QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

HOME  |   SEARCH  |   ARCHIVE  |   SUBSCRIBE  |   CONTACT  |   HELP

This Article Abstract Full Text (PDF) Submit an eLetter Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via ISI Web of Science (35) Citing Articles via Google Scholar Google Scholar Articles by Zhou, J. Y. Articles by Miller, R. J. Search for Related Content PubMed PubMed Citation Articles by Zhou, J. Y. Articles by Miller, R. J.

 Previous Article  |  Next Article 

The Journal of Neuroscience, October 1, 2000, 20(19):7143-7148

Selective Regulation of N-Type Ca Channels by Different Combinations of G-Protein / Subunits and RGS Proteins

Janice Y. Zhou¹, David P. Siderovski², and Richard J. Miller¹

¹ Department of Neurobiology, Pharmacology, and Physiology, University of Chicago, Chicago, Illinois 60637, and ² Department of Pharmacology, University of North Carolina, Chapel Hill, North Carolina 27599

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

We examined the effects of G-protein  and  subunit heterodimers on human _1B (N-type) Ca channels expressed in HEK293 cells. All of the known  subunits (1-5) produced voltage-dependent inhibition of _1B Ca channels, depending on the  subunit found in the heterodimer. 1-4 subunits inhibited Ca channels when paired with 1-3. However, 5 subunits only produced inhibition when paired with 2. In contrast, heterodimers between 5 subunits and RGS (regulators of G-protein signaling) proteins containing GGL domains did not produce inhibition of Ca channels. However, GGL domain-containing RGS proteins (e.g., RGS6 and RGS11) did block the ability of G5/2 heterodimers to inhibit Ca channels. Because all of the G-protein  subunits are found in the nervous system, we conclude that they may all potentially participate in Ca channel inhibition. The interaction of GGL-containing RGS proteins with G52 suggests a novel way in which Ca channels can be regulated.

Key words: heterotrimeric G-proteins; calcium channel; ion-channel modulation; RGS proteins; presynaptic inhibition; synaptic transmission

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Activation of G-protein-coupled receptors (GPCRs) by neurotransmitters has been shown to induce the inhibition of several types of voltage-sensitive Ca channels, including _1B (N-type), _1A (P/Q-type), and _1E (R-type) (Miller, 1998; Simen and Miller, 1998, 2000). The resulting reduction in Ca influx may be important for GPCR-mediated inhibition of neurotransmitter release (Miller, 1998). Investigations of the mechanisms underlying GPCR-mediated Ca channel inhibition have shown that different processes can occur. The best studied of these is rapid and is characterized by its voltage dependence (Hille, 1994; Miller, 1998). The view is widely held that Ca channel inhibition of this type is mediated by the direct binding of G-protein / subunits to one or more sites on the Ca channel 1 subunit (Herlitze et al., 1996; Ikeda, 1996; J. F. Zhang et al., 1996; Qin et al., 1997; Simen and Miller, 1998, 2000; Canti et al., 1999). According to this model, activation of any GPCR should produce inhibition of Ca channels, because / subunits are always released. However, this is clearly not the case, and there are many examples of GPCR activation that does not produce voltage-dependent inhibition of Ca channels (Bernheim et al., 1991; Taussig et al., 1992; Shapiro and Hille, 1993; Hille, 1994; Shapiro et al., 1994; Liu et al., 1995; Margeta-Mitrovic et al., 1997). In many cases these GPCRs are linked to G-proteins of the q/11 family. However, the reasons for this selectivity are not clear. One possibility is that not all combinations of / subunits are equally effective in inhibiting Ca channels. There are at least 5 types of  subunits, all of which are found in the nervous system (Betty et al., 1998), and at least 11 types of  subunits; therefore, many / combinations are potentially possible (Morris and Malbon, 1999). Garcia et al. (1998) examined this question by analyzing the effects of expressing different  subunits in cultured rat superior cervical ganglion (SCG) neurons. They observed that only 1 and 2 produced strong voltage-dependent Ca channel inhibition, whereas 5 and, particularly, 3 and 4 were weak in this regard. Because G_q is often thought to associate with 5 (Fletcher et al., 1998), it could be argued that lack of effect of 5 was responsible for the modest Ca channel inhibition observed with GPCRs of this type. Recently, however, Ruiz-Velasco and Ikeda (2000) reexamined this question and observed that all  subunits could produce inhibition of Ca channels in rat sympathetic neurons under the appropriate conditions.

