 |
 Previous Article | Next Article 
The Journal of Neuroscience, October 15, 2000, 20(20):7547-7555
Two Novel doubletime Mutants Alter Circadian
Properties and Eliminate the Delay between RNA and Protein in
Drosophila
Vipin
Suri1,
Jeffery C.
Hall2, 4, and
Michael
Rosbash2, 3, 4
Graduate Departments of 1 Biochemistry and
2 Biology, 3 Howard Hughes Medical Institute,
and 4 National Science Foundation Center for Biological
Timing, Brandeis University, Waltham, Massachusetts 02454
 |
ABSTRACT |
Phosphorylation is an important feature of pacemaker organization
in Drosophila. Genetic and biochemical evidence suggests involvement of the casein kinase I homolog doubletime
(dbt) in the Drosophila circadian
pacemaker. We have characterized two novel dbt mutants.
Both cause a lengthening of behavioral period and profoundly alter
period (per) and
timeless (tim) transcript and protein
profiles. The PER profile shows a major difference from the wild-type
program only during the morning hours, consistent with a prominent role
for DBT during the PER monomer degradation phase. The transcript
profiles are delayed, but there is little effect on the protein
accumulation profiles, resulting in the elimination of the
characteristic lag between the mRNA and protein profiles. These results
and others indicate that light and post-transcriptional regulation play
major roles in defining the temporal properties of the protein curves
and suggest that this lag is unnecessary for the feedback regulation of
per and tim protein on per
and tim transcription.
Key words:
circadian; entrainment, Drosophila; CKI ; PERIOD; phosphorylation
| |
INTRODUCTION |
The metabolic and behavioral
physiology of living systems is intimately tied to the geophysical
periodicity caused by the 24 hr rotational frequency of the earth. Most
eukaryotes and some prokaryotes have evolved extensive mechanisms to
adapt to and exploit the consequent diurnal changes in illumination and
temperature. These circadian pacemakers maintain temporal harmony
between the organism and its environment. They continue in the absence
of any external environmental cue (a zeitgeber), can be entrained to
follow imposed cycles of illumination or temperature, and can be
phase-altered by a sharp, brief change in illumination or temperature (Saunders, 1982 ). Additionally, the periods of these pacemakers are
remarkably temperature-insensitive. Extensive molecular details are now
available because of some outstanding genetics, genomics, and
biochemical investigations in Neurospora,
Drosophila, Cyanobacteria and, more recently,
mammals and zebra fish (Dunlap, 1999).
The key mechanistic feature of circadian pacemakers is the presence of
autoregulatory feedback loops (Dunlap, 1999). In general, oscillations
are generated by product feedback on synthesis reactions. For circadian
clocks, oscillatory gene expression defines periodicity, and a delay
between the synthesis and feedback steps prevents dampening of the
oscillations to a steady-state. period
(per) and timeless (tim) are
two central components of the Drosophila circadian pacemaker
(Young, 1998; Edery, 1999). Temporal expression of both genes is
manifest as rhythmic transcription, rhythmic mRNA, and rhythmic protein
accumulation (Hardin et al., 1990; Edery et al., 1994; Sehgal et al.,
1995; Marrus et al., 1996; So and Rosbash, 1997). CLOCK (CLK) and CYCLE
(CYC) form a heterodimer, which activates transcription at the
per and tim loci (Allada et al., 1998; Darlington
et al., 1998; Rutila et al., 1998a). Both per and
tim show highest rates of transcription at approximately zeitgeber time 12 (ZT12; ZT0 is defined as the time when lights come
on, and ZT12 is the time when lights go off; So and Rosbash, 1997).
Steady-state levels of per and tim mRNA show a
robust cycle, with a peak at approximately ZT15 and trough at
approximately ZT3 (Marrus et al., 1996). Temporal dynamics of
per transcript are also influenced by post-transcriptional
regulation (So and Rosbash, 1997; Suri et al., 1999). Assays of
steady-state protein levels on Western blots show a robust diurnal
cycle of accumulation and protein phosphorylation of both PER and TIM
(Edery et al., 1994; Marrus et al., 1996; Myers et al., 1996; Zeng et
al., 1996). PER protein peaks at approximately ZT20 and is least
abundant at approximately ZT8. TIM is slightly phase-advanced, with the peak and trough at approximately ZT19 and ZT7, respectively. The striking temporal phosphorylation pattern of PER (and probably TIM) is
responsible for, among other things, regulating protein half-life
(Dembinska et al., 1997; Kloss et al., 1998; Price et al., 1998).
DOUBLETIME (DBT), a casein kinase I homolog, is believed to be a PER
kinase (Kloss et al., 1998; Price et al., 1998). Although it has not
been directly shown to phosphorylate PER, DBT forms stable complexes
with PER (Kloss et al., 1998). Additionally, the absence of DBT results
in hyperaccumulation of under-phosphorylated PER in larvae, and the
dbt tissue expression pattern overlaps with that of the
per transcript (Kloss et al., 1998; Price et al., 1998). In
the lateral neurons, the likely pacemaker cells of
Drosophila, PER and TIM enter the nucleus at approximately ZT18 (Curtin et al., 1995; Lee et al., 1996). PER and TIM protein accumulation and nuclear entry correlate approximately with
downregulation of per and tim transcripts, and
this has been suggested to be caused by direct inhibition of CLK-CYC
activation by the PER-TIM dimer (Darlington et al., 1998; Lee et al.,
1999).
The molecular mechanisms and machinery involved in the generation of
circadian rhythms are remarkably similar between Drosophila and mammalian systems. The mammalian homolog of CLK is mCLK, and that
of CYC is bMAL1 (Gekakis et al., 1998). The CLK-bMAL1 complex is the
transcriptional activator in mammals (Gekakis et al., 1998). There are
three PER-like proteins: mPER1, mPER2, and mPER3 (Zylka et al., 1998a).
All three are cyclically expressed in the suprachiasmatic nucleus, the
anatomical location of the mammalian pacemaker, as well as in several
other tissues (Zylka et al., 1998a). There is also a TIM-like protein,
mTIM (Sangoram et al., 1998; Zylka et al., 1998b), and a DBT homolog,
CKI (Fish et al., 1995). Very recent genetic and biochemical
evidence indicates that CKI plays a prominent role in the mammalian
pacemaker (Keesler et al., 2000; Lowrey et al., 2000).
We report here the characterization of
Dbtg and
dbth, two novel long-period mutants
of the Drosophila dbt kinase. Both mutations strongly reduce
kinase activity, when tested in the context of a highly similar yeast
HRR25 kinase (DeMaggio et al., 1992). Analysis of PER in the mutant
flies shows defective PER degradation. Additionally, per and
tim mRNA cycles are significantly delayed in the mutants. However, PER and TIM kinetics during the accumulation phase are identical to wild-type kinetics, eliminating the usual 4-6 hr delay
between the protein and mRNA accumulation. In conditions of constant
darkness, the protein and mRNA profiles are equally delayed from those
of wild type, suggesting that light overrides the dbt
defects through some post-translational mechanism. The mutants provide
a unique opportunity to address the mechanisms underlying parametric
entrainment of Drosophila circadian rhythms.
| |
MATERIALS AND METHODS |
Isolation and identification of dbt
mutants. Both dbt mutants were isolated in the
previously described third chromosome mutagenesis screen (Rutila et
al., 1996; Allada et al., 1998; Rutila et al., 1998a). Complementation
analysis indicated that the mutation mapped to the dbt
locus. Total DNA was isolated from wild-type and
dbth mutant flies, and the entire
dbt open reading frame was amplified using
5'-CGAACTCTACCACACAGAAACC-3' [dbt1, nucleotides (nts)
24-45 in GenBank (gb) accession number AF0055583] as the forward
primer and 5'-CCGCATATATAAAGCAAGTAT-3' (dbt16, nts
1500-1520 in gb AF0055583) as the reverse primer (numbering is based
on GenBank sequence AF0055583). Both strands were sequenced using
Applied Biosystems (Foster City, CA) PRISM sequencing. Total mRNA was
isolated from Dbtg/+ flies, and the
dbt transcript was amplified using reverse transcription with dbt16 primer and PCR with dbt1 as the
forward primer and AGAGCTCTCGAGTTTGGCGTTCCCCAC (nts 1372-1386 in gb
AF0055583) as the reverse primer. The PCR product was cloned in
pBluescript (Stratagene, La Jolla, CA), and several independent clones
were sequenced.
