 |
Previous Article | Next Article 
The Journal of Neuroscience, October 1, 2000, 20(19):7377-7383
Enhanced Proliferation, Survival, and Dopaminergic
Differentiation of CNS Precursors in Lowered Oxygen
Lorenz
Studer1, 3,
Marie
Csete2, 4,
Sang-Hun
Lee1, 5,
Nadine
Kabbani1,
Jean
Walikonis2,
Barbara
Wold2, and
Ron
McKay1
1 Laboratory of Molecular Biology, National Institute
of Neurological Disorders and Stroke, National Institutes of Health,
Bethesda, Maryland 20892, 2 Biology Division, California
Institute of Technology, Pasadena, California 92215, 3 Laboratory of Stem Cell and Tumor Biology, Neurosurgery
and Cellular Biochemistry and Biophysics, Sloan Kettering, New York,
New York 10021, 4 Departments of Anesthesiology, and Cell
and Developmental Biology, University of Michigan, Ann Arbor, Michigan
48109-0615, and 5 College of Medicine, Hanyang University,
Seoul, 133-791, Korea
 |
ABSTRACT |
Standard cell culture systems impose environmental oxygen
(O2) levels of 20%, whereas actual tissue
O2 levels in both developing and adult brain are an order
of magnitude lower. To address whether proliferation and
differentiation of CNS precursors in vitro are influenced by the O2 environment, we analyzed embryonic day
12 rat mesencephalic precursor cells in traditional cultures
with 20% O2 and in lowered O2 (3 ± 2%).
Proliferation was promoted and apoptosis was reduced when cells were
grown in lowered O2, yielding greater numbers of
precursors. The differentiation of precursor cells into neurons with
specific neurotransmitter phenotypes was also significantly altered.
The percentage of neurons of dopaminergic phenotype increased to 56%
in lowered O2 compared with 18% in 20% O2.
Together, the increases in total cell number and percentage of
dopaminergic neurons resulted in a ninefold net increase in dopamine
neuron yield. Differential gene expression analysis revealed more
abundant messages for FGF8, engrailed-1, and erythropoietin in lowered
O2. Erythropoietin supplementation of 20% O2
cultures partially mimicked increased dopaminergic differentiation
characteristic of CNS precursors cultured in lowered O2.
These data demonstrate increased proliferation, reduced cell death, and
enhanced dopamine neuron generation in lowered O2,
making this method an important advance in the ex vivo
generation of specific neurons for brain repair.
Key words:
CNS precursors; CNS stem cells; dopaminergic neurons; erythropoietin; oxygen; Parkinson's disease
 |
INTRODUCTION |
Cultured CNS stem cells have proved
useful in defining the pathways that lead to generation of neurons and
glia (McKay, 1997 ). These cells self-renew, and after mitogen
withdrawal, differentiate into neurons, astrocytes and oligodendrocytes
in predictable proportions (Johe et al., 1996 ; McKay, 1997 ). Single
extrinsic factors can shift the fate of CNS stem cells toward specific
cell lineages (Johe et al., 1996 ; Panchision et al., 1998 ). The
potential therapeutic application of CNS stem cells in common
degenerative and ischemic diseases has become a major focus of
research. The generation of dopaminergic neurons from CNS precursors is
of special interest given the promising results of fetal cell
transplantation in patients with Parkinson's disease (Olanow et al.,
1996 ; Piccini at al., 1999; Freeman et al., 2000 ).
In clinical settings, gases are appreciated as primary variables in
organ survival, with O2 as the critical gas
parameter. However, traditional CNS stem cell culture (as well as
virtually all other ex vivo cell culture) is performed in
nonphysiologically high O2. Standard tissue
culture incubator conditions are 5% CO2 and 95%
air, which exposes cells to a 20% O2
environment. In mammalian brain, interstitial tissue
O2 levels range from ~1 to 5% (Table 1). We tested the effects of culturing
CNS progenitor cells in physiological "lowered" (3 ± 2%)
O2, comparing the cultures with those grown in
the usual 20% O2. Our results indicate that
oxygen lowered to more physiological levels alters cultured CNS
progenitors in important ways; lowered O2
culturing provides marked trophic and proliferative effects on CNS
precursors and significantly changes developmental kinetics and outcome
compared with traditional culture conditions. Initial investigation of
the molecular basis for these effects reveals selective changes in
expression of a subset of functionally interesting genes whose products
can partially recapitulate some of the effects of lowered
O2 culturing. The shift in precursor-derived
neuronal subtype differentiation in lowered O2
cultures suggests a powerful method for large-scale production of
specific neurons for brain repair.
 |
MATERIALS AND METHODS |
Animals were housed and treated following National Institutes of
Health guidelines. Cells dissected from rat embryonic day 12 (E12)
mesencephalon were mechanically dissociated, plated on plastic 24-well
plates (Costar, Cambridge, MA) on 12 mm glass coverslips
(Carolina Biological Supply Company, Burlington, NC) precoated with
polyornithine-fibronectin, and grown in defined medium with basic
fibroblast growth factor (bFGF) (Johe et al., 1996 ; Studer et
al., 1998 ). After precursor expansion in the presence of bFGF for 4-6
d, bFGF was withdrawn from the medium to promote differentiation.
Clonal assays were performed in plastic 48-well plates (Costar). In
some studies, recombinant human Epo, recombinant human vascular
endothelial growth factor 165 (VEGF165), or
recombinant mouse FGF8b, or their neutralizing antibodies (all
from R & D Systems, Minneapolis, MN) were added to cultures at the
following concentrations: 0.5 U/ml Epo, 10 µg/ml Epo neutralizing
antibody, 250 ng/ml FGF8, 5 µg/ml FGF8b neutralizing antibody,
50 ng/ml VEGF, and 0.5 µg/ml VEGF neutralizing antibody. Dose
response for Epo was performed at 0.05, 0.5, 5, and 15 U/ml and at 10 and 100 µg/ml for anti-Epo. Results of all experiments were confirmed by at least two independent culture series.
Lowered O2 culture. Cultures were
placed in humidified portable isolation chambers (Billups-Rothenberg,
Del Mar, CA), flushed daily with a gas mixture of 1%
O2 plus 5% CO2 plus
94% N2. Precise O2 levels
in the chamber atmosphere depended on the length of flush (90 sec at 15 l/min achieved 6% O2, and 6 min of flush
achieved 1.5% O2), which was not standardized
until availability of an O2-sensitive electrode
system (OS2000; Animas Corp., Frazer, PA). Thus, "lowered
O2 " conditions represent a range of ambient
O2 of 3 ± 2%, which approximates normal
brain tissue levels (Table 1). The entire chamber was housed in an
incubator to maintain 37°C temperature. To minimize oxygen
fluctuations at the time of medium changes, media were pre-equilibrated
to lowered O2 conditions in separate chambers for
several hours (or at 20% O2) in the incubator.
Bromodeoxyuridine uptake and terminal deoxynucleotidyl
transferase-mediated biotinylated UTP nick end labeling
analysis. Bromodeoxyuridine (BrdU) (10 µM) was added to cultures for exactly 60 min,
just before fixation. Anti-BrdU staining (Amersham Pharmacia
Biotech, Arlington Heights, IL) and terminal deoxynucleotidyl
transferase-mediated biotinylated UTP nick end labeling (TUNEL)
reaction (Boehringer Mannheim, Mannheim, Germany) were performed
according to the protocol of the manufacturer. TUNEL-positive
(TUNEL+) cells were visualized by metal-enhanced DAB reaction
(Pierce, Rockford, IL) after peroxidase conversion of the FITC label.
Phase contrast was used for counting total number of nuclei in a field.
All counts were performed by observers blinded to experimental conditions.