In the present series of experiments we examined this question further using cloned human _1B (N-type) Ca channels and different combinations of / subunits. Our data indicates that all of the  subunits can inhibit Ca channels, but that this is dependent on the nature of the  subunit present in the / heterodimer. Moreover, the effects of some / combinations are influenced by RGS (regulators of G-protein signaling) proteins, suggesting a novel mechanism through which these proteins may regulate neuronal Ca channels.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Expression constructs. Mouse G4 (GenBank accession number M87286) was prepared from adult male CD4 mouse brain mRNA. Human G1 (X04526), G2 (NM_005273), G3 (NM_002075), and G5 (AF017656) were obtained from human embryonic kidney (HEK) cell line mRNA (Quick Prep Micro mRNA purification kit; Amersham Pharmacia Biotech, Piscataway, NJ).  subunit cDNAs were amplified from the isolated mRNA by reverse transcription-PCR (thermal cycling: 98°C, 20 min; 56°C, 1 min; 72°C, 1.5 min; 35 cycles, preceded by a 3 min 98°C denaturing) with SuperScript II reverse transcriptase (Life Technologies, Rockville, MD) and oligo-dT oligonucleotides and then with specific primers and TakaRa LA Taq DNA polymerase (PanVera, Madison, WI). Subunit specific primers used here were as follows: 1 forward (1F), GCCGCCACCATGAGTGAGCTTGACCAGTTACGGCAGGAG; 1 reverse (1R), CTTAGTTCCAGATCTTGAGGAAGCTATCCCA; 2F, GCCGCCACCA-TGAGTGAGCTGGAGCAACTGAG; 2R, CCATTAGTTCCAGATC-TTGAGGAAGG; 3F, GCCACCATGGAGCAACTGCGTCAGGAA-GC; 3R, CCACTTCCCTTTCTCCAGCCTCC; 4F, GCCACCATGA-GCGAGCTGGAGCAGCTGA; 4R, CTCCATGTATCATTGGAGA-ACAG; 5F, GCCGCCACCATGGCAACCGAGGGGCTGC; and 5R, GATGATTAGGCCCAGACTCTGAG.

All constructs contained an expression-optimized Kozak sequence (GCCACC) before the 5'-ATG start codon. The resulting amplification products were first cloned into pCRII/TOPO vector (Invitrogen, San Diego, CA) for verification. Verified constructs were directionally cloned into a mammalian expression vector driven by the cytomegalovirus (CMV) promoter (G1 was cloned in pCMV6C; G2, G3, and G5 were cloned in pcDNA3.1; and G4 was cloned in pCR3.1). The resulting clones were verified by restriction enzyme digestion and automated DNA sequencing (ABI 377 sequencer; Perkin-Elmer, Oak Brook, IL). G1 was subcloned in pCDNA1, G2 in pCDM8.1, and G3 in pCDNA1 (gifts from Dr. Katz, Caltech). Green fluorescent protein (GFP) vector is commercially available from Life Technologies.

The RGS11n construct encoding the N-terminal half of the RGS11 protein contains DEP and GGL domains, and the RGS11c construct encoding the C-terminal half of the RGS11 protein contains an RGS domain. They were generated by PCR (T7 primer with R11R, CTTCGTGGGGGCAGCCTCGAGGGGGGCATTCATGAC; and pcDNA3.1R primer with R11F, GTGGTGGAATTCGACCATGCCGCATCTGAG-GAAGATGGAGCGGGTGGTCGTGAGCATGCAGGACGTCATGAATGCCCCCACGGTGGCT) using pfu DNA polymerase (Stratagene, La Jolla, CA) and were subcloned into a pcDNA3.1 vector. The two constructs were designed to have the same sequence around the start codon as in full-length RGS11 to achieve similar expression levels. Full-length RGS11, RGS11D, and RGS11*(PW274AS), full-length RGS6, RGS6D, and RGS6*(D297A) constructs were tagged with an N-terminal hemagglutinin epitope and subcloned into the pcDNA3.1 vector as described (Snow et al., 1998, 1999). RGS2, RGS4, and untagged RGS11 constructs, cloned into the mammalian expression vector pcDNA3.1, were gifts from Drs. A. Gilman and A. Krumins (University of Texas Southwestern Medical Center).

Cell culture and transient transfection. The C2D7 cell line, derived from HEK293 cells stably expressing the N-type Ca channel _1B, ₂, and _1-3 subunits (Simen and Miller, 1998, 2000), was kindly provided by SIBIA Neurosciences and kept in medium (11995DMEM, 1% penicillin/streptomycin, 5% bovine calf serum, 0.5 g/l geneticin, and 70 µl/500 ml hygromicin). The cells were transfected with 5 µg of G-protein  subunit, 5 µg of G-protein  subunit, and 1 µg of GFP DNA, using the polyethylenimine method as described by Boussif et al. (1995). In RGS cotransfection experiments, different amounts of G, G, and RGS DNA were used as indicated in the text. Successfully transfected cells were identified by GFP fluorescence.

Electrophysiological recording. At 40-72 hr after transfection, total Ba²⁺ currents were measured using the whole-cell patch-clamp technique. The coverslips were mounted in a perfusion chamber and constantly perfused by a gravity feed system with a modified HEPES-balanced external solution (151 mM tetraethylammonium chloride, 10 mM HEPES, 5 mM BaCl₂, 1 mM MgCl₂, and 10 mM glucose, pH adjusted to 7.4 and osmolarity to 310 mOsm) to isolate the I_Ba. Pipettes of 3-5 M were pulled from microhematocrit capillary tubes (VWR Scientific, West Chester, PA) with a Flaming-Brown P-97 micropipette puller (Sutter Instrument Co., Novato, CA). The pipette solution contained 100 mM CsCl, 1 mM MgCl₂, 10 mM HEPES, 10 mM BAPTA, 3.6 mM MgATP, 14 mM phosphocreatine (CrP), 0.1 mM LiGTP, and 50 U/ml creatine phosphokinase (CrPK); pH was adjusted to 7.2 with Cs(OH), and osmolarity was near 290mOsm. The tip solution was similar to the pipette solution without MgATP, CrP, LiGTP, or CrPK.

