 |
Previous Article | Next Article 
The Journal of Neuroscience, October 15, 2000, 20(20):7682-7690
Differential Expression of COUP-TFI, CHL1, and Two
Novel Genes in Developing Neocortex Identified by Differential Display
PCR
Qing
Liu*,
Noelle D.
Dwyer*, and
Dennis D. M.
O'Leary
Molecular Neurobiology Laboratory, The Salk Institute, La
Jolla, California 92037
 |
ABSTRACT |
Genes that control the specification and differentiation of the
functionally specialized areas of the mammalian neocortex are likely
expressed across the developing neocortex in graded or restricted
patterns. To search for such genes we have performed a PCR-based
differential display screen using RNAs from rostral neocortex, which
included the primary motor area, and caudal neocortex, which included
the primary visual area, of embryonic day 16 rats. We identified
82 differentially expressed gene fragments. Secondary screening by
in situ hybridization confirmed that five fragments, representing four genes, are differentially expressed across developing rat neocortex. Two of the genes, chick ovalbumin upstream
transcription factor I (COUP-TFI) and
close homolog of L1 (CHL1), have been cloned previously, but their differential expression in cortex has not
been reported. Sequences from the other two fragments suggest that they
represent novel genes. The expression patterns include graded,
restricted, and discontinuous expression with abrupt borders that might
correlate with those of areas. The differential expression patterns of
all four genes are established before the arrival of thalamocortical
afferents, suggesting that they are independent of thalamic influence,
and could direct or reflect arealization. In addition,
COUP-TFI and CHL1 exhibit dynamic
expression patterns that undergo substantial changes after
thalamocortical afferents invade the cortical plate, suggesting that
thalamic axons may influence their later expression. Postnatally,
COUP-TFI is most prominently expressed in layer 4, in
both rats and mice, and CHL1 is expressed in layer 5. COUP-TFI expression in cortex, and in ventral
telencephalon and dorsal thalamus, suggests several possible causes for
the loss of layer 4 neurons and the reduced thalamocortical projection
reported in COUP-TFI knock-out mice.
Key words:
CHL1; cortical areas; cortical development; cortical specification; COUP-TFI; dorsal thalamus; layer 4; layer 5
 |
INTRODUCTION |
The cerebral cortex is divided into
several major regions, each composed of distinct areas. The most
prominent region, the neocortex, is divided into numerous areas that
share a basic organization but nonetheless are characterized by their
unique architecture, connections, and function. An important issue is
to define the mechanisms that control the specification of areas and
their differentiation from the cortical plate. Recent evidence suggests
that differential gene expression across the embryonic neocortex has a
primary role in regulating arealization (Bishop et al., 2000 ) and is
established by mechanisms intrinsic to it (Miyashita-Lin et al., 1999 ;
Nakagawa et al., 1999 ). Extrinsic influences on arealization, most
notable being thalamocortical afferents (TCAs), the principal input to neocortex, likely operate within the context of this molecular framework to promote the later differentiation of certain areal specializations (Rakic, 1988 ; O'Leary, 1989 ; Chenn et al., 1997 ; Gitton et al., 1999b ).
Genes reported to be differentially expressed across the embryonic
neocortex include several transcription factor genes: the homeobox
genes Emx1 and Emx2 (Gulisano et al., 1996 ;
Mallamaci et al., 1998 ), the paired-box gene Pax6 (Walther
and Gruss, 1991 ; Stoykova and Gruss, 1994 ), the LIM-homeodomain
gene Lhx2 (Porter et al., 1997 ; Nakagawa et al., 1999 ),
retinoid Z receptor (RZR ), a nuclear
melatonin receptor (Becker-Andre et al., 1994 ; Park et al., 1997 ;
Schaeren-Wiemers et al., 1997 ), Tbr1, a T-box gene, and
Id2, a helix-loop-helix gene (Bulfone et al., 1995 ;
Rubenstein et al., 1999 ). Other differentially expressed molecules
include the NGF receptor p75 (Mackarehtschian et al., 1999 ), some EphA receptors and ephrin-A ligands (Donoghue and Rakic, 1999a ;
Mackarehtschian et al., 1999 ), and the cadherins 6, 8, and 11 (Suzuki
et al., 1997 ; Inoue et al., 1998 ; Nakagawa et al., 1999 ).
To identify other differentially expressed genes that might be involved
in regulating arealization, we used differential display PCR (ddPCR)
that used total RNAs from the rostral and caudal neocortex of embryonic
day 16 (E16) rats; rostral pieces were from frontal cortex and included
the primary motor area, and caudal pieces were from occipital cortex
and included the primary visual area. We chose E16 as a compromise in
the timing of key developmental phenomena. This age is approximately
midway through cortical neurogenesis; marginal zone and subplate
neurons, as well as most neurons that will form layers 6, 5, and 4, have been generated (Bayer and Altman, 1991 ). In addition, TCAs are
just beginning to reach the cortex and have not yet invaded the
cortical plate (Catalano et al., 1991 , 1996 ; De Carlos et al., 1995 ).
Therefore, differential gene expression at this age would be
established independent of TCAs and likely intrinsic to the neocortex
and could have a role in the development of area-specific TCA projections.
We have identified four genes differentially expressed across the
developing neocortex in a manner consistent with their possible involvement in arealization. In addition, they exhibit layer-specific expression consistent with a role in defining unique properties of
subsets of cortical neurons. Two of these genes have been cloned previously: the orphan nuclear receptor chick ovalbumin upstream transcription factor I (COUP-TFI) (Jonk et al.,
1994 ; Qiu et al., 1994 ) and the cell adhesion molecule close
homolog of L1 (CHL1) (Holm et al., 1996 ). However,
their differential expression in the cortex has not been described. The
other two gene fragments appear to represent novel genes.
 |
MATERIALS AND METHODS |
Animals. Animals used for this study were obtained
from timed pregnant Sprague Dawley rats and ICR mice from Harlan
Sprague Dawley (Indianapolis, IN). The day of vaginal plug detection is designated E0, and the day of birth is postnatal day 0 (P0).
ddPCR. Pregnant mothers were anesthetized with an overdose
of Nembutal (100 mg/kg of body weight). E16.5 rats were used to prepare
total RNA. The brains were dissected out from E16.5 rats, and the
meninges were removed from the brain surface. Two 500 × 500 µm
pieces of cortex (from the surface of the marginal zone to the
ventricle) were dissected out from the caudal (occipital) and rostral
(frontal) portions of the neocortex (see Fig.
1A). These tissues were washed in L15 media and then
put directly into lysis buffer (Qiagen RNeasy kit) for total RNA extraction.
For both the rostral and caudal dissections, three separate RNA samples
were prepared from two different litters to reduce false positives.
Five embryos were used for each RNA preparation, yielding ~6-7 µg
of RNA. The RNA samples were digested with DNase I to remove genomic
DNA. The RNA (250 ng) was reverse transcribed with SUPERSCRIPT
Preamplification System for First Strand cDNA Synthesis (Life
Technologies; 18089-011), priming with downstream primers (Operon
Technology). The detailed protocol for reverse transcription and PCR
analysis was performed as described by M. Gesemann, E. D. Litwack, and
D. D. M. O'Leary (unpublished observations). Each sample of
caudal and rostral DNA was amplified with 400 combinations of arbitrary
upstream and downstream primers (Operon Technology) by PCR. The PCR
products were separated on a 6% denaturing polyacrylamide gel. The
differences in the intensity of the bands were recognized by visual
inspection. More than 10,000 DNA fragments were analyzed.
In situ hybridization. The DNA fragments obtained from
the differential display were used as templates for making riboprobes. These DNA fragments were subcloned into pBluescript. The linear templates used for in vitro transcription were generated
either by restriction digest of the plasmids or by amplifying the
fragments using a primer containing the T7 RNA polymerase promoter
sequence AAAAATGTAATACGACTCACTATAGGGCCCACCGCGGTGGCGGCCGCTCTAGA. All
templates were gel-purified before being included in the in
vitro transcription reaction in the presence of
[35S]-UTP.