Behavioral analysis. Flies were entrained for 3 d in 12 hr light/dark cycles; then lights were turned off for the next 4-7 d,
and the activity of individual animals was recorded in every 30 min
bin. Periods were obtained using  2 analysis (with
 = 0.05). Light/dark activity profiles were plotted as
previously described (Wheeler et al., 1993).
Western blotting and RNase protection analysis. Flies were
entrained for three 12 hr light/dark cycles and collected on dry ice at
each time point. Western blotting was performed as previously described
(Suri et al., 1999). Head extracts (10 heads per lane) were
fractionated using 6% SDS-PAGE (29.6:0.4 acrylamide/bisacrylamide) and
transferred to nitrocellulose membranes. The blots were stained with
Ponceau-S to ensure equal loading. Rabbit -PER and rat -TIM were
used to detect PER and TIM, respectively. Band intensity was calculated
using an AGFA scanner and Molecular Analyst software. RNase protection
assays were performed as previously described (Suri et al., 1999).
Total mRNA was isolated from 30 fly heads and hybridized to
32P-labeled per 2/3,
tim, and rp-49 probes, as previously described. The free probe was digested with RNASE-ONE, and the reactions were run
on a 5% sequencing gel. Band intensity was calculated using a
phosphoimager and Molecular Analyst software.
Cloning of HRR25, binding, and kinase assays. The entire
HRR25 open reading frame was amplified by PCR from yeast
genomic DNA using 5'-CTCATACATATGGACTTAAGAGTAGGAAGG-3' (nts 1-21 in gb M68605) as the forward primer and 5'-CATTCACTCGAGCAACCAAATTGACTGGCC-3' (nts 1465-1482 in gb M68605) as the reverse primer. The PCR product
was directly cloned into NdeI-XhoI sites in the
polylinker region of pET 23b (Novagen, Madison, WI) vector.
Full-length DBT was also cloned into the same sites in the
same vector. Proteins were expressed and purified according to the
manufacturer's protocol. Glutathione S-transferase
(GST)-PER 1-640 was expressed and purified as previously
described (Saez and Young, 1996). The final product was ~60% pure.
The GST-PER concentration was calculated using the Bradford assay for
total protein and estimating protein amounts by running GST-PER with
BSA standards on an SDS-PAGE gel. For binding assays, GST-PER 1-640
was bound to glutathione-agarose beads.
35S-Labeled DBT and HRR25 were in
vitro-transcribed and translated using the TnT-coupled
transcription-translation system (Promega, Madison, WI), following the
manufacturer's instructions. GST-PER-coupled beads were incubated with
increasing volumes of the translation product in a final volume of 500 µl for 4 hr. The beads were thoroughly washed, boiled in SDS-PAGE
sample buffer, and loaded on a 10% SDS-polyacrylamide gel. Kinase
assays were done exactly as previously described (Fish et al., 1995).
Briefly, GST-PER immobilized on glutathione beads was washed with
kinase buffer (in mM: 20 Tris, pH 7.5, 100 NaCl,
10 MgCl2, and 1 DTT).
His6-tagged HRR25 was purified according to the
manufacturer's instructions (Novagen). Ten microliter beads were then
incubated with 50 µl of kinase buffer containing
[ -32P]ATP for 30 min and the purified
kinase. The beads were rinsed once with kinase buffer containing 1 mM EDTA, boiled in SDS-sample loading buffer, and
run on an 8% gel. The peptide phosphorylation assays used
AHALS(P)VASLPGLKKK as substrate. The HPLC-purified peptide was
purchased from Sigma-Genosys (St. Louis, MO). Wild-type and mutant
HRR25 were expressed in Escherichia coli. Whole-cell extracts were used in the assay. The assay mixture contained 1 mM peptide, 100 µM ATP (5 µCi), 20 mM Tris, pH 7.5, 100 mM NaCl, 10 mM
MgCl2, and 1 mM DTT. One
hundred micrograms of total protein were incubated with the assay
mixture in a volume of 20 µl for 30 min. The mixture was then spotted
on P81 phosphocellulose paper. The paper was washed several times with
75 mM phosphoric acid, dried, and counted. HRR25
mutants were made by using the QuikChange site-directed
mutagenesis system and following the manufacturer's instructions. For
the R124H mutation, the forward oligonucleotide was
5'-TCGTTCATTCATCACGATATCAAACCAGAC-3' (nts 367-396 in gb M68605), and
the reverse oligonucleotide was 5'-GTCTGGTTTGATATCGTGATGAATGAACGA-3' (nts 367-396 in gb M68605). For the T44I mutation, the forward oligonucleotide was 5'-GAATCGATCAGGATCAGACATCCTCAATTG-3' (nts 6118-147
in gb M68605), and the reverse oligonucleotide was 5'-CAATTGAGGATGTCTGATCCTGATCGATTC-3' (nts 118-147 in gb M68605. For
the K38R mutation, the forward oligonucleotide was
5'-GAAGTAGCCATCAGGCTGGAATCGATCAGG-3' (nts 100-114 in gb M68605), and
the reverse oligonucleotide was
5'-CCTGATCGATTCCAGCCTGATGGCTACTTC-3' (nts 100-114 in gb
M68605).
| |
RESULTS |
Dbtg and
dbth are two
dbt alleles
While screening for third chromosome mutations affecting locomotor
activity periods, we found two lines that caused a strong lengthening
of the endogenous period. Complementation analysis indicated that the
mutations were allelic to dbt. They were named Dbtg and
dbth.
Dbtg is the stronger of the two
mutants and renders the flies behaviorally arrhythmic when combined
with a chromosomal deficiency deleting dbt or with a
dbt allele carrying a P-element insertion. It is also a
stronger dominant mutant, which lengthens the locomotor activity period
to 29 hr as a heterozygote. dbth
lengthens the locomotor activity period to 29 hr as a homozygote and to
25.1 hr as a heterozygote (Table 1).
Figure 1, A-D, shows the
light/dark (LD) activity profiles of wild-type and dbt
mutant flies. As previously reported, wild-type flies show an
anticipation of both the light-to-dark (evening) and the dark-to-light
(morning) transitions by 2-3 hr. In dbt mutant flies, there
is neither an anticipation of the morning nor an anticipation of the
evening events. dbt flies can, however, still entrain to 24 hr cycles, and the peak of evening activity is delayed by several hours
into the night. Homozygous dbth
flies in a pers background have a
period of 22 hr, intermediate between the periods of the two mutants
when assayed individually. The double mutant combination shows a normal
anticipation of the LD transition, although the evening peak is
advanced by 1-2 hr, consistent with the <24 hr period (Fig.
1D).
View larger version (33K):
[in this window]
[in a new window]
|
Figure 1.