I_Ba was measured and recorded with an Axopatch 200B (Axon Instruments, Foster City, CA) using the Clampex program (pClamp 6 software suite; Axon Instruments). Data were digitized at 10 kHz and filtered at 5 kHz. Series resistance was compensated to 70%, and currents were leak-corrected on-line using a P4 protocol. Prepulse experiments were performed using a prepulse protocol consisting of a 50 msec +10 mV depolarization test pulse from 80 mV holding potential with (test pulse 2) or without (test pulses 1) a 50 msec +80 mV prepulse (Fig. 1A). There was a 5 msec 80 mV interval between the prepulse and test pulse. Currents were analyzed off-line using the Clampfit program. Facilitation was indicated by calculating the "facilitation ratio" (P2/P1), which we defined as the peak current of test pulse 2 divided by the current of test pulse 1 at the same time point (See Simen and Miller, 1998). This time point was normally between 6 and 15 msec after the start of the depolarizing test pulse. All experiments and solutions were used at room temperature.

Statistical analysis for multiple comparisons was performed using one-way ANOVA followed by a nonparametric Kolmogorov-Smirnov test. The unpaired t test was used for two-group comparison. p < 0.01 was considered statistically significant.

Northern blots. Total RNA was isolated from transfected (48 hr) C2D7 cells using the guanidine thiocyanate-phenol method (Trizol reagent; Life Technologies). Total RNA from untransfected cells was used as a control. Twenty micrograms of RNA for each sample were separated on formaldehyde-agarose gels and transferred to Hybond-N⁺ nylon membranes (Amersham Pharmacia Biotech). Each  subunit was probed with a subunit-specific oligonucleotide (1, TTCCCACTGGGTCGATGTTGTT-TGTG; 2, GGAGCAGATGTTGTCCAACC; 3, AATGAAGAGATTG-AAGTCAGGAGACAC; 4, TCCCGAACTTGTAATGATTT GTCCA; 5: CGTGCAGGGCATGGTGACCGCGTGCT). The probe was labeled with T4 polynucleotide kinase (New England Biolabs, Beverly, MA) and [³²P]ATP (6000Ci/mmol; Amersham Pharmacia Biotech). Membranes were prehybridized for 2 hr at 42°C (6× SSPE, 5× Denhardt's solution, 0.1% SDS, and 100 µg/ml boiled salmon sperm DNA) and hybridized at 42°C overnight (prehybridization solution plus labeled probes). The blots were washed in 5× SSC and 0.5% SDS at room temperature for 10 min and in 0.5× SSC and 0.1% SDS at 42°C for 10-60 min.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

We subcloned human G-protein 1, 2, 3, and 5 and mouse (m) 4 into CMV vectors. All  subunits were sequenced and matched sequences formerly reported, with the exception that the m4 sequence showed four differences from that reported in the database (M87286). As previously observed (Snow et al., 1999), there were two silent mutations at positions 433 (AG) and 634 (GC), and differences at positions 434 (GA) and 458 (GC) corresponded to AspAsn and AlaPro substitutions. Three independent clones were sequenced, and all showed the same changes.

We examined the effects of overexpressing different G-protein  subunits on cloned human _1B (N-type) Ca channels (_1B-1, ₂, and _1-3) stably expressed in HEK293 cells (C2D7 cells). In control cells, a 50 msec depolarizing test pulse to +10 mV elicited a rapidly activating and slowly inactivating I_Ba, which was not significantly altered by a 50 msec prepulse to +80 mV (Fig. 1A). To study the ability of different G protein / dimers to inhibit the I_Ba, we transiently transfected C2D7 cells with different G-protein  subunits, together with 3 subunits and GFP DNA. Ba currents were only recorded from GFP fluorescent cells. Expression of 13 subunits in C2D7 cells reduced the I_Ba amplitude and slowed its activation rate (Fig. 1B, trace 1). The inhibition was "relieved" by a depolarizing prepulse (Fig. 1B, trace 2). The resulting "facilitation ratio" (see Materials and Methods) has frequently been used as an index of voltage-dependent, membrane-delimited inhibition of Ca channels by G protein / subunits (Simen and Miller, 1998, 2000). In addition, the I-V curve for the I_Ba was shifted to the left by ~10-15 mV after the prepulse (Fig. 1B, bottom traces). As did Garcia et al. (1998), we observed that both 13 and 23 inhibited N-type currents in a voltage dependent manner, with facilitation ratios of 1.76 ± 0.16 and 1.87 ± 0.21, respectively (Fig. 1B,C). In contrast to Garcia et al. (1998), we found that 43 and 33 also significantly inhibited the I_Ba (Fig. 1D,E). 43 and 33 produced facilitation ratios of 2.01 ± 0.18 and 1.50 ± 0.12, respectively. However, no effects were observed in cells transfected with G53 DNA (Fig. 1F). Moreover, overexpression of any  subunits alone failed to produce inhibition of the I_Ba (data not shown). To exclude the possibility that the inability of 53 to inhibit the I_Ba was attributable to a failure to express the 5 subunit, total RNA was isolated from transfected cells and probed with  subunit-specific oligonucleotides. Each  subunit was expressed as a transcript of ~1.2 kb (Fig. 2).