The protocol for in situ hybridization was modified from
that described by Goulding et al. (1993) . Embryos were either immersion fixed or perfused transcardially with 4% paraformaldehyde. Either whole embryos or brains were cryoprotected in 30% sucrose and sectioned at 20 µm on a cryostat. Brains from a minimum of two animals were used per gene for each age analyzed. Sections were secondarily fixed in 4% paraformaldehyde and then pretreated with acetic anhydride and dehydrated in a series of ethanol baths. Hybridization was done overnight at 55°C. After hybridization, the
sections were treated with ribonuclease A (20 µg/ml) at 37°C for 30 min and then washed at high stringency in 0.2× SSC at 55°C for 30 min and 0.1× SSC at 55°C for 30 min. Sections were dipped in Kodak
NTB2 nuclear track emulsion and stored for 2 d to 2 weeks in the
dark at 4°C. The sections were developed with Kodak D-19, fixed with
Kodak fixer, and counterstained with 4',6-diamidino-2-phenylindole (DAPI) or thionin. The sections were again dehydrated in a series of
alcohols and xylenes, air-dried, and coverslipped with DPX mountant. Sections were photographed under dark-field or UV
fluorescence on a Nikon Microphot microscope. For each montage, all
adjustments to contrast and brightness were equally applied. None of
the sense control probes generated signals above background level (data not shown).
 |
RESULTS |
Identification of genes differentially expressed across the
developing neocortex by the use of ddPCR
ddPCR was used to search for differences in gene expression
between rostral and caudal parts of the developing neocortex. For each
experiment, three independent preparations of total RNA were generated
from 500 µm2 pieces of rostral (i.e.,
frontal cortex, which included the primary motor area) and caudal
(i.e., occipital cortex, which included the primary visual area)
neocortex dissected from E16 rats (Fig. 1A) and used to make
first-strand cDNA using arbitrary primers. We used 400 different primer
sets and screened >10,000 gene fragments, 148 of which are
differentially amplified in at least two of the three independent RNA
preparations used. Figure 1B shows two examples of
differentially expressed gene fragments: 31v1 exhibits greater amplification from caudal neocortex RNA in two of the three RNA preparations, whereas 36m1 is preferentially amplified from rostral neocortex RNA in all three of the RNA preparations. We were able to
reamplify 90 of the 148 differentially amplified gene fragments. Sequence analysis reveals that they represent 82 different gene fragments. Of these, 37 are preferentially amplified from caudal neocortex, and 45 are from rostral neocortex RNA. Table
1 summarizes the general categories of
the identified genes based on their sequences.

View larger version (61K):
[in this window]
[in a new window]
|
Figure 1.
Identification of genes differentially expressed
in developing neocortex by the use of ddPCR. A, The
dorsal view of an E16 rat brain shows the location of the rostral and
caudal pieces of neocortex dissected out for total RNA extraction.
Scale bar, 500 µm. B, Examples of ddPCR gels are
shown. PCR products amplified from three independent pools of total RNA
from rostral and caudal neocortex were separated on a denaturing
polyacrylamide gel. Left, 31v1 message is preferentially
amplified in two of the three RNA sample preparations from caudal
cortex (band marked by an asterisk). This
gene fragment was later identified as rat COUP-TFI.
Right, 36m1 was preferentially amplified from three
samples of RNA from rostral cortex (band marked by an
asterisk) but not caudal cortex. The identity of 36m1 is
unknown. C, Caudal; R, rostral.
|
|
To confirm the differential expression of the amplified fragments and
to determine their cortical expression patterns, in situ
hybridization was performed on E16 rat brain sections using the
amplified gene fragments as templates to generate antisense riboprobes.
In situ hybridization was successful for 40 of the gene
fragments, of which 5 exhibited strong differential expression along
the rostral-caudal axis of the neocortex. Three of these gene
fragments represent previously identified genes. Fragments 31v1 and 7v2
are identical to the rat orphan nuclear receptor COUP-TFI,
originally cloned in mouse (Jonk et al., 1994 ; Qiu et al.,
1994 ). The 31v1 sequence encodes amino acids Gly87 to Gly184, and 7v2
contains 190 nucleotides of sequence identical to part of the
3'-untranslated region of COUP-TFI. The other fragment, 1v1,
is 91% identical and 97% similar to the mouse CHL1
from amino acids 581 (Y) to 637 (Y). CHL1 is a member
of the L1 family of neural cell adhesion molecules (Holm et al., 1996 ).
The sequences of the remaining two gene fragments do not match any
known genes in the database and thus could represent novel genes.
Fragment 2m3 contains 200 bp and is 88% identical to human
EST AA 771960 at the nucleotide level. Fragment 36m1 has 180 bp
and is 100% identical to rat EST AI 145639.
Below we present detailed in situ hybridization analyses of
COUP-TFI and CHL1 in rat neocortex from E12, when
neurogenesis begins, to P7, ~10 d after it ceases and areas and
layers are readily defined (Bayer and Altman, 1991 ). We also describe
the differential expression of the two novel genes in E16 rat cortex and COUP-TFI in postnatal mouse neocortex.
Graded and layer-specific expression of COUP-TFI in
developing neocortex
COUP-TFI was reported previously to be expressed in
embryonic mice in the optic stalk, the dorsocaudal part of the
telencephalon, the diencephalon, the midbrain, and the hindbrain (Jonk
et al., 1994 ; Qiu et al., 1994 ). Our expression analyses in rats and
mice extend these findings.
In E12 rat, we find that COUP-TFI is expressed in the dorsal
telencephalon with highest expression in the neuroepithelium that will
give rise to cortical structures caudal to the neocortex. The level of
expression exhibits a graded caudal-to-rostral decline from the
presumptive hippocampus through caudal neocortex (Fig. 2A). No expression is
detected in rostral neocortex. A strong caudal-to-rostral graded
expression in the neocortical neuroepithelium persists throughout the
period of neurogenesis (Fig. 2B-D). At E14,
COUP-TFI expression is highest in the hippocampal anlage and
caudal neocortex. The expression in caudal neocortex is present in both
the ventricular zone and preplate (Fig.
3A,A'). However, in rostral
neocortex, expression above background levels cannot be detected. The
expression at E16 is higher than that at E14 but maintains a similar
strong high-caudal-to-low-rostral graded pattern (Fig. 2C),
which begins in cortical regions caudal to the neocortex and
progressively declines across the neocortex. Expression is highest in
the ventricular zone and lower in the intermediate zone and cortical
plate (Fig. 3B,B'). Expression declines abruptly in the
putative somatosensory area (Fig. 2C, arrow). There is also
strong expression in the medial ganglionic eminence (Fig.
2C). Because this differential expression of
COUP-TFI is evident before the arrival of TCAs, it is likely
to be independent of thalamic influences and established by mechanisms
intrinsic to the telencephalon.

View larger version (82K):
[in this window]
[in a new window]
|
Figure 2.
Differential expression of COUP-TFI
across the rostral-caudal axis of developing neocortex. In
situ hybridizations using S35-labeled
riboprobes on sagittal sections of rat (A-F) or
mouse (G) forebrain are shown. A,
At E12, COUP-TFI is expressed in a graded manner in the
dorsal telencephalon, with higher levels in the future
hippocampus decreasing to lower levels in the ventricular zone
of the future neocortex. B, A similar gradient of
COUP-TFI expression is seen at E14, in the ventricular
zone and preplate. C, At E16, COUP-TFI
expression is still strongly graded, with expression highest in the
ventricular zone. The high expression appears to drop abruptly in the
presumptive, future somatosensory area (arrow).
D, The high-caudal-to-low-rostral gradient is apparent
in all layers at E19, with the strongest expression in the ventricular
zone. E, At P0, the ventricular zone has thinned, and
COUP-TFI expression is seen in the cortical plate and
subplate. Expression is still highest caudally and in developing layer
4. F, COUP-TFI expression at P7 is still
highest caudally in all layers of the cortical plate. Layer 4 shows the
strongest expression, which declines abruptly at the presumptive
rostral border of visual cortex and exhibits another sharp decrease at
the presumptive rostral border of somatosensory cortex.