Light-dark activity profiles for wild-type and
mutant flies. The genotype of the flies is given at the
top of each plot. Flies were kept in light/dark cycles
for 4 d. Data were pooled from 30-32 individual flies. Light/dark
activity profiles were plotted as previously described (Wheeler et al.;
1993). The shaded bars indicate times when the lights
were off, and the open bars indicate the times when the
lights were on. The data are plotted starting at 2 P.M.
(1400); lights came on at 8 P.M. and were turned off at
8 A.M. Light intensity used was ~2000 lux. All behavioral runs were
at a constant temperature of 25°C.
|
|
Sequencing of the two dbt mutants revealed amino acid
changes at conserved locations. The
dbth mutation is caused by a G C
change, causing a Thr44Ile change in
the nucleotide binding domain of DBT (Fig.
2A). This position is
occupied by a hydroxyamino acid in most casein kinase I homologs. The
Dbtg mutation alters
Arg127His in the catalytic domain of
the enzyme (Fig. 2A). This position is always
strongly basic (R/K) in the casein kinase family. In the structure of
casein kinase I , this arginine provides a contact to a regulatory
phosphate (Xu et al., 1995).
View larger version (46K):
[in this window]
[in a new window]
|
Figure 2.
dbth and
Dbtg mutations alter conserved amino
acids and strongly reduce kinase activity. A, DBT and
HRR25 sequences were aligned using CLUSTAL W algorithm of the MacVector
Package. dbth mutation alters
Thr44 to Ile (*), and
Dbtg mutation alters
Arg127 to His (#). Sequence numbering is
based on GenBank accession numbers O76324 for DBT and AAA34687 for
HRR25. Only the kinase domains are shown in the alignment. The homology
outside of the kinase domain is not significant. The darkly
shaded areas indicate identities, and the lightly shaded
areas indicate similarities. B, C,
35S-Labeled in vitro-translated HRR25
(B) or DBT (C) were
incubated with increasing concentrations of GST-PER 1-640 immobilized
on glutathione beads for 3 hr. GST-PER concentrations used were 10, 50, and 200 nM. The beads were pelleted, washed three times,
loaded on 10% SDS-PAGE, and autoradiographed. GST was used as a
negative control. D, Two different concentrations of
GST-PER 1-640, 10 and 100 nM, were immobilized on
glutathione beads and incubated with HRR25 and -32P for
30 min. The beads were pelleted, washed, loaded on 10% SDS-PAGE,
and autoradiographed. GST was used as a control.
E, Kinase activity of wild-type and mutant HRR25
proteins was determined by measuring the incorporation of
32P from [-32P]ATP into
AHALS(P)VASLPGLKKK. Kinase activity relative to that of wild-type HRR25
(set to 1) is plotted. Error bars indicate SD.
|
|
There are no reports of active DBT expressed in a heterologous system.
In addition, we made extensive efforts to express functional DBT, as
assayed by transfer of labeled phosphate to either recombinant PER or
to generic casein kinase I peptide substrates, with no success (data
not shown). However, the highly homologous HRR25 yeast casein kinase I
was easily expressed as an active kinase (DeMaggio et al., 1992). HRR25
binds to PER with affinities similar to DBT; it also efficiently
phosphorylates PER (Fig. 2B-D). We studied the
effects of altering the amino acids corresponding to those mutated in
the Dbtg and
dbth alleles on HRR25 activity. This
was assayed by following incorporation of
32P into a peptide substrate optimized for
casein kinase phosphorylation. A K38R mutant served as a negative
control. In several kinases, this mutation within the ATP binding
domain completely abolishes activity (Fish et al., 1995). Peptide
phosphorylation was reduced to ~20-30% in the mutant versions of
the enzyme, suggesting that both are strong loss-of-function mutations
(Fig. 2E).
dbt mutants strongly alter per and
tim transcript and protein accumulation profiles in
light/dark conditions
During the late day and early night, much of PER appears as a
fast-migrating species on Western blots (Fig.
3A). However, as the night
progresses, several forms of PER appear as slower-migrating species.
Phosphatase treatment converts them to faster-migrating forms,
indicating that much of the temporal mobility shift is attributable to
PER phosphorylation. A similar but less striking mobility shift is
observed for TIM (Fig. 3A; Myers et al., 1996; Zeng et al.,
1996). By comparison with this wild-type PER profile, the
dbt profiles were dramatically altered (Fig.
3A-C). In the day (~ZT1-ZT11), PER levels in the mutant
strains were significantly higher than in wild type, and PER levels
decreased several hours after the time of the PER nadir in wild-type
flies. This delayed disappearance suggests a role for
dbt-catalyzed phosphorylation in targeting PER for
degradation. This is consistent with the hyperaccumulation of
hypophosphorylated PER in larvae, which carry a P-element-inactivated
allele of dbt (Price et al., 1998). It is important to note,
however, that the highest levels of PER in the mutants are only
slightly higher than peak levels of PER in wild-type flies.
View larger version (36K):
[in this window]
[in a new window]
|
Figure 3.
PER and TIM cycling is altered in
dbt mutants under light/dark conditions. Shown are
Western blots on fly heads collected from files maintained under 12 hr
light/dark conditions with anti-PER (left panels) and
anti-TIM (right panels) antibodies. The zeitgeber time
of fly collections is mentioned at the top of each
lane. Quantitation of the TIM blot is shown at the
bottom. The blots were stained with Ponceau-S to ensure
equal loading. TIM signal was quantitated using an AGFA scanner and
Molecular Analyst software. The penciled-in lines
(left panels, lanes 1, 3, and 2 in A,
B, and C, respectively) are the molecular weight
markers corresponding to 185 KDa. The experiment was repeated three
times with similar results.
|
|
Interestingly, PER did not appear not to be underphosphorylated in the
kinase mutants, at least by the one-dimensional SDS-PAGE mobility
criterion. In fact, several slower-migrating forms that are hardly
visible in wild-type flies were readily apparent in dbt
mutant flies, suggesting that PER may even be hyperphosphorylated in
the dbt mutant flies (Fig. 3B,C). Because the
mutants probably have lower dbt enzymatic activity (see
below), dbt might make only a minor contribution to the
overall PER phosphorylation program, at least by this assay (see
Discussion). Furthermore, PER accumulation profiles during the night
(~ZT13-ZT23) were hardly affected, despite the strong effect on the
earlier disappearance phase during the day. This suggests that there is
only a weak relationship between the disappearance phase of the program
during the day and the accumulation phase during the night. This is
apparent in the mutant profiles, in which the high-mobility forms of
PER begin accumulating well before the lower-mobility forms disappear
at ZT11 and ZT13 (Fig. 3).
The effect of the dbt mutants on the TIM phosphorylation
profile was much less striking. The TIM trough was delayed relative to
that in wild-type flies (ZT9 in mutants vs ZT5 in wild-type flies). We
suggest that this modest effect is attributable to delayed template
disappearance (see below). Thereafter (ZT11-ZT19), the TIM
accumulation in the mutant flies was even faster than in wild-type
flies, so that the peak occurred at approximately the same time, namely
ZT19. In summary, both dbt mutations had strong effects on
the PER morning disappearance profile as well as the timing of the PER
and TIM nadir, but there were only minor effects on the nighttime
accumulation profiles. It is likely that the strong effects are
directly attributable to reduced DBT activity on PER metabolism.