Immunohistochemistry. Cells were fixed in 4%
paraformaldehyde plus 0.15% picric acid-PBS, and standard
immunohistochemical protocols followed. The following primary
antibodies were used: for stem cell-progenitor characterization,
nestin polyclonal #130 at 1:500 (Martha Marvin and Ron McKay,
National Institutes of Health Bethesda, MD), sialic acid-substituted
form of neuronal cell adhesion molecule (PSA-NCAM), engrailed-1
(En1), and FP4 (all monoclonal at 1:2; provided by Tom
Jessell, Developmental Studies Hybridoma Bank, Iowa City, IA); for stem
cell differentiation, -tubulin type III (Tuj1) monoclonal at 1:500
and polyclonal at 1:500 (both Babco, Richmond, CA), O4 monoclonal at
1:5 (Boehringer Mannheim), galactocerebroside monoclonal at 1:50
(Boehringer Mannheim), and glial fibrillary acidic protein (GFAP) at
1:100 (ICN Biochemicals, Costa Mesa, CA); for neuronal subtype
differentiation, tyrosine hydroxylase (TH) polyclonal at 1:200-1:500
(Pel-Freez Biologicals, Rogers, AR) or monoclonal at 1:2000 (Sigma, St.
Louis, MO), GABA polyclonal at 1:500 (Sigma), serotonin polyclonal at
1:2000 (Sigma), glutamate at 1:500 (Sigma), and dopamine
-hydroxy-lase at 1:100 (Protos Biotech Corp.). Appropriate
fluorescence-tagged (Jackson ImmunoResearch, West Grove, PA) or
biotinylated (Vector Laboratories, Burlingame, CA) secondary antibodies
were used for visualization.
Cell counts and statistical procedures. Uniform random
sampling procedures were used for cell counts and quantified using the
fractionator sampling technique (Gundersen et al., 1988 ). Data are expressed as mean ± SEM. Statistical comparisons were made by ANOVA with post hoc Dunnett's test when more than
two groups were involved. If data were not normally distributed, a nonparametric test (Mann-Whitney U test) was used to
compare lowered with 20% O2 results.
Reverse-phase HPLC determinations of dopamine content.
Culture supernatants of medium, HBSS, and HBSS plus 56 mM KCl (for evoked release) were stabilized with
orthophosphoric acid and metabisulfite and stored at 80°C until
analysis. Stabilization, aluminum adsorption, equipment, and elution of
dopamine have been described previously (Studer et al., 1996 , 1998 ).
Results were normalized against dopamine standards at varying flow
rates and sensitivities.
Western blots. Cell pellets were stored at 80°C. Pellet
was lysed in 20 mM HEPES, pH 7.6, 20% glycerol,
10 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, and
0.1% Triton X-100, with protease inhibitors (Complete; Boehringer
Mannheim), homogenized, and incubated on ice for 1 hr. After
centrifugation, supernatant protein concentration was assayed by BCA
(Pierce). For Western blots, the block was 5% milk in TBS-Tween
20, primary TH antibody (Pel-Freez Biologicals) was used at
1:500, and secondary was HRP-conjugated goat anti-rabbit (Pierce) at
1:5000. Signal was detected with SuperSignal (Pierce).
Reverse transcription-PCR. Cultures were washed once in PBS
before solubilization in Trizol (Life Technologies, Gaithersburg, MD)
and then stored at 80°C. RNA extraction was performed according to
the recommendations of the manufacturer (Life Technologies). Superscript kit (Life Technologies) was used for reverse transcription of 10 µg of RNA per condition. PCR conditions were optimized by varying MgCl2 concentration and cycle number to
determine linear amplification range. Amplification products were
identified by size and confirmed by DNA sequencing.
MgCl2 concentrations for TH, sonic hedgehog
(SHH), and FGFR3 reactions were 2 mM, and for all
others was 1.5 mM. Primer sequences, cycle
numbers, and annealing temperatures were as follows: GAPDH, [forward
(f)] CTCGTCTCATAGACAAGATGGTGAAG, [reverse (r)]
AGACTCCACGACATACTCAGCACC, 28 cycles, 59°C, 305 bp; von Hippel Lindau
(VHL), (f) CCTCTCAGGTCATCTTCTGCAACC, (r) AGGGATGGCACAAACAGTTCC, 35 cycles, 60°C, 208 bp; hypoxia inducible factor-1 (HIF1 ), (f)
GCAGCACGATCTCGGCGAAGCAAA, (r) GCACCATAACAAAGCCATCCAGGG, 30 cycles,
59°C, 235 bp; Epo, (f) CGCTCCCCCACGCCTCATTTG, (r)
AGCGGCTTGGGTGGCGTCTGGA, 30 cycles, 60°C, 385 bp; VEGF, (f)
GTGCACTGGACCCTGGCTTTACT, (r) CGCCTTGCAACGCGAGTCT-GTGTT, 30 cycles,
60°C, 474 bp (detects VEGF-1, VEGF-2, and VEGF-3); Nurr1, (f)
TGAAGAGAGCGGAGAAGGAGATC, (r) TCTGGA-GTTAAGAAATCGGAGCTG, 30 cycles, 55°C, 255 bp; TH (kindly provided by Vera Vikodem, National
Institute of Diabetes and Digestive and Kidney Diseases, Bethesda,
MD) 30 cycles, 56°C, 300 bp; Ptx3, (f) CGTGCGTGGTTGGTTCAAGAAC, (r) GCGGTGAGAATACAGGTTGTGAAG, 35 cycles, 60°C, 257 bp; SHH, (f) GGAAGATCACAAGAAACTCCGAAC, (r) GGATGCGAGCTTTGGATTCATAG, 30 cycles, 59°C, 354 bp; FGF8, (f) CATGTGAGGGACCAGAGCC, (r)
GTAGTTGTTCTCCAGCAGGATC, 35 cycles, 60°C, 312 bp; En1, (f)
TCAAGACTGACTACAGCAACCCC, (r) CTTTGTCCTGAACCGTGGTGGTAG, 30 cycles,
60°C, 381 bp; FGFR3, (f) ATCCTCGGGAGATGACGAAGAC, (r)
GGA-TGCTGCCAAACTTGTTCTC, 30 cycles, 55°C, 326 bp; glial-derived
neurotrophic factor, according to Moreau et al. (1998) ; and
BDNF, (f) GTGACAGTATTAGCGAGTGGG, (r) GGGTAGTTCGGCATTGC, 35 cycles,
56°C, 213 bp.
 |
RESULTS |
Lowered O2 augments precursor cell yield by affecting
cell proliferation and cell death and enhances clonal growth
In lowered O2, precursors from E12 rat
mesencephalon expanded in the presence of bFGF yielded an average
twofold to threefold more cells than 20% O2
cultures over a wide range of plating densities (Fig.
1A). To test whether
increased precursor yield in lowered O2 is
because of increased proliferation, reduced cell death, or both,
the cells were pulsed with BrdU at several time points during expansion
or differentiation. Increased BrdU labeling indices were found in
precursors grown in lowered O2 when compared with traditional cultures. The BrdU labeling index was increased in precursors both during expansion (in the presence of bFGF) and during
differentiation (after mitogen withdrawal) (Fig. 1B).
In addition to increased proliferation in lowered
O2 cultures and clones (Fig. 1C), CNS
precursors were also less likely to undergo apoptosis than those grown
in 20% O2. The number of TUNEL-positive cells
was reduced both during expansion and after bFGF withdrawal (Fig.
1D). To investigate O2 effects
at clonal densities, mesencephalic precursors were first expanded in 20 ng/ml bFGF for 6 d in 20% O2, passaged and
replated at a density of one to five cells per well, and then
maintained at either lowered or 20% O2. After
20 d, bFGF was withdrawn. The efficiency of clone formation was
three times higher in lowered O2, and the average
clone size increased from <50 cells in 20% O2
to 50-500 cells in lowered O2 (Fig.
1C). We conclude that both reduced apoptosis and increased
proliferation contribute to greater cell yield in lowered versus 20%
O2.

View larger version (45K):
[in this window]
[in a new window]
|
Figure 1.
Lowered O2 mediates
increased yield of CNS precursors. A, Precursor yield
across plating densities. CNS precursors derived from the ventral
mesencephalon were expanded with bFGF in lowered or 20%
O2, and total cell numbers were assessed after
5 d of proliferation, when >90% of cells are nestin+ precursors.
Significantly increased cell numbers were detected at all plating
densities in lowered O2 compared with 20% O2.
B, Precursor proliferation. CNS precursors were pulsed
with 10 µM BrdU for 60 min immediately before fixation
and then stained for BrdU uptake. More BrdU+ cells were seen in lowered
O2 cultures during both proliferation and differentiation.
Data are presented as mean ± SEM (n = 40).
Differences between lowered and 20% O2 were statistically
significant at all time points and for all parameters
(n = 8, p < 0.05), except
percentage of BrdU+ cells at day 4 of expansion (n = 8; p = 0.10). Scale bar, 20 µm.
C, Clonal growth. The yield of clones derived from
single precursors was threefold higher in lowered O2
compared with 20% O2 cultures (left). The
majority of clones derived from precursors in lowered O2
cultures contained 50-500 cells, whereas clone size in 20%
O2 cultures was generally 5-50 cells
(right). D, Cell death. Apoptosis was
assayed by TUNEL labeling of mesencephalic precursors cultured in
either lowered or 20% O2. Representative TUNEL stains
during expansion (2 and 6 d of culture) and differentiation
(4 d after bFGF withdrawal) are shown. Scale bar, 20 µm. A
significant decrease in the percentage of apoptotic cells in lowered
O2 compared with traditional cultures was detected
(n = 8; p < 0.05).
|
|
Cell lineage
We used a series of molecular markers together with morphological
assessment to characterize how lowered O2
culturing affects the choice of differentiation pathways and the
kinetics of differentiation. Immunoreactivity for the intermediate
filament nestin was used to discriminate CNS stem and progenitor cells
from more differentiated progeny (Lendahl et al., 1990 ). Six days after
bFGF withdrawal, the percentage of nestin-positive cells derived from
expanded precursors was grossly reduced in lowered
O2 compared with 20% O2
cultures, suggesting that differentiation might have been accelerated in lowered O2. Immunoreactivity to PSA-NCAM, a
marker expressed in committed neuronal progenitors (Mayer-Proschel et
al., 1997 ), was also reduced in differentiated lowered
O2 cultures. The idea of accelerated progression
to a more differentiated phenotype was further supported by the earlier
appearance of neuronal and glial markers in lowered
O2. The proportion of CNS lineages derived from
expanded precursors was determined by immunohistochemical analysis.
Neurons were identified by Tuj1, astrocytes were identified by GFAP,
and oligodendrocyte precursors were identified by O4 staining. Five
days after bFGF withdrawal, mesencephalic precursors yielded 73% Tuj1+
cells versus 63% in 20% O2 (n = 12, p = 0.06); no GFAP+ cells were detected in either
condition; 1% were O4+ versus 0% in 20% O2
(n = 12, p < 0.01). The remaining
cells were nestin+ or did not react with any of the markers tested.
Neuronal subtype differentiation
We next examined the effect of lowered O2 on
neuron subtype differentiation. Compared with traditional cultures,
differentiated mesencephalic precursors from lowered
O2 cultures displayed a striking increase in both
the absolute number and fraction of neurons expressing TH (Fig.
2A). In lowered
O2, large neuronal clusters were seen in which
virtually all neurons were TH+. On average, 56% of neurons (costained
with Tuj1) were TH+ versus 18% in 20% O2
cultures (n = 12, p < 0.001).
Increased TH immunoreactivity in lowered O2
cultures correlated with increased TH protein content in Western blots
(Fig. 2B). Dopamine production by these neurons was
confirmed by reverse-phase HPLC, which showed significantly increased
levels of dopamine in lowered versus 20% O2
cultures (Fig. 2C); conditioned medium (24 hr) showed a
fivefold increase in dopamine (n = 5, p < 0.01), and evoked release was threefold increased (n = 5, p < 0.05). These results demonstrate that lowered oxygen increases the yield of functional dopaminergic neurons.

View larger version (65K):
[in this window]
[in a new window]
|
Figure 2.
Lowered O2 culturing improves the
yield of functional precursor-derived dopaminergic neurons.
A, Precursors from E12 mesencephalon were expanded in
the presence of bFGF for 5 d, followed by 5 d of
differentiation, and then stained for the neuronal marker Tuj1 and for
TH. A large increase in both the total number and percentage of TH+
neurons was detected in lowered O2 compared with 20%
O2 cultures (p < 0.001). Scale
bar, 20 µm. B, Western blot analysis revealed
significantly more TH protein in samples from lowered (vs 20%)
O2 cultures. Each lane was loaded with 2.5 µg of total protein. C, Reverse-phase HPLC with
electrochemical detection was used to quantify dopamine levels in
conditioned medium (24 hr) and in buffer with 56 mM KCl
after 15 min (evoked release). Significantly more dopamine was detected
in cultures maintained in lowered O2 compared with those
grown in 20% O2 (p < 0.01 in
conditioned medium; p < 0.05 for evoked release).
Inset shows typical chromatogram for dopamine detection
in lowered and 20% O2 culture media.
|
|
Mesencephalic precursors give rise to neurons with several distinct
neurotransmitter phenotypes in addition to dopaminergic fate.
Interestingly, the percentage of serotonergic neurons was also
increased in lowered O2, 3.2 ± 1.2 versus
1.2 ± 0.3% in 20% O2 (n = 12, p < 0.05) (Fig.
3A). On the other hand, the
percentage of GABA+ and glutamate+ neurons was reduced in lowered
O2; only 6.6 ± 1.8% of neurons were GABA+
in lowered O2 versus 10.4 ± 1.5% in 20%
O2 (n = 12, p < 0.05), and 12.8 ± 3.8% of neurons were glutamate+ in lowered
O2 cultures versus 23.6 ± 4.0% in 20%
O2 (n = 12, p < 0.01). No double labeling of TH with dopamine -hydroxylase or TH
with GABA was detected (data not shown). These results indicate that TH
immunoreactivity reflected the generation of differentiated dopaminergic neurons but not noradrenergic or adrenergic fates, or the
transient developmental expression of TH reported in some GABAergic
neurons (Max et al., 1996 ).

View larger version (81K):
[in this window]
[in a new window]
|
Figure 3.
Neuronal subtype differentiation and
molecular characterization of mesencephalic precursors in lowered
versus 20% O2. A, Double immunocytochemical
labeling of neurons (Tuj1+, red) revealed that lowered
O2 culturing markedly increased the fractional yield of
dopaminergic and serotonergic neuronal subtypes but decreased the
fractional yield of GABA+ and glutamate+ neurons (all subtype labels,
green). The 20% O2 colony is an example of
high GABA expression under these conditions. TH and GABA were not
coexpressed as in some developing neurons in vivo. The
percentage of neurons expressing the midbrain transcription factor En1
was increased in lowered O2. Scale bars, 20 µm.
B, C, Semiquantitative PCR demonstrates
differential gene expression in CNS precursors cultured in lowered or
20% O2. B, Expression of genes involved in
the physiological response to changes in oxygen levels. The expression
of HIF1 , VHL, Epo, and VEGF was assessed after 2 or 6 d of
expansion and after 4 d of differentiation in lowered or 20%
O2. Data are normalized to GAPDH expression. A significant
increase in Epo expression was detected in lowered versus 20%
O2 mostly during differentiation, whereas VEGF was
upregulated during both expansion and differentiation. No
O2-dependent regulation of HIF1 or VHL messages was
observed. C, Candidate genes involved in midbrain
dopaminergic neuron development were also tested for
O2-dependent differential expression. Increased expression
of TH and Ptx3 during differentiation confirmed the larger number of
functional dopaminergic neurons in lowered O2 cultures
(compare with Fig. 2). Significant increases in expression
levels of FGF8 and En1 were also detected in lowered
O2.
|
|
We then examined the effect of lowered oxygen on dopaminergic
differentiation as a function of exposure timing, during proliferation versus differentiation. Mesencephalic precursors were expanded for
5 d in either lowered or 20% O2. These
cultures were then divided for differentiation in either lowered or
20% O2. Precursors expanded in lowered
O2 but differentiated in 20%
O2 resulted in 54 ± 7% of all the neurons
expressing TH, similar to those maintained in lowered
O2 throughout (58 ± 7%, n = 12, p = NS) but significantly higher than those
maintained throughout in 20% O2 (25 ± 5%,
n = 12, p < 0.01). Exposure to lowered
O2 confined to the differentiation phase did not
significantly increase the percentage of neurons expressing TH (32 ± 5%, n = 12, p = NS) compared with
cultures maintained in 20% O2 throughout. These
data suggest that important effects of lowered oxygen in promoting
dopaminergic differentiation and survival are initiated when the cells
are still functionally precursors.
Semiquantitative reverse transcription-PCR was used to assay cultures
at various time points for differential expression of genes regulated
by oxygen or involved in mediating oxygen responsiveness (Fig.
3B). In addition, we analyzed expression of candidate genes for dopaminergic neuron development (Fig. 3C). As expected,
erythropoietin and VEGF RNAs were upregulated in lowered versus 20%
O2 conditions, although with different kinetics
(Fig. 3A). Transcript levels for the tumor suppressor gene
VHL and the bHLH-PAS gene hypoxia inducible factor-1
(HIF1 ) (Maxwell et al., 1999 ) did not differ between
O2 conditions.
A small increase in TH message was detected from lowered
O2 cultures after differentiation compared with
20% O2. The Ptx3 homeobox gene, implicated in
dopamine neuron development (Smidt et al., 1997 ), was also expressed at
increased levels in lowered O2, confirming that
these conditions promoted the specific midbrain dopaminergic phenotype
and not just simply upregulated TH expression. Strong evidence links
sonic hedgehog (Echelard et al., 1993 ) and Nurr1 (Saucedo-Cardenas et
al., 1998 ) genes to the differentiation of midbrain dopaminergic
neurons, but no O2-dependent changes in their
expression were detected. However, engrailed-1 was upregulated in
lowered O2, a finding confirmed at the protein
level by immunohistochemistry (Fig. 3A). FGF8b message was
dramatically upregulated in lowered O2 by the end
of the expansion phase. Messages for other regulators of dopaminergic
differentiation or survival did not differ between O2 conditions.
Based on these results, precursor cells were exposed to recombinant
proteins and neutralizing antibodies for FGF8b, VEGF, or Epo in both
lowered or 20% O2 and in the presence of bFGF. VEGF or its neutralizing antibody did not affect the number of dopaminergic neurons generated in the two O2
conditions. FGF8b promoted proliferation in mesencephalic precursors;
cells maintained in 20% O2 increased by 7.5 ± 1.2-fold in 5 d compared with 5.1 ± 1.0-fold without
FGF8b (n = 6, p < 0.05). After bFGF
withdrawal, continuous FGF8 exposure prolonged precursor proliferation
in both O2 conditions and substantially delayed
neuronal differentiation, including the generation of TH+ cells.
Surprisingly, addition of recombinant human Epo led to a marked
dose-dependent increase in TH+ cells in 20% O2
cultures (Fig.
4A,C).
Furthermore, addition of Epo neutralizing antibody to both lowered and
20% O2 cultures dramatically reduced the yield
of dopaminergic neurons (Fig. 4B). These results
demonstrate that Epo added to 20% O2 cultures
partially mimics the effects of lowered O2 on
dopamine neuron yield. Furthermore, differential oxygen-dependent gene
expression patterns can be used to elucidate pathways important for
differentiation and survival of particular neuronal phenotypes.

View larger version (98K):
[in this window]
[in a new window]
|
Figure 4.
Epo mimics the lowered O2 effect on
dopaminergic differentiation. A, Representative images
of TH+ cells grown in the presence or absence of Epo and anti-Epo
antibody and in lowered or 20% O2 conditions. All reagents
were added to E12 mesencephalic precursor cultures throughout cell
expansion and differentiation (10 d total) in lowered or 20%
O2. Epo supplementation significantly increased TH+ cell
numbers in 20% O2 cultures (n = 6;
p < 0.05). Epo neutralizing antibody decreased TH+
cell numbers in both lowered O2 (n = 6;
p < 0.01) and 20% O2 cultures
(n = 6; p < 0.05). Scale bar,
20 µm. B, Effects of Epo and anti-Epo blocking
antibody on dopamine neuron yield. C, Epo positively
influences dopaminergic neuron yield in 20% O2 in a
dose-dependent manner.
|
|
 |
DISCUSSION |
Lowered oxygen cultures favor proliferation and survival of CNS
stem cells
Standard conditions for the culture of mammalian cells are 37°C
in a gas atmosphere of 5% CO2 and 95% air.
Thus, ambient temperature is adjusted to reflect core mammalian body
temperature and CO2 is adjusted to reflect
approximate venous concentrations, whereas in striking contrast,
O2 levels in culture are not adjusted to normal
physiological levels. At sea level, unhumidified room air contains 21%
O2, and a 95% air-5% CO2
mixture contains 20% O2. Alveolar air contains
14% O2, arterial O2
concentration is 12%, venous O2 levels are
5.3%, and mean tissue O2 concentration is 3%
(Guyton and Hall, 1996 ). In mammalian brain, interstitial tissue O2 levels range from ~1 to 5% (Goda et al.,
1997 ; Liu et al., 1997 ; Tammela et al., 1997 ). Data gathered from
extensive sampling suggest that mean brain O2
levels in adult rat and fetal sheep are 1.6% (Koos and Power, 1987 ;
Silver and Erecinska, 1988 ). Physiological tissue
O2 levels in some brain regions are even lower
(Table 1).
In this work, we analyze the impact of lowered, more
physiological O2 levels on CNS stem cell culture
and report four major effects: (1) increased proliferation of
progenitors; (2) reduced apoptosis; (3) accelerated progression to
differentiated states; and (4) elevated absolute number and proportion
of dopaminergic neurons.
Lowered O2 culturing consistently enhanced
proliferation of CNS precursors and stem cells. A twofold to fourfold
increase in cell number was observed during the proliferation phase
when most of the cells are nestin+ precursors. The increase in cell number was also maintained after mitogen withdrawal when proliferation overall was vastly reduced. The effects of lowered oxygen were not
limited to precursors derived from the ventral mesencephalon. CNS
precursors derived from the E14 lateral ganglionic eminences, the
anlage of the striatum, and from E14 cortex showed very similar results
to those reported here for mesencephalic precursor proliferation, cell
death, and clonal growth (data not shown). Although more cells were
present in differentiated cultures in lowered O2,
our data show that the proportions of neurons and glia were generally similar in the two culture conditions. In neural tissue, there is one
supporting, although specialized, precedent for mitogenic activity of
lowered O2 in neural crest-derived carotid body
chromaffin cells (Nurse and Vollmer, 1997 ). These dopaminergic glomus
cells are functionally specialized O2-sensitive
chemoreceptors and so would be expected to be specifically responsive
to changes in O2 levels in the carotid artery.
Our results show that lowered oxygen enhances the proliferation and
survival of CNS stem cells.
We identified two specific growth factors, FGF8 and Epo, as candidates
for significant roles in the lowered O2 responses
and showed that each can recapitulate part of the lowered
O2 phenotype at 20% O2. In
early midbrain development, FGF8 functions as a mitogen (Danelian and
McMahon, 1996 ), but significant mitogenic or trophic effects of FGF8 on
CNS stem cell cultures have not been reported. In our study, the
increased cell yield from mesencephalic precursors maintained in 20%
O2 and exposed to 250 ng/ml FGF8 partly
recapitulated the proliferation-trophic effects of lowered O2, with a 30% increase in total number compared
with a 200-400% increase in lowered O2.
Less apoptosis occurs in CNS stem cells cultured in lowered versus 20%
O2. Among the many possible mechanisms
contributing to reduced apoptotic death in lowered oxygen cultures,
erythropoietin may act as an anti-apoptotic agent (Quelle et al., 1998 )
or as an anti-oxidant (Bany-Mohammed et al., 1996 ). Oxidative activity was not directly measured in our cultures but may contribute to apoptosis in high-oxygen conditions (Zaman et al., 1999 ). In addition, oxidative stress and decreased ability to respond to oxidative stress
are thought to contribute to the pathophysiology of Parkinson's disease (Olanow and Tatton, 1999 ).
Dopaminergic commitment and differentiation
For several years, the midbrain has been studied as a model for
neuron subtype specification (Ericson et al., 1995 ; Hynes et al., 1995 ;
Wang et al., 1995 ; Ye et al., 1998 ) (for review, see Hynes and
Rosenthal, 1999 ). Under optimal conditions, mesencephalic precursors
have been reported to yield neurons in which 24% are dopaminergic, a
markedly improved yield historically (Studer et al., 1998 ). Lowered
oxygen here led not only to higher total cell numbers but also
increased the percentage of dopaminergic neurons to a remarkable 56%.
The percentage of serotonergic neurons, another ventral neuronal
phenotype (Yamada et al., 1991 ; Hynes et al., 1995 ; Ye et al., 1998 ),
was also increased in lowered oxygen. In contrast, the fractional
yields of GABAergic and glutamatergic neurons were reduced. The lowered
oxygen conditions were most effective in generating dopaminergic
neurons during the phase of precursor cell expansion. These results
suggest that lowered oxygen conditions enhance the production of
ventral fates by a mechanism that acts before neuronal differentiation.
Transcript levels of FGF8 and En1, known mediators of midbrain
dopaminergic neuron development (Simone et al., 1998 ; Ye et al., 1998 ;
Shamim et al., 1999 ), were upregulated in lowered versus 20%
O2 cultures. FGF8 has also been implicated in the
commitment of serotonergic neurons (Ye et al., 1998 ). These findings
are consistent with a role for FGF8 in the expansion of dopaminergic and serotonergic neuronal subtypes seen in lowered
O2 cultures. However, addition of FGF8 to 20%
O2 cultures or neutralization of FGF8 in lowered
O2 cultures did not reproduce the
O2-dependent neuronal subtype differentiation
patterns. The secreted morphogen SHH induces dopaminergic neuron
differentiation in explants of the early neural plate (Hynes et al.,
1995 ; Wang et al., 1995 ; Ye et al., 1998 ). Purified sonic hedgehog (10 ng/ml to 1 µg/ml) had no effect on expanded mesencephalic precursors
under both oxygen conditions (data not shown).
Engrailed-1 mRNA and protein levels were increased in lowered oxygen.
Engrailed-1 is thought to act in a pathway with pax2, wnt-1, and FGF8
to regulate the fate of midbrain neurons (Wurst et al., 1994 ; Danelian
and McMahon, 1996 ; Joyner, 1996 ; Simone et al., 1998 ). The FGF8 gene
contains a binding site for engrailed (Gemel et al., 1999 ). In
addition, we found that the FGF8 5'-UTR sequence (GenBank
accession number AF065607) contains a nine base sequence (CCTCCCTCA),
which may be involved in oxygen responsiveness in VEGF and Epo
regulatory elements (Scandurro and Beckman, 1998 ). We have not yet
determined whether En1 acts as a direct upstream regulator of FGF8 in
our lowered O2 cultures or whether they act independently. Nonetheless, the prominent expression of En1 in young
neurons (Fig. 3) suggests it may be a good candidate for regulating
neuronal subtype differentiation.
Epo levels are known to be regulated by oxygen in the erythropoietic
system. Epo and its receptor are expressed in brain from early
development through adulthood (Juul et al., 1999 ), but no specific role
for Epo in CNS development has been described. In the adult CNS,
however, Epo has received attention as a neuroprotective agent
(Sakanaka et al., 1998 ), and Epo treatment of PC12 cells has been
demonstrated to increase intracellular monoamine levels (Masuda et al.,
1993 ). Here we showed that, at 20% O2, Epo can mimic part of the lowered O2 effect of
dopaminergic differentiation and survival. Increases in yield of
dopaminergic neurons in 20% O2 cultures were
dose-dependent, but no additional increase in yield was mediated by Epo
in lowered oxygen, suggesting that the Epo levels in lowered
O2 were at maximal functional levels for this
response. Of note, the full effect of lowered O2
on dopaminergic yield could not be recapitulated by Epo, suggesting
that additional factors are involved in this
O2-mediated outcome. Nonetheless, the finding
that Epo alters the differentiation patterns of expanded CNS precursors
is novel and identifies Epo as a component of increased dopaminergic
neuron yield in lowered oxygen conditions.
A recent report demonstrated increased dopamine content after
differentiated dopaminergic mesencephalic neurons were exposed to
anoxic (O% O2) conditions (Gross et al., 1999 ).
Another study described a relative increase in TH-expressing neurons in
primary neuronal cultures from E14 rats after exposure to 5%
O2 (Colton et al., 1995 ). It is also known that
hypoxic conditions favor expression of the TH gene (Czyzyk-Krzeska et
al., 1994 ; Paulding and Czyzyk-Krzeska, 1999 ). However, to our
knowledge, this is the first report that lowered
O2 conditions support CNS stem cells during the
expansion phase and enhance the production of ventral neuronal subtypes.
Overall, our results suggest that O2 levels much
lower than those traditionally used in culture allow for improved
precursor cell proliferation and provide a powerful tool for the
generation of specific neuron types. In particular, lowered
O2 culturing has the practical effect of
contributing to more efficient production of dopaminergic neurons for
potential transplantation therapies. Furthermore, the effects of
lowered, more physiological O2 on cell cultures
are not limited to the CNS and extend to the peripheral nervous system
(Morrison et al., 2000 ) and to non-neuronal tissues (M. Csete
and B. Wold, unpublished observations).
 |
FOOTNOTES |
Received May 12, 2000; revised July 6, 2000; accepted July 19, 2000.
This work was supported in part by Defense Advanced Research Projects
Agency/Air Force Office of Scientific Research Grant F49620-98-1-0487 (M.C.) and National Institutes of Health Grants AR40780-8 and AR42671-05 (B.W.). We thank David Panchision for technical support and critical discussions.
L.S. and M.C. contributed equally to this work.
Correspondence should be addressed to Dr. Marie Csete, Anesthesiology
Research Laboratories, 1150 West Medical Center Drive, Medical Sciences
I, Room 7444, Ann Arbor, MI 48109-0615. E-mail: csete{at}umich.edu.
 |
REFERENCES |
-
Bany-Mohammed FM,
Slivka S,
Hallman M
(1996)
Recombinant human erythropoietin: possible role as an antioxidant in premature rabbits.
Pediatr Res
40:381-387[Web of Science][Medline].
-
Colton DA,
Pagan F,
Snell J,
Colton JS,
Cummins A,
Gilbert DL
(1995)
Protection from oxidation enhances the survival of cultured mesencephalic neurons.
Exp Neurol
132:54-61[Web of Science][Medline].
-
Czyzyk-Krzeska MF,
Furnari BA,
Lawson EE,
Millhorn DE
(1994)
Hypoxia increases rate of transcription and stability of tyrosine hydroxylase mRNA in pheochromocytoma (PC12) cells.
J Biol Chem
269:760-764[Abstract/Free Full Text].
-
Danelian PS,
McMahon AP
(1996)
Engrailed-1 as a target of the Wnt-1 signalling pathway in vertebrate midbrain development.
Nature
383:332-334[Medline].
-
Echelard Y,
Epstein DJ,
St-Jacques B,
Shen L,
Mahler J,
McMahon JA,
McMahon AP
(1993)
Sonic hedgehog, a member of a family of putative signaling molecules, is implicated in the regulation of CNS polarity.
Cell
75:1417-1430[Web of Science][Medline].
-
Ericson J,
Muhr J,
Placzek M,
Lints T,
Jessell TM,
Edlund T
(1995)
Sonic hedgehog induces the differentiation of ventral forebrain neurons: a common signal for ventral patterning within the neural tube.
Cell
81:747-756[Web of Science][Medline].
-
Freeman TB,
Vawter DE,
Leaverton PE,
Godbold JH,
Hauser RA,
Goetz CG,
Olanow CW
(2000)
Use of placebo surgery in controlled trials of a cellular-based therapy for Parkinson's disease.
N Engl J Med
341:988-992[Free Full Text].
-
Gemel J,
Jacobsen C,
MacArthur CA
(1999)
Fibroblast growth factor-8 expression is regulated by intronic engrailed and Pbx1-binding sites.
J Biol Chem
274:6020-6026[Abstract/Free Full Text].
-
Goda F,
O'Hara JA,
Liu KJ,
Rhodes ES,
Dunn JF,
Swartz HJ
(1997)
Comparisons of measurements of pO2 in tissue in vivo by EPR oximetry and microelectrodes.
Adv Exp Med Biol
411:543-549[Web of Science][Medline].
-
Gross J,
Ungethum U,
Andreeva N,
Heldt J,
Gao J,
Marschhausen G,
Altmann T,
Muller I,
Husemann B,
Andersson K
(1999)
Hypoxia during early developmental period induces long-term changes in the dopamine content and release in a mesencephalic cell culture.
Neuroscience
92:699-704[Web of Science][Medline].
-
Gundersen HJG,
Bendtsen TF,
Korbo L,
Marcussen N,
Moller A,
Nielsen K,
Nyengaard JR,
Pakkenberg B,
Soerensen FB,
Vesterby A,
West MJ
(1988)
Some new, simple and efficient stereological methods and their use in pathological research and diagnosis.
APMIS
96:379-394[Web of Science][Medline].
-
Guyton AC,
Hall JE
(1996)
In: Textbook of medical physiology. Philadelphia: Saunders.
-
Hynes M,
Rosenthal A
(1999)
Specification of dopaminergic and serotonergic neurons in the vertebrate CNS.
Curr Opin Neurobiol
9:26-36[Web of Science][Medline].
-
Hynes M,
Poulsen K,
Tessier-Lavigne M,
Rosenthal A
(1995)
Control of neuronal diversity by the floor plate: contact-mediated induction of midbrain dopaminergic neurons.
Cell
80:95-101[Web of Science][Medline].
-
Johe KK,
Hazel TG,
Muller T,
Dugich-Djordjevic MM,
McKay RD
(1996)
Single factors direct the differentiation of stem cells from the fetal and adult central nervous system.
Genes Dev
10:3129-3140[Abstract/Free Full Text].
-
Joyner AL
(1996)
Engrailed, Wnt, and Pax genes regulate midbrain-hindbrain development.
Trends Genet
12:15-20[Web of Science][Medline].
-
Juul SE,
Yachnis AT,
Rojiani AM,
Christensen RD
(1999)
Immunohistochemical localization of erythropoietin and its receptor in the developing human brain.
Pediatr Dev Pathol
2:148-158[Web of Science][Medline].
-
Koos BJ,
Power GG
(1987)
Predict fetal brain PO2 during hypoxaemia and anemia in sheep.
J Dev Physiol
9:517-526[Web of Science][Medline].
-
Lendahl U,
Zimmerman LB,
McKay RD
(1990)
CNS stem cells express a new class of intermediate filament protein.
Cell
60:585-595[Web of Science][Medline].
-
Liu KJ,
Hoopes PJ,
Rolett EL,
Beerle BJ,
Azzawi A,
Goda F,
Dunn JF,
Swartz HM
(1997)
Effect of anesthesia on cerebral tissue oxygen and cardiopulmonary parameters in rats.
Adv Exp Med Biol
411:33-39[Web of Science][Medline].
-
Masuda S,
Nagao M,
Takahata K,
Konishi Y,
Gallyas Jr F,
Tabira T,
Sasaki R
(1993)
Functional erythropoietin receptors of cells with neural characteristics: comparison with receptor properties of erythroid cells.
J Biol Chem
268:11208-11216[Abstract/Free Full Text].
-
Max SR,
Bossio A,
Iacovitti L
(1996)
Co-expression of tyrosine hydroxylase and glutamic acid decarboxylase in dopamine differentiation factor-treated striatal neurons in culture.
Dev Brain Res
91:140-142[Medline].
-
Maxwell PH,
Wiesener MS,
Chang GW,
Clifford CS,
Vaux EC,
Cockman ME,
Wykoff CC,
Pugh CW,
Maher ER,
Ratcliffe PJ
(1999)
The tumour suppressor protein VHL targets hypoxia-inducible factors for oxygen-dependent proteolysis.
Nature
399:271-275[Medline].
-
Mayer-Proschel M,
Kalyani AJ,
Mujtaba T,
Rao MS
(1997)
Isolation of lineage-restricted neuronal precursors from multipotent neuroepithelial stem cells.
Neuron
19:773-785[Web of Science][Medline].
-
McKay RD
(1997)
Stem cells in the central nervous system.
Science
276:66-71[Abstract/Free Full Text].
-
Moreau E,
Vilar J,
Lelievre-Pegorier M,
Merlet-Benichou C,
Gilbert T
(1998)
Regulation of c-ret expression by retinoic acid in rat metanephros: implication in nephron mass control.
Am J Physiol
44:F938-F945.
-
Morrison SJ,
Csete M,
Groves AK,
Melega W,
Wold B,
Anderson DJ
(2000)
Culture in reduced levels of oxygen promotes clonogenic sympathoadrenal differentiation by isolated neural crest stem cells.
J Neurosci
20:7370-7376[Abstract/Free Full Text].
-
Nurse CA,
Vollmer C
(1997)
Role of basic FGF and oxygen in control of proliferation, survival, and neuronal differentiation in carotid body chromaffin cells.
Dev Biol
184:197-206[Web of Science][Medline].
-
Olanow CW,
Tatton WG
(1999)
Etiology and pathogenesis of Parkinson's disease.
Annu Rev Neurosci
22:123-144[Web of Science][Medline].
-
Olanow CW,
Kordower JH,
Freeman TB
(1996)
Fetal nigral transplantation as a therapy for Parkinson's disease.
Trends Neurosci
19:102-109[Web of Science][Medline].
-
Panchision D,
Hazel T,
McKay R
(1998)
Plasticity and stem cells in the vertebrate nervous system.
Curr Opin Cell Biol
10:727-733[Web of Science][Medline].
-
Paulding WR,
Czyzyk-Krzeska MF
(1999)
Regulation of tyrosine hydroxylase mRNA stability by protein binding, pyrimidine-rich sequence in the 3' untranslated region.
J Biol Chem
274:2532-2538[Abstract/Free Full Text].
-
Quelle FW,
Wang J,
Feng J,
Wang D,
Cleveland JL,
Ihle JN,
Zambetti GP
(1998)
Cytokine rescue of p53-dependent apoptosis and cell cycle arrest is mediated by distinct Jak kinase signaling pathways.
Genes Dev
12:1099-1107[Abstract/Free Full Text].
-
Sakanaka M,
Wen TC,
Matsuda S,
Masuda S,
Morishita E,
Nagao M,
Sasaki R
(1998)
In vivo evidence that erythropoietin protects neurons from ischemic damage.
Proc Natl Acad Sci USA
95:4635-4640[Abstract/Free Full Text].
-
Saucedo-Cardenas O,
Quintana-Hau JD,
Le WD,
Smidt MP,
Cox JJ,
De Mayo F,
Burbach JP,
Conneely OM
(1998)
Nurr1 is essential for the induction of the dopaminergic phenotype and the survival of ventral mesencephalic late dopaminergic precursor neurons.
Proc Natl Acad Sci USA
95:4013-4018[Abstract/Free Full Text].
-
Scandurro AB,
Beckman BS
(1998)
Common proteins bind mRNAs encoding erythropoietin, tyrosine hydroxylase, and vascular endothelial growth factor.
Biochem Biophys Res Commun
246:436-440[Web of Science][Medline].
-
Shamim H,
Mahmood R,
Logan C,
Doherty P,
Lumsden A,
Mason I
(1999)
Sequential roles for Fgf4, En1 and Fgf8 in specification and regionalisation of the midbrain.
Development
126:945-959[Abstract].
-
Silver I,
Erecinska M
(1988)
Oxygen and ion concentrations in normoxic and hypoxic brain cells.
Adv Exp Med Biol
454:7-16.
-
Simone HH,
Saueressig H,
Wurst W,
Goulding MG,
O'Leary DD
(1998)
En-1 and En-2 control the fate of the dopaminergic neurons in the substantia nigra and ventral tegmentum.
Eur J Neurosci
10:389-399.
-
Smidt MP,
van Schaick HS,
Lanctot C,
Tremblay JJ,
Cox JJ,
van der Kleij AA,
Wolterink G,
Drouin J,
Burbach JP
(1997)
A homeodomain gene Ptx 3 has highly restricted brain expression in mesencephalic dopaminergic neurons.
Proc Natl Acad Sci USA
94:13305-13310[Abstract/Free Full Text].
-
Studer L,
Psylla M,
Buhler B,
Evtouchenko L,
Vouga CM,
Leenders KL,
Seiler RW,
Spenger C
(1996)
Non-invasive dopamine determination by reversed phase HPLC in the medium of free-floating roller tube cultures of rat fetal ventral mesencephalon. A tool to assess dopaminergic tissue prior to grafting.
Brain Res Bull
41:143-150[Web of Science][Medline].
-
Studer L,
Tabar V,
McKay R
(1998)
Transplantation of expanded mesencephalic precursors leads to recovery in parkinsonian rats.
Nat Neurosci
1:290-295[Web of Science][Medline].
-
Tammela O,
Song D,
Olano M,
Delivoria-Papadopoulos M,
Wilson DF,
Pastuszko A
(1997)
Response of cortical oxygen and striatal extracellular dopamine to metabolic acidosis in newborn piglets.
Adv Exp Med Biol
411:103-111[Web of Science][Medline].
-
Wang MA,
Jin P,
Bumcrot DA,
Marigo V,
McMahon AP,
Wang EA,
Woolf T,
Pang K
(1995)
Induction of dopaminergic neuron phenotype in the midbrain by Sonic hedgehog protein.
Nat Med
1:1184-1188[Web of Science][Medline].
-
Wurst W,
Auerbach AB,
Joyner AL
(1994)
Multiple developmental defects in Engrailed-1 mutant mice: an early mid-hindbrain deletion and patterning defects in forelimbs and sternum.
Development
120:2065-2075[Abstract].
-
Yamada T,
Placzek M,
Tanaka H,
Dodd J,
Jessell TM
(1991)
Control of cell pattern in the developing nervous system: polarizing activity of the floor plate and notochord.
Cell
64:635-647[Web of Science][Medline].
-
Ye W,
Shimamura K,
Rubenstein JL,
Hynes MA,
Rosenthal A
(1998)
FGF and Shh signals control dopaminergic and serotonergic cell fate in the anterior neural plate.
Cell
93:755-766[Web of Science][Medline].
-
Zaman K,
Ryu H,
Hall D,
O'Donovan K,
Lin KI,
Miller MP,
Marquis JC,
Baraban JM,
Semenza GL,
Ratan RR
(1999)
Protection from oxidative stress-induced apoptosis in cortical neuronal cultures by iron chelators is associated with enhanced DNA binding of hypoxia-inducible factor-1 and ATF-1/CREB and increased expression of glycolytic enzymes, p21 (waf1/cip1), and erythropoietin.
J Neurosci
19:9821-9830[Abstract/Free Full Text].
Copyright © 2000 Society for Neuroscience 0270-6474/00/20197377-07$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
A. M. McCord, M. Jamal, U. T. Shankavarum, F. F. Lang, K. Camphausen, and P. J. Tofilon
Physiologic Oxygen Concentration Enhances the Stem-Like Properties of CD133+ Human Glioblastoma Cells In vitro
Mol. Cancer Res.,
April 1, 2009;
7(4):
489 - 497.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Preynat-Seauve, D. M. Suter, D. Tirefort, L. Turchi, T. Virolle, H. Chneiweiss, M. Foti, J.-A. Lobrinus, L. Stoppini, A. Feki, et al.
Development of Human Nervous Tissue upon Differentiation of Embryonic Stem Cells in Three-Dimensional Culture
Stem Cells,
March 1, 2009;
27(3):
509 - 520.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Kawahara, T. Imai, H. Imataka, M. Tsujimoto, K. Matsumoto, and H. Okano
Neural RNA-binding protein Musashi1 inhibits translation initiation by competing with eIF4G for PABP
J. Cell Biol.,
October 17, 2008;
181(4):
639 - 653.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Schieke, M. Ma, L. Cao, J. P. McCoy Jr., C. Liu, N. F. Hensel, A. J. Barrett, M. Boehm, and T. Finkel
Mitochondrial Metabolism Modulates Differentiation and Teratoma Formation Capacity in Mouse Embryonic Stem Cells
J. Biol. Chem.,
October 17, 2008;
283(42):
28506 - 28512.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Rabie and H. H. Marti
Brain Protection by Erythropoietin: A Manifold Task
Physiology,
October 1, 2008;
23(5):
263 - 274.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. E. O'Keeffe, S. A. Scott, P. Tyers, G. W. O'Keeffe, J. W. Dalley, R. Zufferey, and M. A. Caldwell
Induction of A9 dopaminergic neurons from neural stem cells improves motor function in an animal model of Parkinson's disease
Brain,
March 1, 2008;
131(3):
630 - 641.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Zhou, J. Wang, M. A. Zapala, J. Xue, N. J. Schork, and G. G. Haddad
Gene expression in mouse brain following chronic hypoxia: role of sarcospan in glial cell death
Physiol Genomics,
February 19, 2008;
32(3):
370 - 379.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Amarilio, S. V. Viukov, A. Sharir, I. Eshkar-Oren, R. S. Johnson, and E. Zelzer
HIF1{alpha} regulation of Sox9 is necessary to maintain differentiation of hypoxic prechondrogenic cells during early skeletogenesis
Development,
November 1, 2007;
134(21):
3917 - 3928.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-L. Chen, F. Pistollato, D. J. Hoeppner, H.-T. Ni, R. D.G. McKay, and D. M. Panchision
Oxygen Tension Regulates Survival and Fate of Mouse Central Nervous System Precursors at Multiple Levels
Stem Cells,
September 1, 2007;
25(9):
2291 - 2301.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z.-Y. Chen, P. Asavaritikrai, J. T. Prchal, and C. T. Noguchi
Endogenous Erythropoietin Signaling Is Required for Normal Neural Progenitor Cell Proliferation
J. Biol. Chem.,
August 31, 2007;
282(35):
25875 - 25883.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Miyashita, K. Higa, N. Kato, T. Kawakita, S. Yoshida, K. Tsubota, and S. Shimmura
Hypoxia Enhances the Expansion of Human Limbal Epithelial Progenitor Cells In Vitro
Invest. Ophthalmol. Vis. Sci.,
August 1, 2007;
48(8):
3586 - 3593.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Lagares, H.-Y. Li, X.-F. Zhou, and C. Avendano
Primary Sensory Neuron Addition in the Adult Rat Trigeminal Ganglion: Evidence for Neural Crest Glio-Neuronal Precursor Maturation
J. Neurosci.,
July 25, 2007;
27(30):
7939 - 7953.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Milosevic, M. Maisel, F. Wegner, J. Leuchtenberger, R. H. Wenger, M. Gerlach, A. Storch, and J. Schwarz
Lack of Hypoxia-Inducible Factor-1{alpha} Impairs Midbrain Neural Precursor Cells Involving Vascular Endothelial Growth Factor Signaling
J. Neurosci.,
January 10, 2007;
27(2):
412 - 421.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. H. L. Teh, K. K. Y. Lam, C. C. Loh, J. M. Loo, T. Yan, and T. M. Lim
Neuronal PAS Domain Protein 1 Is a Transcriptional Repressor and Requires Arylhydrocarbon Nuclear Translocator for Its Nuclear Localization
J. Biol. Chem.,
November 10, 2006;
281(45):
34617 - 34629.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. A Goldman and M. S Windrem
Cell replacement therapy in neurological disease
Phil Trans R Soc B,
September 29, 2006;
361(1473):
1463 - 1475.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. C. Chavez, O. Baranova, J. Lin, and P. Pichiule
The Transcriptional Activator Hypoxia Inducible Factor 2 (HIF-2/EPAS-1) Regulates the Oxygen-Dependent Expression of Erythropoietin in Cortical Astrocytes
J. Neurosci.,
September 13, 2006;
26(37):
9471 - 9481.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. H. Haase
Hypoxia-inducible factors in the kidney
Am J Physiol Renal Physiol,
August 1, 2006;
291(2):
F271 - F281.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Pacary, H. Legros, S. Valable, P. Duchatelle, M. Lecocq, E. Petit, O. Nicole, and M. Bernaudin
Synergistic effects of CoCl2 and ROCK inhibition on mesenchymal stem cell differentiation into neuron-like cells
J. Cell Sci.,
July 1, 2006;
119(13):
2667 - 2678.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. E. Anderson
The satellite cell as a companion in skeletal muscle plasticity: currency, conveyance, clue, connector and colander
J. Exp. Biol.,
June 15, 2006;
209(12):
2276 - 2292.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Chung, B.-S. Shin, M. Hwang, T. Lardaro, U. J. Kang, O. Isacson, and K.-S. Kim
Neural Precursors Derived from Embryonic Stem Cells, but Not Those from Fetal Ventral Mesencephalon, Maintain the Potential to Differentiate into Dopaminergic Neurons After Expansion In Vitro
Stem Cells,
June 1, 2006;
24(6):
1583 - 1593.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Hermann, M. Maisel, F. Wegner, S. Liebau, D.-W. Kim, M. Gerlach, J. Schwarz, K.-S. Kim, and A. Storch
Multipotent Neural Stem Cells from the Adult Tegmentum with Dopaminergic Potential Develop Essential Properties of Functional Neurons
Stem Cells,
April 1, 2006;
24(4):
949 - 964.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. L. Covello, J. Kehler, H. Yu, J. D. Gordan, A. M. Arsham, C.-J. Hu, P. A. Labosky, M. C. Simon, and B. Keith
HIF-2{alpha} regulates Oct-4: effects of hypoxia on stem cell function, embryonic development, and tumor growth.
Genes & Dev.,
March 1, 2006;
20(5):
557 - 570.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. T. Tsai, J. J. Ohab, N. Kertesz, M. Groszer, C. Matter, J. Gao, X. Liu, H. Wu, and S. T. Carmichael
A Critical Role of Erythropoietin Receptor in Neurogenesis and Post-Stroke Recovery
J. Neurosci.,
January 25, 2006;
26(4):
1269 - 1274.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Shin, M. Mitalipova, S. Noggle, D. Tibbitts, A. Venable, R. Rao, and S. L. Stice
Long-Term Proliferation of Human Embryonic Stem Cell-Derived Neuroepithelial Cells Using Defined Adherent Culture Conditions
Stem Cells,
January 1, 2006;
24(1):
125 - 138.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Bosch, S. L. Pratt, and S. L. Stice
Isolation, Characterization, Gene Modification, and Nuclear Reprogramming of Porcine Mesenchymal Stem Cells
Biol Reprod,
January 1, 2006;
74(1):
46 - 57.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Yun, Q. Lin, and A. J. Giaccia
Adaptive Myogenesis under Hypoxia
Mol. Cell. Biol.,
April 15, 2005;
25(8):
3040 - 3055.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. West, W. D. Richardson, and M. Fruttiger
Stabilization of the retinal vascular network by reciprocal feedback between blood vessels and astrocytes
Development,
April 15, 2005;
132(8):
1855 - 1862.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-s. Mukouyama, H.-P. Gerber, N. Ferrara, C. Gu, and D. J. Anderson
Peripheral nerve-derived VEGF promotes arterial differentiation via neuropilin 1-mediated positive feedback
Development,
March 1, 2005;
132(5):
941 - 952.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Li, D. Johnson, M. Calkins, L. Wright, C. Svendsen, and J. Johnson
Stabilization of Nrf2 by tBHQ Confers Protection against Oxidative Stress-Induced Cell Death in Human Neural Stem Cells
Toxicol. Sci.,
February 1, 2005;
83(2):
313 - 328.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. G. Meyron-Holtz, M. C. Ghosh, and T. A. Rouault
Mammalian Tissue Oxygen Levels Modulate Iron-Regulatory Protein Activities in Vivo
Science,
December 17, 2004;
306(5704):
2087 - 2090.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Liste, E. Garcia-Garcia, and A. Martinez-Serrano
The Generation of Dopaminergic Neurons by Human Neural Stem Cells Is Enhanced by Bcl-XL, Both In Vitro and In Vivo
J. Neurosci.,
December 1, 2004;
24(48):
10786 - 10795.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. C. Schulz, S. A. Noggle, G. M. Palmarini, D. A. Weiler, I. G. Lyons, K. A. Pensa, A. C.B. Meedeniya, B. P. Davidson, N. A. Lambert, and B. G. Condie
Differentiation of Human Embryonic Stem Cells to Dopaminergic Neurons in Serum-Free Suspension Culture
Stem Cells,
December 1, 2004;
22(7):
1218 - 1238.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Acker and H. Acker
Cellular oxygen sensing need in CNS function: physiological and pathological implications
J. Exp. Biol.,
August 15, 2004;
207(18):
3171 - 3188.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. H. Marti
Erythropoietin and the hypoxic brain
J. Exp. Biol.,
August 15, 2004;
207(18):
3233 - 3242.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. F. Muschler, C. Nakamoto, and L. G. Griffith
Engineering Principles of Clinical Cell-Based Tissue Engineering
J. Bone Joint Surg. Am.,
July 1, 2004;
86(7):
1541 - 1558.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-C. Kuo, K.-Y. F. Pau, R. R. Yeoman, S. M. Mitalipov, H. Okano, and D. P. Wolf
Differentiation of Monkey Embryonic Stem Cells into Neural Lineages
Biol Reprod,
May 1, 2003;
68(5):
1727 - 1735.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Yu, J. J. Shacka, J. B. Eells, C. Suarez-Quian, R. M. Przygodzki, B. Beleslin-Cokic, C.-S. Lin, V. M. Nikodem, B. Hempstead, K. C. Flanders, et al.
Erythropoietin receptor signalling is required for normal brain development
Development,
March 3, 2003;
129(2):
505 - 516.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. J. Toledo-Aral, S. Mendez-Ferrer, R. Pardal, M. Echevarria, and J. Lopez-Barneo
Trophic Restoration of the Nigrostriatal Dopaminergic Pathway in Long-Term Carotid Body-Grafted Parkinsonian Rats
J. Neurosci.,
January 1, 2003;
23(1):
141 - 148.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Reecy, S. A. Miller, and M. Webster
Recent Advances That Impact Skeletal Muscle Growth and Development Research
J Anim Sci,
January 1, 2003;
81(13_suppl_1):
E1 - 8.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. C. Lie, G. Dziewczapolski, A. R. Willhoite, B. K. Kaspar, C. W. Shults, and F. H. Gage
The Adult Substantia Nigra Contains Progenitor Cells with Neurogenic Potential
J. Neurosci.,
August 1, 2002;
22(15):
6639 - 6649.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Bocker-Meffert, P. Rosenstiel, C. Rohl, N. Warneke, J. Held-Feindt, J. Sievers, and R. Lucius
Erythropoietin and VEGF Promote Neural Outgrowth from Retinal Explants in Postnatal Rats
Invest. Ophthalmol. Vis. Sci.,
June 1, 2002;
43(6):
2021 - 2026.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. J. Burton, A. L. Watson, J. Hempstock, J. N. Skepper, and E. Jauniaux
Uterine Glands Provide Histiotrophic Nutrition for the Human Fetus during the First Trimester of Pregnancy
J. Clin. Endocrinol. Metab.,
June 1, 2002;
87(6):
2954 - 2959.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Shingo, S. T. Sorokan, T. Shimazaki, and S. Weiss
Erythropoietin Regulates the In Vitro and In Vivo Production of Neuronal Progenitors by Mammalian Forebrain Neural Stem Cells
J. Neurosci.,
December 15, 2001;
21(24):
9733 - 9743.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Akerud, J. M. Canals, E. Y. Snyder, and E. Arenas
Neuroprotection through Delivery of Glial Cell Line-Derived Neurotrophic Factor by Neural Stem Cells in a Mouse Model of Parkinson's Disease
J. Neurosci.,
October 15, 2001;
21(20):
8108 - 8118.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Yu, C.-S. Lin, F. Costantini, and C. T. Noguchi
The human erythropoietin receptor gene rescues erythropoiesis and developmental defects in the erythropoietin receptor null mouse
Blood,
July 15, 2001;
98(2):
475 - 477.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Matsuura, D. C. Lie, M. Hoshimaru, M. Asahi, M. Hojo, R. Ishizaki, N. Hashimoto, S. Noji, H. Ohuchi, H. Yoshioka, et al.
Sonic Hedgehog Facilitates Dopamine Differentiation in the Presence of a Mesencephalic Glial Cell Line
J. Neurosci.,
June 15, 2001;
21(12):
4326 - 4335.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. J. Morrison, M. Csete, A. K. Groves, W. Melega, B. Wold, and D. J. Anderson
Culture in Reduced Levels of Oxygen Promotes Clonogenic Sympathoadrenal Differentiation by Isolated Neural Crest Stem Cells
J. Neurosci.,
October 1, 2000;
20(19):
7370 - 7376.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|