 |
Previous Article | Next Article 
The Journal of Neuroscience, January 15, 2000, 20(2):722-728
Insulin-Like Growth Factor-I Protects Axotomized Rat Retinal
Ganglion Cells from Secondary Death via PI3-K-Dependent Akt
Phosphorylation and Inhibition of Caspase-3 In Vivo
Pawel
Kermer,
Nikolaj
Klöcker,
Monika
Labes, and
Mathias
Bähr
Department of Neurology, Medical School, University of
Tübingen, 72076 Tübingen, Germany
 |
ABSTRACT |
Recently we have shown that the majority of retinal ganglion cells
(RGCs) dies via activation of caspase-3 after transection of the optic
nerve (ON) in the adult rat. In the present study we investigated
whether insulin-like growth factor-I (IGF-I), an important factor in
retinal development, prevents secondary death of RGCs after axotomy.
Moreover, we studied potential intracellular mechanisms of IGF-mediated
neuroprotection in more detail. Our results indicate that intraocular
application of IGF-I protects RGCs from death after ON transection in a
dose-dependent manner. We show reduced caspase-3 activity as one
possible neuroprotective mechanism of IGF-I treatment in
vivo. Caspase-3 mRNA expression remained unchanged. Because
caspase inhibition can be mediated by Akt in vitro, we
examined phosphorylation of Akt after axotomy and under IGF treatment.
Western blot analysis revealed decreased Akt phosphorylation after
axotomy without treatment and an increased phosphorylation of Akt under
treatment with IGF-I. This strong increase could be reduced by
simultaneous injection of wortmannin (WM), a potent inhibitor of
phosphatidylinositol 3-kinase (PI3-K). To prove the pathway
suggested by these experiments as relevant for the in
vivo situation, we assessed the number of RGCs 14 d after
ON transection under a combined treatment strategy of IGF-I and WM. As
expected, WM significantly reduced the neuroprotective effects of
IGF-I. In summary, we show for the first time in vivo that IGF is neuroprotective via PI3-K-dependent Akt phosphorylation and
by inhibition of caspase-3.
Key words:
insulin-like growth factor-I; retinal ganglion cells; neuroprotection; PKB/Akt; PI3-K; caspase-3; apoptosis
 |
INTRODUCTION |
Insulin-like growth factor-I (IGF-I)
was originally discovered as serum-derived "sulfation-factor
activity" (Salmon and Daughaday, 1957 ) and belongs to a group of
polypeptide hormones called somatomedins (Daughaday et al., 1972 ;
Daughaday and Rotwein, 1989 ). The biological actions of IGF-I
are mainly mediated by the IGF-I receptor, which contains a tyrosine
kinase domain responsible for the phosphorylation of intracellular
signal transduction proteins (Ullrich et al., 1986 ). Throughout the
last decade, a multitude of in vitro studies was performed
to investigate the trophic actions of IGF-I on various neuronal cell
types (for review, see Ishii, 1993 ; Lewis et al., 1993 ;
Lindsay, 1994 ; Doré et al., 1997 ). Knock-out experiments revealed IGF-I as an important factor in neurogenesis and
differentiation (for review, see Beck et al., 1995 ; Stewart and
Rotwein, 1996 ). Moreover, IGF-I has neuroprotective properties as it
reduces the programmed death of motoneurons during development, after
axotomy and spinal cord transection (Lewis et al., 1993 ; Neff et al., 1993 ; Li et al., 1994 ). Besides that, intraventricular application of
IGF-I attenuated neuronal cell loss after hypoxic-ischemic brain injury
in adult rats (Guan et al., 1993 ; Tagami et al., 1997a ,b ).
More recent in vitro studies started to examine the
mechanisms by which IGF-I exerts its antiapoptotic activity. Current
understanding of IGF-mediated neuroprotection implies the activation of
phosphatidylinositol 3-kinase (PI3-K), as demonstrated for cerebellar
granule cells and sensory dorsal root ganglion cells (Alessi et al.,
1996 ; Miller et al., 1997 ; Russell et al., 1998 ), which eventually
leads to activation of protein kinase B (PKB/Akt) by phosphorylation
(Franke et al., 1995 ; Alessi et al., 1997 ; Dudek et al., 1997 ; Nunez
and del Peso, 1998 ). Active PKB in turn can phosphorylate and thereby inactivate the initiator caspase-9 (Cardone et al., 1998 ) and the
proapoptotic protein Bad (Datta et al., 1997 ; del Peso et al., 1997 ).
Because caspase-9 is a major activator of the downstream effector
caspase-3 (Li et al., 1997 ), reduced activity of the latter might
account for the neuroprotection mediated by this pathway, which is in
line with studies demonstrating that IGF-I effectively blocked
caspase-3 activity in hippocampal neurons in vitro (Suzuki
et al., 1998 ; Tamatani et al., 1998 ).
Despite the fact that the IGF-I receptor is expressed in retinal
neurons (Waldbillig et al., 1988 ; Ocrant et al., 1989 ; Charkrabarti et
al., 1991 ; Burren et al., 1996 ) and IGF-I is known as a proliferation and differentiation factor for the neural retina (Frade et al., 1996 ),
nothing has been known so far about putative neuroprotective effects of
IGF-I on axotomized adult rat retinal ganglion cells (RGCs) that mainly
die by caspase-3-dependent apoptosis (Kermer et al., 1998 , 1999a ,b ). In
the present study, we injected IGF-I intraocularly after ON transection
and assessed RGC survival 14 d after the lesion. Moreover, we
investigated the signaling cascade by which IGF-I potentially mediates
its neuroprotective effects in vivo.
 |
MATERIALS AND METHODS |
Surgery and retrograde labeling. Transection of the
ON was performed as described previously (Kermer et al., 1998 ).
Briefly, adult female Sprague Dawley rats (200-250 gm; Charles River
Wiga, Sulzfeld, Germany) were anesthetized by intraperitoneal injection of chloral hydrate (0.42 gm/kg of body weight). After skin incision close to the superior orbital rim, the orbita was opened taking care to
leave the supraorbital vein intact. After subtotal resection of the
lacrimal gland, the superior extraocular muscles were spread by means
of a small retractor. The ON was exposed by longitudinal incision of
the eye retractor muscle and the perineurium. Transection was performed
~2 mm from the posterior eye pole without damaging retinal blood
supply. Animals with persistent retinal ischemia verified
fundoscopically were excluded. In a subset of animals assigned for the
neuroprotection study, RGCs were retrogradely labeled by the
fluorescent tracer fast blue (FB; Dr. Illing Chemie, Gross-Umstadt,
Germany). Accurate and reproducible labeling was achieved by placing a
small piece of gel foam soaked in 2% aqueous FB at the ocular stump of
the axotomized ON.
Drug administration and tissue processing. IGF-I (Sigma,
Deisenhofen, Germany) was dissolved in 0.1 mM acetic acid
according to the manufacturer's instructions. Wortmannin (WM;
Sigma) was dissolved in 100% dimethylsulfoxide (DMSO; Sigma).