G, A sagittal section of P8 mouse brain shows a
COUP-TFI expression pattern similar to that seen in P7
rat. The highest expression is in layers 4 and 6 of the cortical plate;
the two layers exhibit strong, but differing, caudal-to-rostral
gradients of expression. A-D are simultaneous exposures
using both dark field to show silver grains and UV illumination to show
DAPI staining; E-G are only dark-field exposures.
Rostral is to the left, and dorsal is up.
cp, Cortical plate; hi, hippocampus;
lge, lateral ganglionic eminence; mge,
medial ganglionic eminence; pp, preplate;
sp, subplate; vd, ventral
diencephalon; vz, ventricular zone. Arabic
numerals indicate differentiated layers of the cortical plate.
Scale bars, 500 µm.
|
|

View larger version (59K):
[in this window]
[in a new window]
|
Figure 3.
COUP-TFI and CHL1
are expressed in layer-specific patterns in developing neocortex.
In situ hybridizations using
S35-labeled riboprobes on sagittal sections of rat
forebrain are shown. The left panel in each
pair shows a dark-field image of the silver grains indicating
gene expression. The right panel in each
pair shows the identical field imaged either with a UV
fluorescence for DAPI nuclear staining (A', B', F', G')
or with bright-field illumination for thionin Nissl staining
(C'-E', H'-J'). Ages are indicated at the
top. A, A'-E, E',
COUP-TFI shows early expression in the ventricular zone
of caudal cortex at E14 (A, A') and E16 (B,
B'). At E19 (C, C') and P0 (D,
D'), expression is seen in the cortical plate and subplate as
well as the ventricular zone and subventricular zone. At P7 (E,
E'), when all cortical layers have formed,
COUP-TFI expression is highest in layer 4 but is also
significant in all layers of the cortical plate and the subplate.
F, F'-J, J', In contrast to COUP-TFI,
CHL1 shows early expression only in the preplate at E14
(F, F') and later in the intermediate zone and the
cortical plate at E16 (G, G'). At E19 (H,
H'), it is expressed strongly in the cortical plate and
subplate and weakly in the subventricular zone and the intermediate
zone. At P0 (I, I') and P7 (J, J'),
expression of CHL1 is still strong throughout the
cortical plate but is highest in layer 5. All photos were taken at a
rostral-caudal location in the cortex that lies approximately above
the hippocampus or just anterior to it. cp, Cortical
plate; iz, intermediate zone; mz,
marginal zone; pp, preplate; sp,
subplate; svz, subventricular zone; vz,
ventricular zone. Arabic numerals indicate
differentiated layers of the cortical plate. Scale bars, 200 µm.
|
|
Analysis of later ages shows that COUP-TFI expression
remains graded throughout cortical development and in addition exhibits layer specificity. At E19, near the end of cortical neurogenesis and
when TCAs are beginning to invade the cortical plate,
COUP-TFI expression remains strongly graded with the highest
levels caudally (Fig. 2D). At this time,
COUP-TFI is expressed in the ventricular, subventricular,
and lower intermediate zones, as well as in the subplate, cortical
plate, and marginal zone (Fig. 3C,C'). At P0, COUP-TFI is expressed throughout the radial extent of the
neocortex and in a high-caudal-to-low-rostral gradient in all layers
except in the diminished ventricular zone (Fig. 2E).
Expression in the cortical plate shows laminar differences, being
highest in the nascent layer 4 and lowest in layer 5 (Figs.
2E, 3D,D'). Similarly, at P7, when
all cortical layers have formed, COUP-TFI is expressed in
the subplate and all cortical plate layers, and expression remains
highest in layer 4 and lowest in layer 5 (Fig. 2F,
3E,E'). Expression is still graded with the exception
of layer 4, which exhibits a discontinuous differential pattern of
expression. In layer 4, expression is highest caudally, in the
presumptive primary visual area, moderate in presumptive somatosensory
cortex, and low in a domain between the two as well as more rostrally,
in the presumptive primary motor area. Expression declines
precipitously at what appears to be the rostral border of the primary
somatosensory area (Fig. 2F).
Qiu et al. (1994) reported that COUP-TFI expression is
strong in mouse neocortex at E14.5 (a stage similar to E16 rat) but is
not detected at E18.5 (a stage similar to E20 rat). Because this report
sharply contrasts with our finding of persistent COUP-TFI expression in postnatal rats and because mice deficient for
COUP-TFI exhibit an excessive, postnatal loss of layer 4 neurons (Zhou et al., 1999 ), we examined COUP-TFI expression
in the neocortex of postnatal mice. Indeed, in situ
hybridization using the 31v1 probe for COUP-TFI reveals an
expression pattern in postnatal mice similar to that in rats, including
strong expression in layer 4 in P8 mice (Fig. 2G), as well
as in P2 mice (data not shown). This result suggests a cell-autonomous
mechanism for the death of layer 4 neurons in the COUP-TFI mutant.
To determine whether COUP-TFI expression is graded along the
medial-lateral axis of embryonic and postnatal rat neocortex, we
performed in situ hybridizations on coronal sections. At all ages examined, COUP-TFI is differentially expressed along
the medial-lateral axis with a high-lateral-to-low-medial gradient at
both rostral and caudal levels (Fig. 4).
COUP-TFI is also expressed in the lateral cortical stream
(Fig. 4A,D,F), a population of migrating cells
that originate from the lateral part of the cortical ventricular zone
and have been proposed to populate the ventrolateral cortical plate
(Bayer and Altman, 1991 ) or, alternatively, the claustrum and
laterobasal amygdala (Puelles et al., 1999 ). Interestingly, COUP-TFI is also expressed in premigratory and migrating
neural crest (Qiu et al., 1997 ). At E19, when TCAs are invading the
cortical plate, COUP-TFI expression is highest in the
superficial part of the lateral cortical plate (Fig.
4D,E). At P0, COUP-TFI expression is still
present in the lateral cortical stream, as well as graded in the
cortical plate (Fig. 4F,G). By P7, the lateral
cortical stream is no longer present. Within layers 2/3, 5, and 6, COUP-TFI still exhibits a high-lateral-to-low-medial graded
expression; expression in layer 4 appears uniform in the lateral
gustatory and somatosensory areas but declines abruptly in more medial
frontal cortex (Fig. 4H,I).

View larger version (100K):
[in this window]
[in a new window]
|
Figure 4.
COUP-TFI is expressed in a
high-lateral-to-low-medial gradient in developing neocortex, as well as
throughout the dorsal thalamus. In situ hybridizations
using S35-labeled riboprobes on coronal sections of
rat forebrain are shown. A-C, A series of coronal
sections of E16 rat brains taken at rostral, mid, and caudal levels
along the rostral-caudal axis of the neocortex is shown. At each
level, COUP-TFI exhibits a high-lateral-to-low-medial
graded expression within the neocortex. A,
Rostrally, graded COUP-TFI expression is evident
in the cortical ventricular zone. In addition, COUP-TFI
expression is apparent in the lateral cortical stream.
B, A mid-level section shows strong
COUP-TFI expression in the dorsal thalamus and graded
expression in the cortical ventricular zone. COUP-TFI
expression is also high in the medial ganglionic eminence and within
the ventral telencephalon closely associated with the internal capsule,
the pathway of TCAs. C, A more caudal section shows very
strong expression in the cortical ventricular zone and in the dorsal
thalamus, as well as in the thin cortical plate laterally. D,
E, By E19, COUP-TFI expression is seen in the
subplate and cortical plate in addition to the ventricular zone,
lateral cortical stream, and dorsal thalamus. At both rostral
(D) and caudal levels (E),
the high-lateral-to-low-medial gradient is apparent. F,
G, At P0, future layers 4 and 6 exhibit high expression of
COUP-TFI laterally within the neocortex, and the dorsal
thalamus and lateral cortical stream continue to express
COUP-TFI. H, I, By P7, all cortical
layers have formed. Although expression in the dorsal thalamus has
declined, cortical expression of COUP-TFI remains
robust. Layers 2/3 and 6 exhibit high-lateral-to-low-medial graded
expression of COUP-TFI. However, layer 4 shows
relatively even expression from the parietal cortex to the rhinal
fissure. Images in A-C are simultaneous
exposures of dark-field illumination to show silver grains and UV
illumination to show DAPI staining; D-I are dark-field
images. Dorsal is up, and lateral is to the
right. c, Caudal level;
cp, cortical plate; dth, dorsal thalamus;
ic, internal capsule; lcs, lateral
cortical stream; lge, lateral ganglionic eminence;
m, mid level; mge, medial ganglionic
eminence; r, rostral level; sp, subplate;
str, striatum; vz, ventricular zone.
