 |
 Previous Article | Next Article 
The Journal of Neuroscience, January 15, 2000, 20(2):736-748
Expression of Neurotrophin-3 (NT-3) and Anterograde Axonal
Transport of Endogenous NT-3 by Retinal Ganglion Cells in Chick
Embryos
Christopher S.
von Bartheld and
Rafal
Butowt
Department of Physiology and Cell Biology, University of Nevada
School of Medicine, Reno, Nevada 89557
 |
ABSTRACT |
Anterograde axonal transport of neurotrophins has been demonstrated
recently, but to date such transport has only been shown for
brain-derived neurotrophic factor and no other endogenous neurotrophin. Endogenous neurotrophin-3 (NT-3) protein is present in
the ganglion cell layer of the chicken retina, as well as the superficial layers of the optic tectum. NT-3 immunolabel in these tectal layers is largely reduced or abolished after treatment of the
eye with colchicine or monensin, demonstrating that endogenous NT-3 is
transported to the optic tectum by retinal ganglion cells (RGCs).
Reverse transcription-PCR analysis of RGCs purified to 100% shows that
RGCs, but not tectal cells, express NT-3 mRNA. Blockade of the
intercellular transfer of NT-3 within the retina does not reduce the
anterograde transport of endogenous NT-3 to the tectum, indicating that
a major fraction of the anterogradely transported NT-3 is produced by
RGCs rather than taken up from other retinal cells. Immunolabel for the
neurotrophin receptor p75, but not trkB or trkC, in the superficial
tectum coincides with the NT-3 label. The p75 label in the neuropil of
superficial tectal layers is largely reduced or eliminated by injection
of monensin in the eye, indicating that p75 protein is exported along RGC axons to the retinotectal terminals and may act as a neurotrophin carrier. These results show that NT-3 is produced by RGCs and that some
of this NT-3 is transported anterogradely along the axons to the
superficial layers of the tectum, possibly to regulate the survival,
synapse formation, or dendritic growth of tectal neurons.
Key words:
anterograde transport; NT-3; BDNF; retina; optic tectum; p75 neurotrophin receptor; neurotrophic factor; visual system; RT-PCR
| |
INTRODUCTION |
Neurotrophins are well known as
target-derived, retrograde survival-promoting molecules that require
the transport of the neurotrophic factor from the axon terminus to the
cell body (Hendry et al., 1974 ; Johnson et al., 1978; Purves, 1988;
Barde, 1989; Oppenheim, 1996). Neurotrophins are also important
regulators of neuronal differentiation and synaptic plasticity (Snider,
1994; Thoenen, 1995). Recent studies have shown that neurotrophins can be transported anterogradely along axons (von Bartheld et al., 1996a;
Zhou and Rush, 1996; Altar et al., 1997; Conner et al., 1997, 1998;
Heymach and Barres, 1997; Johnson et al., 1997; Michael et al., 1997;
Smith et al., 1997; Yan et al., 1997; Altar and DiStefano, 1998). Such
anterograde transport may function to provide trophic support from
afferents (Linden, 1994; von Bartheld et al., 1996a; Altar et al.,
1997), to mediate fast, local effects at synaptic sites (Lohof et al.,
1993; Kang and Schuman, 1995; Thoenen, 1995; Berninger and Poo, 1996),
or to regulate dendritic growth, neuronal cytoarchitecture, and
phenotypes (Purves, 1988; Altar et al., 1997; McAllister et al., 1999).
Brain-derived neurotrophic factor (BDNF) is stored in axon terminals
(Conner et al., 1997; Fawcett et al., 1997; Michael et al., 1997) and
may be released into the synaptic cleft to activate postsynaptic
neurotrophin (trk) receptors (Levine et al., 1995; Wu et al., 1996).
Endogenous BDNF is transported anterogradely in several systems (Zhou
and Rush, 1996; Altar et al., 1997; Conner et al., 1997; Smith et al.,
1997; Yan et al., 1997), but anterograde transport of other endogenous
neurotrophins has not been demonstrated. Exogenous neurotrophin-3
(NT-3) is transported anterogradely by retinal ganglion cells (RGCs),
is released from the terminals, and is taken up by the dendrites of
second-order target cells in the optic tectum of chick embryos (von
Bartheld et al., 1996a), but this study did not examine transport of
endogenous NT-3. Because current research in this field focuses on
BDNF, it is of interest to know whether other neurotrophins may
function as anterograde messengers. The retinotectal pathway is a model
system in which the anterograde transport and release of neurotrophins
can be uniquely quantified (Baeten et al., 1997; Wang et al., 1999). This pathway allows us to determine whether anterograde transport characteristics of endogenous and exogenous neurotrophins are similar
or whether they may differ and which receptors may be involved in
axonal transport.
Here we show that RGCs produce NT-3, that endogenous NT-3 is
transported by RGCs in the same manner as exogenous NT-3, and that NT-3
transport and transport of the p75 neurotrophin receptor coincide. Our
study further provides evidence that a major fraction of the
transported endogenous NT-3 is expressed by the RGCs themselves, rather
than taken up from other cells in the retina. The analysis of the
contributions of intrinsic and extrinsic sources of the p75
neurotrophin receptor in the superficial layers of the optic tectum
provides evidence that this receptor is predominantly derived from the retina.
Parts of this paper have been published previously in abstract form
(von Bartheld, 1997).
| |
MATERIALS AND METHODS |
Sources of materials. The hybridoma cell line
(1D53B2) producing antibody to NT-3 (termed NT-3 mAB) (Gaese et al.,
1994) was provided by Boehringer Mannheim (courtesy of Ilse Bartke).
Polyclonal antibody to NT-3 was a kind gift of Robert Rush (Flinders
University, Adelaide, Australia) (Zhou and Rush, 1993). Monoclonal
antibodies to chicken p75 were obtained from Hideaki Tanaka (Kumamoto
University, Kumamoto, Japan) and to Thy1 were from Peter Jeffrey
(French and Jeffrey, 1986). Polyclonal antibody to BDNF was from Karen
Bailey and Yves Barde (Martinsried, Germany). Polyclonal antibody to trkB and trkC (against the extracellular domain) was from Louis Reichardt, Frances Lefcort, and Doug Clary (Lefcort et al., 1996; von
Bartheld et al., 1996b). Polyclonal antibody to truncated trkC was from
Barbara Hempstead (Cornell, NY). Chicken NT-3 cDNA was a gift of George
Yancopoulos (Regeneron, Tarrytown, NY). Human recombinant BDNF,
NT-3, and NT-4 were provided by Ron Lindsay (Regeneron). Mouse
NGF was a kind gift of Mark Bothwell (Seattle, WA). Colchicine and
monensin were from Sigma (St. Louis, MO); pertussis toxin was from List
Biologic (Campbell, CA). Chicken eggs were obtained from H+N (Redmond,
WA) or California Golden Eggs (Sacramento, CA) and were incubated in
humidified incubators at 37.5-38°C. Approximately 450 chicken eggs
were used. The ages of chick embryos were verified at the time of death
according to the method of Hamburger and Hamilton (1951). The
terminology of LaVail and Cowan (1971) was used for the optic tectum of
the embryonic chicken. Experimental procedures were conducted in
compliance with the Policy on the Use of Animals in Neuroscience
Research and were approved by the local animal care committee.
Hybridoma culturing. NT-3 mAB hybridoma cells (United States
Department of Agriculture permit #40032) were grown in 25 ml Corning
flasks containing RPMI, 2 mM glutamine, 1 mM
Na-pyruvate, 1% nonessential amino acids, and 2-5% fetal bovine
serum. Supernatant was harvested every 2-6 weeks; the antibody
was concentrated by precipitation with ammonium sulfate, dialyzed
overnight, purified on a Bio-Rad Protein A (Affi-Gel) column, dialyzed
again overnight, and concentrated by membrane filtration using
Ultrafree MC membrane tubes (Millipore, Bedford, MA). The final
concentration of the antibody was determined in a spectrophotometer.