Both solutions were further diluted in PBS. For intraocular drug
injection, animals were anesthetized by diethylether. By means of a
glass microelectrode with a tip diameter of 30 µm, 2 µl of IGF
and/or WM was injected into the vitreous space puncturing the
eye at the cornea-sclera junction.
For the examination of neuroprotective effects, two different doses of
IGF-I [2 µg (n = 6) or 5 µg (n = 4) per injection] were applied. Animals received either three
intraocular injections of IGF-I on days 4, 7, and 10 after axotomy or
an additional injection on day 0 immediately after surgery
(n = 5). For combined IGF and WM treatment
(n = 4), IGF injection (5 µg) was followed by 2 µl of 0.1 mM WM. Injection of vehicle (PBS;
n = 4) or 0.1 mM WM alone (n = 3) served as control. Fourteen days after ON
transection, animals received an overdose of chloral hydrate, and the
eyes were removed. The retinae were dissected, flat-mounted on
gelatin-coated glass slides, and fixed for 20 min in 4%
paraformaldehyde in PBS. RGCs were examined under the
fluorescence microscope (Axiovert 35; Zeiss) with a UV filter (365/420
nm) for FB fluorescence. The number of FB-positive RGCs was determined
according to a blind protocol published previously (Kermer et al.,
1998 ; Klöcker et al., 1998 ).
For caspase-3 activity assay and Western blot analysis, animals were
injected intraocularly on days 0 and 4 after the lesion. Animals
received an overdose of chloral hydrate, and the eyes including the
contralateral control eye were removed ~6 hr after the second caspase
inhibitor injection on day 4.
Reverse transcription-PCR for caspase-3. For reverse
transcription (RT)-PCR experiments, dissected retinae were immediately snap-frozen in liquid nitrogen. Total RNA was extracted using Trizol
reagent (Life Technologies) following the manufacturer's protocol.
RT-PCR was performed according to standard protocols. For cDNA
synthesis, 2.5 µg of total RNA was reversely transcribed with
Superscript II (Life Technologies) in a volume of 50 µl according to
the manufacturer's instructions. The reaction was primed using random
primers (300 ng). For subsequent PCR reaction, 100 ng of ethanol-precipitated cDNA was used as the template. The primer sequences and cycling conditions for semiquantitative PCR were the
following: 94°C for 3 min, annealing for 30 sec, and extension for 30 sec at 72°C; caspase-3 primers, TACCCTGAAATGGGCTTGTGT (forward) and
GTTAACACGAGTGAGGATGTG (reverse), annealing temperature of 50°C, 28 cycles; glyceraldehyde-3-phosphate dehydrogenase (G3PDH) primers, GTGATGCTGGTGCTGA (forward) and GCTAAGCAGTTGGTGG (reverse), annealing temperature of 50°C, 23 cycles; and actin primers,
CTACAATGAGCTGCGTGTGGC (forward) and CAGGTCCAGACGCAGGATGGC (reverse),
annealing temperature of 55°C, 30 cycles.
Caspase-3 activity assay. Retinae were homogenized and lysed
(150 mM NaCl, 50 mM Tris, pH 8.0, 2 mM EDTA, and 1% Triton, containing 0.1 mM PMSF
and 2 µg/ml pepstatin, leupeptin, and aprotinin) for 10 min at
37°C, and cell debris were pelleted at 13,000 × g
for 15 min. The protein concentration of the supernatant was determined using the BCA reagent (Pierce, Rockford, IL).The caspase-3 fluorogenic activity assay was performed with 30 µl of fresh protein
lysates [control (n = 13); axotomy day 4 (n = 6); and axotomy day 4 treated with 5 µg of IGF-I
on days 0 and 4 (n = 4)] that were incubated with 100 µM Ac-Asp-Glu-Val-Asp-AMC
[acetyl-Asp-Glu-Val-Asp-amino-4-methylcoumarin (Ac-DEVD-AMC);
Bachem], a fluorogenic substrate of caspase-3. Optical density (OD)
was determined every 15 min for 2 hr using 360 nm
excitation and 460 nm emission wavelengths (CytoFlour 2350); caspase-3 activity was calculated as the increase in OD per microgram of protein over time. Statistics were performed applying one-way ANOVA
followed by Duncan's test.
Western blot analysis. Tissue was processed as described
above except for lysation that was performed on ice for 20 min. After separation by reducing SDS-PAGE (Ausubel et al., 1987 ) of the lysates
(20 µg of protein per lane), proteins were transferred to a
polyvinylidene difluoride membrane and blocked with 5% skim milk in 0.1% Tween 20 in PBS (PBS-T). The membranes were incubated with the primary antibody against phospho-Akt (New England Biolabs GmbH, Schwalbach, Germany; 1:1000 in 1% skim milk in PBS-T). After washing in PBS-T, the membranes were incubated with HRP-conjugated secondary antibodies against rabbit IgG (Dianova, Hamburg, Germany; 1:2000 in PBS-T). Labeled proteins were detected using the ECL-plus reagent (Amersham, Arlington Heights, IL). All experiments for RT-PCR
and Western blotting were performed with at least four animals and
reproduced three times.
 |
RESULTS |
IGF-I is a survival factor for axotomized RGCs
in vivo
Within 14 d after ON transection, as determined by retrograde
FB labeling from the axon stump, no more than 339 with a SE of 43 RGCs
per mm2 were detectable (n = 6; Figs. 1,
2), which is ~17% of controls (Kermer
et al., 1998 ) (Fig. 2). To examine the potential neuroprotective effects of IGF-I on axotomized RGCs, we treated the animals
intraocularly with IGF-I on days 4, 7, and 10 after the lesion.
Compared with axotomy without therapy, IGF treatment significantly
improved RGC survival in a dose-dependent manner (Figs. 1, 2). Although 2 µg of IGF-I per injection promotes survival up to 463 ± 32 cells per mm2 14 d after the lesion
(n = 6), the RGC number could be significantly further
increased by 5 µg of IGF-I per injection (609 ± 25 per mm2; n = 4;
p < 0.05). Vehicle injection had no significant effect on RGC survival (379 ± 56 per mm2;
n = 4). An additional intraocular injection of IGF-I (5 µg per injection) on day 0 immediately after surgery resulted in an
even higher RGC survival 14 d after the lesion (661 ± 49 per
mm2; n = 5) but did not
reach statistical significance when compared with treatment on days 4, 7, and 10 after axotomy.

View larger version (67K):
[in this window]
[in a new window]
|
Figure 1.
Retrogradely labeled RGCs. a,
Axotomy without treatment. Note that only a few FB-labeled RGCs are
detectable, and these appear shrunken and hardly display any dendritic
processes. b, Axotomy intraocularly treated with 5 µg of IGF-I on days 0, 4, 7, and 10 after ON transection. RGC
survival is significantly increased with many regularly shaped somata
and dendrites. c, Combined treatment with 5 µg of
IGF-I and 0.1 mM WM on days 0, 4, 7, and 10 after ON
transection. Note that the neuroprotective effects of IGF-I are blocked
by WM. Scale bar, 100 µm.
|
|

View larger version (20K):
[in this window]
[in a new window]
|
Figure 2.