View larger version (31K): [in this window] [in a new window]   Figure 1.   Effects of different G  subunits on barium current facilitation. Top panel, Superimposed IBa during a 50 msec depolarization to +10 mV from 80 mV holding potential, without (trace 1) and with (trace 2) a 50 msec +80 mV prepulse. Bottom panels, Leftward shift of the I-V curve after the prepulse (dashed gray line). Currents were recorded 40-72 hr after transfection of C2D7 cells with GFP alone (A) or with G-protein 1 (B), 2 (C), 3 (D), 4 (E), or 5 (F), expressed together with G3.

View larger version (56K): [in this window] [in a new window]   Figure 2.   Northern blot of G protein  subunit expression. Total mRNA (20 µg) isolated from untransfected C2D7 cells (as control, C) and cells transfected with different G protein  subunits (as marked) were hybridized with subunit-specific oligonucleotide probes (see Materials and Methods). Positions of the RNA size standards (in kilobases) are shown on the left. Heterologously expressed G subunits are marked with an arrow on the right. Endogenous G subunits were expected to have similar sizes. However, because they were expressed in much lower amounts, they would not be detected under these experimental conditions.

To further assess the potential role of G-protein  subunits, we investigated the ability of other combinations between 1-4 and 1-3 to inhibit the I_Ba. These results are summarized in Figure 3. For 1 combinations, 11 exhibited the largest facilitation ratio (1.72 ± 0.14). 21, 31,and 41 exhibited smaller effects, although they were still significantly different from control (one-way ANOVA, p < 0.01). As with 53, 51 failed to inhibit the I_Ba. 2 combinations showed similar facilitation ratios for 1-4 as did 3 and 1 combinations. A striking difference, however, was that 52 strongly inhibited the I_Ba, exhibiting a facilitation ratio of 1.76 ± 0.07. 

View larger version (24K): [in this window] [in a new window]   Figure 3.   Summary of facilitation ratios for barium current inhibition after transfection of different G combinations. G-protein  subunits were coexpressed with G1 (A), G2 (B), and G3 (C). G expressed alone did not produce facilitation of IBa, as represented by G2 in B. Data are plotted as mean ± SEM; *p < 0.01, one-way ANOVA analysis followed by nonparametric Kolmogorov-Smirnov test (n = 7~15).

It is interesting to note that G protein  subunits are not the only proteins that can potentially form heterodimers with -subunits. RGS6, 7, 9,and 11 belong to a subfamily of G protein -subunit GTPase-activating proteins (GAPs) that contain a -subunit-like (GGL) domain (Hepler, 1999; Siderovski et al., 1999). It has been shown that GGL domain-containing RGS proteins form heterodimers with G5 (Snow et al., 1998, 1999; Posner et al., 1999), raising the possibility that 5/RGS heterodimers could effectively inhibit Ca channels or that RGS proteins could act as "antagonists" by inhibiting the interaction between 2 and 5. The next series of experiments were designed to investigate these possibilities. Coexpression of the GGL domain containing RGS11 with G5 did not result in Ca channel inhibition (data not shown). Furthermore, neither RGS11 nor G5 expressed alone produced any effect on the I_Ba (Fig. 4A; data not shown for G5 alone). Interestingly, however, we observed that coexpression of RGS6 or RGS11 with 52 was able to antagonize the effects of the / heterodimers (Fig. 5). Thus, increasing the ratio of RGS11 to 2 in the transfection produced a dose-dependent reduction in the facilitation ratio observed (Fig. 4A). This inhibition was selective for the 52 combination; when RGS11 was coexpressed at an 8:1 ratio to 2, together with 2, no reduction in the effects of the 22 subunits was observed (Fig. 4B). It has been shown that point mutations in the GGL domain (D297A in RGS6 and PW274AS in RGS11) abolish the interaction between GGL-containing RGS proteins and G5 (Snow et al., 1999). Expression of full-length RGS6/11 cDNA constructs with these mutations failed to block the effects of G52 (Fig. 5), thus supporting the role of the GGL domain in the interaction between RGS11 and 52.