PER and TIM have been suggested to feedback inhibit directly their own
transcription (Zeng et al., 1994; Darlington et al., 1998; Lee et al.,
1999). It is therefore likely that the mutant alterations in the
PER-TIM program affect per and tim steady-state mRNA levels. To address this possibility, we measured the steady-state per and tim mRNA levels across a circadian cycle
in wild-type and mutant flies. As previously reported, per
and tim mRNA peaked at approximately ZT13-ZT15 in wild-type
flies (Fig. 4). In both long-period
dbt mutants, the mRNA profiles were delayed by ~4-6 hr,
with the peaks at ZT19-ZT21 (Fig. 4). This delay is consistent with
the delay in the evening activity peak under these same conditions (Fig. 1). We surmise that the altered protein pattern during the day
determines the timing of the subsequent mRNA rise. The same relationship has been previously described for the
pers mutant strain (Marrus et al.,
1996). The amplitudes of per and tim oscillations
were comparable in wild-type and dbt mutant flies.
View larger version (31K):
[in this window]
[in a new window]
|
Figure 4.
PER and TIM mRNA cycling is altered in the
dbt mutants. mRNA amounts were quantitated from RNase
protection assays using rp49 as an internal control.
A, Representative RNase protection assay showing
per, tim, and rp49 bands
in heads from dbth flies collected at
different zeitgeber times. The first lane contains the
ladder, a HindIII-MspI digest of pBR322,
labeled with [32P]dCTP. The circadian time of fly
collections is at the top of each lane.
B, per mRNA levels in wild-type
(CS), dbth, and
Dbtg flies. C,
tim mRNA levels in wild-type (CS),
dbth, and
Dbtg flies. The experiment was
repeated twice with similar results.
|
|
Juxtaposition of the RNA and protein profiles, in wild-type and
dbt mutant flies, highlighted a striking difference: the
mRNA profile was advanced by 4-6 hr relative to the protein profile in
wild-type flies as previously described, whereas there was almost no
advance in both dbt mutant strains (Fig.
5A,B). This is because of the
delayed RNA profiles with little or no effect on the protein
accumulation profiles. The origins of the characteristic transcript-protein product "lag" are not very well understood, but
it is believed to contribute to the "delay" for a limit cycle oscillator and considered an important feature of Drosophila, Neurospora, and mammalian pacemakers (Garceau et al., 1997; So and
Rosbash, 1997; Hastings et al., 1999; Scheper et al., 1999). These data
indicate that robust oscillations can persist without the mRNA-protein
lag, consistent with previous observations of modest behavioral and
molecular oscillations with strongly reduced per RNA
oscillations (Ewer et al., 1988; Frisch et al., 1994; Cheng and Hardin,
1998). More importantly, the data indicate that robust transcriptional
oscillations of per and tim RNA and presumably feedback by PER and/or TIM do not require the characteristic lag between protein and RNA. It is still possible that the lag plays an
important part in period determination.
View larger version (18K):
[in this window]
[in a new window]
|
Figure 5.
The mRNA-protein lag is much reduced in
dbt mutant flies. Comparison of tim mRNA
and protein profiles for wild-type flies (A) and
dbth mutant flies
(B) is shown.
|
|
Absence of the lights-on transition delays both transcript and
protein accumulation programs in dbt mutants
We next assayed PER accumulation and phosphorylation
profiles under conditions of constant darkness (DD), i.e., when the
lights do not come on at ZT0. As previously reported, the DD PER
profile in wild-type flies was similar to the LD profile, with somewhat reduced PER levels (Fig.
6A; Marrus et al.,
1996). Importantly, in the absence of the dark-to-light transition, the
phase of neither PER nor TIM was substantially altered in wild-type
flies. On the other hand, both mutant lines showed significant
differences from LD conditions and from wild-type flies (Fig.
6B-D). There was much more TIM in the morning when
the lights did not come on, and the phase of the TIM cycle was delayed
by several hours compared with wild-type flies. The mutant PER profile
was also delayed by several hours relative to the wild-type profile;
i.e., the appearance of more rapidly migrating, newly synthesized forms of PER was delayed by several hours compared with wild-type or with
dbt mutant flies in LD conditions. When the lights failed to
come on, the dbt mutants delayed the accumulation profiles as well as the disappearance profiles of PER and TIM.
View larger version (35K):
[in this window]
[in a new window]
|
Figure 6.
PER and TIM cycling is altered in
dbt mutants under constant darkness conditions. Western
blots on fly heads collected from files kept under LD for 3 d and
then transferred to DD with anti-PER (left panels) and
anti-TIM (right panels) antibodies are shown. The
circadian time of fly collections is mentioned at the
top of each lane. Quantitation of the TIM
blot in DD versus that in LD conditions is shown. The experiment was
repeated twice with similar results.
|
|
We also assayed the mRNA profiles under these conditions. As
previously reported, the per and tim DD mRNA
profiles in wild-type flies are very similar to those in LD (Fig.
7). Also in the mutants, the mRNA
profiles were not significantly affected by the absence of the 12 hr of
illumination or the lights-on transition (Fig. 7). This is surprising
in view of the differences in the protein accumulation profiles between
DD and LD and suggests that light affects protein accumulation without
affecting the mRNA dynamics.
View larger version (29K):
[in this window]
[in a new window]
|
Figure 7.
per and tim profiles
in wild-type and dbt mutant flies under DD conditions.
A, Representative RNase protection assay showing
per, tim, and rp49 bands
in heads from dbth flies collected at
different circadian times. The first lane contains a DNA
ladder, a HindIII-MspI digest of pBR322,
labeled with [32P]dCTP. The numbers
at the top of the lanes indicate the
times at which flies were collected. The last LD cycle ends at
circadian time 24. Samples were collected every 2 hr starting at
circadian time 25. B, per mRNA levels in
wild-type (CS), dbth,
and Dbtg flies. C,
tim mRNA levels in wild-type (CS),
dbth, and
Dbtg flies. Two independent sets of
RNase protection assays were performed, both with similar
results.
|
|
| |
DISCUSSION |
Temporal phosphorylation of the clock proteins PER and TIM is
dramatic and was suggested to be a major post-translational regulatory
mechanism important for the Drosophila circadian pacemaker (Edery et al., 1994; Myers et al., 1996; Zeng et al., 1996; Edery, 1999). A major advance then came with the identification of DBT as a
pacemaker kinase (Kloss et al., 1998; Price et al., 1998). The
relationship between DBT activity and the pacemaker, however, is not
clear. It is uncertain whether the long- and short-period mutations are
a consequence of decreased and increased activity, respectively, or if
one class of mutation is caused by aberrant DBT regulation (if any).
Moreover, there is only indirect evidence that PER is a DBT substrate.
Finally, the relationship between the PER phosphorylation program and
other molecular and behavioral oscillatory phenomena is not understood.
To clarify the role of dbt-catalyzed phosphorylation in the
pacemaker, we characterized two novel dbt mutants. Both
mutations, when presented in the context of the highly similar yeast
casein kinase I HRR25, severely reduce kinase activity on peptide
substrates (Fig. 2). The long-period phenotypes are likely caused by
insufficient DBT activity, so it takes longer to reach some required
level of PER phosphorylation. We also assume that both mutants are
expressed at levels similar to that of wild-type DBT.
Both dbth and
Dbtg/+ have ~29 hr periods and are
similar in all other respects, suggesting that the phenotypes are not
idiosyncratic features of the mutations but reflect the role of DBT in
the pacemaker. Although the mutant flies entrain to imposed 24 hr
photoperiods, the LD locomotor activity patterns indicate that there is
no anticipation of the morning or evening light/dark transitions, and
the evening activity peak is delayed by several hours into the night.