IGF-I is a survival factor for
axotomized RGCs. Data are given as the mean (± SEM) of retrogradely
labeled RGCs per millimeter squared (left
y-axis) or as the percentage of control retinae
(right y-axis) 14 d after ON
transection. Although vehicle treatment had no neuroprotective effects
when compared with axotomy without treatment, intraocular injection of
IGF-I on days 4, 7, and 10 after the lesion significantly increased the
number of surviving RGCs in a dose-dependent manner. An additional
injection on day 0 immediately after surgery further increased the
number of RGCs per millimeter squared without reaching significant
levels. axo, Axotomy without treatment;
vehicle, treatment with vehicle on days 0, 4, 7, and 10 after axotomy; IGF2, treatment with 2 µg of IGF-I on
days 4, 7, and 10 after axotomy; IGF5, treatment with 5 µg of IGF-I on days 4, 7, and 10 after axotomy;
IGF5d0, treatment with 5 µg of IGF-I on days
0, 4, 7, and 10 after axotomy. *, Statistically significant when
compared with axo (p < 0.05;
one-way ANOVA followed by Duncan's test); **, statistically
significant when compared with IGF2
(p < 0.05; one-way ANOVA followed by
Duncan's test).
|
|
IGF-I blocks retinal caspase-3 activity after ON transection
The activity of caspase-3 was measured in the retinal tissue of
controls and of animals with axotomy without therapy and under treatment with IGF-I on days 0 and 4 after ON transection to elucidate whether the neuroprotective effects of IGF-I rely on the inhibition of
a downstream executioner of neuronal death in vivo. Because caspase-3 gets activated until day 4 after the lesion (Kermer et al.,
1999b ), we performed activity assays on postlesional day 4 ~6 hr
after the second IGF injection. As indicated in Figure 3, cleavage of the caspase-3-specific
fluorogenic substrate Ac-DEVD-AMC in axotomized retinae was
significantly increased by 43% (p < 0.05) when compared with controls. Intraocular injection of
IGF-I on days 0 and 4 after axotomy blocked this increased activity down to control levels, suggesting that inhibition of caspase-3 is
one possible mechanism by which IGF-I exerts its
neuroprotective action in vivo. Figure 3 includes data
of animals treated with the specific and irreversible inhibitor of
caspase-3-like caspases benzyloxycarbonyl (z)-DEVD-chloromethylketone
(cmk) that inhibited caspase-3 activity more effectively (Kermer et
al., 1998 , 1999b ).

View larger version (12K):
[in this window]
[in a new window]
|
Figure 3.
Caspase-3 activity after axotomy and under IGF
treatment. Data are given as the mean OD units (± SEM) per minute and
microgram of protein as a measurement of Ac-DEVD-AMC cleavage by active
caspase-3. Compared with that of control retinae, the activity of
caspase-3 on day 4 after ON transection (axo) is
significantly increased. Intraocular injection of 5 µg of IGF-I on
days 0 and 4 after the lesion (IGF) results in a
strong reduction of caspase-3 activity down to control levels.
Treatment with z-DEVD-cmk (DEVD), a potent inhibitor of
caspase-3-like proteases, inhibited caspase-3 activity more
effectively, reflecting a higher neuroprotective activity (Kermer et
al., 1998 ). *, Statistically significant when compared with control
(p < 0.05).
|
|
IGF-I does not induce changes in caspase-3 mRNA expression
To study changes of caspase-3 mRNA expression under treatment with
IGF-I, we used total retinal tissue for RT-PCR from postlesional day 4 treated with 5 µg of IGF-I on days 0 and 4 after ON transection. In
agreement with our results comparing caspase-3 mRNA expression in
axotomized but otherwise untreated retinae with corresponding contralateral controls at various time points after lesion (Kermer et
al., 1999b ), we were not able to detect any significant change in
caspase-3 mRNA expression (Fig. 4).
Densitometric analysis comparing caspase-3 mRNA expression with the
expression of G3PDH and actin as housekeeping genes did not reveal any
significant differences. Mean normalized values for caspase-3 versus
actin (± SD) of the four IGF-treated animals and contralateral
controls shown in Figure 4 were 4.353 ± 0.56 for IGF-I-treated
and 4.295 ± 0.32 for contralateral control retinae.

View larger version (29K):
[in this window]
[in a new window]
|
Figure 4.
Caspase-3 mRNA under treatment with IGF-I. Retinal
caspase-3 mRNA expression on day 4 after axotomy treated with 5 µg of
IGF-I on postlesional days 0 and 4 (IGF) compared
with that of control retinae (C). In none of the
investigated animals were significant changes in caspase-3 mRNA levels
detectable. The corresponding expression of G3PDH and actin mRNA as
housekeeping genes is shown below.
|
|
IGF-I induces Akt phosphorylation
A potential pathway by which IGF-I exerts its neuroprotective
effects was further examined by investigating the phosphorylation of
PKB/Akt (Dudek et al., 1997 ). From in vitro studies it is
known that caspase-9 cleaves caspase-3 in its active fragments (Li et al., 1997 ). Phospho-Akt, representing the active form of PKB (for review, see Coffer et al., 1998 ), is able to phosphorylate and thereby
inactivate Bad and caspase-9 (Datta et al., 1997 ; del Peso et al.,
1997 ; Cardone et al., 1998 ), which in turn might finally prevent the
cleavage and activation of caspase-3.
Western blot analysis of phospho-Akt was performed on day 4 after the
lesion in retinal tissue of controls, axotomized retinae without
treatment, and axotomized retinae treated with 5 µg of IGF-I on days
0 and 4 after ON transection. As indicated in Figure 5a and revealed by
densitometric analysis of four paired samples in each experimental
group (given in parentheses as the mean ± SD), axotomy
without treatment resulted in a decreased Akt phosphorylation (41.05 ± 9.41) when compared with the corresponding contralateral control (91.29 ± 4.48). To conclude that this observation is not caused by decreased levels of the unphosphorylated, inactive Akt protein, we performed Western blots of murine Akt revealing no significant changes in Akt levels after axotomy (data not shown). In
contrast, IGF-I treatment on days 0 and 4 after axotomy led to an
increased phosphorylation of Akt in the lesioned eye (106.04 ± 22.28) when compared with the contralateral control (43.73 ± 2.68; Fig. 5b), whereas vehicle injection did not mimic this
effect (data not shown).

View larger version (38K):
[in this window]
[in a new window]
|
Figure 5.