Arabic numerals indicate differentiated layers of the
cortical plate. Scale bars: A-C, 500 µm;
D-I, 1 mm.
|
|
Because the majority of TCAs fail to reach the cortex in
COUP-TFI-mutant mice (Zhou et al., 1999 ), we examined
COUP-TFI expression relative to the internal capsule, the
path of TCAs through the ventral telencephalon, and in the dorsal
thalamus, the origin of the TCA projection. At E16, when many TCAs are
extending through the internal capsule, COUP-TFI is highly
expressed in the medial ganglionic eminence at the level of the
internal capsule, as well as in ventral telencephalic cells positioned
close to and within the internal capsule (Fig. 4B).
COUP-TFI is also highly expressed in the dorsal thalamus at
E16 (Fig. 4C), E19 (Fig. 4E), and P0 (Fig.
4G), ages that cover much of the period during which TCAs extend from the dorsal thalamus to the neocortex and invade the cortical plate. COUP-TFI expression in the dorsal thalamus
declines substantially by P7 (Fig. 4I). These
findings suggest that COUP-TFI may regulate TCA development
by influencing the differentiation of ventral telencephalic cell groups
that direct TCA pathfinding (see Tuttle et al., 1999 ; Braisted
et al., 2000 ) and of the dorsal thalamic nuclei that give rise to TCAs.
Graded and layer-specific expression of CHL1 in
developing neocortex
Previous reports of CHL1 expression are limited (Holm
et al., 1996 ; Hillenbrand et al., 1999 ). Northern blot analysis of
CHL1 expression shows that it is first expressed at E12 in
mouse. Immunohistochemical analysis shows that CHL1 protein is present
in subpopulations of neurons, astrocytes, oligodendrocyte precursors,
and Schwann cells in mouse and rat. The brief description of
CHL1 expression in neocortex mentions that it is
preferentially expressed in layer 5 in postnatal mouse (Hillenbrand et
al., 1999 ).
To better define possible roles for CHL1 in cortical
development, we analyzed its expression in E12 to P7 rat forebrain by the use of in situ hybridization. At E12, CHL1 is
expressed in postmitotic neurons of the presumptive hippocampus,
septum, and ventral diencephalon. CHL1 is not expressed,
however, in E12 neocortex (Fig.
5A). At E14, CHL1
expression extends from the hippocampus into caudal neocortex and is
only present in the outermost layer of cells including the preplate
(Figs. 3F,F', 5B). CHL1 expression is
graded, being higher in caudal preplate. At E16, CHL1 is
expressed in the intermediate zone and at lower levels in the cortical
plate of neocortex (Fig. 3G,G'). Interestingly,
CHL1 expression shows an abrupt decline in the rostral
intermediate zone; this abrupt change in expression is not evident in
the marginal zone and cortical plate (Fig. 5C). This
differential expression of CHL1 before the arrival of TCAs
indicates that it is established independent of their potential
influences.

View larger version (77K):
[in this window]
[in a new window]
|
Figure 5.
Differential expression of CHL1
across the rostral-caudal axis of developing neocortex. In
situ hybridizations using S35-labeled
riboprobes on sagittal sections of rat forebrain are shown.
A, At E12, rat CHL1 is not expressed in
the developing neocortex but is present in the hippocampal primordium,
the septum, and the ventral diencephalon. B, At E14,
within the neocortex, CHL1 is expressed only in the
caudal part of the preplate. C, By E16,
CHL1 is expressed relatively uniformly rostrocaudally
across the cortical plate but exhibits a high-caudal-to-low-rostral
graded expression within the intermediate zone that shows a substantial
decline rostrally. D, At E19,
CHL1 is expressed relatively uniformly rostrocaudally
across the cortical plate and subplate; low levels of expression are
detected in the intermediate zone and subventricular zone, which is
weakly graded with subtly higher levels caudally. E, At
P0, CHL1 is expressed in all layers of the cortical
plate, but its expression is substantially higher in layer 5. In
addition, CHL1 expression is highest in the caudal
neocortex, within the presumptive visual cortex, and shows a
substantial decline within the presumptive somatosensory cortex
(arrow). F, At P7, layer 5 expression is
still differential and higher caudally, but the differences in
expression levels along the rostral-caudal axis are not as pronounced
as at P0. Rostral is to the left, and dorsal is
up. A-D are simultaneous exposures of
dark-field illumination to show silver grains and UV fluorescence to
show DAPI staining; E and F are dark
field alone. cp, Cortical plate;
hi, hippocampus; iz, intermediate
zone; lge, lateral ganglionic eminence;
mge, medial ganglionic eminence; pp,
preplate; sp, subplate; svz,
subventricular zone; vd, ventral diencephalon;
5, layer 5. Scale bars, 500 µm.
|
|
At E19, CHL1 is highly expressed in the cortical plate,
subplate, intermediate zone, and subventricular zone. Expression is not
detectable, however, in the marginal zone and ventricular zone (Fig.
3H,H'). Although expression in the cortical plate appears to
be uniform, expression in the subventricular and intermediate zones is
graded with higher expression caudally (Fig. 5D). At P0,
CHL1 is expressed throughout the cortical plate, but
the highest expression is found in the nascent layer 5 (Fig.
3I,I'). The expression in layer 5 is highest in caudal
neocortex, including the presumptive primary visual area, and declines
abruptly in the presumptive somatosensory area (Fig. 5E,
arrow). At P7, CHL1 is expressed in all cortical
layers and remains highest in layer 5 (Fig. 3J,J'). Expression in layer 5 is higher caudally than rostrally, although this
differential expression is not as obvious as at P0 (Fig. 5F).
Examination of CHL1 expression on coronal sections reveals
several interesting features. At E16, expression in the cortical plate
is graded along the lateral-medial axis at both rostral (Fig.
6A) and caudal (Fig.
6B) levels. This could reflect the lateral-to-medial
maturational gradient of the neocortex. At E19, expression in the
cortical plate appears higher in the medial and lateralmost parts of
the neocortex than in the parietal cortex interposed between them (Fig.
6C). At both P0 (Fig. 6D) and P7 (Fig.
6E), layer 5 expression is stronger in retrosplenial
and insular cortices than in parietal cortex. This differential layer 5 expression is not observed within the neocortex at levels caudal to the
hippocampus (data not shown), which is consistent with the expression
observed in sagittal sections (Fig. 5F) showing high
layer 5 expression in caudal neocortex. Apart from the cortex, CHL1 is widely expressed in other parts of the forebrain,
including thalamus and hypothalamus (Fig. 6B,D),
striatal mantle, olfactory tuberculum, septum (Fig.
6A), and amygdala (Fig. 6C,D).

View larger version (51K):
[in this window]
[in a new window]
|
Figure 6.
CHL1 is differentially expressed
along the medial-lateral axis of the developing neocortex. In
situ hybridizations using S35-labeled
riboprobes on coronal sections of rat forebrain are shown. A,
B, Coronal sections of E16 rat brains taken at a rostral
(A) and a caudal (B) level
along the rostral-caudal axis of the neocortex are shown.
CHL1 is expressed in the intermediate zone and the
cortical plate. Rostrally, CHL1 exhibits
high-lateral-to-low-medial graded expression within the cortical plate
but high-medial-to-low-lateral graded expression within the
intermediate zone. Caudally, CHL1 appears to exhibit
high-lateral-to-low-medial graded expression in both the cortical plate
and intermediate zone. C, At E19, CHL1 is
present in the cortical plate and subplate and is most highly expressed
in more medial and lateral parts of the cortex, with lower levels in
between. D, At P0, the pattern of expression is similar
to that described for E19, with the notable exception that
CHL1 expression is substantially higher in layer 5 than
in other layers. E, By P7, CHL1
expression appears lower than at P0. Expression in layer 5 continues to
be higher than that in other layers and exhibits the same pattern as at
P0, being higher in more lateral and more medial parts of the cortex.