Aliquots were stored at  80°C. Samples were run on 10% SDS-PAGE and
stained with Coomassie blue, revealing a major band at ~50 kDa, as
expected for IgG. The supernatant from p75 (M7412) mAB hybridoma cells was frozen in aliquots at 80°C and used at a dilution of 1:2 for
immunocytochemistry (von Bartheld et al., 1995).
Dot blots. A dilution series of 100-0.05 ng of NGF, BDNF,
NT-3, and NT-4 was pipetted onto filter paper, dried, and incubated after washes with 2% normal horse serum in 1 or 20 µg/ml NT-3 mAB.
The blots were incubated with biotinylated secondary antibodies followed by streptavidin-conjugated horseradish peroxidase (Vector Laboratories, Burlingame, CA) and reacted with diaminobenzidine (DAB).
The sensitivity of the antibody was evaluated by visual inspection.
Immunocytochemistry. After anesthesia with Nembutal, chicken
embryos were perfused transcardially with 4% paraformaldehyde (PFA) in
PBS, and tecta and retinae were post-fixed in the same fixative
for 16 hr at 4°C. After sucrose impregnation of the tissues (30%
sucrose for 24 hr at 4°C), 18 µm cryosections were thawed on
gelatin-coated slides. Sections through the tectum were cut at 30 µm
and processed free-floating. Brain sections were cut in the transverse
plane. Immunostaining was performed according to the Vector protocol
(Vector Laboratories) with some modifications (Zhou et al., 1994). In
brief, some sections were treated with three washes of 50% ethanol and
then were incubated with diluted blocking serum (5-10% normal goat or
horse serum) for 30 min at room temperature, followed by three washes
with PBS and 0.1% Triton X-100 and incubation overnight with
primary antisera. Primary antibodies were applied at the following
dilutions or concentrations: NT-3 mAB, 20 µg/ml; p75 mAB (7412, tissue culture supernatant), diluted 1:2; NT-3 polyclonal antibody
(pAB), 1 µg/ml; BDNF pAB, diluted 1:100; trkB pAB, 1 µg/ml; trkC
pAB, 1 µg/ml; and truncated trkC pAB, diluted 1:500 or 1:1000.
Sections treated with polyclonal antibodies (NT-3, BDNF, trkB, or trkC)
as the primary antibodies were rinsed three times and incubated with a
biotinylated goat anti-rabbit antibody diluted in blocking serum. For
sections treated with monoclonal antibodies (NT-3 mAB and M7412 p75
mAB) as the primary antibodies, a biotinylated horse anti-mouse or goat
anti-mouse antibody was used. After three washes, we applied ABC
reagent or horseradish peroxidase-conjugated streptavidin (1:500;
Zymed, South San Francisco, CA) for 30 min, rinsed three times, and
preincubated for 10 min in 0.1% DAB in 0.04% nickel ammonium sulfate
in Tris-buffered saline (100 mM Tris, pH 7.4, and 150 mM NaCl) until the reaction product was clearly visible.
Slides were rinsed in water, dehydrated, and coverslipped. Some
sections were lightly counterstained with thionin. Control sections
were processed with omission of the primary antibody, with normal
rabbit IgG as the primary antibody, or after preabsorption of the
primary antibody with 10 4 105 M NT-3 peptide for 24 hr
at 4°C.
Radio-iodination, intraocular injections, and
autoradiography. Human recombinant NT-3 and NT-3 mAB were
iodinated with lactoperoxidase as described (Vale and Shooter, 1985;
von Bartheld, 1998b). Na125I was purchased
from Dupont NEN (Boston, MA). Incorporations were 79.7-90.3% (NT-3)
and 84.9% (NT-3 mAB), and the specific activities were 70.6-129.4
cpm/pg of NT-3 and 116.6 cpm/pg of NT-3 mAB. Free iodide was removed
from the NT-3 preparation when the incorporation was less than 90%.
Iodinated NT-3 migrated in 15% SDS-PAGE as a single band at ~14 kDa
and was transported in a receptor-mediated manner (von Bartheld et al.,
1996a). Cold blocking NT-3 antibody (mAB; 0.4-20 µg) was injected in
one eye of 14- to 15-d-old chick embryos, followed by co-injection of
0.4-10 µg of antibody with 50-100 ng of
125I-NT-3 1 hr later in the same eye.
Control embryos received the higher dose of a control IgG (192 IgG, a
rat-specific monoclonal antibody) (Chandler et al., 1984; Taniuchi and
Johnson, 1985) at the same concentration, followed by an injection of
50-100 ng of 125I-NT-3 in the same eye.
Two to sixty-four hours (usually 20 hr) later, the embryos were
anesthetized with Nembutal, perfused with 4% PFA, staged, and
post-fixed. The amount of radioactivity in the dissected eyes and
midbrains [embryonic day 15 (E15)-E17] was measured in a
gamma counter. The ratios of the activity in the midbrain/eye were
determined for each animal and averaged for the different treatment
groups (normal animals, intraocular control antibody, and intraocular
blocking NT-3 antibody). SEs were calculated, and the data were plotted
as a function of the doses injected. The brains and the eyes were
embedded in paraffin, four series of sections (10 µm thickness)
through the midbrain at the level of the isthmo-optic nucleus were
collected on glass slides and exposed on x-ray film for 2-5 d, and the
sections were coated with NTB-2 emulsion (Eastman Kodak,
Rochester, NY). Sections were exposed for 3-8 weeks at 4°C and were
lightly counterstained with thionin after development and coverslipped.
After injections of iodinated proteins into the retina or into the
tectum, the amount of radioactivity in the eyes was measured in a gamma
counter. Autoradiographic silver grains were counted using 40× or
100× objectives. To determine whether the NT-3 mAB was transported from the retina to the optic tectum, we injected 350 ng of
125I-NT-3 mAB into the eye of a 15-d-old
chick embryo and processed the brain 21 hr later for gamma counting and
emulsion autoradiography as described.
Other injection procedures. Colchicine (0.7 µg) was
dissolved in PBS and was injected in a volume of 5 µl in the
vitreous. Monensin (9 µg) was dissolved in ethanol and injected in a
volume of 2-4 µl. Pertussis toxin (0.2 µg) was dissolved in PBS
and injected in a volume of 7 µl. Antibodies (0.4-22 µg of mAB
NT-3 or irrelevant IgG) were diluted in PBS and injected in volumes of
4-10 µl in the vitreous. Solution with vehicle only in the same
volume was injected in the control eye. The eyes were embedded in
paraffin, sectioned at 10 µm, and stained with thionin, and the
frequency of pyknotic cells was compared between the ipsilateral and
the contralateral retina.
Injections into the tectum were made through the skull as described
previously (von Bartheld et al., 1995). Radio-iodinated NT-3 was
injected into the optic tectum of 20- to 21-d-old chick embryos by
using disposable syringes (von Bartheld, 1998b). After 20 hr of
survival, the animals were anesthetized and perfused transcardially
with 4% PFA. Midbrains containing 100,000-200,000 cpm were counted
after dehydration and dissected for further localization of the counts,
and the retinae were dissected, dehydrated, and counted in the gamma counter.
NT-3 in situ hybridization. A chicken NT-3 cDNA
(Maisonpierre et al., 1992) (courtesy of P. Maisonpierre and G. Yancopoulos, Regeneron) was subcloned into pGEM. Single-stranded
riboprobes (644 bp) were labeled with
35S-UTP and used for hybridization as
described (von Bartheld et al., 1991, 1996a). Animals at E13 and
E15/E16 were anesthetized and perfused with 4% PFA. The eyes were
dehydrated, embedded in paraffin, and sectioned at 10 µm. Sections
through the brain and retina were collected on silane-coated glass
slides. Adjacent sections were hybridized with a sense control probe.
Hybridization conditions were as described previously (von Bartheld et
al., 1991). Emulsion-coated sections were exposed for 14-28 d,
developed, and lightly counterstained with thionin.
RGC purification. RGCs were purified by a combination
of retrograde labeling with DiI, immunopanning with Thy1, and
microaspiration of labeled immunopanned cells for molecular analysis
(Butowt et al., 2000). Chick embryos or hatchling chicks were
anesthetized by intramuscular injection of Nembutal (50 mg/kg of body
weight), and 2-4 µl of DiI was injected into the optic nerve ~2 mm
proximal to its exit from the eye. Fifteen hours later, the animals
were killed by an overdose of Nembutal, and the retina was dissected and dissociated with trypsin. It was verified by cryosectioning (von
Bartheld et al., 1990; Butowt et al., 2000) that DiI label in the
retina was restricted to cells in the ganglion cell layer and displaced
ganglion cells in the inner nuclear layer (INL) (Reiner et al., 1979).
For immunopanning, we used mouse monoclonal IgG SB1-20.11 against
chicken Thy1 (French and Jeffrey, 1986) as the primary antibody and
affinity-purified goat anti-mouse IgG (M8645; Sigma) as the secondary
antibody. Plates with adhering RGCs were placed on an inverted
microscope (Nikon TE200) equipped with phase-contrast optics and
epifluorescence. Glass capillaries (pulled from glass borosilicate
capillaries to a final average diameter ranging from 20 to 30 µm)
were positioned with a micromanipulator, and viable (phase-bright)
cells with intense fluorescence were collected in the pipette tip by
exerting negative pressure. Up to 500 fluorescent cells were collected
in one micropipette, transferred to sterile RNase-free Eppendorf
microfuge tubes, and immediately frozen at 80°C.
RNA isolation and reverse transcription-PCR. Total RNA was
isolated from 600 or 1000 viable purified RGCs, the same numbers of random retinal cells, or 1000-2000 random cells obtained from the
superficial layers of the optic tectum of the same animals (E19-E20
embryos). RNA was extracted with Trizol reagent (Life Technologies,
Rockville, MD) according to the manufacturer's recommended procedure.
Before the final RNA precipitation, 2.5 µg of RNase-free yeast tRNA
(Life Technologies) was added to the sample as a carrier. Total RNA
samples were digested with 0.5 U of RNase-free DNase I (Ambion, Inc.,
Austin, TX) for 20 min at 37°C followed by heating to 80°C for 6 min. Reverse transcription (RT) was performed by using RETROscript
reagents (Ambion, Inc.) with 5 µM random decamer primers
and 100 U of MMLV RT in a buffer containing 50 mM Tris-HCl, pH 8.3, 75 mM KCl, 3 mM
MgCl2, and 3 mM DTT in a total volume of 20 µl at 44°C for 60 min. Whole cDNA was digested with
HinfI (Promega, Madison, WI; to avoid any genomic DNA
contamination) at 37°C for 20 min. After the RT step, two separate
PCR reactions were performed, one for abundant 18 S rRNA (primers:
forward, 5'TCAAGAACGAAAGTCGGAGG, and reverse, 5'GGACATCTAAGGGCATCACA;
product size, 488 bp; 27 cycles, 94°C for 35 sec, 58°C for 40 sec,
and 72°C for 45 sec) and a second one for NT-3 (primers: forward, 5'CTTACAGGTGAACAAGGTGATGTCC, bp 69-93, and reverse
5'CACGCAGGAGGTGTCTATTCTTATC, bp 828-804; product size, 758 bp; 30 cycles, 94°C for 30 sec, 55°C for 45 sec, and 72°C for 55 sec).
NT-3 primers (Life Technologies) were designed by using Mac-Vector
software, and 18 S rRNA primers were purchased from commercial sources
(Ambion, Inc.). The final PCR volume of 50 µl contained 5 µl of
cDNA, each primer at 0.4 µM, 0.2 mM dNTP, 1.5 mM
MgCl2, and 2.5 U of Taq polymerase
(Life Technologies) in standard PCR buffer (Life Technologies). For NT-3, the second "nested" PCR cycle was performed by using 0.3 µl
of the first PCR product (primers: forward, 5'TGGATCAAAGGAGTTTGCCAGA, bp 149-170, and reverse, 5'CTTAACTGGAGAGTGGCCTGTT, bp 648-627; product size, 498 bp; 27 cycles, 94°C for 25 sec, 48°C for 35 sec,
and 72°C for 45 sec). Control experiments were performed without MMLV
RT for each set of primers. RT-PCR products for NT-3 were purified by
using the Qiaquick PCR purification kit (Qiagen, Santa Clarita, CA) and
directly sequenced by using an ABI Prism 310 machine. Sequencing
results were compared with the published chicken NT-3 cDNA sequence
available in the database (Maisonpierre et al., 1992). PCR products
were separated by 1.2% agarose gel electrophoresis containing 0.5 µg/ml ethidium bromide in standard TBE buffer, pH 8.4. Bands
were documented with a Gel-Doc 2000 system (Bio-Rad, Hercules, CA).
Quantification of cell death and thickness of layers in the
tectum. The number of pyknotic profiles in the stratum griseum centrale (SGC) layer of the optic tectum of chick embryos was quantified after injections of blocking NT-3 mAB (2-22 µg) to assess
effects of anterogradely transported NT-3. Cell death was also
quantified after injections of the eye with pertussis toxins to verify
the success of these injections. In short, 3 d after intraocular
injections, chick embryos were decapitated, heads were fixed in
Methacarns fixative, and the brains were dissected from the skull. In
the case with injections of pertussis toxin, the eyes required PFA
fixation for subsequent NT-3 immunocytochemistry; therefore, the
animals were anesthetized with Nembutal, the brains were dissected out
and fixed in Methacarns, and the rest of the body was transcardially
perfused with 4% PFA. Embryos were staged according to the method of
Hamburger and Hamilton (1951), and the brains were embedded in
paraffin. Pyknotic cells were quantified as described (Catsicas et al.,
1992; von Bartheld et al., 1996a). The brains were serially sectioned
at 10 µm, a one in four series was collected on slides and stained
with thionin, and every neuronal profile containing a pyknotic nucleus
was counted in the ipsilateral and contralateral SGC in sections
through the caudal part of the tectum at the level of the isthmo-optic
nucleus. Profiles were counted blind as to the treatment group.
Unbiased stereological methods were not used for these experiments. The
data were used only to establish the success of the intraocular
injection (pertussis toxin) or to determine whether cell death in the
tectum was significantly enhanced by the treatment of the eye with
antibodies. Because the structures being counted do not change in
shape, size, or orientation between the treatment groups, any
systematic bias in the estimation of population size should cancel out
of the calculation. After injections of either 0.7 µg of colchicine
or 9 µg of monensin or daily injections of anti-NT-3 mAB in the eye, the thickness of the tectal layers containing retinal ganglion cell
axons and terminals [stratum opticum (SO) and stratum griseum et
fibrosum superficiale (SGFSa-f)] was measured and compared between
the contralateral and the ipsilateral tectum (internal control). The
mean percent difference in thickness was calculated from six to seven
brains, and statistical significance was determined by t test.
DiI tracing after injections of colchicine or monensin. In
five embryos injected with either colchicine or monensin in one eye and
vehicle in the other eye, DiI crystals were subsequently applied to the
optic tract or superficial layer of the optic tecta of PFA-fixed brains
(Godement et al., 1987; von Bartheld et al., 1990), and the brains were
kept in PFA for 20-25 d at 37°C. The brains were sectioned at 100 µm on a vibratome, and sections through the tectum were collected on
gelatin-coated slides. The sections were immediately coverslipped in
aqueous mounting medium and examined on a Nikon Eclipse microscope for
fluorescence, and representative sections were photographed with T-MAX
400 film.
| |
RESULTS |
Specificity and sensitivity of the NT-3 mAB
The sensitivity and specificity of the monoclonal NT-3 antibody
were tested in a dot blot assay. NT-3 antibody detected 1-5 ng of
NT-3, and there was no cross-reactivity with BDNF or NGF, even at
20-100 times higher concentrations (Fig.
1A). Therefore, the
monoclonal NT-3 antibody is as sensitive and specific as other neurotrophin antibodies that have been characterized previously (Zhou
and Rush, 1993; Anderson et al., 1995).
View larger version (67K):
[in this window]
[in a new window]
|
Figure 1.
Specificity and sensitivity of the monoclonal NT-3
antibody (mAB 1D53B2). A, Dot blot of NT-3 mAB showing
its sensitivity and specificity for NT-3 compared with NGF, BDNF, and
NT-4. The antibody detected <5 ng of NT-3 and did not cross-react with
100 ng of NGF, BDNF, or NT-4. Dilutions are 100 ng (row
1), 10 ng (row 2), 5 ng (row 3),
1 ng (row 4), and 0.5 ng (row 5).
B, Section through the retina from a 16-d-old chick
embryo. A control section in which the primary antibody was omitted is
shown. The layers of the retina are indicated. C,
NT-3 immunolabel of cryosection near-adjacent to the one in
B. Note the cellular label in the GCL and the inner half
of the INL. Several bands (arrowheads) are immunolabeled
in the OPL, but not all of these bands were seen consistently.
D, NT-3 immunolabel of a retina that had been injected
with 500 ng of human recombinant NT-3 20 hr before death. Note the
distribution of exogenous NT-3 (+exog.) in the
IPL. Scale bar: B-D, 20 µm.
|
|
NT-3 immunoreactivity in the retina
Sections collected on slides and free-floating sections through
the retina of 14- to 16-d-old chick embryos were immunolabeled with
pABs and mABs against NT-3. Free-floating retinal sections tended to
have higher nonspecific background, and our analysis therefore focused
on sections reacted on the slide. Both antibodies showed a similar
pattern. The large majority if not all cells in the ganglion cell layer
(GCL) were immunolabeled (Fig. 1C). In addition, many cells
in the inner half of the INL were labeled faintly or moderately (Fig.
1C), consistent with a previous report (Das et al., 1997).
In some sections, two to three thin bands of immunolabel were visible
in the outer plexiform layer (OPL; Fig. 1C), but this
banding was not consistently seen. When the primary antibody was
omitted, there was no cellular or neuropil label (Fig.
1B). When 250-500 ng of human recombinant NT-3 was injected in the chick eye, 20 hr later, sections through the retina showed greatly increased immunolabel for NT-3 in the GCL and inner plexiform layer (IPL) compared with the vehicle-injected or noninjected control retina (Fig. 1B-D). No difference in the
intensity of the immunolabel was detected between the ipsilateral and
contralateral optic tectum in these animals (data not shown).
NT-3 immunoreactivity in the tectum
RGCs can transport exogenous NT-3 anterogradely to the optic
tectum (von Bartheld et al., 1996a) where it accumulates in the superficial tectal layers SO and SGFSa-d (Fig.
2A). Sections through the normal tectum show a distinct band of NT-3 immunolabel in the same
layers (SO-SGFSa-d; Fig. 2B). The label was most
intense in the SGFSd and less pronounced in the SGFSc. The same pattern was seen in sections processed with either the monoclonal or the polyclonal antibodies (Fig. 2B,D). There was no label
when the primary antibody was preabsorbed or omitted (Fig.
2C). The label in the superficial tectal layers was seen
consistently in free-floating sections and occasionally could also be
observed in sections reacted on the slide. In addition to the neuropil
label in SO-SGFSa-d, many cell bodies were labeled in the SGC (Fig.
2B,D). To determine the percentage of SGC neurons
labeled with the NT-3 antibody, some sections through the tectum were
counterstained with thionin after immunolabeling. Approximately 70% of
the cells in the SGC were immunolabeled. Because the SGFSd is the
predominant layer in which retinal axons terminate (Fig.
2F) (Crossland et al., 1975; Acheson et al., 1984),
the NT-3 immunolabel in this neuropil is consistent with the notion
that RGCs may transport endogenous NT-3 to their axon terminals.
View larger version (70K):
[in this window]
[in a new window]
|
Figure 2.
Sections through the superficial layers of the
optic tectum of 16-d-old chick embryos showing the distribution of
exogenous and endogenous (endog.) NT-3.
A, Distribution of radiolabeled NT-3 in the optic tectum
after injection in the eye and anterograde transport by retinal
ganglion cell axons is shown. Dark-field image of a paraffin section
processed for autoradiography. B, Normal tissue section
immunolabeled with pAB to NT-3 shows a strong band of neuropil label in
the same layers, the SO, and the SGFSa-d as well as cellular
label in the SGC. Free-floating cryosection. The same pattern was seen
with mAB to NT-3 (shown in D). C, No
label was seen in control sections in which the primary antibody was
replaced by irrelevant IgG. Free-floating cryosection. The layers SGFSg
(g) and SGC are indicated. D,
Section through the ipsilateral (control) optic tectum 48 hr after the
intraocular injection of colchicine and immunolabeled with mAB to NT-3
is shown. Free-floating section. Note a normal band of NT-3
immunoreactivity. E, Same section shown in
D but from the contralateral optic tectum. Note that
intraocular colchicine (COL) largely reduced the NT-3
label in the SO and SGFSa-d, demonstrating that NT-3-like
immunoreactivity was derived from the retina and was present in
retinotectal axons. F, Fluorescent label in the SO and
SGFSa-d layers of the contralateral tectum after injection of DiI into
the eye is shown. Cryosection. Scale bars: A, B-E, F,
100 µm.
|
|
Reduced NT-3 immunoreactivity with colchicine or monensin: evidence
of anterograde transport of endogenous NT-3
To determine whether the endogenous NT-3 immunoreactivity in the
superficial layers of the optic tectum was derived from the retina or
from other sources in the brain, 16- to 17-d-old chick embryos were
injected in one eye with either colchicine (0.7 µg) or monensin (9 µg). These doses entirely prevent anterograde transport of exogenous
NT-3 (von Bartheld et al., 1996a) (C. S. von Bartheld, unpublished
observations). When examined 48 hr later (colchicine experiments) or
30-50 hr later (monensin experiments), the immunoreactivity in the
superficial layers of the optic tectum on the contralateral side was
much reduced or abolished (Fig. 2E), whereas that on the vehicle-treated ipsilateral (control) side was unaffected (Fig.
2D). Sections immunolabeled with either the
monoclonal or the polyclonal NT-3 antibodies yielded similar results.
The cell body labeling in the SGC layer was not visibly affected by the colchicine or monensin treatment in the eye. These data show that the
source of the NT-3 immunoreactivity in the superficial tectal layers
was in the retina, demonstrating that RGCs transport endogenous NT-3 to
the tectum.
Loss of NT-3 from the tectum: lack of transport or loss because of
retinal fiber degeneration?
Loss of NT-3 protein from the superficial tectum may be caused by
the elimination of anterograde transport, but it may also be caused by
the degeneration of retinotectal terminals and fibers as a consequence
of toxin treatment (chemical axotomy) (Lunn et al., 1990). To determine
whether the retinal axon terminals in the tectum were maintained after
colchicine or monensin treatment of the eye, we attempted to label
these fibers in fixed tissue by the postmortem DiI technique (Godement
et al., 1987). DiI label was readily obtained in the SGFSa-f layers on
the control side (Fig. 3A),
but not in the experimental tectum where a diffuse DiI-labeling pattern
was confined to the SO layer (Fig. 3B). In addition, after
either axotomy or monensin or colchicine treatment in the eye, the SO
and SGFSa-f layers were significantly reduced in thickness (Figs.
3C-E), and the number of pyknotic cells in the GCL of the
injected retina was increased compared with that of control retinae
(data not shown). These data are consistent with the notion that
chemical axotomy induces terminal fiber degeneration and membrane
disintegration of distal axons. We conclude that both the elimination
of anterograde axonal transport and the ensuing degeneration of axon
terminals contribute to the loss of NT-3 protein seen in the
retinotectal projection after colchicine or monensin treatment.
View larger version (70K):
[in this window]
[in a new window]
|
Figure 3.
Effects of intraocular monensin, colchicine, and
NT-3 antibodies on retinotectal projections in chick embryos.
A, DiI application to the fixed retinotectal projection
shows DiI label in the SO and SGFSd (d,
arrowheads). B, Pretreatment with
monensin (+Mon) in the eye abolishes DiI label in SGFSd
and results in diffuse DiI label in the SO. C, The
thickness (arrow) of the SO and SGFSa-f in the normal
tectum [layer SGFSg is indicated (g)] is shown.
D, Pretreatment of the eye with colchicine
(+Col) reduces the thickness
(arrow) of the SO and SGFSa-f. E,
Quantification of changes in the thickness of the SO + SGFSa-f tectal
layers (ipsilateral vehicle control side = 100%) is shown. Note
that axotomy, monensin, and colchicine cause a similar reduction in the
thickness of the retinorecipient tectal layers, at least in part
because of degeneration of retinotectal fibers and terminals. Error
bars indicate SEM. The number of independent experiments
(n) is indicated. a-NT3, NT-3
antibody; Axo, axotomy; IgG, normal IgG
control; Veh, vehicle. Scale bars: A, B;
C, D, 50 µm.
|
|
Lack of transport of endogenous BDNF
Endogenous BDNF has been shown to be transported anterogradely in
several neuronal populations (Zhou and Rush, 1996; Altar et al., 1997;
Conner et al., 1997; Smith et al., 1997; Yan et al., 1997), and it has
been suggested that it may be transported in the retinotectal
projection (Garner et al., 1996). A small fraction of chick RGCs
produce BDNF (Herzog and von Bartheld, 1998; Karlsson and
Hallböök, 1998). To determine whether endogenous BDNF is
also transported by RGCs to the tectum, colchicine or monensin was
injected in the eye, and sections through the tectum were immunolabeled
with an antibody specific for BDNF (Jungbluth et al., 1994; Herzog and
von Bartheld, 1998). There was no apparent difference in the pattern of
immunolabeling for BDNF in the retinorecipient layers of the optic
tectum, although cell bodies and dendrites were labeled in the deeper
tectal layers (Fig. 4). Thus, there was
no evidence that endogenous BDNF was transported by RGCs to the tectum,
but we cannot exclude that such transport may be detected with more
sensitive antibodies. Nevertheless, these data eliminate the
possibility that loss of NT-3 label in the retinorecipient layers may
be a nonspecific artifact of toxin treatment that is seen with all
antibodies. Rather, the anterograde transport of endogenous
neurotrophin by RGCs appears to be specific for NT-3.
View larger version (119K):
[in this window]
[in a new window]
|
Figure 4.
Sections through the optic tectum of a 16-d-old
chick embryo immunolabeled for BDNF. A, Section through
the ipsilateral (control) tectum. B, Section through the
experimental tectum, contralateral to the eye that was injected with
monensin (MON) to block anterograde transport and
induce RGC axon degeneration in the tectum. Layer SGFSi
(i) is indicated. Note that there is no
appreciable difference in BDNF label between the two sides of the same
tissue section. Scale bar, 100 µm.
|
|
Is NT-3 expressed in RGCs and/or the optic tectum?
In situ hybridization for NT-3 mRNA
NT-3 protein has been detected in many neurons of the GCL in
retinal sections from E15 to E17 chick embryos by immunocytochemistry with polyclonal and monoclonal antibodies specific for NT-3 (see Figs. 1C, 6A) (Das et al., 1997). To determine
whether cells in the GCL (presumptive RGCs) express NT-3 mRNA
themselves (von Bartheld et al., 1996a) or whether RGCs take up NT-3
from other cells in the retina that express NT-3 mRNA
(Hallböök et al., 1996), we performed in situ
hybridization experiments. Low levels of NT-3 mRNA were detected in the
GCL at E15-E16 (von Bartheld et al., 1996a), and low levels of NT-3
mRNA were present in some cells of the GCL (Fig.
5A,B). However, because
approximately one-third of the cells in the GCL are amacrine cells
(Ehrlich, 1981), it was not certain that NT-3 mRNA expression in the
GCL was localized to the RGC population. Attempts to label RGCs
retrogradely and detect NT-3 hybridization signals failed (data not
shown), presumably because of the low copy number of neurotrophin mRNA
in the chick retina (estimated to be ~1.2 copies/cell) (Herzog et
al., 1994; Hallböök et al., 1996). Similar experiments
detected BDNF signal that is expressed at higher levels in a small
subpopulation of RGCs (Herzog and von Bartheld, 1998; Karlsson and
Hallböök, 1998).
View larger version (83K):
[in this window]
[in a new window]
|
Figure 5.
Sections through the retina of a 16-d-old chick
embryo hybridized with a probe for NT-3 (A, B) or
immunolabeled for NT-3 protein (C, D). A,
Section hybridized with the antisense probe for NT-3. Note the label in
some cells (arrowhead) within the GCL. B,
Adjacent section hybridized with a sense control probe.
C, Immunolabeled section through the normal (control)
retina. Note that the INL is labeled differentially; the inner half is
labeled more intensely than the outer half. D, Section
through the retina of the same embryo in which pertussis toxin
(PTX) was injected into the eye. Note that
PTX changed the pattern of NT-3 distribution that became
homogeneous throughout the INL, but PTX treatment did
not consistently change the intensity or distribution of NT-3 label in
the GCL. Scale bars: A, B, 10 µm; C, D,
20 µm.
|
|
RT-PCR of purified RGCs and random tectal cells
To resolve whether RGCs in the ganglion cell layer (Fig.
6A) express the gene
for NT-3, we used RT-PCR from 100% purified RGCs. Expression of NT-3
mRNA and 18 S rRNA was consistently detected in 600-1000 random
retinal cells as well as in 600-1000 purified RGCs from E19 to E20
chicken embryos (Fig. 6B). High-abundance 18 S rRNA
was detected after one round of PCR, whereas expression of the
low-abundance NT-3 gene was consistently detected after a second round
of PCR by using nested primers. Our protocol (Butowt et al., 2000)
purified RGCs to 100% purity. Analysis of sectioned retinae after
injections of DiI into the optic nerve verified that only cells in the
GCL and large displaced ganglion cells in the INL were labeled, but no
other cell types (Butowt et al., 2000). Whether the large displaced
ganglion cells project to the optic tectum in chicken is controversial
(Reiner et al., 1979), and therefore we had to consider the possibility
that the observed NT-3 signal may be caused entirely by expression in
this cell type. However, neither the in situ hybridization
nor the immunolabeling data provided any indication that the displaced
ganglion cell type may express larger quantities of NT-3 than do
orthotopic RGCs (data not shown).
View larger version (61K):
[in this window]
[in a new window]
|
Figure 6.
NT-3 expression in RGCs. A,
NT-3-like immunoreactivity in the ganglion cell layer of a 16-d-old
chick embryo. The cryosection is immunolabeled with the monoclonal NT-3
antibody. Scale bar, 10 µm. B, RT-PCR analysis for
NT-3 expression in 1000 purified (purif)
RGCs, 1000 random retinal cells (RC), and 2000 random
tectal cells (TC). The number of base pairs (400, 500)
is indicated. The NT-3 product is 498 bp; the 18 S rRNA product is 488 bp. Note that the NT-3 signal is obtained from purified RGCs and random
retinal cells but not from random tectal cells. RT,
Minus reverse transcriptase; 18S, 18 S ribosomal
RNA.
|
|
By the use of RT-PCR with the same conditions used for retinal cells,
NT-3 expression could not be detected in four independent PCR
experiments with RNA extracted from 1000 to 2000 cells derived from the
superficial layers of the optic tectum from the same embryos (Fig.
6B). These data confirm the reported lack of NT-3 expression in this region (von Bartheld et al., 1996a; Karlsson and
Hallböök, 1998). No signal was detected in experiments
without reverse transcriptase or with water instead of RNA. We conclude that RGCs express NT-3, although at low levels.
Prevention of NT-3 release in the retina with pertussis toxin
The RT-PCR experiments showed that RGCs express at least some NT-3
themselves, but these experiments do not exclude that a major fraction
of the anterogradely transported NT-3 may be taken up from other
retinal cells. If much of the retinal NT-3 was produced by INL and
outer nuclear layer (ONL) cells (Hallböök et al., 1996) and
then transferred to RGCs, one would predict a loss or reduction of NT-3
label in the GCL when immunolabeled for NT-3 after blockade of
intraretinal release or transfer of NT-3. Pertussis toxin (PTX) was
injected in the eye that is known to reduce the secretion of
neurotrophins (Gunther et al., 1996). To verify the success of the PTX
injections in the eye, pyknotic profiles in samples of the SGC layer of
the ipsilateral and contralateral optic tectum were quantified. This
analysis showed a nearly 100% increase in the number of dying cells in
the contralateral SGC. Yet, there was no substantial decrease in the
NT-3 immunolabel of the GCL, visualized with either the mAB or the pAB
(Fig. 5C,D). PTX induced a more homogeneous distribution of
NT-3 label in the INL, suggesting that normal movement of NT-3 protein
from the outer half of the INL to the inner half was reduced by the PTX treatment. These data are consistent with the notion that a significant amount of NT-3 is produced by RGCs themselves.
Blockade of intraretinal transfer of NT-3
To determine further the extent to which RGCs may take up NT-3
from other retinal cells for anterograde transport, we determined the
dose of blocking NT-3 antibody that is sufficient to abolish the
transport of exogenous NT-3 from the retina to the tectum. This
antibody reduced the transport of radio-iodinated NT-3 to the tectum in
a dose-dependent manner (Fig.
7A). A dose of 2 µg in the
eye blocked >90% of the transport that normally would have occurred,
whereas even 10-fold higher doses of irrelevant IgG did not
significantly reduce the transport (Fig. 7A). We then injected 20 µg of blocking NT-3 antibody in one eye of 15- to 17-d-old chick embryos and examined the optic tectum for NT-3 immunolabel. If a substantial amount of anterogradely transported NT-3
was not expressed by RGCs themselves but taken up from other cells in
the retina, the blocking antibody would prevent the transfer of NT-3
within the retina, and there should be a reduction of the NT-3
immunolabel in the tectum. However, even daily injections of the 20 µg dose of the blocking antibody in the eye did not reduce the
intensity or the pattern of NT-3 immunoreactivity in the
retinorecipient tectal layers (Fig. 7B,C). Thus, we conclude that the RGCs produce at least a major fraction of the anterogradely transported NT-3 themselves.
View larger version (43K):
[in this window]
[in a new window]
|
Figure 7.
Effects of the blocking NT-3 mAB in the eye on the
distribution of NT-3 and cell death in the tectum. A,
Dose-response curve of the effect of blocking mAB to NT-3 in the eye
on the transport of radio-iodinated NT-3 from the eye to the midbrain
in 15- to 16-d-old chick embryos. mAB (0.4 µg ) blocks ~60% of the
transport, 2 µg blocks ~90%, and 20 µg blocks ~95%. Each data
point with error bars (SEM) is the average of three to eight
experiments. Dashed line, Control antibody.
B, C, Sections through the optic tectum
of a 16-d-old chick embryo immunolabeled for NT-3 after daily injections of 20 µg
of NT-3 mAB in one eye. Note the persistence of NT-3 label in the
retinorecipient neuropil of layers SGFSa-d in the antibody-treated
retinotectal projection (C) compared with the
ipsilateral control side (B). The experimental
tectum showed an increase in the number of NT-3-labeled cell bodies in
SGFSg-i. D, Example of a pyknotic cell
(arrowhead) in the SGC of a 16-d-old chick
embryo. E, Quantification of pyknotic neuronal profiles
in the optic tectum after injections of 2, 22, or 3 × 22 µg of NT-3 mAB (a-NT) in the eye or of
irrelevant, control antibody (CO) in the eye. Bar graphs
show a significant effect (p  0.05, t test) of NT-3 mAB in the eye on the cell death of
neurons in the SGC of the contralateral optic tectum only after
multiple high doses over 4 d. The number of independent
experiments is indicated on each vertical
bar. Error bars indicate SEM. These data are consistent
with the hypothesis that RGCs export primarily their own NT-3 to the
optic tectum so that depletion of extrinsic sources becomes relevant
only after 3-4 d. Scale bars: B, C, 100 µm;
D, 10 µm.
|
|
Unexpectedly, the cellular pattern of NT-3 immunolabel in the optic
tectum was altered with injections of the blocking NT-3 antibody in the
eye. In the tectum innervated by the control-injected eye, NT-3
immunolabel in cell bodies was restricted to the SGC layer (Fig.
7B), but in the tectum receiving innervation from the retina
injected with the NT-3-blocking antibody, many cells in the SGFS layer
were immunolabeled for NT-3 (Fig. 7C). This effect was not
seen in tecta when the eye was injected with control antibodies. It
remains to be determined whether this may represent de novo
expression of NT-3 by the SGFS cells or whether NT-3 protein becomes
distributed differently in SGFS neurons as a result of interference
with NT-3 signaling in the eye or in the tectum. To determine whether
the NT-3 mAB may be transported from the eye to the tectum and may
accumulate in tectal neurons, the NT-3 mAB was radiolabeled and
injected in the eye. There was no evidence of transport to, and
accumulation in, the tectum by either gamma counting or emulsion
autoradiography of sections through the tectum (data not shown), but we
cannot exclude the possibility that radio-iodination of the antibody
may have altered its function.
As a final approach to the question of the source of anterogradely
transported NT-3, cell death in the optic tectum was analyzed after
injection of blocking NT-3 antibody or control antibody in the eye.
There was no significant increase in cell death in the SGC 48 hr after
a single injection of 2 or 22 µg of blocking mAB in the retina when
compared with control injections (Fig. 7D,E). However, daily
injections of 22 µg of mAB over 3-4 d induced a significant
enhancement of cell death in the SGC compared with control injections,
and this was apparently not caused by retinotectal fiber degeneration,
because the thickness of the SO and SGFSa-f layers was not reduced
(Fig. 3E), and daily injections of the NT-3 mAB did not
increase the frequency of pyknotic cells in the GCL (data not shown).
These data indicate that much of the anterogradely transported NT-3 is
produced by RGCs, but this amount needs supplementation from other
retinal sources, because prolonged lack of supply from additional
retinal sources of NT-3 appears to be fatal for many SGC neurons.
Localization of neurotrophin receptors in the
retinotectal projection
Previous studies have indicated that the bulk of the anterograde
transport of exogenous NT-3 is receptor-mediated (von Bartheld et al.,
1996a). Cells in the chicken GCL express mRNAs for the neurotrophin
receptors p75, trkB, and trkC (von Bartheld et al., 1991;
Hallböök et al., 1996). To determine which neurotrophin receptors may be present within retinotectal terminals,
immunocytochemistry with antibodies to p75, trkB, trkC, and truncated
trkC was performed. The trkB antibody labeled cell bodies in the SGFSc
and g and SGC layers of the optic tectum (Fig.
8A). The trkC antibody
labeled many cells throughout the SGFS and SGC (Fig.
8B). The antibody against truncated trkC labeled cell
bodies in the SGC (data not shown). Neither of the trk antibodies
labeled a distinct band of neuropil in the retinorecipient tectal
layers. Immunocytochemistry with a monoclonal antibody specific for
chicken p75 (Tanaka et al., 1989; von Bartheld et al., 1995) showed
that strong p75 immunoreactivity was present in the neuropil-containing
retinotectal fibers and terminals (tectal layers SO and SGFSa-d, Fig.
8D). Label was heaviest in SGFSd, moderate in SO and
SGFSa and b, and weaker in SGFSc. Thus, the p75 antibody labeled those
tectal layers with abundant retinotectal terminals (Crossland et al.,
1975; Acheson et al., 1984) that also contain NT-3-like
immunoreactivity (Fig. 2B). Control sections showed
no label when the primary antibody was omitted (Fig. 8C).
These data indicate that p75 receptors may be transported by RGCs to
their axon terminals.
View larger version (84K):
[in this window]
[in a new window]
|
Figure 8.
Sections through the optic tectum immunolabeled
with antibodies to neurotrophin receptors. A,
B, Sections labeled with pAB to trkB
(A) and pAB to trkC (B).
Note the lack of neuropil label within the retinorecipient layer SGFSd.
C, Control section in which the primary antibody was
omitted. The layers of the optic tectum are indicated.
D, Section labeled with a mAB to the p75 neurotrophin
receptor. p75 label distributes in the same sublayers of the SO and
SGFSa-d as the exogenous and endogenous NT-3 (compare with Fig.
2A,B). E, Section through the
experimental (contralateral) optic tectum of the same tissue section
after injection of monensin in the eye. Note the absence of p75
immunoreactivity in the SGFSd but the normal appearance of p75-labeled
neuronal cell bodies in SGFSc and SGFSi. Scale bar, 100 µm.
|
|
Source and transport of p75 receptors in the
retinotectal projection
Several neuronal cell types in the SGFS layer of the optic tectum
express p75 mRNA (von Bartheld et al., 1991) and contain p75 protein
(present study). Therefore, it was not clear whether the p75 label in
the retinorecipient layers was contained within processes from
intrinsic tectal neurons or was caused by anterograde transport of p75
within RGC projections. To determine whether RGCs transport p75 protein
to their axon terminals, we injected monensin or colchicine in one eye
of E16 chick embryos and examined the optic tectum for p75 immunolabel.
When transport from the retina was abolished and terminal degeneration
of retinotectal fibers likely was in progress, there was a marked
decrease of the p75 neuropil label in the SGFSc and d layers of the
contralateral optic tectum (Fig. 8D,E). The p75
immunolabel of the neuronal cell bodies and their primary and secondary
dendrites in the SO and SGFSa and b was not affected, thus serving as
an internal positive control. These results demonstrate that a
substantial amount of the p75 protein in the SGFSc and d was derived by
anterograde transport from the RGCs.
We have shown previously that exogenous BDNF, when injected into the
optic tectum, is transported retrogradely by retinotectal axons to the
retina, presumably by binding to p75 receptors (Herzog and von
Bartheld, 1998). To determine whether exogenous NT-3 is also
transported retrogradely in this system, we injected
125I-NT-3 into the tectum of 20- to
21-d-old chick embryos. Successful injections showed that ~0.5-1.2
ng of 125I-NT-3 remained in the tectum at
the time of death, as measured by gamma counting of the dissected
tecta. There was no difference in the amounts of radioactivity between
the experimental eyes and the control eyes, but differences could have
been obscured by systemic leakage. When the retinae were dissected from
the eye, dehydrated, and then measured in a gamma counter, there was a
slight difference (increase) of ~30 cpm (0.2 pg) between the contralateral (experimental) and the ipsilateral (control) retinae, indicating that as much as 0.2 pg of
125I-NT-3 (equivalent to 0.02% of the
amount that remained in the tectum) may have been transported
retrogradely to the contralateral retina. The efficiency of this
retrograde transport is 20 times less than that of anterograde
transport after injection in the eye, but it has to be kept in mind
that differences between retinotectal and tectoretinal transport could
also be caused by technical difficulties such as differences in
applying and retaining access of the exogenous neurotrophin for
internalization at the injection site.
Taken together, our data are consistent with the notion that the p75
receptor is a major carrier of exogenous, and possibly endogenous, NT-3
in the retinotectal pathway (von Bartheld, 1996) and a carrier of BDNF
in the retrograde direction (Curtis et al., 1995; Herzog and von
Bartheld, 1998). The distribution of NT-3, p75, trkB, and trkC protein
in the superficial tectal layers and their sources are schematically
summarized in Figure 9.
View larger version (39K):
[in this window]
[in a new window]
|
Figure 9.
Synopsis of NT-3 immunolabel and neurotrophin
receptor immunolabel in the superficial layers of the optic tectum in
16-d-old chick embryos and their sources from within the tectum or
retinal projection. Shaded (gray)
areas indicate neuropil label, graded from
light (low levels) to dark (high levels).
Labeled cell bodies are indicated by dots or
profiles (when dendritic details are labeled).
+MON, Monensin added in the eye (to reveal nonretinal
source of label; intraocular monensin prevents anterograde axonal
transport and causes degeneration of RGC axons and axon terminals). The
right-hand panel depicts
the fiber course of retinal ganglion cell axons in the SO and the SGFS
and the morphology of tectal neurons in sublayer SGFSi with ascending
dendrites into SGFSg, d, and c.
|
|
| |
DISCUSSION |
Recent studies have shown that neurotrophins are not only
retrograde trophic molecules but that they may have important functions as messengers that are transported in the anterograde direction along
axons. Anterograde transport of at least some neurotrophins is now
thought to be the predominant form of transport in the adult CNS
(Conner et al., 1997). NGF can be transported anterogradely in some
pathways (Wayne and Heaton, 1990; Hoyle et al., 1993), but not in
others (Claude et al., 1982; Ferguson et al., 1990). Recent studies
with BDNF and NT-3 have demonstrated the anterograde transport of
exogenous NT-3 (von Bartheld et al., 1996a; Johnson et al., 1997) and
of exogenous and endogenous BDNF (Zhou and Rush, 1996; Altar et al.,
1997; Conner et al., 1997; Johnson et al., 1997; Smith et al., 1997;
Yan et al., 1997). In agreement with the notion of anterograde
transport of neurotrophins, BDNF has been shown to accumulate in axon
terminals (Fawcett et al., 1997; Michael et al., 1997), and functional
trk receptors have been localized to the postsynaptic density (Levine
et al., 1995; Wu et al., 1996). Anterograde transport is technically
difficult to demonstrate because the amounts transported to the
terminals can be two to three orders of magnitude lower than those that are transported retrogradely to the cell bodies (von Bartheld et al.,
1996a,b). For this reason, the axonal transport of neurotrophins in the
retinotectal projection of chick embryos is of considerable interest.
In this system, 3-4 × 106 RGCs
project onto a relatively thin layer of the contralateral optic tectum
(Rager, 1980). The strong convergence, lack of direct tectoretinal
projections (i.e., the lack of potential retrograde axonal transport),
and the lack of production of NT-3 in the target, the optic tectum (von
Bartheld et al., 1996a; Karlsson and Hallböök, 1998), make
this an ideal system for the study of anterograde axonal transport of
NT-3 (LaVail and Margolis, 1987; von Bartheld, 1998a).
Evidence of the anterograde transport of endogenous NT-3
Anterograde transport of endogenous trophic factors has been
demonstrated previously for insulin-like growth factor-I
(Hansson et al., 1987), BDNF (for review, see Conner et al.,
1998), and possibly glial cell line-derived neurotrophic factor
(Holstege et al., 1998). Our paper presents the first direct evidence
of the anterograde transport of endogenous NT-3. The validity of this
interpretation is based on the use of two different antibodies that are
both specific and sensitive, and they rendered virtually identical
results. Furthermore, different ways of blocking anterograde transport
were used; monensin is specific for blockade of anterograde transport
(Hammerschlag and Stone, 1982; Hammerschlag et al., 1982), whereas
colchicine blocks both the retrograde and the anterograde transport.
Both toxins also induce RGC death and retinal axon degeneration. Our
data show that RGCs transport endogenous NT-3 to their terminals in the
optic tectum. Thus, the anterograde transport of radio-iodinated,
exogenous, NT-3 in this pathway (von Bartheld et al., 1996a) reflects a
process that occurs normally in this animal. The apparent lack of
anterograde transport of BDNF in the retinotectal projection suggests
specificity of this process among the neurotrophins. Anterograde
transport of NT-3 may be a common feature in laminated structures.
Granule cells of the cerebellum may produce NT-3 for cerebellar
Purkinje cells and transfer the NT-3 after anterograde transport
(Lindholm et al., 1993). Endogenous BDNF and NT-3 have effects on the
dendritic growth of pyramidal neurons in cortex slices (McAllister et
al., 1999), possibly mimicking a physiological function of
anterogradely transported neurotrophins in vivo.
The source of NT-3 in the retina
We have demonstrated previously that RGCs transport exogenous NT-3
from the retina to the optic tectum, and we have shown axodendritic
transfer of NT-3 (von Bartheld et al., 1996a). The anterograde
transport of the exogenous neurotrophin suggested that RGCs may
similarly transport endogenous NT-3. We now have shown that this is the
case. The source of the endogenous NT-3 in the retinotectal system was
controversial. Hallböök et al. (1996) reported NT-3 mRNA
expression only in the ONL and the outer half of the INL of the retina,
but not in the GCL. This localization would indicate that RGCs take up
NT-3 produced by other cells in the retina, presumably bipolar or
Müller cells, whereas the study by von Bartheld et al. (1996a)
indicated that low levels of NT-3 may be expressed in the GCL.
Our study shows that RGCs, rapidly purified to 100%, express NT-3 mRNA
and that RGCs efficiently transport endogenous NT-3 anterogradely to
the optic tectum. In addition, we conclude that a major fraction of the
anterogradely transported NT-3 is produced by the RGCs themselves
rather than taken up by RGCs from other cells in the retina.
Intraocular injections of pertussis toxin, which reduces the release of
neurotrophins (Gunther et al., 1996), did not decrease NT-3 label in
the GCL, and function-blocking NT-3 antibody that reduces the uptake
(and thus the anterograde transport) of exogenous NT-3 by RGCs did not
reduce the transport of endogenous NT-3 to the superficial layers of
the optic tectum. Such a reduction of NT-3 transport was readily
achieved with either monensin or colchicine. These substances block the
anterograde transport of NT-3, regardless whether it is produced by
RGCs or taken up from other cells. The loss of NT-3 protein in the
superficial layer of the optic tectum may be caused by the elimination
of anterograde transport as well as degeneration of retinal axons as a
result of the exposure of RGCs to the toxin.
The role of p75 in neurotrophin transport
The "low-affinity" p75 neurotrophin receptor has been
implicated in the retrograde axonal transport of neurotrophins. For NGF, the role of p75 is controversial (Taniuchi and Johnson, 1985; Johnson et al., 1987; Kiss et al., 1993; Bothwell, 1995; Curtis et al.,
1995), but not for BDNF, NT-3, and NT-4 (Curtis et al., 1995;
Ibáñez, 1996; von Bartheld et al., 1996b). Recent data on
cross-linking and immunoprecipitation of neurotrophins during anterograde axonal transport (von Bartheld, 1996) have implicated p75
as a major carrier of exogenous NT-3. In agreement with these data,
cells in the GCL express p75 receptor mRNA heavily (von Bartheld et
al., 1991), and p75 expression by RGCs can be concluded because our
study shows that p75 protein is present in the retinotectal projection.
Different p75 antibodies show different intensities of immunolabel in
the RGC cell bodies (Das et al., 1997; Herzog and von Bartheld, 1998),
but p75 protein is clearly present in the retinotectal projection
(present study). Differential retrograde and anterograde axonal
transport of neurotrophins and/or differential cell-death/survival
signaling may be regulated by p75 targeting (Carter and Lewin, 1997).
If the p75 receptor acts as a "shuttle" of neurotrophins between
the cell body and the axon terminal, it is possible that p75 delivers
NT-3 from the cell body to the axon terminals on the anterograde route
and takes BDNF back from the terminals to the cell body on the
retrograde route (Herzog et al., 1994; Herzog and von Bartheld, 1998),
possibly delivering a death signal (Frade et al., 1996). Thus, the
multifunctional p75 receptor may be used as a neurotrophin carrier in
both directions of axonal transport.
Possible functional significance of anterograde
neurotrophin transport
The first functional studies on anterograde transport of
neurotrophins have examined the survival and phenotype of target neurons (von Bartheld et al., 1996a; Altar et al., 1997), but it was
difficult to demonstrate conclusively that effects were caused by the
direct action of the anterogradely transported neurotrophic factor.
Neurotrophins have many additional roles in the developing and mature
nervous system (Snider, 1994). Some of these functions are on the
efficacy and plasticity of synapses (Lohof et al., 1993; Kang and
Schuman, 1995; Thoenen, 1995; Berninger and Poo, 1996; Snider and
Lichtman, 1996); others are on formation and branching of neurites
(Cohen-Cory and Fraser, 1995; McAllister et al., 1999). The
demonstrated functions of neurotrophins on dendritic growth in
laminated structures (McAllister et al., 1999) are of particular
interest. Many cell types have distinct lamina-specific apical and
basal dendritic geometries in the avian tectum in which 16 layers have
been distinguished (LaVail and Cowan, 1971; Hunt and Brecha, 1984). The
formation of such layer-specific domains may be regulated by
neurotrophins. The work of McAllister and her colleagues has
demonstrated that neurotrophins interact in their influences on
dendritic growth in cortex slices and can have opposing effects that
are specific for certain layers within the cortex. The release of NT-3
from axon terminals is increased by depolarization (Wang et al., 1999),
and the expression of at least some neurotrophins is regulated by
neuronal activity (Lindholm et al., 1994). Thus, neurotrophins, whether
acting as retrograde or anterograde messengers, may have substantial
influences on the activity-dependent fine tuning of circuitry in the
developing brain, and this is a current focus of our lab.
| |
FOOTNOTES |
Received Aug. 19, 1999; revised Nov. 3, 1999; accepted Nov. 5, 1999.
The work was supported by National Institutes of Health Grants HD 29177 and NS 35931. This work is dedicated to the memory of Dietrich L. Meyer
(1947-1999). Hybridoma cell lines for this study were kindly provided
by I. Bartke (Boehringer Mannheim) (NT-3 antibody) and H. Tanaka (p75
antibody M7412). Monoclonal antibodies were provided by P. Jeffrey
(anti-Thy1); polyclonal antibodies were provided by R. Rush
(anti-NT-3), K. Bailey and Y. Barde (anti-BDNF), L. Reichardt, D. Clary, and F. Lefcort (anti-trkB and -trkC), and B. Hempstead
(anti-truncated trkC); chicken NT-3 cDNA was provided by P. Maisonpierre and G. Yancopoulos (Regeneron); and human recombinant
BDNF, NT-3, and NT-4 were provided by R. Lindsay (Regeneron). We thank
Y. Kinoshita and K.-H. Herzog for help with antibody collection and
purification and M. Bothwell for logistic support in the initial
phases of this project.
Correspondence should be addressed to Dr. Christopher von Bartheld,
Department of Physiology and Cell Biology, Mailstop 352, University of
Nevada School of Medicine, Reno, NV 89557. E-mail: chrisvb{at}physio.unr.edu.
| |
REFERENCES |
-
Acheson DWK,
Kemplay SK,
Webster KE
(1984)
Quantitative analysis of optic terminal profile distribution within the pigeon optic tectum.
Neuroscience
5:1067-1084.
-
Altar CA,
DiStefano PS
(1998)
Neurotrophin trafficking by anterograde transport.
Trends Neurosci
21:433-437[ISI][Medline].
-
Altar CA,
Cai N,
Bliven T,
Juhasz M,
Conner JM,
Acheson AL,
Lindsay RM,
Wiegand SJ
(1997)
Anterograde transport of brain-derived neurotrophic factor and its role in the brain.
Nature
389:856-860
|
TOP
ABSTRACT
INTRODUCTION