Western blot analysis of phospho-Akt.
a-d, Each panel shows axotomized
and/or contralateral control retinae of two independent animals
in the various experimental groups. a, Axotomy without
treatment on day 4 after the lesion (A) compared
with the corresponding contralateral control retina
(C). Note the strong decrease of phospho-Akt
after axotomy. b, Axotomy treated with 5 µg of IGF-I
(A; IGF below) on postlesional days 0 and
4 compared with the corresponding contralateral control retina
(C). Note the massive increase of phospho-Akt in
axotomized retinae under IGF treatment. c, Control
retina treated with 0.1 mM WM (C;
WM below) on postlesional days 0 and 4 compared with the
corresponding contralateral control (C). Note the
decrease of phospho-Akt in the control under treatment with WM.
d, Axotomy treated with 5 µg of IGF-I and 0.1 mM WM (A; IGF/WM below) on
postlesional days 0 and 4 compared with the corresponding contralateral
control (C). Note the inhibition of Akt
phosphorylation down to control levels.
|
|
Akt gets phosphorylated in a PI3-K-dependent manner
As is the case with other tyrosine kinase growth factor receptors,
binding of IGF-I to the IGF-I receptor activates PI3-K in
vitro (Miller et al., 1997 ; Russell et al., 1998 ). Moreover, Akt
is established as a downstream effector of PI3-K (Franke et al., 1997 ;
Coffer et al., 1998 ). Whether the PI3-K/Akt antiapoptotic-signaling pathway in vitro (Kennedy et al., 1997 ) reflects the
in vivo situation was not known yet. WM, a naturally
occurring inhibitor of PI3-K, is known to abolish Akt phosphorylation
and neuroprotective effects in vitro (Alessi et al., 1996 ;
Franke et al., 1997 ; Miller et al., 1997 ; Nunez and del Peso, 1998 ;
Russell et al., 1998 ). Consequently, we examined whether injection of
WM alone and in combination with IGF-I inhibits the induction of Akt
phosphorylation. Figure 5, c and d, illustrates
our observations. Intraocular injection of various doses of WM in
untreated control eyes effectively decreased Akt phosphorylation
(34.57 ± 3.38 vs 112.83 ± 7.01; Fig. 5c). For
the combination study with 5 µg of IGF-I we chose a WM concentration of 0.1 mM. As shown in Figure 5d, an
additional injection of 2 µl of 0.1 mM WM on
days 0 and 4 after the lesion immediately after application of IGF-I
resulted in a clear decrease of Akt phosphorylation down to control
levels (82.79 ± 6.28 vs 93.97 ± 14.56) when compared with
IGF-I treatment alone (Fig. 5b). Thus, treatment with IGF-I seems to activate the PI3-K/Akt-signaling pathway in
vivo.
Wortmannin blocks neuroprotective effects of IGF-I
The results demonstrated above clearly indicate that IGF-I induces
the phosphorylation of Akt in a PI3-K-dependent manner. However,
whether these results are of significance for the neuroprotective action of IGF-I in vivo was still speculative, because such
changes could occur as epiphenomena. To prove significance of the
suggested pathway in our model, we assessed RGC survival under a
combined treatment of IGF-I and WM (n = 4). As
indicated in Figures 1 and 6, an
additional intraocular injection of 0.1 mM WM
significantly reduced the neuroprotective effects of IGF-I on RGCs
14 d after ON transection (449 ± 43 vs 661 ± 49 RGCs
per mm2). Treatment with 0.1 mM WM alone (n = 3), however, did
not alter the number of RGCs after axotomy (353 ± 80 RGCs per
mm2). In reference to our blotting
experiments (Fig. 5), these data suggest the IGF-I-induced,
PI3-K-dependent Akt phosphorylation as one important pathway by which
IGF-I exerts its survival effects on axotomized RGCs in
vivo.

View larger version (18K):
[in this window]
[in a new window]
|
Figure 6.
Wortmannin blocks neuroprotective effects of
IGF-I. Data are given as the mean (± SEM) of retrogradely labeled RGCs
per millimeter squared (left y-axis) or
as the percentage of control (right
y-axis) 14 d after ON transection. Although
intraocular injection of 0.1 mM wortmannin on days 0, 4, 7, and 10 after axotomy (WM0.1) did not alter the number of
surviving RGCs when compared with axotomy without treatment
(axo), treatment with 5 µg of IGF-I on days 0, 4, 7, and 10 after ON transection (IGF5d0) resulted in an
significantly increased survival rate of RGCs (compare Fig. 1). These
neuroprotective effects were significantly reduced by an additional
injection of 0.1 mM WM directly after each IGF treatment
(IGF5d0 WM0.1). *, Statistically significant when
compared with IGF5d0 (p < 0.05; one-way ANOVA followed by Duncan's test).
|
|
 |
DISCUSSION |
In this study, we present IGF-I as a trophic factor, which
prevents secondary RGC death after axotomy. For the first time we give
evidence that the neuroprotective action of IGF-I in vivo is
most likely mediated by the antiapoptotic PI3-K/Akt pathway (Alessi et
al., 1997 ; Franke et al., 1997 ; Coffer et al., 1998 ; Nunez and del
Peso, 1998 ) and inhibition of caspase-3 activity.
Because of good surgical accessibility, the retinotectal projection in
the rat serves as a convenient in vivo model to study degenerative and regenerative processes in the mammalian CNS
(Villegas-Perez et al., 1988 ; Mey and Thanos, 1993 ; Bähr and
Bonhoeffer, 1994 ; Berkelaar et al., 1994 ; Bähr and Wizenmann,
1996 ; Clarke et al., 1998 ; DiPolo et al., 1998 ; Chaudhary et
al., 1999 ). The RGC population can easily be identified with similar
labeling efficacy by retrograde tracing with fluorescent dyes either
from the optic nerve stump or from both superior colliculi, which have
been stereotactically injected in an additional intervention before ON
transection (Bähr et al., 1992 ; Eschweiler and Bähr, 1993 ;
Kermer et al., 1998 ; Klöcker et al., 1998 ). Axotomy of all RGCs
by ON transection results in the delayed death of ~80-90% of RGCs
within 14 d (Eschweiler and Bähr, 1993 ; Mansour-Robaey et
al., 1994 ; Cui and Harvey, 1995 ). Experimental evidence indicates that
this secondary death can primarily be ascribed to apoptosis
(Garcia-Valenzuela et al., 1994 ; Rabacchi et al., 1994 ; Isenmann et
al., 1997 ). Caspase-3, as a downstream effector of apoptosis, is
activated selectively in axotomized RGCs and has been identified as an
important mediator of secondary RGC death after axotomy (Kermer et al.,
1998 , 1999a ,b ). In addition to the very effective inhibition of
caspase-3 applying specific inhibitors, various potential
neuroprotective agents, such as brain-derived neurotrophic factor
(BDNF), neurotrophin-4, and glial cell line-derived neurotrophic
factor, have been shown previously to prevent secondary neuronal
loss in our experimental paradigm (Mey and Thanos, 1993 ; Mansour-Robaey
et al., 1994 ; Klöcker et al., 1997 , 1998 ). In agreement with
results obtained under therapy with BDNF (Klöcker et al., 1998 )
the rescue effects of IGF-I reported in the present study were
dose-dependent. In a first set of experiments we intraocularly injected
2 µg of IGF-I on days 4, 7, and 10 after the lesion with significant
neuroprotective effects. Applying a 2.5-fold higher concentration of
IGF-I further increased the number of surviving RGCs significantly.
