez et al., 1997a; Sasaki et al., 1998; Ishikawa et al.,
1999a). Moreover, we found that immunostaining with anti-CT1 did not
reflect any compartmentalization of exon 47 expression into
parasagittal zones in rat cerebella (data not shown). Thus, although
the two types of Ca2+ channel mutations
appear to have some opposing effects on P/Q-type Ca2+ channel activity, differences in the
inheritance pattern, age of onset, and tissue selectivity between the
two resulting diseases suggest a model in which Purkinje cell
development and viability depend on tight control of
Ca2+ channel function and the avoidance of
either abnormally increased or decreased
Ca2+ current. The congenital myasthenic
syndromes represent a similar case in which weakness and impaired
neuromuscular transmission can arise from either homozygous
inactivating mutations or heterozygous "gain-of-function" mutations
of the acetylcholine receptor subunits (Engel et al., 1996a,b; Gomez et
al., 1996).
The changes in P/Q channel properties resulting from the SCA6 mutations
will have several effects on the electrophysiological and cellular
properties of the Purkinje cells. In isolation, a delay in inactivation
of the magnitude measured in this study will result in entry of
1.3-fold greater Ca2+ per activation. This
could significantly increase the amount of
Ca2+ entering the Purkinje cell during
climbing fiber activity or other influences that activate 1 Hz complex
spike activity (Kitazawa et al., 1998; Lang et al., 1999).
The effect of the shift in activation of P/Q channels toward the
hyperpolarizing direction could have a more dramatic effect on both
Purkinje cell firing and intracellular ion content. In the absence of
any compensatory response, this change would potentially lead to
opening of a greater number of VGCC and entry of more Ca2+. At the physiological level,
excessive Ca2+ ions entering through the
SCA6-mutant channels might be compensated for by downregulation of gene
expression of the 1A subunit. This is
apparently not the case, because immunohistochemical staining of
1A subunits in SCA6 cerebellar Purkinje cells
shows normal levels (Ishikawa et al., 1999b). If sufficient to exceed
the intracellular buffering capacity, Ca2+
overload could result in activation of
Ca2+-sensitive enzymes, such as caspases,
calpain, and phospholipases, leading to cell death, as has been
suggested for other conditions characterized by excitotoxity or
Ca2+ overload (Mattson, 1992; Choi, 1994;
Dugan and Choi, 1994; Gomez et al., 1997b).
Neurodegeneration in SCA6 is highly selective for Purkinje cells (Gomez
et al., 1997a; Sasaki et al., 1998; Ishikawa et al., 1999a). On the
basis of their prominent involvement in other multisystem degeneration
(Durr et al., 1995; Durr et al., 1996; Koeppen, 1998), Purkinje cells
appear to be a vulnerable cell type. However, expression of the
SCA6-associated exon 47 is more prominent in the Purkinje cells than in
many other regions. Furthermore, expression of the 4 subunit is more abundant in Purkinje cells
than in other areas (Burgess et al., 1999). There are conflicting
reports on the relative level of expression of
3 (Tanaka et al., 1995; Ludwig et al., 1997;
Volsen et al., 1997; Burgess et al., 1999). The strikingly selective
degeneration of Purkinje cells may relate in part to the combined
effect of a high level of Purkinje cell expression of the pathogenic
splice form and its co-localization with the 4
subunit. Regional co-localization studies at the subcellular level
combined with co-immunoprecipitation studies may clarify this issue.
Another study has demonstrated the presence of cytoplasmic aggregates
in Purkinje cells in SCA6 (Ishikawa et al., 1999b). These aggregates
may arise because of self-association properties of the polyglutamine
tract. Although it is difficult to envision how cytoplasmic aggregates
could contribute to altered channel function, the formation of these
associations while inserted in the membrane of the Purkinje cell soma
or dendrite could have a prominent effect on channel gating.
These studies show that the SCA6 polyglutamine expansion causes a
change in the function of an endogenous ion channel molecule, suggesting that SCA6 differs qualitatively from the other characterized forms of SCA. Although abnormal protein folding may yet underlie this
perturbed channel function in SCA6, recognition that SCA6 is a
channelopathy may lead to development of rational drug therapies. Further advances using co-localization studies and neuronal expression studies in vitro and in vivo may reveal more
details of the pathogenesis of SCA6.
| |
FOOTNOTES |
Received March 3, 2000; revised June 7, 2000; accepted June 9, 2000.
This work was supported by National Institutes of Health Grants RO1
NS37211 and RO1 NS36809 (C.M.G.), NATO Grant CRG 972059, Association
Francaise contre les Myopathies, Association pour la Recherche contre
le Cancer, Ligue Nationale contre le Cancer (P.C.), and Groupement
TOP
ABSTRACT
INTRODUCTION