The altered LD patterns are probably a consequence of the longer
periods. Indeed, flies that carry
pers as well as
dbth have a period of ~22.5 hr and
manifest robust anticipation of both morning and evening transitions as
well as an advanced evening activity peak. Both dbt mutant
LD profiles resemble that of the 29 hr period
perl mutant strain, consistent with
this altered period notion.
The molecular features of the perl
circadian program are difficult to compare with those of wild-type
flies, because the mutant rhythms are weak and of low amplitude as well
as long period even under 12 hr LD entraining conditions (Rutila et
al., 1996, 1998b; Zeng et al., 1996). In contrast, PER and TIM cycling
in the long-period dbt mutants is robust. Protein levels are
comparable with those in wild-type flies during the night, and levels
in the two mutant strains appear even higher than wild-type levels
during the daytime (Fig. 3). Because previous work suggests a role for
DBT-catalyzed phosphorylation in targeting PER for degradation, this
probably reflects slower protein turnover during the morning in the
dbt mutants. The TIM phosphorylation pattern in the mutants
did not show any noticeable difference from the wild-type pattern.
These observations suggest that the modest mutant effects on the TIM profiles are indirect, perhaps through a primary effect of the dbt mutants on PER.
PER phosphorylation was still readily observable in both mutant lines.
In fact, there was a hint that PER was even hyperphosporylated in these
strains. Although this might reflect phosphorylation events that never
take place in a wild-type background, less active DBT mutants might be
expected to depress the magnitude as well as the kinetics of the
temporal phosphorylation program. This suggests that PER might not be a
direct DBT substrate in vivo but is only influenced
indirectly, through intermediates that are direct DBT targets. For
example, DBT may phosphorylate and activate a direct PER kinase or a
specific protease. In this context, PER has not yet been shown to be a
direct DBT substrate. It is also possible that DBT is a functionally
relevant but minor PER kinase. In this case, the bulk of the PER
mobility shift on SDS-PAGE is a consequence of other kinases. Because
PER persists for several hours longer in the mutants than in wild-type
flies, the other kinases would continue to function and give rise to
even more highly phosphorylated species than are usually observed.
These would be an indirect consequence of weak dbt activity
and delayed degradation. A final possibility is that the enhanced and
delayed PER phosphorylation simply reflects some misregulation of DBT activity.
Careful analysis of the PER and TIM protein profiles in the long-period
dbt mutants suggests that DBT acts in the late night and
morning phase of the molecular cycle: the mutants leave the early
evening protein profile almost unaltered. This indicates that
dbt probably targets nuclear, monomeric PER, consistent with previous observations (Kloss et al., 1998; Price et al., 1998). It was
also suggested that DBT acts in the early night to destabilize cytoplasmic PER, thus delaying nuclear entry and repression (Kloss et
al., 1998; Price et al., 1998). The dbt mutants reported
here do not significantly change this early night, presumptive
cytoplasmic phase of accumulation. It is possible that DBT prefers free
PER over PER complexed to TIM. If free PER is a better substrate, then
DBT mutants should show a greater effect in the late night and early
morning, after a large fraction of TIM has disappeared. Alternatively,
DBT might influence only marginally the PER accumulation phase for some
other reason. But dbt mutant larvae accumulate high levels
of hypophosphorylated PER, which suggests that DBT is the major PER
kinase and strongly influences PER accumulation as well as degradation
(Fig. 8). There is evidence, however,
that much of this PER accumulation occurs in cells and tissues where PER is not normally detectable, making the connection with the normal
PER-TIM cycle uncertain.
View larger version (19K):
[in this window]
[in a new window]
|
Figure 8.
A possible model for DBT function in the
Drosophila pacemaker. Day
 1 indicates the light/dark cycle before Day
1. In the cytoplasm, destabilization of PER delays substantial
buildup of PER-TIM complexes. In the nucleus, PER destabilization
relieves repression. In DBT mutants, PER degradation is much slower.
This prolongs repression and delays the per and
tim mRNA upswing in the next cycle. Because both mutants
entrain well to an imposed 24 hr light/dark cycle, it is likely that
photic entraining signals play a major role in the protein accumulation
phase.
|
|
To assess the effect of the dbt mutants on transcription, we
assayed per and tim mRNA cycling in wild-type and
dbt mutant flies. Both mutant profiles were delayed by 4-5
hr. This is presumably because of the delayed disappearance of PER as
well as TIM, which has been suggested to repress per and
tim transcription (Zeng et al., 1994; Darlington et al.,
1998; Lee et al., 1999). This relationship is very similar to that
previously reported for the perS
mutant strain; in this case, the clock proteins disappear more quickly,
leading to an advance in the RNA profiles (Marrus et al., 1996;
Rothenfluh et al., 2000). The perS
effect is more pronounced on PER than on TIM, consistent with the
notion that monomeric PER might be the major transcriptional repressor
(Marrus et al., 1996). In any case, comparable results in the three
mutants indicate a solid relationship between the timing of the decline
in protein levels and the timing of the subsequent increase in
per and tim transcription (Fig. 8).
There is also an impressive relationship between the per and
tim RNA profiles on the one hand and the evening locomotor
activity peak on the other. In all cases, these begin to increase at
approximately the same time, i.e., around ZT7 in the middle of the
daytime. Mutants or physiological manipulations that affect the timing of the RNA profiles affect the timing of the evening activity peak in
parallel (Marrus et al., 1996; Qiu and Hardin, 1996). This fits with
the emerging view, from mammalian as well as Drosophila work, that cycling transcription plays an important role in
circadian output as well as within the central pacemaker oscillator
(Jin et al., 1999; Renn et al., 1999; Park et al., 2000; Ripperger et
al., 2000; Sarov-Blat et al., 2000). A further implication of these
relationships is that the protein oscillations from one day affect
behavior as well as the RNA profiles on the next one: the morning
decline and eventual disappearance of PER and TIM terminate a protein
cycle from the previous day, which then causes the subsequent increases
in both RNA levels and locomotor activity (Fig. 8).
In contrast, the delayed PER and TIM disappearance in the mutants had
little if any effect on the subsequent protein accumulation phase
(ZT13-ZT20) under these standard LD conditions; it was hardly affected, and both proteins peaked at approximately the same time as
they do in the wild-type flies (ZT19-ZT21). Because of the delayed RNA
rise in the mutants, the per and tim RNA
accumulation profiles almost coincide with those of the proteins,
between ZT15 and ZT21. This indicates that the timing of the RNA rise
is insufficient to time the protein rise. The increase in protein
levels may reflect protein half-life regulation, which is uncoupled
from the underlying mRNA levels, at least under some circumstances.
The coincidence of the protein and RNA curves also raises doubts about
the importance of the 4-6 hr lag between these two accumulation
profiles. The data presented here indicate that it is dispensable for
robust behavioral and molecular oscillations. This is especially
relevant for the RNA fluctuations. Despite evidence that at least
per mRNA fluctuations may not be necessary for core
oscillator function (Frisch et al., 1994; Cheng and Hardin, 1998), they
normally correlate with other molecular and behavioral circadian
fluctuations. Moreover, there are substantial data indicating that PER
and TIM feedback regulate these transcriptional oscillations (Hardin et
al., 1990; Darlington et al., 1998). There are also considerable
experimental evidence and theoretical models, suggesting that the
normal 4-6 hr lag between the RNA and protein curves is essential for
generating these robust, high-amplitude transcriptional oscillations
(Zerr et al., 1990; Marrus et al., 1996; Garceau et al., 1997; Edery,
1999; Hastings et al., 1999; Scheper et al., 1999). The general view is
that the protein accumulation delay gives enough time for transcription
to increase substantially, before protein levels have increased
sufficiently to inhibit transcription (Edery, 1999). The presence of
robust transcriptional oscillations without the delayed protein
accumulation makes this scheme less likely. It redirects focus toward
some post-transcriptional delay (e.g., the timing of nuclear entry of
the PER-TIM dimer), which we predict to be functional and important for
transcriptional feedback regulation. It is important to note that our
conclusions are based on biochemical experiments with whole-head
extracts. It is still possible that the mRNA-protein lag may be
important in the specific pacemaker neurons of Drosophila
(Kaneko, 1998).