However, as shown for BDNF (Mansour-Robaey et al., 1994 ), an early
onset of treatment with an intraocular injection of IGF-I on day 0 immediately after ON transection had no additional effect on RGC
survival 14 d after the lesion. At least for BDNF, this
observation could be explained by an increased endogenous BDNF
expression in the retina after lesion (Gao et al., 1997 ). That this
increased expression holds true for IGF-I as well seems reasonable but
needs further investigation.
The hypothesis that IGF-I might exert its neuroprotective effects via
the inhibition of caspase activity was based on the observation that a
combined treatment strategy of a neurotrophic factor with the
irreversible inhibitor of caspase-3-like proteases z-DEVD-cmk revealed
no increased survival of axotomized RGCs compared with single-drug
therapy (Klöcker et al., 1999 ). Consequently, we measured the
activity of caspase-3 by studying the cleavage of the fluorogenic
substrate Ac-DEVD-AMC (Kermer et al., 1999b ) under treatment with
IGF-I. As shown by in vitro studies of other investigators
(Suzuki et al., 1998 ; Tamatani et al., 1998 ), we were able to
demonstrate an increased activation of caspase-3 on day 4 after lesion
in vivo that could be effectively inhibited by treatment
with IGF-I. In agreement with the lower neuroprotective effects of
IGF-I, reduction of caspase-3 activity was not as effective as that
observed under z-DEVD-cmk treatment (Fig. 3; Kermer et al., 1998 ,
1999b ). Postlesional day 4 was chosen for these experiments because we
had shown previously that a significant increase in caspase-3 activity
after ON transection first occurs on day 4 (Kermer et al., 1999b ). To
test whether IGF-I might induce the inhibition of caspase-3 activity by
decreasing the expression of caspase-3 mRNA, we additionally performed
RT-PCR for caspase-3 on day 4 after ON transection. In agreement with
results comparing control retinae with untreated retinae after axotomy
by RT-PCR and in situ hybridization (Chaudhary et al., 1999 ;
Kermer et al., 1999b ), we were not able to detect significant changes
in caspase-3 mRNA expression when comparing axotomized retinae under
IGF-I treatment on day 4 after the lesion with the corresponding
contralateral control retinae. Because we failed to detect a
significant regulation, we hypothesized that IGF-I treatment decreases
caspase-3 activity on the translational or post-translational level.
However, it should be noted that the lack of mRNA regulation in our
lesion paradigm could also be explained by the fact that the RGC
population represents only ~0.57% of the entire retinal tissue
(Simon and Thanos, 1998 ). Thus, modest changes in caspase-3 mRNA
expression in single cells might escape detection by RT-PCR of total
retinal tissue.
Because caspase-3 activity in our model is regulated on the
translational or post-translational level, it seemed reasonable to
expect a signaling pathway by which binding of IGF-I to its receptor
finally inhibits caspase-3 activity (Kulik et al., 1997 ). Recently, it
was shown that phosphorylation of unprocessed or active caspase-9 by
active PKB/Akt results in an inactivation of this zymogen (Cardone et
al., 1998 ). Because caspase-3 represents a major downstream substrate
of caspase-9 (Li et al., 1997 ), the inactivation of caspase-9 might
lead to decreased activation of caspase-3. Whereas the activation and
inhibition of caspase-9 as a potential link between neuroprotective
pathways and downstream caspase-3 activity in our lesion model are
under current investigation, we here examined the phosphorylation of
PKB/Akt as a part of the antiapoptotic PI3-K/Akt pathway (Franke et
al., 1995 , 1997 ; Alessi et al., 1996 ; Kennedy et al., 1997 ; Shimoke et
al., 1998 ) after ON transection in more detail. By Western blot
analysis using an antibody against active phospho-Akt, we first
compared axotomy without treatment with contralateral controls.
Interestingly, we observed a decreased phosphorylation of Akt in
axotomized retinae. In contrast, IGF-I treatment resulted in a massive
induction of phospho-Akt in lesioned retinal tissue. To date, the
explanation of decreased phospho-Akt levels in axotomized retinae
remains speculative. We could exclude decreased levels of the murine
Akt protein after axotomy as a trivial explanation for this
observation. Because several neurotrophic factors are able to
phosphorylate Akt (Coffer et al., 1998 ), the interrupted retrograde
transport of neurotrophic factors from the superior colliculus, the
target of the retinotectal projection, might serve as another
explanation. However, the neurotrophic hypothesis (Barde, 1989 ) seems
unlikely to be the only possible explanation because, as stated above, at least BDNF is upregulated in RGCs after ON transection (Gao et al.,
1997 ). On the other hand, sustained or elevated intracellular calcium
levels, for example, influence the activity of PI3-K (Scharenberg and
Kinet, 1998 ), which might be the regulatory element resulting in
decreased levels of phospho-Akt after axotomy (Franke et al., 1997 ;
Nunez and del Peso, 1998 ). Nevertheless, decreased intracellular levels
of phospho-Akt may result in increased levels of active Bad or
caspase-9 and subsequently increased activity of caspase-3, whereas
increased phospho-Akt levels under treatment with IGF-I are accompanied
by a reduced activity of caspase-3 and a reduced RGC death. Making the
scenario more complex, it should be noted that there are several
processes under physiological conditions in which a role for Akt has
been implicated, including intermediary metabolism and protein
synthesis (for review, see Coffer et al., 1998 ). Because the
axotomy-induced signal causing secondary RGC death is not yet known,
more detailed studies are necessary dealing with the intracellular
processes after lesion.
To complete the investigation of the PI3-K/Akt pathway in our model, we
demonstrated that the phosphorylation of Akt depends on the activation
of PI3-K. Several in vitro studies suggested that treatment
with the PI3-K inhibitor wortmannin abolished the neuroprotective
effects of IGF-I (Alessi et al., 1996 ; Dudek et al., 1997 ; Miller et
al., 1997 ; Russell et al., 1998 ). Additional intraocular injection of
WM in IGF-treated retinae on days 0 and 4 after the lesion reduced Akt
phosphorylation to control levels. These data suggest that after
binding of IGF-I to its tyrosine kinase domain-containing receptor
molecule, downstream events including the phosphorylation of Akt are
controlled by PI3-K (Franke et al., 1997 ; Scharenberg and Kinet, 1998 ).
We are aware that we provide only indirect evidence of this
antiapoptotic pathway being selectively activated in axotomized RGCs.
However, taking into account that caspase-3 is activated selectively in
RGCs after ON transection (Kermer et al., 1999b ) and that this is the
only cell type affected by the lesion directly, it seems reasonable to
assume that IGF-induced Akt phosphorylation occurs in RGCs. Nevertheless, to prove this pathway as a predominant mechanism of
IGF-I-induced neuroprotection in our in vivo model, we
finally assessed the number of RGCs 14 d after axotomy under a
combined treatment strategy of IGF-I and WM. As hypothesized, the
positive effects of IGF-I on the survival of axotomized RGCs in
vivo could be significantly blocked by inhibition of PI3-K.
Taken together, the results discussed above show for the first time
that IGF-I is a survival factor for axotomized RGCs in vivo.
Moreover, this is the first study that demonstrates that the
PI3-K-dependent Akt phosphorylation and reduced caspase-3 activity are
important in vivo mechanisms by which IGF-I mediates its
neuroprotective action. Future studies are necessary to examine the
possible role of caspase-9 and the proapoptotic protein Bad as a
connection between the antiapoptotic PI3-K/Akt pathway and downstream
caspase-3 activity in this model.
 |
FOOTNOTES |
Received June 29, 1999; revised Oct. 15, 1999; accepted Oct. 22, 1999.
This work was supported by the Bundesministerium für Bildung und
Forschung and Sonderforschungsbercich 430. M.B. was supported by the
Herrmann-and-Lilly-Schilling Foundation. We thank S. Thomsen for
technical assistance and R. Ankerhold for critical discussion on this manuscript.
Correspondence should be addressed to Dr. Pawel Kermer, The Burnham
Institute, Program on Cell Death and Apoptosis Research, 10901 North
Torrey Pines Road, La Jolla, CA 92037. E-mail:
pkermer{at}burnham-inst.org.
 |
REFERENCES |
-
Alessi DR,
Andjelkovic M,
Caudwell B,
Cron P,
Morrice N,
Cohen P,
Hemmings BA
(1996)
Mechanism of activation of protein kinase B by insulin and IGF-1.
EMBO J
15:6541-6551[Web of Science][Medline].
-
Alessi DR,
James SR,
Downes CP,
Holmes AB,
Gaffney PR,
Reese CB,
Cohen P
(1997)
Characterization of a 3-phosphoinositide-dependent protein kinase which phosphorylates and activates protein kinase Balpha.
Curr Biol
7:261-269[Web of Science][Medline].
-
Ausubel FM,
Brent R,
Klingston RE,
Moore DD,
Seidman JG,
Smith JA,
Struhl K
(1987)
In: Current protocols in molecular biology. New York: Wiley.
-
Bähr M,
Bonhoeffer F
(1994)
Perspectives on axonal regeneration in the mammalian CNS.
Trends Neurosci
17:473-479[Web of Science][Medline].
-
Bähr M,
Wizenmann A
(1996)
Retinal ganglion cell axons recognize specific guidance cues present in the deafferented adult rat superior colliculus.
J Neurosci
16:5106-5116[Abstract/Free Full Text].
-
Bähr M,
Eschweiler GW,
Wolburg H
(1992)
Precrushed sciatic nerve grafts enhance the survival and axonal regrowth of retinal ganglion cells in adult rats.
Exp Neurol
166:13-22.
-
Barde YA
(1989)
Trophic factors and neuronal survival.
Neuron
2:1525-1534[Web of Science][Medline].
-
Beck KD,
Powell Braxton L,
Widmer HR,
Valverde J,
Hefti F
(1995)
Igf1 gene disruption results in reduced brain size, CNS hypomyelination, and loss of hippocampal granule and striatal parvalbumin-containing neurons.
Neuron
14:717-730[Web of Science][Medline].
-
Berkelaar M,
Clarke DB,
Wang YC,
Bray GM,
Aguayo AJ
(1994)
Axotomy results in delayed death and apoptosis of retinal ganglion cells in adult rats.
J Neurosci
14:4368-4374[Abstract].
-
Burren CP,
Berka JL,
Edmondson SR,
Werher GA,
Batch JA
(1996)
Localization of mRNAs for insulin-like growth factor-I (IGF-I), IGF-I receptor, and IGF binding proteins in rat eye.
Invest Ophthalmol Vis Sci
37:1459-1468[Abstract/Free Full Text].
-
Cardone MH,
Roy N,
Stennicke HR,
Salvesen GS,
Franke TF,
Stanbridge E,
Frisch S,
Reed JC
(1998)
Regulation of cell death protease caspase-9 by phosphorylation.
Science
282:1318-1321[Abstract/Free Full Text].
-
Charkrabarti S,
Ghahary A,
Murphy LJ,
Sima AA
(1991)
Insulin-like growth factor-I expression is not increased in the retina of diabetic BB/W-rats.
Diabetes Res Clin Pract
14:91-97[Web of Science][Medline].
-
Chaudhary P,
Ahmed F,
Ouebada P,
Sharma SC
(1999)
Caspase inhibitors block the retinal ganglion cell death following optic nerve transection.
Mol Brain Res
67:36-45[Medline].
-
Clarke DB,
Bray GM,
Aguayo AJ
(1998)
Prolonged administration of NT-4/5 fails to rescue most axotomized retinal ganglion cells in adult rats.
Vision Res
38:1517-1524[Web of Science][Medline].
-
Coffer PJ,
Jin J,
Woodgett JR
(1998)
Protein kinase B (c-Akt): a multifunctional mediator of phosphatidylinositol 3-kinase activation.
Biochem J
335:1-13.
-
Cui Q,
Harvey AR
(1995)
At least two mechanisms are involved in the death of retinal ganglion cells following target ablation in neonatal rats.
J Neurosci
15:8143-8155[Abstract].
-
Datta SR,
Dudek H,
Tao X,
Masters S,
Fu H,
Gotoh Y,
Greenberg ME
(1997)
Akt phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery.
Cell
91:231-241[Web of Science][Medline].
-
Daughaday WH,
Rotwein P
(1989)
Insulin-like growth factors I and II. Peptide, messenger ribonucleic acid and gene structure, serum and tissue concentrations.
Endocr Rev
10:68-91[Abstract/Free Full Text].
-
Daughaday WH,
Hall K,
Raben MS,
Salmon Jr WD,
Brande JL,
Wyk JJ
(1972)
Somatomedin: proposed designation for sulphation factor.
Nature
235:107[Medline].
-
del Peso L,
Gonzalez Garcia M,
Page C,
Herrera R,
Nunez G
(1997)
Interleukin-3-induced phosphorylation of BAD through the protein kinase Akt.
Science
278:687-689[Abstract/Free Full Text].
-
DiPolo A,
Aigner LJ,
Dunn RJ,
Bray GM,
Aguayo AJ
(1998)
Prolonged delivery of brain-derived neurotrophic factor by adenovirus-infected Mueller cells temporarily rescues injured retinal ganglion cells.
Proc Natl Acad Sci USA
95:3978-3983[Abstract/Free Full Text].
-
Doré S,
Kar S,
Quirion R
(1997)
Rediscovering an old friend, IGF-I: potential use in the treatment of neurodegenerative diseases.
Trends Neurosci
20:326-331[Web of Science][Medline].
-
Dudek H,
Datta SR,
Franke TF,
Birnbaum MJ,
Yao R,
Cooper GM,
Segal RA,
Kaplan DR,
Greenberg ME
(1997)
Regulation of neuronal survival by the serine-threonine protein kinase Akt [see comments].
Science
275:661-665[Abstract/Free Full Text].
-
Eschweiler GW,
Bähr M
(1993)
Flunarizine enhances rat retinal ganglion cell survival after axotomy.
J Neurol Sci
116:34-40[Web of Science][Medline].
-
Frade JM,
Marti E,
Bovolenta P,
Rodriguez Pena MA,
Perez Garcia D,
Rohrer H,
Edgar D,
Rodriguez Tebar A
(1996)
Insulin-like growth factor-I stimulates neurogenesis in chick retina by regulating expression of the alpha 6 integrin subunit.
Development
122:2497-2506[Abstract].
-
Franke TF,
Yang SI,
Chan TO,
Datta K,
Kazlauskas A,
Morrison DK,
Kaplan DR,
Tsichlis PN
(1995)
The protein kinase encoded by the Akt proto-oncogene is a target of the PDGF-activated phosphatidylinositol 3-kinase.
Cell
81:727-736[Web of Science][Medline].
-
Franke TF,
Kaplan DR,
Cantley LC
(1997)
PI3K: downstream AKT ion blocks apoptosis.
Cell
88:435-437[Web of Science][Medline].
-
Gao H,
Qiao X,
Hefti F,
Hollyfield JG,
Knusel B
(1997)
Elevated mRNA expression of brain-derived neurotrophic factor in retinal ganglion cell layer after optic nerve injury.
Invest Ophthalmol Vis Sci
38:1840-1847[Abstract/Free Full Text].
-
Garcia-Valenzuela E,
Gorczyca W,
Darzynkiewicz Z,
Sharma SC
(1994)
Apoptosis in adult retinal ganglion cells after axotomy.
J Neurobiol
25:431-438[Web of Science][Medline].
-
Guan J,
Williams C,
Gunning M,
Mallard C,
Gluckman P
(1993)
The effects of IGF-1 treatment after hypoxic-ischemic brain injury in adult rats.
J Cereb Blood Flow Metab
13:609-616[Web of Science][Medline].
-
Isenmann S,
Wahl C,
Krajewski S,
Reed JC,
Bähr M
(1997)
Up-regulation of Bax protein in degenerating retinal ganglion cells precedes apoptotic cell death after optic nerve lesion in the rat.
Eur J Neurosci
9:1763-1772[Web of Science][Medline].
-
Ishii DN
(1993)
Neurobiology of insulin and insulin-like growth factors.
In: Neurotrophic factors (Loughlin SE,
Fallon JH,
eds), pp 415-442. San Diego: Academic.
-
Kennedy SG,
Wagner AJ,
Conzen SD,
Jordan J,
Bellacosa A,
Tsichlis PN,
Hay N
(1997)
The PI 3-kinase/Akt signaling pathway delivers an anti-apoptotic signal.
Genes Dev
11:701-713[Abstract/Free Full Text].
-
Kermer P,
Klöcker N,
Labes M,
Bähr M
(1998)
Inhibition of CPP32-like proteases rescues axotomized retinal ganglion cells from secondary cell death in vivo.
J Neurosci
18:4656-4662[Abstract/Free Full Text].
-
Kermer P,
Klöcker N,
Bähr M
(1999a)
Long-term effect of inhibition of ced 3-like caspases on the survival of axotomized retinal ganglion cells in vivo.
Exp Neurol
158:202-205[Web of Science][Medline].
-
Kermer P,
Klöcker N,
Labes M,
Thomsen S,
Srinivasan A,
Bähr M
(1999b)
Activation of caspase-3 in axotomized rat retinal ganglion cells in vivo.
FEBS Lett
453:361-364[Web of Science][Medline].
-
Klöcker N,
Bräunling F,
Isenmann S,
Bähr M
(1997)
In vivo neurotrophic effects of GDNF on axotomized retinal ganglion cells.
NeuroReport
8:3439-3442[Web of Science][Medline].
-
Klöcker N,
Cellerino A,
Bähr M
(1998)
Free radical scavenging and inhibition of nitric oxide synthase potentiates the neurotrophic effects of brain-derived neurotrophic factor on axotomized retinal ganglion cells in vivo.
J Neurosci
18:1038-1046[Abstract/Free Full Text].
-
Klöcker N,
Kermer P,
Weishaupt J,
Labes M,
Bahr M
(1999)
BDNF inhibits caspase-3 activity in axotomized retinal ganglion cells in vivo.
Soc Neurosci Abstr
25:199.14.
-
Kulik G,
Klippel A,
Weber MJ
(1997)
Antiapoptotic signalling by the insulin-like growth factor I receptor, phosphatidylinositol 3-kinase, and Akt.
Mol Cell Biol
17:1595-1606[Abstract].
-
Lewis ME,
Neff NT,
Contreras PC,
Stong DB,
Oppenheim RW,
Grebow PE,
Vaught JL
(1993)
Insulin-like growth factor-I: potential for treatment of motor neuronal disorders.
Exp Neurol
124:73-88[Web of Science][Medline].
-
Li L,
Oppenheim RW,
Lei M,
Houenou LJ
(1994)
Neurotrophic agents prevent motoneuron death following sciatic nerve section in the neonatal mouse.
J Neurobiol
25:759-766[Web of Science][Medline].
-
Li P,
Nijhawan D,
Budihardjo I,
Srinivasula SM,
Ahmad M,
Alnemri ES,
Wang X
(1997)
Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade.
Cell
91:479-489[Web of Science][Medline].
-
Lindsay RM
(1994)
Trophic protection of motor neurons: clinical potential in motor neuron diseases.
J Neurol
242[Suppl 1]:S8-S11[Web of Science][Medline].
-
Mansour-Robaey S,
Clarke DB,
Wang YC,
Bray GM,
Aguayo AJ
(1994)
Effects of ocular injury and administration of brain-derived neurotrophic factor on survival and regrowth of axotomized retinal ganglion cells.
Proc Natl Acad Sci USA
91:1632-1636[Abstract/Free Full Text].
-
Mey J,
Thanos S
(1993)
Intravitreal injections of neurotrophic factors support the survival of axotomized retinal ganglion cells in adult rats in vivo.
Brain Res
602:304-317[Web of Science][Medline].
-
Miller TM,
Tansey MG,
Johnson Jr EM,
Creedon DJ
(1997)
Inhibition of phosphatidyl-inositol 3-kinase activity blocks depolarization- and insulin-like growth factor I-mediated survival of cerebellar granule cells.
J Biol Chem
272:9847-9853[Abstract/Free Full Text].
-
Neff NT,
Prevette D,
Houenou LJ,
Lewis ME,
Glicksman MA,
Yin QW,
Oppenheim RW
(1993)
Insulin-like growth factors: putative muscle-derived trophic agents that promote motoneuron survival.
J Neurobiol
24:1578-1588[Web of Science][Medline].
-
Nunez G,
del Peso L
(1998)
Linking extracellular survival signals and the apoptotic machinery.
Curr Opin Neurobiol
8:613-618[Web of Science][Medline].
-
Ocrant I,
Vanlentino KL,
King MG,
Wimpy TH,
Rosenfeld RG,
Baskin DG
(1989)
Localization and structural characterization of insulin-like growth factor receptors in mammalian retina.
Endocrinology
125:2407-2413[Abstract/Free Full Text].
-
Rabacchi SA,
Bonfanti L,
Liu XH,
Maffei L
(1994)
Apoptotic cell death induced by optic nerve lesion in the neonatal rat.
J Neurosci
14:5292-5301[Abstract].
-
Russell JW,
Windebank AJ,
Schenone A,
Feldman EL
(1998)
Insulin-like growth factor-I prevents apoptosis in neurons after nerve growth factor withdrawal.
J Neurobiol
36:455-467[Web of Science][Medline].
-
Salmon WD,
Daughaday WH
(1957)
A hormonally controlled serum factor which stimulates sulfate incorporation by cartilage in vitro.
J Lab Clin Med
49:825-836[Web of Science][Medline].
-
Scharenberg AM,
Kinet JP
(1998)
PtdIns-3,4,5-P3: a regulatory nexus between tyrosine kinases and sustained calcium signals.
Cell
94:5-8[Web of Science][Medline].
-
Shimoke K,
Yamada M,
Ikeuchi T,
Hatanaka H
(1998)
Synthetic lipid products of PI3-kinase which are added to culture medium prevent low K+-induced apoptosis of cerebellar granule neurons via Akt kinase activation.
FEBS Lett
437:221-224[Web of Science][Medline].
-
Simon P,
Thanos S
(1998)
Combined methods of retrograde staining, layer-separation and viscoelastic cell stabilization to isolate retinal ganglion cells in adult rats.
J Neurosci Methods
83:113-124[Web of Science][Medline].
-
Stewart CE,
Rotwein P
(1996)
Growth, differentiation, and survival: multiple physiological functions for insulin-like growth factors.
Physiol Rev
76:1005-1026[Abstract/Free Full Text].
-
Suzuki J,
Kaziro Y,
Koide H
(1998)
Synergistic action of R-Ras and IGF-1 on Bcl-xL expression and caspase-3 inhibition in BaF3 cells: R-Ras and IGF-1 control distinct anti-apoptotic kinase pathways.
FEBS Lett
437:112-116[Web of Science][Medline].
-
Tagami M,
Yamagata K,
Nara Y,
Fujino H,
Kubota A,
Numano F,
Yamori Y
(1997a)
Insulin-like growth factors prevent apoptosis in cortical neurons isolated from stroke-prone spontaneously hypertensive rats.
Lab Invest
76:603-612[Web of Science][Medline].
-
Tagami M,
Ikeda K,
Nara Y,
Fujino H,
Kubota A,
Numano F,
Yamori Y
(1997b)
Insulin-like growth factor-1 attenuates apoptosis in hippocampal neurons caused by cerebral ischemia and reperfusion in stroke-prone spontaneously hypertensive rats.
Lab Invest
76:613-617[Web of Science][Medline].
-
Tamatani M,
Ogawa S,
Tohyama M
(1998)
Roles of Bcl-2 and caspases in hypoxia-induced neuronal cell death: a possible neuroprotective mechanism of peptide growth factors.
Brain Res Mol Brain Res
58:27-39[Medline].
-
Ullrich A,
Gray A,
Tam AW,
Yang Feng T,
Tsubokawa M,
Collins C,
Henzel W,
Le Bon T,
Kathuria S,
Chen E
(1986)
Insulin-like growth factor I receptor primary structure: comparison with insulin receptor suggests structural determinants that define functional specificity.
EMBO J
5:2503-2512[Web of Science][Medline].
-
Villegas-Perez MP,
Vidal Sanz M,
Bray GM,
Aguayo AJ
(1988)
Influences of peripheral nerve grafts on the survival and regrowth of axotomized retinal ganglion cells in adult rats.
J Neurosci
8:265-280[Abstract].
-
Waldbillig RJ,
Fletcher RT,
Somers RL,
Chader GJ
(1988)
IGF-I receptors in the bovine neural retina: structure, kinase activity and comparison with retinal insulin receptors.
Exp Eye Res
47:587-607[Web of Science][Medline].
Copyright © 2000 Society for Neuroscience 0270-6474/00/202722-07$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
X. Zhou, F. Li, L. Kong, H. Tomita, C. Li, and W. Cao
Involvement of Inflammation, Degradation, and Apoptosis in a Mouse Model of Glaucoma
J. Biol. Chem.,
September 2, 2005;
280(35):
31240 - 31248.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Digicaylioglu, G. Garden, S. Timberlake, L. Fletcher, and S. A. Lipton
Acute neuroprotective synergy of erythropoietin and insulin-like growth factor I
PNAS,
June 29, 2004;
101(26):
9855 - 9860.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. E. N. Reiter, L. Sandirasegarane, E. B. Wolpert, M. Klinger, I. A. Simpson, A. J. Barber, D. A. Antonetti, M. Kester, and T. W. Gardner
Characterization of insulin signaling in rat retina in vivo and ex vivo
Am J Physiol Endocrinol Metab,
October 1, 2003;
285(4):
E763 - E774.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Chaum and H. Yang
Transgenic Expression of IGF-1 Modifies the Proliferative Potential of Human Retinal Pigment Epithelial Cells
Invest. Ophthalmol. Vis. Sci.,
December 1, 2002;
43(12):
3758 - 3764.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Cheng, P. Sapieha, P. Kittlerova, W. W. Hauswirth, and A. Di Polo
TrkB Gene Transfer Protects Retinal Ganglion Cells from Axotomy-Induced Death In Vivo
J. Neurosci.,
May 15, 2002;
22(10):
3977 - 3986.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. P. Lafuente, M. P. Villegas-Perez, P. Sobrado-Calvo, A. Garcia-Aviles, J. Miralles de Imperial, and M. Vidal-Sanz
Neuroprotective Effects of {alpha}2-Selective Adrenergic Agonists against Ischemia-Induced Retinal Ganglion Cell Death
Invest. Ophthalmol. Vis. Sci.,
August 1, 2001;
42(9):
2074 - 2084.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Diem, R. Meyer, J. H. Weishaupt, and M. Bahr
Reduction of Potassium Currents and Phosphatidylinositol 3-Kinase-Dependent Akt Phosphorylation by Tumor Necrosis Factor-{alpha} Rescues Axotomized Retinal Ganglion Cells from Retrograde Cell Death In Vivo
J. Neurosci.,
March 15, 2001;
21(6):
2058 - 2066.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|