View larger version (28K): [in this window] [in a new window]   Figure 4.   RGS11 antagonized the effects of 52. Increasing the ratio of RGS11 to 2 reduced the IBa facilitation ratio produced by 52 (A). However, RGS11 did not antagonize the effects of 22 (B). In the second set of experiments (B), 8 µg of RGS11 was cotransfected with 1 µg of 22 or 52. Numbers of experiments are in parentheses. Data are plotted as mean ± SEM; *p < 0.01, unpaired t test between 52 and 52RGS11.

View larger version (30K): [in this window] [in a new window]   Figure 5.   RGS6 and RGS11 antagonism of G52 facilitation of Ca currents depends on their GGL domains. RGS6 and RGS11 constructs were cotransfected with G52 at an 8:1 ratio. (RGS6* and RGS11* represent full-length cDNA constructs with mutations in the GGL domain that inhibit binding to 5; see Results and Snow et al., 1999). A, Typical current traces with (trace 2) or without (trace 1) prepulse. B, Summary of facilitation ratios for IBa inhibition after cotransfection with 52 and different RGS constructs. Data are plotted as mean ± SEM; *p < 0.01, one-way ANOVA analysis followed by nonparametric Kolmogorov-Smirnov test (n = 6~15).

All four of the GGL-containing RGS proteins, RGS6, 7, 9, and 11, contain a DEP (dishevelled/Egl-10/pleckstrin) domain as well as GGL and RGS domains. To further answer the question of which domain(s) is involved in the interaction with G52, we made two constructs consisting of the N-terminal (RGS11n) and C-terminal (RGS11c) halves of the RGS11 protein, with RGS11n containing the DEP and GGL domains and RGS11c containing the RGS domain and a C-terminal tail (Fig. 6B). At an 8:1 ratio, cotransfection of the RGS11n construct reduced the facilitation ratio produced by G52 to a degree similar to that observed with the full-length RGS11. However, cotransfection of RGS11c did not reduce the facilitation ratio significantly (Fig. 6C). In accordance with this result, RGS2 and RGS4 proteins, which contain only an RGS domain, failed to reduce the facilitation ratio when coexpressed with G52 (Fig. 6C). To further address the question of whether the DEP domain is a requirement for interaction with G5, the DEP domains of RGS6 and RGS11 were deleted. Both constructs blocked the facilitation by G52 to an extent similar to that of full-length RGS6 and RGS11 (Fig. 6C).

View larger version (38K): [in this window] [in a new window]   Figure 6.   RGS protein constructs have different abilities to antagonize IBa inhibition by 52. Various RGS constructs were cotransfected with G52 at an 8:1 ratio. A, Typical current traces with (trace 2) or without (trace 1) prepulse. B, Schematic structures of different RGS protein constructs. Artificial linkers or termini are drawn in thick lines. Hatched boxes, DEP domain; open boxes, GGL domain; filled boxes, hemagglutinin (HA) epitope; gray boxes, RGS domain. C, Summary of facilitation ratios for IBa inhibition after cotransfection with 52 and different RGS protein constructs. Data are plotted as mean ± SEM; *p < 0.01, one-way ANOVA analysis followed by nonparametric Kolmogorov-Smirnov test (n = 8~15).

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Voltage-dependent inhibition of Ca channels is thought to be mediated by direct binding of G protein / subunits to one or more sites on the ₁ subunit of the Ca channel (Herlitze et al., 1996; Ikeda 1996; Simen and Miller, 1998, 2000). An important question is how selectivity can be imparted to this process. That this is indeed important is indicated by studies showing that the productive activation of some GPCRs, particularly those linked to the _q family of heterotrimeric G proteins, does not produce voltage dependent inhibition of Ca channels, or at least rather little in comparison with other receptors (see introductory remarks). Because the activation of all GPCRs presumably results in the release of / subunits, it is unclear what factors underlie specificity. However, because the precise composition of the heterotrimeric G proteins that interact with each receptor presumably differs, this may dictate specificity in some manner that is not currently understood. One important possibility is that not all combinations of / heterodimers are able to inhibit Ca channels. Considering that there are at least 5 different  subunits and at least 11 types of  subunits, the number of possible combinations is very large (Morris and Malbon, 1999). Garcia et al. (1998), examined the ability of all of the known  subunits to produce Ca channel inhibition when they overexpressed them in rat SCG neurons. They observed that only 1 and 2 produced strong Ca channel inhibition. Our results complement those of Garcia et al. (1998) in certain important respects. We have shown that all of the  subunits can in fact produce strong Ca channel inhibition, but that this may depend critically on the nature of the -subunit involved. For example, although 1-4 are effective when combined with 1, 2, or 3, 5 is only effective when expressed with 2. Similar conclusions can be drawn from the recent work of Ruiz-Velasco and Ikeda (2000). These results indicate that it is possible that in the SCG neurons used by Garcia et al. (1998), 2 was not highly expressed, or that any other  subunits that form heterodimers with 5 are also probably ineffective (Watson et al., 1994, 1996). Other explanations are also possible (see below).

The observation that only 2 was effective in combination with 5 is consistent with several other observations in the literature. It has been shown that 5 will associate with several different  subunits, including 2, 4, 5, and 7 (Watson et al., 1994, 1996). Comparison of the functional effects of these heterodimers is limited. However, 52 was shown to be a far more effective activator of phospholipase C (PLC)-2 than either 54 or 57 (S. Zhang et al., 1996). On the other hand, none of these combinations proved to be effective activators of the MAPK and JNK pathways, although they were all effective in combination with 1 (S. Zhang et al., 1996). Thus, 5-containing heterodimers are not effective in all signaling pathways. Clearly, in the case of N-type Ca channels, the 5/2 combination is effective, but 51 and 53 are not. Of particular interest in this regard are observations that 52 heterodimers are selectively found in association with _q or other members of this family of heterotrimeric G proteins (Fletcher et al., 1998). Thus, activation of receptors such as the M1 muscarinic receptor, the ET1 endothelin receptor, or other _q linked receptors can be expected to release 52 subunits (Lindorfer et al., 1998). Because we have now shown that these heterodimers are effective inhibitors of _1B Ca channels, it is unlikely that this explains the ineffectiveness of _q-linked GPCRs in inhibiting Ca channels.

The structure of the 5 subunit is the most unusual of all of the  subunits, being only ~50% identical to 1-4, all of which are very similar to one another (Morris and Malbon, 1999). It has recently been shown that the 5 subunit can associate not only with  subunits but also with proteins of the RGS family that possess  subunit-like GGL domains (Hepler, 1999; Siderovski et al., 1999). The question arises of the biological significance of these 5/RGS heterodimers. One possibility is that they might support the same effector signaling events as 5/2 heterodimers. However, as we demonstrate here, this does not necessarily appear to be the case. Coexpression of 5 with RGS11 did not produce Ca channel inhibition. It has been shown biochemically that overexpression of 5 (but not 1-4) with GGL-containing RGS proteins does actually lead to the formation of tight complexes in the cytosol of cells (Snow et al., 1998, 1999; Posner et al., 1999; Liang et al., 2000). Thus, it is unlikely that the lack of effect of the RGS11 seen in our experiments is attributable to the lack of formation of heterodimers. Recently, Posner et al. (1999) and Snow et al. (1998) demonstrated that although heterodimers formed between RGS6, 7, or 11 and 5 possessed appreciable GAP activity, they were ineffective in activating or inhibiting adenylate cyclases I and II and were also unable to antagonize the ability of 12 to activate cyclase. In addition, neither 5/RGS complex was able to activate PLC-2, although high concentrations of the heterodimer had a small inhibitory effect on the enzyme activated by 12 (Posner et al., 1999). Thus, the lack of effect of 5/RGS11 complexes on Ca channels mirrors other data indicating that these complexes are generally inactive in traditional assays of /-mediated signal transduction.

On the other hand, it is also possible that GGL-containing RGS proteins might compete with 2 for 5 subunits and therefore antagonize the effects of the 52 heterodimer. Indeed, it has been proposed that GGL-containing RGS proteins have a higher affinity for G5 than G2 does, because conversion from phenylalanine (Phe-61) within G2 to tryptophan (Trp-274) at the analogous position found within GGL domains of RGS proteins increases G5/2 binding under low-detergent conditions (Snow et al., 1999). We have now obtained evidence for this competing interaction, although the relative affinities of the binding partners cannot be accurately assessed from our experiments. Thus, coexpression of both RGS6 and RGS11 blocked the inhibitory effects of 52 on Ca channels, although they were unable to block the effects of 22. The role of the GGL domains in these effects is clear from the fact that mutations that prevent binding of the GGL domain to 5 also prevented the effect of RGS6 and 11. Furthermore, when we cut the RGS11 proteins into two sections, the portion containing the GGL and DEP domains inhibited the effect of 52, whereas the portion containing the RGS domain did not. The function of the DEP domain is unclear. It has been suggested that DEP domains may play a role in membrane targeting of proteins (Axelrod et al., 1998). However, in the present case, deletion of the DEP domains from RGS6 or 11 did not abolish their effects on 52. Thus, our data are consistent with the possibility that GGL-containing RGS proteins may regulate 52-dependent inhibition of Ca channels through interaction of their GGL domains with 5. In support of this possibility, 5/RGS6 and 5/RGS7 complexes have been isolated from the brain (Liang et al. 2000, Zhang and Simonds, 2000). It is also possible that the decreased effectiveness observed by Garcia et al. (1998) and Ruiz-Velasco and Ikeda (2000) when 5 was expressed in SCG neurons reflects the expression of GGL-containing RGS proteins in these neurons.

In summary, our results indicate that all of the known G-protein  subunits are capable of producing rapid, voltage-dependent inhibition of Ca channels, although this ability may depend on the type of  -subunit found in the heterodimer. Because all of the  subunits are highly expressed in the nervous system (Betty et al., 1998), it is likely that they may all participate in the receptor-mediated regulation of Ca channels. Thus, the reasons why activation of some GPCRs does not produce strong Ca channel inhibition may not simply depend on the selectivity of / heterodimers for Ca channel inhibition (Garcia et al., 1998). Our data also suggest that GGL-containing RGS proteins may act as antagonists of heterotrimeric G proteins in two ways. First, they can act as GAP proteins for G-protein  subunits, and second, as we show here, they may act as antagonists of 52 heterodimers through their interactions with 5 subunits.

	FOOTNOTES

Received June 1, 2000; revised July 10, 2000; accepted July 12, 2000.

This study was supported by US Public Health Service Grants DA-02121, DA-13141, DA-44840, MH-40165, NS-33826, and NS-21442. We thank Dr. C. Lee for helpful suggestions and comments throughout the project and D. Ren for excellent technical assistance. We are grateful to Drs. A. Gilman and A. Krumins for kindly providing cDNA for RGS proteins, to Dr. Katz for G subunit cDNA, and to SIBIA Neuroscience for cell lines expressing 1B Ca channels.

Correspondence should be addressed to Dr. Richard J. Miller, Department of Neurobiology, Pharmacology, and Physiology, University of Chicago, 947 East 58th Street (MC 0926), Chicago, IL 60637. E-mail: rjmx{at}midway.uchicago.edu.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

• Axelrod JD, Miller JR, Shulman JM, Moon RT, Perrimon N (1998) Differential recruitment of Dishevelled provides signaling specificity in the planar cell polarity and Wingless signaling pathways. Genes Dev 12:2610-2622[Abstract/Free Full Text].
• Bernheim L, Beech DJ, Hille B (1991) A diffusible second messenger mediates one of the pathways coupling receptors to calcium channels in rat sympathetic neurons. Neuron 6:859-867[ISI][Medline].
• Betty M, Harnish SW, Rhodes KJ, Cockett MI (1998) Distribution of heterotrimeric G-protein  and  subunits in the rat brain. Neurosci 85:475-486[ISI][Medline].
• Boussif O, Lezoualch F, Zania MA, Mergny MD, Scherman D, Demeneix B, Behr JP (1995) A versatile vector for gene and oligonucleotide transfer into cells in culture and in vivo: polyethylenimine. Proc Natl Acad Sci USA 92:7297-7301[Abstract/Free Full Text].
• Canti C, Page KM, Stephens GJ, Dolphin AC (1999) Identification of residues in the N terminus of 1B critical for inhibition of the voltage-dependent calcium channel by G. J Neurosci 19:6855-6864[Abstract/Free Full Text].
• Fletcher JE, Lindorfer MA, De Filippo JM, Yasuda H, Guilmard M, Garrison JC (1998) The G-protein 5 subunit interacts selectively with the Gq  subunit. J Biol Chem 273:636-644[Abstract/Free Full Text].
• Garcia DE, Li B, Garcia-Ferreiro RE, Hernandez-Ochoa EO, Yan K, Gautam N, Catterall WA, Mackie K, Hille B (1998) G-protein -subunit specificity in the fast membrane delimited inhibition of Ca channels. J Neurosci 18:9163-9170[Abstract/Free Full Text].
• Hepler JR (1999) Emerging roles for RGS proteins in cell signaling. Trends Pharmacol Sci 20:376-382[Medline].
• Herlitze S, Garcia DE, Mackie K, Hille B, Scheuer T, Catterall WA (1996) Modulation of Ca channels by G-protein / subunits. Nature 380:258-262[Medline].
• Hille B (1994) Modulation of ion channel function by G-protein coupled receptors. Trends Neurosci 17:531-536[ISI][Medline].
• Ikeda SR (1996) Voltage dependent modulation of N-type calcium channels by G-protein / subunits. Nature 380:255-258[Medline].
• Liang JJ, Chen HH, Jones PG, Khawaja XZ (2000) RGS7 complex formation and colocalization with the G5 subunit in the adult rat brain and influence on G52-mediated PLC signaling. J Neurosci Res 60:58-64[Medline].
• Lindorfer MA, Myung CS, Savino Y, Yasuda H, Khazan R, Garrison JC (1998) Differential activity of the G-protein 52 subunit at receptors and effectors. J Biol Chem 273:34429-34436[Abstract/Free Full Text].
• Liu NJ, Xu T, Xu C, Li CQ, Yu YX, Kang HG, Han JS (1995) Cholecystokinin octapeptide reverses µ-opioid receptor mediated inhibition of calcium current in rat dorsal root ganglion neurons. J Pharmacol Exp Ther 275:1293-1299[Abstract/Free Full Text].
• Margeta-Mitrovic M, Grigg JJ, Koyano K, Nakajima Y, Nakajima S (1997) Neurotensin and substance P inhibit low and high voltage activated Ca channels in cultured newborn rat nucleus basalis neurons. J Neurophysiol 78:1341-1352[Abstract/Free Full Text].
• Miller RJ (1998) Presynaptic receptors. Annu Rev Pharmacol Toxicol 38:201-227[ISI][Medline].
• Morris AJ, Malbon CC (1999) Physiological regulation of G-protein linked signalling. Physiol Rev 79:1373-1430[Abstract/Free Full Text].
• Posner BA, Gilman AG, Harris BA (1999) Regulators of G-protein signalling 6 and 7. J Biol Chem 274:31087-31093[Abstract/Free Full Text].
• Qin N, Platano D, Olcese R, Stefani E, Birnbaumer L (1997) Direct interaction of G with a C-terminal G-binding domain of the Ca²⁺ channel 1 subunit is responsible for channel inhibition by G protein-coupled receptors. Proc Natl Acad Sci USA 4:8866-8871.
• Ruiz-Velasco V, Ikeda SR (2000) Multiple G-protein combinations produce voltage-dependent inhibition of N-type calcium channels in rat superior cervical ganglion neurons. J Neurosci 20:2183-2191[Abstract/Free Full Text].
• Shapiro MS, Hille B (1993) Substance P and somatostatin inhibit calcium channels in rat sympathetic neurons via different G-protein pathways. Neuron 10:11-20[ISI][Medline].
• Shapiro MS, Wollmuth LP, Hille B (1994) Angiotensin 11 inhibits calcium and M current channels in rat sympathetic neurons via G-proteins. Neuron 12:1319-1329[ISI][Medline].
• Siderovski DP, Strockbine B, Behe CI (1999) Whither goest the RGS proteins? Crit Rev Biochem Mol Biol 34:215-251[ISI][Medline].
• Simen AA, Miller RJ (1998) Structural features determining differential receptor regulation of neuronal Ca channels. J Neurosci 18:3689-3698[Abstract/Free Full Text].
• Simen AA, Miller RJ (2000) Involvement of regions in domain I in the opioid receptor sensitivity of alpha1B Ca(2+) Channels. Mol Pharmacol 57:1064-1074[Abstract/Free Full Text].
• Snow BE, Krumins AM, Brothers GM, Lee S, Wall MA, Chung S, Mangion J, Arya S, Gilman AG, Siderovske DP (1998) A G protein  subunit-like domain shared between RGS11 and other RGS proteins specifies binding to G5 subunits. Proc Natl Acad Sci USA 95:13307-13312[Abstract/Free Full Text].
• Snow BE, Betts L, Mangion J, Sondek J, Siderovski DP (1999) Fidelity of G protein -subunit association by the G protein -subunit-like domains of RGS6, RGS7, and RGS11. Proc Natl Acad Sci USA 96:6489-6494[Abstract/Free Full Text].
• Taussig R, Sanchez R, Rifo M, Gilman AG, Belardetti F (1992) Inhibition of the -conotoxin sensitive calcium current by distinct G-proteins. Neuron 8:799-809[ISI][Medline].
• Watson AJ, Katz A, Simon MI (1994) A fifth member of the mammalian G-protein -subunit family. J Biol Chem 269:22150-28160[Abstract/Free Full Text].
• Watson AJ, Aragay AM, Slepak VZ, Simon MI (1996) A novel form of the G-protein  subunit G5 is specifically expressed in the vertebrate retina J. Biol Chem 271:28154-28160[Abstract/Free Full Text].
• Zhang JF, Ellinor PT, Aldrich RW, Tsien RW (1996) Multiple structural elements in voltage-dependent Ca2+ channels support their inhibition by G proteins. Neuron 17:991-1003[ISI][Medline].
• Zhang JH, Simonds WF (2000) Copurification of brain G-protein beta5 with RGS6 and RGS7. J Neurosci 20(RC59):1-5[Abstract/Free Full Text].
• Zhang S, Coso OA, Lee C, Gutkind JS, Simmonds WF (1996) Selective activation of effector pathways by brain specific Gprotein 5. J Biol Chem 271:33575-33579[Abstract/Free Full Text].

---

Copyright © 2000 Society for Neuroscience  0270-6474/00/20197143-06$05.00/0

This article has been cited by other articles:

				E. A. Yost, S. M. Mervine, J. L. Sabo, T. R. Hynes, and C. H. Berlot Live Cell Analysis of G Protein beta5 Complex Formation, Function, and Targeting Mol. Pharmacol., October 1, 2007; 72(4): 812 - 825. [Abstract] [Full Text] [PDF]

				H. W. Tedford and G. W. Zamponi Direct G Protein Modulation of Cav2 Calcium Channels Pharmacol. Rev., December 1, 2006; 58(4): 837 - 862. [Abstract] [Full Text] [PDF]

				H. W. Tedford, A. E. Kisilevsky, J. B. Peloquin, and G. W. Zamponi Scanning Mutagenesis Reveals a Role for Serine 189 of the Heterotrimeric G-Protein Beta 1 Subunit in the Inhibition of N-Type Calcium Channels J Neurophysiol, July 1, 2006; 96(1): 465 - 470. [Abstract] [Full Text] [PDF]

				P. Koulen, J. Liu, E. Nixon, and C. Madry Interaction between mGluR8 and Calcium Channels in Photoreceptors Is Sensitive to Pertussis Toxin and Occurs Via G Protein {beta}{gamma} Subunit Signaling Invest. Ophthalmol. Vis. Sci., January 1, 2005; 46(1): 287 - 291. [Abstract] [Full Text] [PDF]