All of these experiments were performed under LD conditions. When the
light comes on at ZT24, it causes a rapid decline in TIM levels. In DD
conditions, therefore, TIM levels were much higher in the early
subjective day as expected. But a major, unanticipated difference was
that the PER and TIM profiles in the dbt mutant flies were
profoundly delayed in DD, as evidenced by the late appearance of
faster-migrating species. This occurred without a comparable change in
the RNA profiles, giving rise to a quasi-normal lag between RNA and
protein. The light-mediated advance of the protein curves and the
absence of a comparable light reset of the RNA profile reinforce the
independent regulation of the accumulation phase of the clock
RNAs and proteins: only the RNA profiles are influenced by
the declining phase of the protein cycle of the previous day, whereas
only the protein profiles appear to be reset by the light entrainment
stimulus. The data are therefore consistent with a post-translational
route of light entrainment, perhaps mediated by some aspect of the
normal light effect on TIM. This presumably contributes to
the daily advance of the dbt mutant clock under LD
conditions, which counteracts the 5 hr period-lengthening effect that
would take place under DD conditions (Fig. 8).
Further understanding of the role of DBT in the clock will require
experiments that directly address DBT function and regulation. For
example, it is possible that temporal regulation of DBT activity makes
a major contribution to the temporal phosphorylation profile and more
generally to the normal timing of the circadian program. Additionally,
the extent to which DBT modifies other pacemaker proteins is not clear.
It is possible that these other putative DBT substrates may also be
intimately connected to the pacemaker mechanism. Addressing these
issues would provide us with a much deeper understanding of the role of
phosphorylation in the pacemaker.
| |
FOOTNOTES |
Received May 5, 2000; revised July 10, 2000; accepted July 31, 2000.
This work was supported by grants from the National Science Foundation
Center for Biological Timing and National Institutes of Health to M.R.
and J.C.H. We thank Gail Fasciani and Myai Le-Emery for help in initial
characterization of the mutants, Nadja Abovich for providing the
hrr25 construct, Li Liu for generating rat anti-TIM antibody, Leah Schraga for help in generating hrr25
mutants, and members of the Rosbash and Hall laboratories for comments
on this manuscript.
Correspondence should be addressed to Michael Rosbash, National Science
Foundation Center for Biological Timing, Brandeis University, 415 South
Street, Waltham, MA 02454. E-mail: rosbash{at}brandeis.edu.
Dr. Suri's present address: Department of Muscoskeletal Sciences,
Genetics Institute, 87 Cambridgepark Drive, Cambridge, MA 02140.
| |
REFERENCES |
-
Allada R,
White NE,
So WV,
Hall JC,
Rosbash M
(1998)
A mutant Drosophila homolog of mammalian Clock disrupts circadian rhythms and transcription of period and timeless.
Cell
93:791-804[Web of Science][Medline].
-
Cheng Y,
Hardin PE
(1998)
Drosophila photoreceptors contain an autonomous circadian oscillator that can function without period mRNA cycling.
J Neurosci
18:741-750[Abstract/Free Full Text].
-
Curtin K,
Huang ZJ,
Rosbash M
(1995)
Temporally regulated nuclear entry of the Drosophila period protein contributes to the circadian clock.
Neuron
14:365-372[Web of Science][Medline].
-
Darlington TK,
Wager-Smith K,
Ceriani MF,
Staknis D,
Gekakis N,
Steeves TDL,
Weitz CJ,
Takahashi JS,
Kay SA
(1998)
Closing the circadian loop: CLOCK-induced transcription of its own inhibitors per and tim.
Science
280:1599-1603[Abstract/Free Full Text].
-
DeMaggio AJ,
Lindberg RA,
Hunter T,
Hoekstra MF
(1992)
The budding yeast HRR25 gene product is a casein kinase I isoform.
Proc Natl Acad Sci USA
89:7008-7012[Abstract/Free Full Text].
-
Dembinska ME,
Stanewsky R,
Hall JC,
Rosbash M
(1997)
Circadian cycling of a period-lacZ fusion protein in Drosophila: evidence for an instability cycling element in PER.
J Biol Rhythms
12:157-172[Abstract/Free Full Text].
-
Dunlap JC
(1999)
Molecular bases for circadian clocks.
Cell
96:271-290[Web of Science][Medline].
-
Edery I
(1999)
Role of post-transcriptional regulation in circadian clocks: lessons from Drosophila.
Chronobiol Int
16:377-414[Web of Science][Medline].
-
Edery I,
Zwiebel LJ,
Dembinska ME,
Rosbash M
(1994)
Temporal phosphorylation of the Drosophila period protein.
Proc Natl Acad Sci USA
91:2260-2264[Abstract/Free Full Text].
-
Ewer J,
Rosbash M,
Hall JC
(1988)
An inducible promoter fused to the period gene in Drosophila conditionally rescues adult per-mutant arrhythmicity.
Nature
333:82-84[Medline].
-
Fish KJ,
Ceigelska A,
Getman ME,
Landes GM,
Virshup DM
(1995)
Isolation and characterization of human casein kinase I epsilon (CKI), a novel member of the CKI gene family.
J Biol Chem
270:14875-14883[Abstract/Free Full Text].
-
Frisch B,
Hardin PE,
Hamblen-Coyle MJ,
Rosbash M,
Hall JC
(1994)
A promoterless DNA fragment from the period locus rescues behavioral rhythmicity and mediates cyclical gene expression in a restricted subset of the Drosophila nervous system.
Neuron
12:555-570[Web of Science][Medline].
-
Garceau NY,
Liu Y,
Loros JJ,
Dunlap JC
(1997)
Alternative initiation of translation and time-specific phosphorylation yield multiple forms of the essential clock protein FREQUENCY.
Cell
89:469-476[Web of Science][Medline].
-
Gekakis N,
Staknis D,
Nguyen HB,
Davis CF,
Wilsbacher LD,
King DP,
Takahashi JS,
Weitz CJ
(1998)
Role of the CLOCK protein in the mammalian circadian mechanism.
Science
280:1564-1569[Abstract/Free Full Text].
-
Hardin PE,
Hall JC,
Rosbash M
(1990)
Feedback of the Drosophila period gene product on circadian cycling of its messenger RNA levels.
Nature
343:536-540[Medline].
-
Hastings MH,
Field MD,
Maywood ES,
Weaver DR,
Reppert SM
(1999)
Differential regulation of mPER1 and mTIM proteins in the mouse suprachiasmatic nuclei: new insights into a core clock mechanism.
J Neurosci
19:1-7[Abstract/Free Full Text].
-
Jin X,
Shearman LP,
Weaver DR,
Zylka MJ,
de Vries GJ,
Reppert SM
(1999)
A molecular mechanism regulating rhythmic output from the suprachiasmatic circadian clock.
Cell
96:57-68[Web of Science][Medline].
-
Kaneko M
(1998)
Neural substrates of Drosophila rhythms revealed by mutants and molecular manipulations.