Expression in the other layers is low and appears more-or-less uniform.
Images shown in A and B
are simultaneous exposures using both dark-field illumination to show
silver grains and UV fluorescence to show DAPI staining; those in
C-E are dark field alone. c, Caudal
level; cp, cortical plate; iz,
intermediate zone; lge, lateral ganglionic eminence;
r, rostral level; 5, layer 5. Scale bars,
500 µm.
|
|
Differential expression of two novel gene fragments across the
developing neocortex
In addition to COUP-TFI and CHL1, we
isolated fragments, referred to here as 2m3 and 36m1, of two
potentially novel genes. In situ hybridization analysis in
E16 rat, the age from which RNA preparations were made for the ddPCR
screen, confirms that these fragments have differential patterns of
expression across the developing neocortex. 2m3 is expressed in the
ventricular and the subventricular zones, but little or no expression
is detected in the cortical plate (Fig.
7A,B). The expression in the
ventricular and subventricular zones is graded with higher levels
rostrally (Fig. 7A) and ventrolaterally (Fig.
7B), where it extends into the basal forebrain, and lower
levels caudally and dorsomedially.

View larger version (58K):
[in this window]
[in a new window]
|
Figure 7.
Two novel gene fragments identified in the ddPCR
screen show graded expression across E16 rat neocortex. In
situ hybridizations using S35-labeled
riboprobes were performed on sagittal (A, C) and coronal
(B, D) sections and imaged using both dark-field
illumination to show silver grains and UV fluorescence to show DAPI
staining. A, Gene fragment 2m3 is expressed in the
ventricular zone in a strong high-rostral-to-low-caudal graded pattern.
B, On coronal sections 2m3 appears more highly expressed
laterally than medially. The expression continues into the ganglionic
eminences of the basal forebrain. C, Gene fragment 36m1
is expressed in the cortical plate in a strong
high-rostral-to-low-caudal graded pattern. D, Expression
of 36m1 is relatively uniform along the medial-lateral cortical axis,
with the exception of a sharp decline laterally. cp,
Cortical plate; lge, lateral ganglionic eminence;
mge, medial ganglionic eminence; vz,
ventricular zone. Scale bars, 500 µm.
|
|
In contrast to 2m3, the expression of 36m1 is detected only in the
cortical plate (Fig. 7C,D). 36m1 exhibits a strong
high-rostral-to-low-caudal graded expression within the neocortex (Fig.
7C). Graded expression of 36m1 is less evident along the
medial-lateral axis of the neocortex but does appear to decline
ventrolaterally in presumptive insular cortex, while remaining strongly
expressed in presumptive perirhinal cortex (Fig. 7D). As for
COUP-TFI and CHL1, the finding of early graded
expression of 2m3 and 36m1 indicates that their differential expression
is established independent of TCAs.
 |
DISCUSSION |
This study is the first report of a screen to identify genes
differentially expressed across the developing neocortex in patterns suggesting a role in arealization. We have cloned four genes
differentially expressed along the rostral-caudal and medial-lateral
axes of the developing neocortex, as well as in a layer-specific
manner. They include COUP-TFI and CHL1, neither
of which has been reported previously to be differentially expressed in
cortex, as well as two novel genes.
Roles for COUP-TFI in the development of the TCA
projection and the survival of cortical neurons
The COUP-TFs are orphan members of the steroid/thyroid hormone
receptor superfamily implicated in regulating signaling pathways involved in development, including those mediated by retinoid acid
receptors, retinoid X receptors, the vitamin D3 receptor, thyroid
hormone receptors, and hepatocyte nuclear factor-4 (Tsai and Tsai,
1997 ). Mice have two COUP-TF genes, I and
II, both expressed in the developing nervous system (Jonk et
al., 1994 ; Qiu et al., 1994 ). In vitro studies
suggest that COUP-TFI may influence expression of the
immediate early response gene NGFI-A (Pipaon et al., 1999 ), the Purkinje cell-specific gene PCP-2 (Anderson et al.,
1998 ), and the glutamate receptor subunit KA2 (Chew et al.,
1999 ).
COUP-TFI mutant mice have a substantially reduced TCA
projection, and TCAs fail to innervate the cortical plate. In addition, subplate and layer 4 neurons undergo excessive cell death (Zhou et al.,
1999 ). Zhou et al. (1999) favor the interpretation that the diminished
TCA projection is caused by defects in the putative guidance functions
of subplate neurons, which as we show express COUP-TFI. If
the diminished TCA projection is secondary to defects in subplate
neurons, our finding of a high-caudal-to-low-rostral graded cortical
expression of COUP-TFI would suggest that caudal parts of
the neocortex, including the visual cortex, would be most severely
affected. However, because COUP-TFI is highly expressed throughout development in dorsal thalamus in both mice and rats (Qiu et
al., 1994 ) (present study), the defects in the TCA projection could be
autonomous to TCA projection neurons; if so, we would not expect areal
differences in the failure of TCAs to invade the cortical plate in
COUP-TFI mutants. In addition, because COUP-TFI is expressed within the ventral telencephalon at the level of the TCA
pathway through it, the diminished TCA projection in
COUP-TFI mutants could be caused in part by an aberrant
differentiation of ventral telencephalic cell groups and the expression
of axon guidance molecules that have been implicated in TCA pathfinding (see Tuttle et al., 1999 ; Braisted et al., 2000 ). Zhou et al. (1999)
also favor the interpretation that the postnatal loss of layer 4 neurons is caused by their lack of thalamic innervation. Although this
is a valid possibility, our finding that layer 4 neurons in both rats
and mice highly express COUP-TFI suggests the alternative
explanation that their loss is cell autonomous. This would be
consistent with the explanation suggested for the death of the
COUP-TFI-expressing neural crest precursors of the ninth
cervical ganglion in COUP-TFI mutants (Qiu et al., 1997 ). Although Zhou et al. (1999) did not analyze COUP-TFI
expression, previous work from the same group (Qiu et al., 1994 )
reported that COUP-TFI is highly expressed in mouse cortex
at E14.5 (a developmental stage similar to E16 rat), but not at E18.5
(similar to E20 rat) we have no explanation for the discrepancy
between these findings of Qiu et al. (1994) and our findings
that COUP-TFI continues to be highly expressed in the
neocortex of both postnatal rats and mice. If the loss of layer 4 neurons in the COUP-TFI mutant is cell autonomous, we would
expect that it would be most pronounced in areas such as visual and
somatosensory cortex that most highly express COUP-TFI.
CHL1 in cortical development
The similarity of CHL1 to the L1 family of cell
adhesion molecules suggests that CHL1 may have similar
functions (Holm et al., 1996 ). Many of the L1 family members have
homophilic or heterophilic interactions and mediate cell-cell (or
axon-axon) interactions during development, regeneration, and
modification of synaptic activity (Rutishauser, 1993 ; Schachner, 1997 ).
In vitro, CHL1 promotes neurite outgrowth by
heterophilic binding to an unknown ligand. CHL1 is expressed
by subpopulations of neurons and glia in the CNS and peripheral
nervous system in a pattern that extensively overlaps with other L1
family members (Hillenbrand et al., 1999 ).
Our results suggest that within the neocortex, CHL1 is only
expressed by postmitotic cells. Its graded expression in the
intermediate and subventricular zones where neurons are migrating
toward the cortical plate suggests that it may regulate cell-cell
interactions and neuronal migration differentially along the
rostral-caudal axis. The timing of CHL1 expression in the
intermediate zone and later its preferential expression in layer 5 suggest that CHL1 may primarily be involved in the migration and
process extension of layer 5 neurons.
Novel genes
The two novel gene fragments that we have isolated, 2m3 and 36m1,
appear to be partial sequences of novel genes. Both are expressed at
E16 in a high-rostral-to-low-caudal graded pattern across the
neocortex. However, their expression patterns differ along the
medial-lateral axis, with 2m3 exhibiting high-lateral-to-low-medial graded expression, whereas the expression of 36m1 drops off laterally except in the perirhinal cortex. In addition, the two exhibit different
laminar expression patterns: 2m3 is expressed in the ventricular zone
suggesting that it is expressed by cortical progenitor cells, whereas
36m1 is expressed only in the cortical plate suggesting that is
expressed by postmitotic cortical neurons.
Differential gene expression before thalamic input
COUP-TFI and CHL1 exhibit
high-caudal-to-low-rostral expression patterns across the neocortex
throughout its development, indicating that their graded expression
patterns are not caused by the gradients of cortical neurogenesis and
maturation but are established by other mechanisms. An issue that has
received much attention recently is whether differential patterns of
gene expression in the neocortex are established by mechanisms
intrinsic to the cortex or by extrinsic influences such as TCAs
(Miyashita-Lin et al., 1999 ; Nakagawa et al., 1999 ). Because of the
timing of development of the TCA projection in rats (Catalano et al.,
1991 , 1996 ; De Carlos et al., 1995 ), differential gene expression
evident in the neocortex at E16 or earlier must be established
independent of TCAs. We find that COUP-TFI and
CHL1 expression is graded in a high-caudal-to-low-rostral
pattern as early as E12 and E14, respectively. In addition, the two
novel genes 2m3 and 36m1 exhibit strong graded expression at E16, the
earliest time that we have examined presently. Thus, the early
differential expression of all four genes is established independent of
TCAs and likely by a mechanism intrinsic to the neocortex, consistent
with a role for them in directing arealization. However, both
COUP-TFI and CHL1 exhibit substantial changes
after the cortical plate is invaded by TCAs. Thus although the early
differential expression of these genes is independent of thalamic
influence, TCAs may modify their later patterns of expression. This
possibility is especially intriguing for COUP-TFI because it
is most highly expressed in layer 4, the principal target of TCAs. By
P7, COUP-TFI expression in layer 4 is discontinuous,
exhibiting abrupt decreases and increases, and appears to be most
pronounced in the primary somatosensory and visual areas, which receive
a prominent TCA input.
Implications for mechanisms controlling arealization
Two issues relevant to understanding mechanisms that control
neocortical arealization are whether area-specific genes exist and
whether they are required to differentiate areas. Genes described previously to be differentially expressed across the embryonic neocortex (see introductory remarks), as well as the four genes that we
have identified, exhibit, at least initially, graded expression patterns that are not restricted to a single area. Interestingly, none
of the 10,000 gene fragments that we examined in the ddPCR screen was
expressed exclusively in rostral or caudal E16 rat neocortex; all of
the 148 differentially expressed fragments were expressed in both
rostral and caudal neocortex. Thus, if area-specific genes are
expressed in E16 rat neocortex, they are rare and could have been
missed in the screen for a variety of reasons. Our screen did not
approach saturation because we did not identify genes shown previously
to be differentially expressed in neocortex. In addition, although we
screened ~10,000 bands, some of which are duplicates or different
fragments of the same gene, on average a neuron is estimated to express
~15,000 genes, and our starting RNA samples were from heterogeneous
cell populations.
At later stages of development, several genes, including
Tbr1, Id2, RZR , EphA7,
and several cadherins, as well as COUP-TFI as shown here,
exhibit expression patterns characterized by relatively abrupt borders
that might correlate with those between neocortical areas (Donoghue and
Rakic, 1999b ; Rubenstein et al., 1999 ). However, the expression of at
least some of these genes, and perhaps all of them, is not limited to a
single area. To date, the only example of a genetic marker restricted
to a single area is the expression of the H-2Z1 transgene, which marks
the granular parts of somatosensory cortex (Cohen-Tannoudji et al.,
1994 ). Although H-2Z1 is not expressed until P2, its area-specific
pattern of expression appears to be specified early in embryonic
cortical development (Cohen-Tannoudji et al., 1994 ; Gitton et al.,
1999a ). Taken together, the available evidence suggests that a
neocortical area is primarily defined by the expression of a unique
subset of genes, each of which is also expressed in other areas, rather
than by the expression of a specific set of genes restricted to that area.
Because neocortical areas have abrupt borders, it is likely (but
not required) that the graded expression of genes that regulate arealization is translated in a manner that results in the expression of some downstream genes in patterns with abrupt borders that relate to
the borders between areas. For example, the transcription factors
Pax6 and Emx2 are expressed in opposing graded
patterns across the rostral-caudal axis of the embryonic neocortex
(Walther and Gruss, 1991 ; Stoykova and Gruss, 1994 ; Gulisano et al.,
1996 ; Mallamaci et al., 1998 ). An analysis of Pax6 and
Emx2 mutant mice suggests that arealization of the neocortex
is disproportionately altered in these mutants in opposing manners
predicted by their countergradients of expression (Bishop et al.,
2000 ). Studies in Drosophila have shown that gradients of
transcription factors can be translated into sharply bordered
expression patterns of downstream genes via a thresholding mechanism
based on concentration-dependent differences in binding efficacy to
promoter and repressor elements (Rusch and Levine, 1996 ) or the
combinatorial action of multiple transcriptional activators and
repressors expressed in overlapping graded patterns (Stanojevic et al.,
1991 ; Small et al., 1996 ).
Interestingly, the graded patterns of gene expression observed in the
neocortex often continue beyond it into other regions of the cerebral
hemisphere, including the limbic cortex, paleocortex, archicortex, and
basal forebrain. These continuous graded expression patterns suggest an
intriguing relationship between arealization of the neocortex and other
cortical regions, as well as regionalization of the cerebral hemisphere.
 |
FOOTNOTES |
Received March 14, 2000; revised July 25, 2000; accepted Aug. 1, 2000.
*
Q.L. and N.D.D. contributed equally to this work.
Correspondence should be addressed to Dr. Dennis D. M. O'Leary,
Molecular Neurobiology Laboratory, The Salk Institute, 10010 North
Torrey Pines Road, La Jolla, CA 92037. E-mail: doleary{at}salk.edu.
This work was supported by National Institutes of Health Grant R01
NS31558 (D.D.M.O.), Cancer Research Fund of the Damon Runyon-Walter Winchell Foundation Fellowship DRG-1544 (N.D.D.), and a National Institute of Neurological Diseases and Stroke National Research Service
Award (Q.L.). We thank Matthias Gesemann and David Litwack for
technical advice and Yasushi Nakagawa and Rebecca Tuttle for comments
on this manuscript.
 |
REFERENCES |
-
Anderson GW,
Larson RJ,
Oas DR,
Sandhofer CR,
Schwartz HL,
Mariash CN,
Oppenheimer JH
(1998)
Chicken ovalbumin upstream promoter-transcription factor (COUP-TF) modulates expression of the Purkinje cell protein-2 gene. A potential role for COUP-TF in repressing premature thyroid hormone action in the developing brain.
J Biol Chem
273:16391-16399[Abstract/Free Full Text].
-
Bayer SA,
Altman J
(1991)
In: Neocortical development. New York: Raven.
-
Becker-Andre M,
Wiesenberg I,
Schaeren-Wiemers N,
Andre E,
Missbach M,
Saurat JH,
Carlberg C
(1994)
Pineal gland hormone melatonin binds and activates an orphan of the nuclear receptor superfamily.
J Biol Chem
269:28531-28534[Abstract/Free Full Text].
-
Bishop KM,
Goudreau G,
O'Leary DDM
(2000)
Emx2 and Pax6 regulate area identity in the mammalian neocortex.
Science
288:344-349[Abstract/Free Full Text].
-
Braisted JE,
Catalano SM,
Stimac R,
Kennedy T,
Tessier-Lavigne M,
Shatz CJ,
O'Leary DDM
(2000)
Netrin-1 promotes thalamic axon growth and is required for proper development of the thalamocortical projection.
J Neurosci
20:5792-5801[Abstract/Free Full Text].
-
Bulfone A,
Smiga SM,
Shimamura K,
Peterson A,
Puelles L,
Rubenstein JL
(1995)
T-brain-1: a homolog of Brachyury whose expression defines molecularly distinct domains within the cerebral cortex.
Neuron
15:63-78[Web of Science][Medline].
-
Catalano SM,
Robertson RT,
Killackey HP
(1991)
Early ingrowth of thalamocortical afferents to the neocortex of the prenatal rat.
Proc Natl Acad Sci USA
88:2999-3003[Abstract/Free Full Text].
-
Catalano SM,
Robertson RT,
Killackey HP
(1996)
Individual axon morphology and thalamocortical topography in developing rat somatosensory cortex.
J Comp Neurol
367:36-53[Web of Science][Medline].
-
Chenn A,
Braisted JE,
McConnell SK,
O'Leary DDM
(1997)
Development of the cereb cortex: mechanisms controlling cell fate, laminar and areal patterning, and axonal connectivity.
In: Molecular and cellular approaches to neural development (Cowan WM,
Zipursky L,
Jessell T,
eds), pp 440-473. New York: Oxford UP.
-
Chew L-J,
Huang F,
Boutin J-M,
Gallo V
(1999)
Identification of nuclear orphan receptor as regulators of expression of a neurotransmitter receptor gene.
J Biol Chem
274:29366-29375[Abstract/Free Full Text].
-
Cohen-Tannoudji M,
Babinet C,
Wassef M
(1994)
Early determination of a mouse somatosensory cortex marker.
Nature
368:460-463[Medline].
-
De Carlos JA,
Schlagger BL,
O'Leary DDM
(1995)
Development of acetylcholinesterase-positive thalamic and basal forebrain afferents to embryonic rat neocortex.
Exp Brain Res
104:385-401[Web of Science][Medline].
-
Donoghue MJ,
Rakic P
(1999a)
Molecular evidence for the early specification of presumptive functional domains in the embryonic primate cerebral cortex.
J Neurosci
19:5967-5979[Abstract/Free Full Text].
-
Donoghue MJ,
Rakic P
(1999b)
Molecular gradients and compartments in the embryonic primate cerebral cortex.
Cereb Cortex
9:586-600[Abstract/Free Full Text].
-
Gitton Y,
Cohen-Tannoudji M,
Wassef M
(1999a)
Specification of somatosensory area identity in cortical explants.
J Neurosci
19:4889-4898[Abstract/Free Full Text].
-
Gitton Y,
Cohen-Tannoudji M,
Wassef M
(1999b)
Role of thalamic axons in the expression of H2Z1, a mouse somatosensory cortex specific marker.
Cereb Cortex
9:611-616[Abstract/Free Full Text].
-
Goulding MD,
Lumsden A,
Gruss P
(1993)
Signals from the notochord and floor plate regulate the region-specific expression of two Pax genes in the developing spinal cord.
Development
117:1001-1016[Abstract].
-
Gulisano M,
Broccoli V,
Pardini C,
Boncinelli E
(1996)
Emx1 and Emx2 show different patterns of expression during proliferation and differentiation of the developing cerebral cortex in the mouse.
Eur J Neurosci
8:1037-1050[Web of Science][Medline].
-
Hillenbrand R,
Molthagen M,
Montag D,
Schachner M
(1999)
The close homologue of the neural adhesion molecule L1 (CHL1): patterns of expression and promotion of neurite outgrowth by heterophilic interactions.
Eur J Neurosci
11:813-826[Web of Science][Medline].
-
Holm J,
Hillenbrand R,
Steuber V,
Bartsch U,
Moos M,
Lubbert H,
Montag D,
Schachner M
(1996)
Structural features of a close homologue of L1 (CHL1) in the mouse: a new member of the L1 family of neural recognition molecules.
Eur J Neurosci
8:1613-1629[Web of Science][Medline].
-
Inoue T,
Tanaka T,
Suzuki SC,
Takeichi M
(1998)
Cadherin-6 in the developing mouse brain: expression along restricted connection systems and synaptic localization suggest a potential role in neuronal circuitry.
Dev Dyn
211:338-351[Web of Science][Medline].
-
Jonk LJ,
de Jonge ME,
Pals CE,
Wissink S,
Vervaart JM,
Schoorlemmer J,
Kruijer W
(1994)
Cloning and expression during development of three murine members of the COUP family of nuclear orphan receptors.
Mech Dev
47:81-97[Web of Science][Medline].
-
Mackarehtschian K,
Lau CK,
Caras I,
McConnell SK
(1999)
Regional differences in the developing cerebral cortex revealed by ephrin-A5 expression.
Cereb Cortex
9:601-610[Abstract/Free Full Text].
-
Mallamaci A,
Iannone R,
Briata P,
Pintonello L,
Mercurio S,
Boncinelli E,
Corte G
(1998)
EMX2 protein in the developing mouse brain and olfactory area.
Mech Dev
77:165-172[Web of Science][Medline].
-
Miyashita-Lin EM,
Hevner R,
Wassarman KM,
Martinez S,
Rubenstein JL
(1999)
Early neocortical regionalization in the absence of thalamic innervation.
Science
285:906-909[Abstract/Free Full Text].
-
Nakagawa Y,
Johnson JE,
O'Leary DDM
(1999)
Graded and areal expression patterns of regulatory genes and cadherins in embryonic neocortex independent of thalamocortical input.
J Neurosci
19:10877-10885[Abstract/Free Full Text].
-
O'Leary DDM
(1989)
Do cortical areas emerge from a protocortex?
Trends Neurosci
12:400-406[Web of Science][Medline].
-
Park HT,
Kim YJ,
Yoon S,
Kim JB,
Kim JJ
(1997)
Distributional characteristics of the mRNA for retinoid Z receptor beta (RZR beta), a putative nuclear melatonin receptor, in the rat brain and spinal cord.
Brain Res
747:332-337[Web of Science][Medline].
-
Pipaon C,
Tsai SY,
Tsai M-J
(1999)
COUP-TF upregulates NGFI-A gene expression through an Sp1 binding site.
Mol Cell Biol
19:2734-2745[Abstract/Free Full Text].
-
Porter FD,
Drago J,
Xu Y,
Cheema SS,
Wassif C,
Huang SP,
Lee E,
Grinberg A,
Massalas JS,
Bodine D,
Alt F,
Westphal H
(1997)
Lhx2, a LIM homeobox gene, is required for eye, forebrain, and definitive erythrocyte development.
Development
124:2935-2944[Abstract].
-
Puelles L,
Kuwana E,
Puelles E,
Rubenstein JLR
(1999)
Comparison of the mammalian and avian telencephalon from the perspective of gene expression data.
Eur J Morphol
37:139-150[Web of Science][Medline].
-
Qiu Y,
Cooney AJ,
Kuratani S,
DeMayo FJ,
Tsai SY,
Tsai MJ
(1994)
Spatiotemporal expression patterns of chicken ovalbumin upstream promoter-transcription factors in the developing mouse central nervous system: evidence for a role in segmental patterning of the diencephalon.
Proc Natl Acad Sci USA
91:4451-4455[Abstract/Free Full Text].
-
Qiu Y,
Pereira FA,
DeMayo FJ,
Lydon JP,
Tsai SY,
Tsai MJ
(1997)
Null mutation of mCOUP-TFI results in defects in morphogenesis of the glossopharyngeal ganglion, axonal projection, and arborization.
Genes Dev
11:1925-1937[Abstract/Free Full Text].
-
Rakic P
(1988)
Specification of cerebral cortical areas.
Science
241:170-176[Abstract/Free Full Text].
-
Rubenstein JL,
Anderson S,
Shi L,
Miyashita-Lin E,
Bulfone A,
Hevner R
(1999)
Genetic control of cortical regionalization and connectivity.
Cereb Cortex
9:524-532[Abstract/Free Full Text].
-
Rusch J,
Levine M
(1996)
Threshold responses to the dorsal regulatory gradient and the subdivision of primary tissue territories in the Drosophila embryo.
Curr Opin Genet Dev
6:416-423[Web of Science][Medline].
-
Rutishauser U
(1993)
Adhesion molecules of the nervous system.
Curr Opin Neurobiol
3:709-715[Medline].
-
Schachner M
(1997)
Neural recognition molecules and synaptic plasticity.
Curr Opin Cell Biol
9:627-634[Web of Science][Medline].
-
Schaeren-Wiemers N,
Andre E,
Kapfhammer JP,
Becker-Andre M
(1997)
The expression pattern of the orphan nuclear receptor ROR beta in the developing and adult rat nervous system suggests a role in the processing of sensory information and in circadian rhythm.
Eur J Neurosci
9:2687-2701[Web of Science][Medline].
-
Small S,
Blair A,
Levine M
(1996)
Regulation of two pair-rule stripes by a single enhancer in the Drosophila embryo.
Dev Biol
175:314-324[Web of Science][Medline].
-
Stanojevic D,
Small S,
Levine M
(1991)
Regulation of a segmentation stripe by overlapping activators and repressors in the Drosophila embryo.
Science
254:1385-1387[Abstract/Free Full Text].
-
Stoykova A,
Gruss P
(1994)
Roles of Pax-genes in developing and adult brain as suggested by expression patterns.
J Neurosci
14:1395-1412[Abstract].
-
Suzuki SC,
Inoue T,
Kimura Y,
Tanaka T,
Takeichi M
(1997)
Neuronal circuits are subdivided by differential expression of type-II classic cadherins in postnatal mouse brains.
Mol Cell Neurosci
9:433-447[Web of Science][Medline].
-
Tsai SY,
Tsai MJ
(1997)
Chick ovalbumin upstream promoter-transcription factors (COUP-TFs): coming of age.
Endocr Rev
18:229-240[Abstract/Free Full Text].
-
Tuttle R,
Nakagawa Y,
Johnson JE,
O'Leary DDM
(1999)
Defects in thalamocortical axon pathfinding correlate with altered cell domains in embryonic Mash-1 deficient mice.
Development
126:1903-1916[Abstract].
-
Walther C,
Gruss P
(1991)
Pax-6, a murine paired box gene, is expressed in the developing CNS.
Development
113:1435-1449[Abstract].
-
Zhou C,
Qiu Y,
Pereira FA,
Crair MC,
Tsai SY,
Tsai MJ
(1999)
The nuclear orphan receptor COUP-TFI is required for differentiation of subplate neurons and guidance of thalamocortical axons.
Neuron
24:847-859[Web of Science][Medline].
Copyright © 2000 Society for Neuroscience 0270-6474/00/20207682-09$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
A. Faedo, G. S. Tomassy, Y. Ruan, H. Teichmann, S. Krauss, S. J. Pleasure, S. Y. Tsai, M.-J. Tsai, M. Studer, and J. L. R. Rubenstein
COUP-TFI Coordinates Cortical Patterning, Neurogenesis, and Laminar Fate and Modulates MAPK/ERK, AKT, and ss-Catenin Signaling
Cereb Cortex,
September 1, 2008;
18(9):
2117 - 2131.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. C. Pinon, T. C. Tuoc, R. Ashery-Padan, Z. Molnar, and A. Stoykova
Altered Molecular Regionalization and Normal Thalamocortical Connections in Cortex-Specific Pax6 Knock-Out Mice
J. Neurosci.,
August 27, 2008;
28(35):
8724 - 8734.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. G. Wright, G. P. Demyanenko, A. Powell, M. Schachner, L. Enriquez-Barreto, T. S. Tran, F. Polleux, and P. F. Maness
Close Homolog of L1 and Neuropilin 1 Mediate Guidance of Thalamocortical Axons at the Ventral Telencephalon
J. Neurosci.,
December 12, 2007;
27(50):
13667 - 13679.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. C. Kudo, S. L. Karsten, J. Chen, P. Levitt, and D. H. Geschwind
Genetic Analysis of Anterior Posterior Expression Gradients in the Developing Mammalian Forebrain
Cereb Cortex,
September 1, 2007;
17(9):
2108 - 2122.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Takeuchi, T. Hamasaki, E. D. Litwack, and D. D.M. O'Leary
Novel IgCAM, MDGA1, Expressed in Unique Cortical Area- and Layer-Specific Patterns and Transiently by Distinct Forebrain Populations of Cajal-Retzius Neurons
Cereb Cortex,
July 1, 2007;
17(7):
1531 - 1541.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Armentano, A. Filosa, G. Andolfi, and M. Studer
COUP-TFI is required for the formation of commissural projections in the forebrain by regulating axonal growth
Development,
November 1, 2006;
133(21):
4151 - 4162.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. N. Sansom, J. M. Hebert, U. Thammongkol, J. Smith, G. Nisbet, M. A. Surani, S. K. McConnell, and F. J. Livesey
Genomic characterisation of a Fgf-regulated gradient-based neocortical protomap
Development,
September 1, 2005;
132(17):
3947 - 3961.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. T. Kroll and D. D. M. O'Leary
Ventralized dorsal telencephalic progenitors in Pax6 mutant mice generate GABA interneurons of a lateral ganglionic eminence fate
PNAS,
May 17, 2005;
102(20):
7374 - 7379.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Melkman and P. Sengupta
Regulation of chemosensory and GABAergic motor neuron development by the C. elegans Aristaless/Arx homolog alr-1
Development,
April 15, 2005;
132(8):
1935 - 1949.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Zhong, M. Takemoto, T. Fukuda, Y. Hattori, F. Murakami, D. Nakajima, M. Nakayama, and N. Yamamoto
Identification of the Genes that are Expressed in the Upper Layers of the Neocortex
Cereb Cortex,
October 1, 2004;
14(10):
1144 - 1152.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Funatsu, T. Inoue, and S. Nakamura
Gene Expression Analysis of the Late Embryonic Mouse Cerebral Cortex Using DNA Microarray: Identification of Several Region- and Layer-specific Genes
Cereb Cortex,
September 1, 2004;
14(9):
1031 - 1044.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Piao, R. S. Hill, A. Bodell, B. S. Chang, L. Basel-Vanagaite, R. Straussberg, W. B. Dobyns, B. Qasrawi, R. M. Winter, A. M. Innes, et al.
G Protein-Coupled Receptor-Dependent Development of Human Frontal Cortex
Science,
March 26, 2004;
303(5666):
2033 - 2036.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. G. M. Frints, P. Marynen, D. Hartmann, J.-P. Fryns, J. Steyaert, M. Schachner, B. Rolf, K. Craessaerts, A. Snellinx, K. Hollanders, et al.
CALL interrupted in a patient with non-specific mental retardation: gene dosage-dependent alteration of murine brain development and behavior
Hum. Mol. Genet.,
July 1, 2003;
12(13):
1463 - 1474.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Buhusi, B. R. Midkiff, A. M. Gates, M. Richter, M. Schachner, and P. F. Maness
Close Homolog of L1 Is an Enhancer of Integrin-mediated Cell Migration
J. Biol. Chem.,
June 27, 2003;
278(27):
25024 - 25031.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Garel, K. J. Huffman, and J. L. R. Rubenstein
Molecular regionalization of the neocortex is disrupted in Fgf8 hypomorphic mutants
Development,
May 1, 2003;
130(9):
1903 - 1914.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Garel, K. Yun, R. Grosschedl, and J. L. R. Rubenstein
The early topography of thalamocortical projections is shifted in Ebf1 and Dlx1/2 mutant mice
Development,
March 14, 2003;
129(24):
5621 - 5634.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Bellion, M. Wassef, and C. Metin
Early Differences in Axonal Outgrowth, Cell Migration and GABAergic Differentiation Properties between the Dorsal and Lateral Cortex
Cereb Cortex,
February 1, 2003;
13(2):
203 - 214.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. M. Bishop, J. L. R. Rubenstein, and D. D. M. O'Leary
Distinct Actions of Emx1, Emx2, and Pax6 in Regulating the Specification of Areas in the Developing Neocortex
J. Neurosci.,
September 1, 2002;
22(17):
7627 - 7638.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Smith, E. Wagner, O. Koul, P. McCaffery, and U. C. Drager
Retinoic Acid Synthesis for the Developing Telencephalon
Cereb Cortex,
October 1, 2001;
11(10):
894 - 905.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Zhou, S. Y. Tsai, and M.-J. Tsai
COUP-TFI: an intrinsic factor for early regionalization of the neocortex
Genes & Dev.,
August 15, 2001;
15(16):
2054 - 2059.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Tole and E. A. Grove
Detailed Field Pattern Is Intrinsic to the Embryonic Mouse Hippocampus Early in Neurogenesis
J. Neurosci.,
March 1, 2001;
21(5):
1580 - 1589.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|