Curr Opin Neurobiol
8:652-658[Web of Science][Medline].
-
Keesler GA,
Camacho F,
Guo Y,
Virshup DM,
Mondadori C,
Yao Z
(2000)
Phosphorylation and destabilization of human period 1 clock protein by human casein kinase Iepsilon.
NeuroReport
11:951-955[Web of Science][Medline].
-
Kloss B,
Price JL,
Saez L,
Blau J,
Rothenfluh-Hilfiker A,
Wesley CS,
Young MW
(1998)
The Drosophila clock gene double-time encodes a protein closely related to human casein kinase I.
Cell
94:97-107[Web of Science][Medline].
-
Lee C,
Parikh V,
Itsukaichi T,
Bae K,
Edery I
(1996)
Resetting the Drosophila clock by photic regulation of PER and a PER-TIM complex.
Science
271:1740-1744[Abstract].
-
Lee C,
Bae K,
Edery I
(1999)
PER and TIM inhibit the DNA binding activity of a Drosophila CLOCK-CYC/dBMAL1 heterodimer without disrupting formation of the heterodimer: a basis for circadian transcription.
Mol Cell Biol
19:5316-5325[Abstract/Free Full Text].
-
Lowrey PL,
Shimomura K,
Antoch MP,
Yamazaki S,
Zemenides PD,
Ralph MR,
Menaker M,
Takahashi JS
(2000)
Positional syntenic cloning and functional characterization of the mammalian circadian mutation tau.
Science
288:483-492[Abstract/Free Full Text].
-
Marrus SB,
Zeng H,
Rosbash M
(1996)
Effect of constant light and circadian entrainment of pers flies: evidence for light-mediated delay of the negative feedback loop in Drosophila.
EMBO J
15:6877-6886[Web of Science][Medline].
-
Myers MP,
Wager-Smith K,
Rothenfluh-Hilfiker A,
Young MW
(1996)
Light-induced degradation of TIMELESS and entrainment of the Drosophila circadian clock.
Science
271:1736-1740[Abstract].
-
Park JH,
Helfrich-Forster C,
Lee G,
Liu L,
Rosbash M,
Hall JC
(2000)
Differential regulation of circadian pacemaker output by separate clock genes in Drosophila.
Proc Natl Acad Sci USA
97:3608-3613[Abstract/Free Full Text].
-
Price JL,
Blau J,
Rothenfluh-Hilfiker A,
Abodeely M,
Kloss B,
Young MW
(1998)
double-time is a novel Drosophila clock gene that regulates PERIOD protein accumulation.
Cell
94:83-95[Web of Science][Medline].
-
Qiu J,
Hardin PE
(1996)
per mRNA cycling is locked to lights-off under photoperiodic conditions that support circadian feedback loop function.
Mol Cell Biol
16:4182-4188[Abstract].
-
Renn SCP,
Park JH,
Rosbash M,
Hall JC,
Taghert PH
(1999)
A pdf neuropeptide gene mutation and ablation of PDF neurons each cause severe abnormalities of behavioral circadian rhythms in Drosophila.
Cell
99:791-802[Web of Science][Medline].
-
Ripperger JA,
Shearman LP,
Reppert SM,
Schibler U
(2000)
CLOCK, an essential pacemaker component, controls expression of the circadian transcription factor DBP.
Genes Dev
14:679-689[Abstract/Free Full Text].
-
Rothenfluh A,
Young MW,
Saez L
(2000)
A TIMELESS-independent function for PERIOD proteins in the Drosophila clock.
Neuron
26:505-515[Web of Science][Medline].
-
Rutila JE,
Zeng H,
Le M,
Curtin KD,
Hall JC,
Rosbash M
(1996)
The timSL mutant of the Drosophila rhythm gene timeless manifests allele-specific interactions with period gene mutants.
Neuron
17:921-929[Web of Science][Medline].
-
Rutila JE,
Suri V,
Le M,
So WV,
Rosbash M,
Hall JC
(1998a)
CYCLE is a second bHLH-PAS protein essential for circadian transcription of Drosophila period and timeless.
Cell
93:805-814[Web of Science][Medline].
-
Rutila JE,
Maltseva O,
Rosbash M
(1998b)
The timSL mutant affects a restricted portion of the Drosophila melanogaster circadian cycle.
J Biol Rhythms
13:380-392[Abstract/Free Full Text].
-
Saez L,
Young MW
(1996)
Regulation of nuclear entry of the Drosophila clock proteins PERIOD and TIMELESS.
Neuron
17:911-920[Web of Science][Medline].
-
Sangoram AM,
Saez L,
Antoch MP,
Gekakis N,
Staknis D,
Whiteley A,
Fruechte EM,
Vitaterna MH,
Shimomura K,
King DP,
Young MW,
Weitz CJ,
Takahashi JS
(1998)
Mammalian circadian autoregulatory loop: a timeless ortholog and mPer1 interact and negatively regulate CLOCK-BMAL1-induced transcription.
Neuron
21:1101-1113[Web of Science][Medline].
-
Sarov-Blat L,
So WV,
Liu L,
Rosbash M
(2000)
The Drosophila takeout gene is a novel link between circadian rhythms and feeding behavior.
Cell
101:647-656[Web of Science][Medline].
-
Saunders DS
(1982)
In: Insect clocks. Oxford, UK: Pergamon.
-
Scheper TO,
Klinkenberg D,
van Pelt J,
Pennartz C
(1999)
A model of molecular circadian clocks: multiple mechanisms for phase shifting and a requirement for strong nonlinear interactions.
J Biol Rhythms
14:213-220[Abstract/Free Full Text].
-
Sehgal A,
Rothenfluh-Hilfiker A,
Hunter-Ensor M,
Chen Y,
Myers M,
Young MW
(1995)
Circadian oscillations and autoregulation of timeless RNA.
Science
270:808-810[Abstract/Free Full Text].
-
So WV,
Rosbash M
(1997)
Post-transcriptional regulation contributes to Drosophila clock gene mRNA cycling.
EMBO J
16:7146-7155[Web of Science][Medline].
-
Suri V,
Lanjuin A,
Rosbash M
(1999)
TIMELESS-dependent positive and negative autoregulation in the Drosophila circadian clock.
EMBO J
18:675-686[Web of Science][Medline].
-
Wheeler DA,
Hamblen-Coyle MJ,
Dushay MS,
Hall JC
(1993)
Behavior in light-dark cycles of Drosophila mutants that are arrhythmic, blind, or both.
J Biol Rhythms
8:67-94[Abstract/Free Full Text].
-
Xu RM,
Carmel G,
Sweet RM,
Kuret J,
Cheng X
(1995)
Crystal structure of casein kinase-1, a phosphate-directed protein kinase.
EMBO J
14:1015-1023[Web of Science][Medline].
-
Young MW
(1998)
The molecular control of circadian behavioral rhythms and their entrainment in Drosophila.
Annu Rev Biochem
67:135-152[Web of Science][Medline].
-
Zeng H,
Hardin PE,
Rosbash M
(1994)
Constitutive overexpression of the Drosophila period protein inhibits period mRNA cycling.
EMBO J
13:3590-3598[Web of Science][Medline].
-
Zeng H,
Qian Z,
Myers MP,
Rosbash M
(1996)
A light-entrainment mechanism for the Drosophila circadian clock.
Nature
380:129-135[Medline].
-
Zerr DM,
Hall JC,
Rosbash M,
Siwicki KK
(1990)
Circadian fluctuations of period protein immunoreactivity in the CNS and the visual system of Drosophila.
J Neurosci
10:2749-2762[Abstract].
-
Zylka MJ,
Shearman LP,
Weaver DR,
Reppert SM
(1998a)
Three period homologs in mammals: differential light responses in the suprachiasmatic circadian clock and oscillating transcripts outside of brain.
Neuron
20:1103-1110[Web of Science][Medline].
-
Zylka MJ,
Shearman LP,
Levine JD,
Jin X,
Weaver DR,
Reppert SM
(1998b)
Molecular analysis of mammalian timeless.
Neuron
21:1115-1122[Web of Science][Medline].
Copyright © 2000 Society for Neuroscience 0270-6474/00/20207547-09$05.00/0
This article has been cited by other articles:
|
|
|
|
 
A. Knowles, K. Koh, J.-T. Wu, C.-T. Chien, D. A. Chamovitz, and J. Blau
The COP9 Signalosome Is Required for Light-Dependent Timeless Degradation and Drosophila Clock Resetting
J. Neurosci.,
January 28, 2009;
29(4):
1152 - 1162.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J.-Y. Fan, F. Preuss, M. J. Muskus, E. S. Bjes, and J. L. Price
Drosophila and Vertebrate Casein Kinase I{delta} Exhibits Evolutionary Conservation of Circadian Function
Genetics,
January 1, 2009;
181(1):
139 - 152.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R.-A. Meissner, V. L. Kilman, J.-M. Lin, and R. Allada
TIMELESS Is an Important Mediator of CK2 Effects on Circadian Clock Function In Vivo
J. Neurosci.,
September 24, 2008;
28(39):
9732 - 9740.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. C. Chiu, J. T. Vanselow, A. Kramer, and I. Edery
The phospho-occupancy of an atypical SLIMB-binding site on PERIOD that is phosphorylated by DOUBLETIME controls the pace of the clock
Genes & Dev.,
July 1, 2008;
22(13):
1758 - 1772.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Sekine, T. Yamaguchi, K. Hamano, M. W. Young, M. Shimoda, and L. Saez
Casein kinase I{varepsilon} Does Not Rescue double-time Function in Drosophila Despite Evolutionarily Conserved Roles in the Circadian Clock
J Biol Rhythms,
February 1, 2008;
23(1):
3 - 15.
[Abstract]
[PDF]
|
|
|
|
|
|
|
M. J. Muskus, F. Preuss, J.-Y. Fan, E. S. Bjes, and J. L. Price
Drosophila DBT Lacking Protein Kinase Activity Produces Long-Period and Arrhythmic Circadian Behavioral and Molecular Rhythms
Mol. Cell. Biol.,
December 1, 2007;
27(23):
8049 - 8064.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Y. Kim, H. W. Ko, W. Yu, P. E. Hardin, and I. Edery
A DOUBLETIME Kinase Binding Domain on the Drosophila PERIOD Protein Is Essential for Its Hyperphosphorylation, Transcriptional Repression, and Circadian Clock Function
Mol. Cell. Biol.,
July 1, 2007;
27(13):
5014 - 5028.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Forger, D. Gonze, D. Virshup, and D. K. Welsh
Beyond Intuitive Modeling: Combining Biophysical Models with Innovative Experiments to Move the Circadian Clock Field Forward
J Biol Rhythms,
June 1, 2007;
22(3):
200 - 210.
[Abstract]
[PDF]
|
|
|
|
|
|
|
K. Vanselow and A. Kramer
Role of Phosphorylation in the Mammalian Circadian Clock
Cold Spring Harb Symp Quant Biol,
January 1, 2007;
72(0):
167 - 176.
[Abstract]
[PDF]
|
|
|
|
|
|
|
J. Blau, F. Blanchard, B. Collins, D. Dahdal, A. Knowles, D. Mizrak, and M. Ruben
What Is There Left to Learn about the Drosophila Clock?
Cold Spring Harb Symp Quant Biol,
January 1, 2007;
72(0):
243 - 250.
[Abstract]
[PDF]
|
|
|
|
|
|
|
D. M. Virshup, E. J. Eide, D. B. Forger, M. Gallego, and E. V. Harnish
Reversible Protein Phosphorylation Regulates Circadian Rhythms
Cold Spring Harb Symp Quant Biol,
January 1, 2007;
72(0):
413 - 420.
[Abstract]
[PDF]
|
|
|
|
|
|
|
L. T. D. Trang, H. Sehadova, N. Ichihara, S. Iwai, K. Mita, and M. Takeda
Casein Kinases I of the Silkworm, Bombyx mori: Their Possible Roles in Circadian Timing and Developmental Determination
J Biol Rhythms,
October 1, 2006;
21(5):
335 - 349.
[Abstract]
[PDF]
|
|
|
|
|
|
|
J.-M. Lin, A. Schroeder, and R. Allada
In Vivo Circadian Function of Casein Kinase 2 Phosphorylation Sites in Drosophila PERIOD
J. Neurosci.,
November 30, 2005;
25(48):
11175 - 11183.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. A. Cyran, G. Yiannoulos, A. M. Buchsbaum, L. Saez, M. W. Young, and J. Blau
The Double-Time Protein Kinase Regulates the Subcellular Localization of the Drosophila Clock Protein Period
J. Neurosci.,
June 1, 2005;
25(22):
5430 - 5437.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Preuss, J.-Y. Fan, M. Kalive, S. Bao, E. Schuenemann, E. S. Bjes, and J. L. Price
Drosophila doubletime Mutations Which either Shorten or Lengthen the Period of Circadian Rhythms Decrease the Protein Kinase Activity of Casein Kinase I
Mol. Cell. Biol.,
January 15, 2004;
24(2):
886 - 898.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. C. Comolli, T. Fagan, and J. W. Hastings
A Type-1 Phosphoprotein Phosphatase from a Dinoflagellate as a Possible Component of the Circadian Mechanism
J Biol Rhythms,
October 1, 2003;
18(5):
367 - 376.
[Abstract]
[PDF]
|
|
|
|
|
|
|
T. Roenneberg, S. Daan, and M. Merrow
The Art of Entrainment
J Biol Rhythms,
June 1, 2003;
18(3):
183 - 194.
[Abstract]
[PDF]
|
|
|
|
|
|
|
E. J. Eide, E. L. Vielhaber, W. A. Hinz, and D. M. Virshup
The Circadian Regulatory Proteins BMAL1 and Cryptochromes Are Substrates of Casein Kinase Iepsilon
J. Biol. Chem.,
May 3, 2002;
277(19):
17248 - 17254.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Yang, P. Cheng, and Y. Liu
Regulation of the Neurospora circadian clock by casein kinase II
Genes & Dev.,
April 15, 2002;
16(8):
994 - 1006.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Stempfl, M. Vogel, G. Szabo, C. Wulbeck, J. Liu, J. C. Hall, and R. Stanewsky
Identification of Circadian-Clock-Regulated Enhancers and Genes of Drosophila melanogaster by Transposon Mobilization and Luciferase Reporting of Cyclical Gene Expression
Genetics,
February 1, 2002;
160(2):
571 - 593.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Baler
Clockless Yeast and the Gears of the Clock: How Do They Mesh?
J Biol Rhythms,
December 1, 2001;
16(6):
516 - 522.
[Abstract]
[PDF]
|
|
|
|
|
|
|
S. Bao, J. Rihel, E. Bjes, J.-Y. Fan, and J. L. Price
The Drosophila double-timeS Mutation Delays the Nuclear Accumulation of period Protein and Affects the Feedback Regulation of period mRNA
J. Neurosci.,
September 15, 2001;
21(18):
7117 - 7126.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION
