 |
 Previous Article | Next Article 
The Journal of Neuroscience, October 15, 2000, 20(20):7706-7715
p75 Is Important for Axon Growth and Schwann Cell Migration
during Development
Cornelia A.
Bentley2 and
Kuo-Fen
Lee1
1 The Salk Institute, La Jolla, California 92037, and
2 The Biomedical Sciences Graduate Program, University of
California, La Jolla, California 92093
 |
ABSTRACT |
Mice lacking the low-affinity neurotrophin receptor p75 have
multiple peripheral neural deficits. Here we examined the developmental nature of these deficiencies. Peripheral axons in p75  / embryos were severely stunted and poorly arborized from embryonic day 11.5 (E11.5) to E14.5. In vitro, neurite outgrowth from the
dorsal root ganglia was significantly decreased in the p75 /
embryos at E12.5, suggesting that stunted axonal growth in the embryo may result in part from defects in neurite elongation. Additionally, Schwann cell marker S100 immunoreactivity was decreased or absent along the growing axons of the ophthalmic branch from the trigeminal ganglia in p75 / embryos. Electron microscopy studies of the axons
of the trigeminal ganglion at E13.5 revealed that in the p75 mutant
embryo, nerve bundles were highly impaired and that coverage of the
growing axons by Schwann cell cytoplasm was substantially reduced.
In vitro, Schwann cell migration from the dorsal root ganglia was significantly decreased in the p75 / embryos at E12.5,
suggesting that the lack of S100 staining and Schwann cell coverage
in the p75 mutant results from a deficit in Schwann cell migration.
These results provide evidence that p75 is important in the developing
embryo for regulating axon growth and arborization and for Schwann cell migration.
Key words:
p75; Schwann cells; neurites; axons; development; peripheral nervous system; branching; electron microscopy
| |
INTRODUCTION |
The neurotrophins play an important
role in the development of the peripheral nervous system by modulating
many cellular activities, including cell survival (Snider, 1994 ),
neurite outgrowth, and axonal branching and morphology (Cohen-Cory and
Fraser, 1995; Gallo and Letourneau, 1998; Cohen-Cory, 1999; Lom and
Cohen-Cory, 1999; McAllister et al., 1999). These effects of the
neurotrophins may be mediated through two classes of receptors: the
high-affinity tyrosine receptor kinase (trk) receptors (Bothwell, 1991;
Chao, 1992; Kaplan and Miller, 1997) and the low-affinity receptor p75.
Targeted mutation of the p75 receptor gene shows that p75 is required
for several aspects of peripheral sensory (Lee et al., 1992) and
sympathetic (Lee et al., 1994a) innervation. Sympathetic innervation to the lateral footpads and the pineal gland is absent in
the p75 mutant mouse (Lee et al., 1994a). More strikingly, the
p75 mutant mice have a 50% loss of the sensory neurons of the dorsal
root ganglia (DRG) affecting all classes of sensory neurons (Bergmann
et al., 1997; Fundin et al., 1997; Rice et al., 1998; Fan et al., 1999;
our unpublished data). Because p75 plays a role in peripheral
innervation from diverse populations of neurons, including sensory and
sympathetic, and in all classes of sensory neurons, a common mechanism
may account for these losses of peripheral innervation. It is this
hypothesis that led us to explore the developmental nature of the
peripheral sensory deficiencies in the p75 mutant mouse.
p75 plays a role in many cellular activities, including cell survival
(Davies et al., 1993; Barrett and Bartlett, 1994; Lee et al.,
1994b), cell death (Rabizadeh et al., 1993; Barrett and Bartlett, 1994; Casaccia-Bonnefil et al., 1996; Frade et al., 1996;
Bamji et al., 1998), and Schwann cell migration (Anton et al., 1994). A
general role for p75 in neural development is supported by the ability
of p75 to bind all neurotrophins (Rodríguez-Tébar et al.,
1990, 1992) along with its broad expression in all classes of sensory
neurons (Yan and Johnson, 1988; Wright and Snider, 1995), Schwann cells
(Taniuchi et al., 1988), and target tissues (Wheeler and Bothwell,
1992). On the basis of this expression pattern, p75 may influence
innervation and axonal morphology through axon-target interaction,
axon-Schwann cell interaction, and Schwann cell migration. Molecular
cues within target tissues expressed in an age-dependent fashion have
been shown to regulate axonal morphology (Erzurumlu and Jhaveri, 1995).
Target-derived neurotrophins, e.g., BDNF, are indeed capable of
promoting axonal branching (Cohen-Cory and Fraser, 1995; Gallo and
Letourneau, 1998; Cohen-Cory, 1999; Lom and Cohen-Cory, 1999). Axons
therefore must be able to respond to these target-derived molecular
cues and be in the appropriate target locations to receive adequate
levels of exposure to these factors. Because p75 has been shown to
signal independently (Anton et al., 1994; Dobrowsky et al., 1995;
Carter et al., 1996; Frade et al., 1996; Yamashita et al., 1999) and in
collaboration with the trk receptors (Davies et al., 1993; Barker and
Shooter, 1994; Hantzopoulos et al., 1994; Lee et al., 1994b;
Verdi et al., 1994; Huber and Chao, 1995; Wolf et al., 1995; Twiss et
al., 1998; Brennan et al., 1999), p75 may support peripheral nerve
development through a number of probable mechanisms. p75 may act in the
development of the peripheral nervous system by independently binding
and responding to target-derived neurotrophins, mediating the binding and response of the trks to target-derived neurotrophins, or more indirectly by affecting axon growth such that it is in the appropriate target area to receive target-derived molecular cues.
p75 may also affect the development of the peripheral nervous system
through regulation of Schwann cell migration. Several studies
demonstrate the importance of Schwann cells for axonal morphology and
neuronal survival. Targeted deletion of the erbB2 and erbB3 genes in
mice, resulting in the absence of Schwann cells in the periphery, leads
to defasciculation (Morris et al., 1999), neural degeneration, and
ultimately neuronal loss (Riethmacher et al., 1997; Morris et al.,
1999; Woldeyesus et al., 1999). Furthermore, Schwann cells have been
shown to be important for neurite outgrowth (Zimmermann and Sutter,
1983; Bixby et al., 1988). Bi-directional signaling occurs between
developing axons and Schwann cells (Jessen and Mirsky, 1991). Schwann
cells can therefore regulate axonal growth, and axons can in turn
regulate Schwann cell migration (Bhattacharyya et al., 1994). p75 may
play a role in this dynamic interaction during development because it
is expressed in both neurons and Schwann cells (Taniuchi et al., 1988)
and has been shown to modulate Schwann cell migration from neonatal rat
DRG (Anton et al., 1994). The present study suggests that p75 promotes peripheral nerve development by regulating both Schwann cell and axonal
growth aspects of innervation.
| |
MATERIALS AND METHODS |
Animals and genotype analysis. p75 mutant mice were
maintained on a mixed 129/Balbc/c background (Lee et al., 1992).
In most cases, embryos were obtained from heterozygote (+/)
intercrosses. Occasionally, mutant embryos were obtained from
homozygote (/) × heterozygote (+/) crosses, whereas control
embryos were obtained from wild-type (+/+) × wild-type (+/+)
crosses. Mice were housed using standard conditions, and the use of
mice is in compliance with the guidelines of Institute Animal Care and
Use Committee of the Salk Institute. E11.5-E14.5 embryos were removed
and washed in HEPES buffer. Yolk sac DNA was isolated for PCR genotyping.
The primers used for p75 PCR analysis were as follows: p75-1,
5'CGATGCTCCTATGGCTACTA3'; p75-2, 5'CCTCGCATTCGGCGTCAGCC3';
and PGK, 5'GGGAACTTCCTGACTAGGGG3'. Each 20 µl PCR
reaction contains 0.4 µl of 10 mM dNTPs, 2.0 µl of 10×
PCR buffer, 0.5 µl each of 20 µM p75-1 primer, p75-2
primer, and PGK primer, 1.2 µl of 25 mM
MgCl2, 1.0 µl of DNA, and 0.15 µl of 5U/µl
Taq. The following PCR conditions were used: 30 cycles of 1 min at 94°C, 1 min annealing at 56°C, and 1 min at 72°C followed
by a single 10 min extension at 72°C. Primers p75-1 and p75-2
yielded a 247 bp product for the wild-type allele. Primers p75-1 and
PGK produced a 317 bp product for the mutant allele.
Whole-mount immunohistochemistry using diaminobenzidene.
Peripheral innervation was visualized at E11.5, E12.5, E13.5, and E14.5
using antibodies against neurofilament (NF150 or NF-M) (Chemicon, Temecula, CA; both at a dilution of 1:500). All incubations were performed on a slow shaker table. Embryos were collected and fixed in
4% paraformaldehyde (PFA) in PBS overnight. Embryos were then eviscerated, rinsed briefly in PBS, and bleached overnight at 4°C in
Dent's fix (4:1, methanol/DMSO) containing 5% hydrogen peroxide.
Bleaching was then allowed to continue for 3 hr at room temperature.
Samples were blocked overnight at room temperature in dilution buffer
(0.5 M NaCl, 0.01 M phosphate buffer, pH 7.3, 3% bovine serum albumin, 0.1% sodium azide, and 0.3% Triton X-100) containing 5% goat serum and 1% DMSO. Blocking buffer (dilution buffer containing 5% goat serum and 1% DMSO) was then replaced with
fresh blocking buffer containing neurofilament antibodies (NFM or
NF150). After 2 d at room temperature, samples were washed three
times for 1 hr each in Tris-buffered saline (TBS) containing 1%
Tween-20 (TBST) and 1% DMSO. Horseradish peroxidase-conjugated goat
anti-rabbit secondary antibody (Vector, Burlingame, CA; 1:1000) in
dilution buffer was added and incubated overnight at room temperature. The samples were washed three times for 1 hr each in TBST + 1% DMSO
and then once in TBS for 1 hr. The diaminobenzidine (DAB) reaction was
catalyzed by 50 U of glucose oxidase (Calbiochem, La Jolla, CA). One
hundred milliliters of the DAB reaction solution contained 0.4 D-glucose, 0.04 gm ammonium chloride, 0.135 gm imidazole, 0.05 gm DAB, 10 ml 10× TBS, and 90 ml water. The reaction was allowed
to proceed no more than 45 min. The samples were then washed briefly in
TBS, dehydrated in graded methanol, and cleared in glycerol for 1-2 d.
Fluorescent whole-mount immunohistochemistry. The embryos
were fixed in 2% PFA in PBS at 4°C overnight. All incubations were performed on a slow shaker table. The following day, the skin above the
eye together with the eye were dissected and rinsed briefly in PBS. The
eye served as a point of orientation for axon morphology. The skin
samples were blocked overnight at 4°C in blocking buffer (dilution
buffer containing 5% goat serum). Blocking buffer was removed and
replaced with blocking buffer containing mouse anti-TuJ1 [unique
-tubulin (III); Babco (Richmond, VA); dilution 1:500] and rabbit
anti-S100 antibodies (Swant, Bellinzona, Switzerland; dilution
1:1000). The tissues were incubated overnight at 4°C and then washed
three times for 1 hr each in PBS containing 0.5% Triton X-100 (PBST).
Secondary antibodies goat anti-mouse IgG (Fab') TRITC conjugate
(Sigma, St. Louis. MO; 1:500) and goat anti-rabbit IgG
F(ab')2 cy3-conjugated (Jackson, West Grove, PA; 1:600) were added in dilution buffer. The samples were incubated overnight at 4°C, washed three times for 1 hr each in PBST, and washed once for 1 hr in PBS. Finally, after the eye was removed, the
skin was flat-mounted in 90% glycerol, polyvinyl alcohol, and
N-propyl gallate. Skin preparations were imaged using
confocal microscopy with scanning lasers (Olympus Fluoview).
Neurite outgrowth and Schwann cell migration assays.
Migration of Schwann cells and neurite outgrowth from DRG were
quantitatively assayed as described previously (Tuttle and Matthew,
1991; Morris et al., 1999). Briefly, E12.5 DRG were dissected out in
L15 medium (Life Technologies, Grand Island, NY), treated with
collagenase (type CLS, Worthington Biochemical, Freehold, NJ) [1 mg/ml
in RPMI medium 1640 (Life Technologies) for 20 min at 37°C] to
remove capsule, and placed on a 20 µm adult sciatic nerve
cryosection. Before culturing the DRG, cryosections were mounted on
glass coverslips, allowed to dry at room temperature for 1 hr, placed
in 35 mm Petri dishes, and then washed three times in RPMI with the
third wash left on nerve sections for at least 1 hr at 37°C. The DRG
were cultured for 3 d in RPMI/10% FBS with BSA or NGF (5 ng/ml).
The medium was then replaced with vital dye 10 mM
5(6)-carboxyfluorescein diacetate succinimidyl ester (Molecular Probes,
Eugene, OR) and incubated for 5 min. The cultures were immediately
photographed. In the presence of BSA, only Schwann cells or Schwann
cell precursors migrate along the sciatic nerve. This was confirmed by
immunohistochemistry with erbB3 antibodies (Morris et al., 1999), a
marker for Schwann cell precursors. The addition of NGF promotes
neurite outgrowth. Schwann cell migration and neurite outgrowth were
quantified by directly measuring the distance form the leading edge of
the DRG to the farthest Schwann cell or neurite on 35 mm photographic negatives taken of vital dye-stained cultures.
The preceding protocol was modified to assess Schwann cell migration in
the presence of NGF. E12.5 DRGs were placed on a sciatic nerve
cryosection at a "starting line," which had been previously marked
with a permanent marker on the bottom side of the glass coverslip.
Schwann cells were allowed to migrate onto the sciatic nerve sections
for 36 hr. The DRG were then removed by cutting away both the sciatic
nerve and DRG at the starting line. The RPMI medium was then replaced
with fresh RPMI with or without 10 ng/ml of NGF. Schwann cell migration
was then allowed to proceed for 72 hr. Schwann cell migration was
measured by the distance of the furthest Schwann cell from the leading
edge of the starting line on 35 mm photographic negatives taken of
vital dye-stained cultures. An additional phase photograph was taken to
pinpoint the location of the starting line. Schwann cell migration and neurite distances are expressed as mean ± SEM. Statistical
significances of differences were tested using the Student's
t test.
Electron microscopy. Under a dissecting microscope, skin
above the eye innervated by the trigeminal ganglia from E13.5 control (n = 2) and mutant (n = 2) embryos was
removed in cold (4°C) Karnovsky's buffered pH 7.4 fixative. After
fixation, samples were then washed three times in cold (4°C) 0.1 M sodium cacodylate buffer, pH 7.4. After three
buffer washes, the tissues were post-fixed in sodium cacodylate-buffered (pH 7.4) 2% osmium tetroxide for 1 hr at room temperature. After three buffer washes of 5 min each, the tissues were
dehydrated through a graded series of ethanol and propylene oxide and
embedded in plastic resin (EM-bed 812, EM Sciences, Fort Washington, PA).
Serial thick sections (1-2 µm) of all tissue blocks for light
microscopy were stained with 1% toluidine blue. From these sections, nerve tracts were identified, and ultrathin sections were cut (60 nm),
mounted on 200 mesh unsupported copper grids, and stained in uranyl
acetate and bismuth subnitrate.
| |
RESULTS |
Peripheral nerves are severely stunted in p75 / embryos
p75 is important for sensory innervation from the DRG (Lee et al.,
1992) and sympathetic innervation from the sympathetic ganglia (Lee et
al., 1994a). To understand how p75 affects the morphology of
these diverse populations of neurons during development, we examined
neurofilament (NF) staining of the peripheral nerves between
E11.5 and E14.5 in the p75 mutant (p75 /) mice (Lee et al., 1992).
Because no differences were noticed between p75 +/+ and p75 +/
embryos, both groups were used as controls. Whole-mount immunohistochemistry allowed us to visualize the morphology of axons in
the limbs using antibodies against NF. These visually accessible
regions showed striking differences between p75 / and control
animals. p75 / mice exhibited increasing deficiencies of
innervation to the forelimbs (Fig. 1) as
they developed from age E11.5 to E14.5. At E11.5 (n = 3), NF-immunopositive axons in the forelimb of p75 / embryos did
not extend as far into the limb as those in the control littermates and
appeared less branched (Fig. 1A,B).
By E12.5 (control, n = 8; p75 /, n = 7), the differences between limb innervation in mutant and control embryos were more dramatic. Branching in the forelimbs of E12.5 control
embryos became quite extensive, whereas axons in the limbs of the
mutants had not arborized and appeared stunted (Fig.
1C,D). NF-immunopositive axons were well
arborized across much of the developing limbs of control embryos at
E13.5 (p75 +/, n = 3; p75 /, n = 2), whereas axons in the limbs of p75 mutant embryos were less
elaborate and visible only in the most proximal regions (Fig.
1E,F). Finally, at E14.5
(n = 3) the forelimbs and digits of control embryos
were highly innervated with well arborized axons (Fig. 1G).
The forelimbs of p75 / embryos, however, showed almost no
immunopositive axonal innervation (Fig. 1H). Although the deficiency of axon growth was severe in the limbs, innervation of
the vibrissae, another visually accessible area, was not notably impaired in the mutants (data not shown).
View larger version (104K):
[in this window]
[in a new window]
|
Figure 1.
Whole-mount immunohistochemistry for neurofilament
shows that innervation of the developing limbs is decreased in the p75
/ embryos. Shown is a dorsal view of the forelimbs of controls
(A, C, E,
G) and p75 mutants (B, D,
F, H) at ages E11.5
(A, B), E12.5 (C,
D), E13.5 (E, F),
and E14.5 (G, H).
Arrows indicate immunoreactive axons projecting into the
forelimbs. Photographs of whole mounts were taken using a dissecting
microscope at 40× magnification.
|
|
To further assess what types of axons are predominantly visible in the
limbs, we also performed whole-mount immunohistochemistry for tyrosine
hydroxylase (TH) to label the sympathetic neurons at E12.5, E13.5, and
E14.5. As expected, the sympathetic chain was labeled along with fibers
emerging from the sympathetic ganglia. No TH-labeled fibers were
observed in the limbs at any of the ages examined (data not shown).
Although at this young age the possibility that some of the fibers
visualized by the NF staining are motor cannot be ruled out, we believe
that they are most likely sensory because of the superficial location
of the NF-stained fibers.
Innervation to the skin above the eye originates from the trigeminal
ganglion (TG). This ganglion also shows a loss of neuronal number in
the p75 mutant mice (Walsh et al., 1999). The translucency of
this region allowed us to closely follow axon growth and morphology of
these sensory nerves in developing p75 / embryos. Whole-mount immunohistochemistry with antibodies against neurofilament, in the p75
mutant mice at E11.5-E14.5, showed stunted neurite processes and a
profound lack of arborization in axons extending from the TG to the
skin anterior to the eye (Fig. 2). At
E11.5 (n = 3), innervation around the eye was barely
visible in both control and p75 / embryos (Fig.
2A,B). Already at E12.5 (control,
n = 8; p75 /, n = 7), the control
embryos showed more arborization of the axons above the eye than the
mutant littermates (Fig. 2C,D). Immunopositive
axons in the skin above the eye in the control animals developed
extensive branching at E13.5 (p75 +/, n = 3; p75
/, n = 2), whereas axons in the mutants were still
largely unarborized and severely stunted (Fig.
2E,F). At E14.5
(n = 3), immunostaining showed that axons remained
stunted in the p75 mutants and had failed to arborize (Fig.
2G,H). These data demonstrate a role for
p75 in axon growth and morphology of several types of sensory neurons,
including DRG neurons innervating the limbs and TG neurons innervating
the skin of the head.
View larger version (119K):
[in this window]
[in a new window]
|
Figure 2.
Neurofilament whole-mount immunohistochemistry of
the skin from the head of developing embryos shows that axons of the
ophthalmic branch of the TG are less extensive and complex in the p75
/ embryos. Shown is a sagittal view of the head in the controls
(A, C, E,
G) and p75 mutants (B, D,
F, H) at ages E11.5
(A, B), E12.5 (C,
D), E13.5 (E, F),
and E14.5 (G, H). The
contralateral side of the head and the brain have been removed in
E-H to increase transparency of the
skin. Asterisks indicate location
of the eye. Arrows point to axons of the ophthalmic
branch. Photographs of whole mounts were taken using a dissecting
microscope at 40× magnification.
|
|
Neurite outgrowth from the DRG of p75 / embryos was decreased
in vitro
Because nerves are severely stunted in the p75 mutant embryo, we
wanted to test neurite outgrowth function. Neurite outgrowth assays
were performed using cervical DRG from E12.5 p75 +/+, +/, and /
embryos. This assay uses neurons that are most likely impaired as
visualized from NF staining, and it has been shown to mimic in
vivo conditions (Sandrock and Matthew, 1987; Tuttle and Matthew,
1991; Morris et al., 1999). After 72 hr in culture in the presence of 5 ng/ml NGF, neurite outgrowth along sciatic nerve cryosections was
measured from the leading edge of the DRG to the farthest neurite
visualized with vital dye. Neurite outgrowth culture assays were
performed at least five times, and the results were pooled. Neurite
outgrowth from the E12.5 DRG of p75 / embryos was decreased by 12%
compared with that of +/+ controls (p75 +/+, 2.38 ± 0.04 mm,
n = 108; p75 /, 2.09 ± 0.05 mm,
n = 50; p < 0.0001) (Fig.
3). Neurite outgrowth from the DRG of p75
/ embryos compared with outgrowth from the DRG of p75 +/ embryos
was decreased by 15% (p75 +/, 2.46 ± 0.04 mm,
n = 82; p < 0.0001) (Fig. 3). There
was not a statistically significant difference in neurite outgrowth
from the DRG of p75 +/+ and p75 +/ embryos. These data suggest that
impaired neurite outgrowth may be responsible in part for the stunted
axon growth in the p75 mutant embryo.
View larger version (43K):
[in this window]
[in a new window]
|
Figure 3.
In vitro neurite outgrowth from the
DRG of control and p75 / embryos. Bar graph shows
mean distance (mm) of neurite outgrowth and SEM in the
presence of NGF (5 ng/ml) from the DRG of p75 +/+, +/, and /
embryos. Mean neurite outgrowth distance from the DRG of p75 /
embryos is significantly lower (asterisk) than the
outgrowth distances from the DRG of both p75 +/+
(p < 0.0001) and p75 +/ embryos
(p < 0.0001). Representative micrographs
showing vital dye staining of the DRG and extended neurites are
overlaid with a line demonstrating measurement of
neurite outgrowth distance.
|
|
Schwann cell marker S100 is decreased or absent along the
ophthalmic branch of the TG in p75 / embryos
p75 is expressed in Schwann cells (Taniuchi et al., 1988) and has
been shown to play a role in neonatal Schwann cell migration (Anton et
al., 1994). Because Schwann cells that support the axons of the TG must
migrate out from the TG along with the axons, we wanted to examine the
in vivo topology of these Schwann cells. The thin and
transparent nature of the embryonic skin, innervated by the ophthalmic
branch of the TG, provides an experimental approach to examine Schwann
cells along the extending axons. A mouse antibody against tubulin
(TuJ1) was used to visualize axons, and a rabbit antibody against
S100 was used to mark Schwann cells in E14.5 (p75 +/+,
n = 3; p75 +/, n = 6; p75 /,
n = 6) skin from p75 +/+, +/, and / embryos.
Imaging of double immunohistochemistry in skin whole mounts was
accomplished using confocal microscopy. No differences were observed
between p75 +/+ and +/ animals. At E14.5, S100 staining was less
frequently associated with the distal tips of the
tubulin-immunoreactive axons in p75 mutant embryos (Fig.
4). These observations were quantified by
measuring the distance from the tip of the tubulin-positive neurite to
the first S100-positive Schwann cell (Fig.
5) in skin from control and mutant
embryos. Three to five axons from each sample (controls, 11 samples
with 48 axons measured; mutants, 10 samples with 45 axons measured)
were randomly selected, viewing only the tubulin staining. The S100
staining was then visualized to make the measurements. In control
samples, 70% of S100 staining was within 10 µm of the
tubulin-stained tip of the axon, whereas only 40% of S100 staining
from samples of p75 / embryos was within 10 µm. S100-positive Schwann cells were rarely measured >40 µm from the visible tip of
the axon (6%) in samples from control embryos; in contrast, nearly
20% of Schwann cell/neurite distances measured in the mutants were
>40 µm. In addition, at E14.5, there was a dramatic loss of S100
staining over extended lengths of tubulin-positive axons in the skin of
the mutants (Fig. 5E,F). The
intensity of S100 immunostaining in the E14.5 mutants was
qualitatively decreased. A 2.5-fold greater laser intensity was
required to visualize S100 immunoreactivity in samples from p75
mutant animals. The loss of S100 immunofluorescence along the
developing axons of the TG in p75 mutants suggests that p75 is
important for Schwann cell function and development in vivo
or has secondary effects on cellular activities associated with S100
expression in Schwann cells.
View larger version (58K):
[in this window]
[in a new window]
|
Figure 4.
Whole-mount double immunohistochemistry using
antibodies against S100 and TuJ1 to visualize the ophthalmic branch
and associated Schwann cells of the TG in E14.5 embryos. Axons
immunopositive for TuJ1 (green) are first shown
at low-power magnification (A, D; scale
bar, 500 µm). Asterisks in A and
D indicate where the TG axons emerge above the eye. The
white boxes in A and D
show regions visualized at high-power magnification in
B, C and E,
F, respectively (scale bar, 100 µm). Axons in the p75
mutants (D-F) are severely
stunted and less branched than those of the controls
(A-C). S100-staining
(red) (C, F)
appears to colocalize with TuJ1 staining (B,
E). Arrows point out strong S100
(C) and TuJ1 (B)
immunoreactivity in distal regions of axons in the control embryos.
However, axons in the p75 / embryos have several regions of
decreased or absent S100 staining (arrows in
E, F). Higher-power magnification
(scale bar, 50 µm) of axons in controls (G,
H) shows robust staining of S100
(H), even at the distal tip
(arrows in G, H) of
the TuJ1-stained axons (G). Higher-power
magnification of axons in p75 / embryos (I,
J) shows that S100 staining
(J) is absent at the distal tip of the
TuJ1-positive (I) axons (top
arrow in J, I) but can be
seen more proximal to the TG (bottom arrow in
J, I).
|
|
View larger version (36K):
[in this window]
[in a new window]
|
Figure 5.
Analysis of S100 immunoreactivity in relation
to the distal tips of tubulin-positive TG axons. Confocal images were
used to measure the distance from the tip of the tubulin-positive axon
to the nearest S100-immunoreactive Schwann cell at E14.5. Three to
five tubulin-positive tips were randomly chosen for measurement in
control (n = 48) and mutant (n = 45) skin samples. The results of measurements are summarized.
|
|
Schwann cell ensheathment of the developing axons is decreased at
the ultrastructural level
Loss of S100 immunoreactivity suggests that p75 / embryos
may have fewer Schwann cells along their developing axons or that
Schwann cells express less S100. To address this issue, we used
electron microscopy to examine Schwann cells along developing axons in
p75 mutant embryos. Skin above the eye innervated by the TG from E13.5
p75 +/ and p75 / embryos was used. Tissue was sectioned with the
plane of the skin to produce a roughly longitudinal view of axons with
their associated Schwann cells. Sections were taken from regions
highest in neurite density to improve chances of finding axons by
electron microscopy. We estimate this area of highest density to be
relatively proximal to the eye (Fig.
2E,F). Electron microscopy
was performed on several nerves from control and p75 mutant embryos.
Axon bundles in the p75 / embryos appeared disorganized and smaller
than those of control embryos (Fig. 6).
In control embryos, Schwann cell cytoplasm was always seen to
completely encase the axon bundle. Frequently, large regions of axon
bundles were bare of Schwann cell cytoplasm in the p75 / embryos.
These results demonstrate that the developing axons in p75 mutant
embryos have less ensheathment of the developing nerves by Schwann
cells.
View larger version (130K):
[in this window]
[in a new window]
|
Figure 6.
Electron microscopy images of axons innervating
the skin above the eye at E13.5 in control and p75 mutant embryos.
Sections with the plane of the skin expose a roughly longitudinal view
of the axon bundle with associated Schwann cells. Schwann cell nuclei
(SCN) and axons are labeled. A, In
micrograph from control embryo, axon bundle is organized and well
defined. Schwann cell cytoplasm makes contact with and ensheaths the
axon bundle (arrows). Cytoplasmic processes from Schwann
cells also innervate the axon bundle (arrowheads). Scale
bars (shown in A and B): 10 µm.
B, In micrograph from p75 / embryos, the axon bundle
is thin and disorganized. Schwann cell cytoplasmic processes make few
contacts with the axon bundle (arrows), whereas much of
the axon bundle is bare of Schwann cell cytoplasmic ensheathment
(arrowheads). C, Higher-power
magnification of box shown in B shows
regions of the axon bundle in contact with Schwann cell cytoplasm
(arrows) and regions of the axon bundle without Schwann
cell cytoplasm ensheathment (arrowheads). Scale bar, 5 µm.
|
|
Schwann cell migration from the DRG of p75 / embryos was
decreased in vitro
p75 is strongly expressed in the membrane of Schwann cell
cytoplasmic processes in several tissues (Taniuchi et al., 1988; Byers,
1990), putting it in position to regulate Schwann cell-axon interaction. Schwann cells and axons interact bi-directionally during
axonal growth (Jessen and Mirsky, 1991) to regulate Schwann cell
migration (Bhattacharyya et al., 1994) and neurite outgrowth (Zimmermann and Sutter, 1983; Bixby et al., 1988). Schwann cell migration therefore may contribute to axonal morphology (Morris et al.,
1999). To investigate the nature of the Schwann cell defects seen
in vivo, we assayed the capability of Schwann cells from p75
mutant embryos to migrate in vitro.
Schwann cell migration assays were performed using cervical DRG from
E12.5 p75 +/+, +/, and / embryos. After 72 hr in culture, Schwann
cell migration along sciatic nerve cryosections was measured from the
leading edge of the DRG to the farthest Schwann cell as visualized with
vital dye. The Schwann cell migration distance results from at least
three experiments were pooled, and measurements were comparable across
experiments. Schwann cell migration from the DRG of E12.5 p75 /
embryos was decreased by 15% compared with migration from the DRG of
p75 +/+ embryos (p75 +/+, 1.99 ± 0.04 mm, n = 88;
p75 /, 1.7 ± 0.06 mm, n = 49;
p < 0.001) (Fig.
7A). Schwann cell migration
from the DRG of p75 / embryos compared with migration from the DRG
of p75 +/ was decreased by 11% (p75 +/, 1.91 ± 0.05 mm,
n = 71; p = 0.01) (Fig. 7A). The difference in Schwann cell migration between +/+ and +/ cultures was not statistically significant.
View larger version (76K):
[in this window]
[in a new window]
|
Figure 7.
In vitro Schwann cell migration
from the DRG of control and p75 / embryos. A,
Bar graph shows mean distance (mm) of
Schwann cell migration and SEM in 72 hr DRG cultures from p75 +/+,
+/, and / embryos. Migration of Schwann cells from the DRG of p75
/ embryos is significantly lower (asterisk) than
migration from both the DRG of p75 +/+ embryos
(p < 0.001) and the DRG of p75 +/ embryos
(p = 0.01). Representative micrographs
showing vital dye staining of DRG and Schwann cells along the sciatic
nerve are marked with a line demonstrating measurement of Schwann cell
migration distance. B, Bar graph shows
mean distance (mm) of Schwann cell migration and SEM
without or with NGF (10 ng/ml) in 5 d cultures from control and
p75 / embryos. Representative micrographs showing vital dye-stained
Schwann cells along the sciatic nerve are marked with a
line demonstrating measurement of Schwann cell migration
distance from original location of the DRG. Micrographs show that
NGF-treated cultures from the DRG of both p75 +/ and p75 /
embryos have many Schwann cells that are adhered to the glass
coverslip.
|
|
Schwann cell migration from P1 rat DRG can be decreased in the presence
of antibodies against NGF (Anton et al., 1994). This implies that NGF
binding to p75 may affect Schwann cell migration. To test how p75 may
affect Schwann cell migration from embryonic DRG in the presence of
NGF, without interference from NGF-induced neurite outgrowth, the
Schwann cell migration assay was modified. E12.5 DRG were again
cultured on sciatic nerve cryosections. Schwann cells were allowed to
migrate onto the sciatic nerve sections for 36 hr. The DRG were then
removed by cutting away the sciatic nerve at the DRG. The medium was
then replaced with fresh medium, with or without NGF (10 ng/ml).
Schwann cell migration was then allowed to proceed for 72 hr. This
culture assay was repeated four times. Groups of the same genotype
performed similarly in each experiment. A comparison of Schwann cell
migration from the DRG of p75 +/ and +/+ embryos revealed no
differences (p75 +/+ without NGF, n = 18; with NGF, n = 22).
As expected in the longer migration experiment, Schwann cell migration
was substantially farther in all groups when compared with the 72 hr
migration distances. Surprisingly, Schwann cells from p75 +/ and +/+
embryos did not migrate farther in the presence of NGF (p75 +/
without NGF, 2.98 ± 0.20 mm, n = 23; p75 +/
with NGF, 2.75 ± 0.13 mm, n = 22) (Fig.
7B). Schwann cells from the DRG of p75 / embryos also do
not migrate significantly farther in the presence of NGF (p75 /
without NGF, 3.20 ± 0.17 mm, n = 26; p75 /
with NGF 3.49 ± 0.13 mm, n = 30). Although NGF
does not appear to affect migration in this assay, addition of NGF appears to qualitatively affect the number of cells adhered to the
glass coverslip after removal of the DRG. This was observed in all p75
genotypes. Using one-way ANOVA, there was a statistically significant
difference (p < 0.01) in Schwann cell migration
from the DRG of p75 / and p75 +/ embryos in the presence of NGF. The biological relevance of this difference is not clear because embryonic Schwann cells did not show a statistically significant response to NGF. These experiments suggest that p75 regulates embryonic
Schwann cell migration in an NGF-independent manner.
| |
DISCUSSION |
Our data show that p75 is important for the developmental
morphology of nerves in the limbs as well as nerves derived from the
trigeminal ganglia. In addition, we found that immunoreactivity for
Schwann cell marker S100 along the developing ophthalmic branch of
the TG from p75 / embryos is decreased or absent in regions.
Schwann cell ensheathment of the developing sensory axon bundles was
also severely impaired. These observations are supported by in
vitro studies showing a decrease in neurite outgrowth and Schwann
cell migration from E12.5 DRG of p75 / embryos. Taken together,
these data suggest that p75 plays an important role in axon growth and
Schwann cell migration.
Because the p75 mutation affects a wide range of peripheral neurons in
adult mice, including sensory neurons (Lee et al., 1992) and
sympathetic neurons (Lee et al., 1994a), we hypothesized that
p75 may be important for aspects of general axon innervation and
growth. Our results show that several types of peripheral nerves are
indeed severely stunted in the p75 mutant embryo. The aberrant
morphology of the p75 peripheral nerves is likely responsible for much
of the sensory neuron loss and innervation deficits described in p75
mutant adult mice. The stunted axons in the p75 / embryos may not
receive adequate neurotrophic and morphogenic cues from intermediate
and final target fields, thereby resulting in deficiencies in
innervation and neuron loss. Further studies to determine the timing of
neuronal loss in the DRG of p75 mutant mice and the mechanism of that
loss (i.e., programmed cell death) will be required to finally
elucidate this point. Our results suggest that the general mechanisms
by which p75 supports appropriate peripheral innervation is
morphological in nature, involving both axonal growth and arborization.
Several cellular phenomena likely contribute to the effect of p75 on
axon growth and morphology, including (1) axonal extension and (2)
axonal arborization and branching. In the case of axonal extension, our
in vitro results suggest that neurite outgrowth is indeed
decreased in p75 / embryos. This is also consistent with recent
work demonstrating that p75 acts through Rho to stimulate neurite
outgrowth (Yamashita et al., 1999). In the case of arbor formation and
branching, p75 may modulate these activities through both axon-target
field interactions and axon-Schwann cell interactions.
Because p75 is also expressed in the target tissue (Wheeler and
Bothwell, 1992), it is reasonable to consider that interaction of axons
with the target field may have profound effects on axon morphology.
In vitro assays have shown that innervation morphology, either an unbranched extension or an arbor formation, is dependent on
the age of the target tissue (Erzurumlu and Jhaveri, 1995). This work
indicates that molecular cues within the target tissue direct
morphological aspects such as branching. p75 has been shown to regulate
sprouting patterns of sympathetic fibers into the TG (Walsh et al.,
1999), thus acting as a target-derived cue for sprouting pattern
and organization. These data support the possibility that p75 may act
in the target to direct axon morphology and demonstrate the importance
of the target in axon morphology. This also raises the possibility that
topographically, the stunted axons in p75 / embryos may not
be exposed to appropriate levels of target field factors such as
neurotrophins, which are known to affect branching (Cohen-Cory and
Fraser, 1995; Gallo and Letourneau, 1998; Cohen-Cory, 1999; Lom and
Cohen-Cory, 1999).
Differential innervation by TG (the ophthalmic branch vs the maxillary
branch) to its targets in the p75 / embryo suggests that p75 has
variable effects on axon-target interactions. Expression studies
indicate that p75 is expressed throughout the TG (Yan and Johnson,
1988; Hallböök et al., 1990); therefore, uneven expression
of p75 in the neurons of the TG is likely not responsible for the
differential loss of innervation. Differential loss of target
innervation has previously been found in the p75 mutant mice, including
loss of sympathetic innervation to the lateral but not medial footpads
(Lee et al., 1994a) and loss of proprioceptive innervation to
the soleus muscle but not the fast hindlimb muscles (Fan et al., 1999).
These data suggest that differential effects on target innervation are
most likely explained by differences in the molecular cues in the
target tissue supporting innervation. p75 may also contribute to
aspects of axon extension, branching, and axon-target interaction
mediated by Schwann cells.
Our finding that p75 regulates Schwann cell migration in
vitro, affects the distal localization of S100-immunoreactive
Schwann cells in vivo, and is important for Schwann cell
cytoplasmic ensheathment of the growing axon bundle suggests that p75
plays an important role in Schwann cell development and Schwann
cell-mediated axonal growth. Several studies indicate that Schwann
cells are important in axonal growth and morphology (Zimmermann and
Sutter, 1983; Bixby et al., 1988; Jessen and Mirsky, 1991). Mice
deficient for tyrosine kinase receptors erbB2 (Morris et al., 1999) and
erbB3 (Riethmacher et al., 1997) have severe deficits of peripheral innervation and a corresponding lack of Schwann cells in the periphery. Schwann cells in these mutants failed to migrate farther than the most
proximal regions of the DRG nerve root. In vitro, a decrease in neurite outgrowth from embryonic DRG of erbB2 mutants could be
rescued by the addition of wild-type Schwann cells to the culture (Morris et al., 1999). These results suggest a direct link between Schwann cell migration and axonal outgrowth. We deduce that the defect
in Schwann cell migration from DRG of p75 / embryos may also
contribute to the observed deficits in axonal outgrowth.
Although NGF has been shown to stimulate Schwann cell migration from
neonatal rat DRG (Anton et al., 1994), we show here that in embryonic
mouse DRG, NGF is not sufficient to alter Schwann cell migration. This
surprising result is supported by our experiments on transected sciatic
nerves and work showing that the culture conditions used here are
capable of supporting migration induction (Morris et al., 1999). The
increase in Schwann cell migration from neonatal rat DRG on transected
sciatic nerves (Anton et al., 1994) was not observed in our embryonic
DRG cultures on transected sciatic nerves (data not shown). We have
also shown that our culture conditions can support migration from
neonatal murine DRG in response to neuregulin (Morris et al., 1999),
similar to the response seen in neonatal rat DRG (Mahanthappa et al.,
1996).
The lack of NGF-induced migration response from embryonic DRG suggests
that either (1) NGF has no affect on embryonic Schwann cell migration
or (2) other factors or substrates not present in the culture assay are
required for the NGF response. Interestingly, neuregulin, the ligand
for the erbB2 and erbB3 heterodimer, is also unable to elicit a
migration response in embryonic Schwann cells, despite the fact that
deletion of the erbB2 gene clearly leads to a decrease in migration and
neuregulin can induce migration from neonatal DRG (Morris et al.,
1999). A trend emerges in which neonatal mouse Schwann cells can
respond to the ligands NGF and neuregulin, whereas migration of
embryonic Schwann cells is independent of these ligands. These data
indicate a distinct developmental difference between embryonic and
neonatal Schwann cells.
Taken together, the decrease in Schwann cell migration from the DRG of
p75 / and erbB2 / embryos implies that these receptors impart
some intrinsic migration capabilities on Schwann cells. Therefore, the
role of p75 in Schwann cell migration is likely more complex than a
simple NGF migration response.
Decreased S100 immunoreactivity along the developing TG axons in the
skin further advocates the importance of p75 in Schwann cell function.
It is not clear whether this decrease results from a lower expression
within a given cell, a decreased number of Schwann cells, particularly
if they fail to migrate, or a combination of both scenarios. In the
first case, we must consider the significance of S100, not only as a
marker but as a calcium-modulating protein involved in many cellular
activities: cell-cell communication, cell growth, cell shape, and
signal transduction (Zimmer et al., 1995). Decreased S100 staining
may be secondary to a developmental delay in the Schwann cells of p75
/ embryos or a primary effect of p75 on regulation of S100
expression. However, electron microscopy of embryonic axons and their
associated Schwann cells suggests that the number of Schwann cells is
indeed decreased along developing axons. These ultrastructural studies
also indicate a severe disruption in Schwann cell cytoplasmic
ensheathment of the developing axon.
The results presented here demonstrate that p75 is a multifunctional
regulator of embryonic neural and Schwann cell development. p75 is
required for appropriate axonal morphology and outgrowth and for
complete Schwann cell migration. Future studies using cell
type-specific gene knockout technologies will be required to understand
how p75 expression in the neurons, Schwann cells, and target tissues
contributes to the axon and Schwann cell defects.
| |
FOOTNOTES |
Received Dec. 28, 1999; revised Aug. 3, 2000; accepted Aug. 8, 2000.
This work was supported by grants from National Institutes of Health
(HD34534 and AG10435) and the March of Dimes Foundation. K.F.L. is a
Pew Scholar. We thank J. Morris, J. Pitman, and T.-C. Sung for critical
reading of this manuscript. We are also grateful to J. Morris for
advice on the Schwann cell migration assay. We thank the Electron
Microscopy Core at the Veterans Administration Hospital,
University of California San Diego for excellent technical support.
Thanks to Susan Fitzpatrick for editorial assistance.
Correspondence should be addressed to Dr. Kuo-Fen Lee, The Salk
Institute, 10010 N. Torrey Pines Road, La Jolla, CA 92037. E-mail:
klee{at}salk.edu.
| |
REFERENCES |
-
Anton ES,
Weskamp G,
Reichardt LF,
Matthew W
(1994)
Nerve growth factor and its low-affinity receptor promote Schwann cell migration.
Proc Natl Acad Sci USA
91:2795-2799[Abstract/Free Full Text].
-
Bamji SX,
Majdan M,
Pozniak CD,
Belliveau DJ,
Aloyz R,
Kohn J,
Causing CG,
Miller FD
(1998)
The p75 neurotrophin receptor mediates neuronal apoptosis and is essential for naturally occurring sympathetic neuron death.
J Cell Biol
140:911-923[Abstract/Free Full Text].
-
Barker PA,
Shooter EM
(1994)
Disruption of NGF binding to the low-affinity neurotrophin receptor p75 reduces NGF binding to trkA on PC12 cells.
Neuron
13:203-215[Web of Science][Medline].
-
Barrett GL,
Bartlett PF
(1994)
The p75 NGF receptor mediates survival or death depending on the stage of sensory neuron development.
Proc Natl Acad Sci USA
91:6501-6505[Abstract/Free Full Text].
-
Bergmann I,
Priestley JV,
McMahon SB,
Bröcker E-B,
Toyka KV,
Koltzenburg M
(1997)
Analysis of cutaneous sensory neurons in transgenic mice lacking the low affinity neurotrophin receptor p75.
Eur J Neurosci
9:18-28[Web of Science][Medline].
-
Bhattacharyya A,
Brackenbury R,
Ratner N
(1994)
Axons arrest the migration of Schwann cell precursors.
Development
120:1411-1420[Abstract].
-
Bixby JL,
Lilien J,
Reichardt LF
(1988)
Identification of the major proteins that promote neuronal process outgrowth on Schwann cells in vitro.
J Cell Biol
107:353-361[Abstract/Free Full Text].
-
Bothwell M
(1991)
Keeping track of neurotrophin receptors.
Cell
65:915-918[Web of Science][Medline].
-
Brennan C,
Rivas-Plata K,
Landis SC
(1999)
The p75 neurotrophin receptor influences neurotrophin-3 responsiveness of sympathetic neurons in vivo.
Nat Neurosci
2:699-705[Web of Science][Medline].
-
Byers MR
(1990)
Segregation of NGF receptor in sensory receptors, nerves and local cells of teeth and periodontium demonstrated by EM immunocytochemistry.
J Neurocytol
19:765-775[Web of Science][Medline].
-
Carter BD,
Kaltschmidt C,
Kaltschmidt B,
Offenhauser N,
Bohm-Matthaei R,
Baeuerle PA,
Barde Y-A
(1996)
Selective activation of NF-
 B by nerve growth factor through the neurotrophin receptor p75.
Science
272:542-545[Abstract]. -
Casaccia-Bonnefil P,
Carter B,
Dobrowsky RT,
Chao MV
(1996)
Death of oligodendrocytes mediated by the interaction of nerve growth factor with its receptor p75.
Nature
383:716-719[Medline].
-
Chao MV
(1992)
Neurotrophin receptors: a window into neuronal differentiation.
Neuron
9:583-593[Web of Science][Medline].
-
Cohen-Cory S
(1999)
BDNF modulates, but does not mediate, activity-dependent branching and remodeling of optic axon arbors in vivo.
J Neurosci
19:9996-10003[Abstract/Free Full Text].
-
Cohen-Cory S,
Fraser SE
(1995)
Effects of brain-derived neurotrophic factor on optic axon branching and remodelling in vivo.
Nature
378:192-196[Medline].
-
Davies AM,
Lee KF,
Jaenisch R
(1993)
p75-deficient trigeminal sensory neurons have an altered response to NGF but not to other neurotrophins.
Neuron
11:565-574[Web of Science][Medline].
-
Dobrowsky R,
Jenkins GM,
Hannun Y
(1995)
Neurotrophins induce sphingomyelin hydrolysis.
J Biol Chem
270:22135-22142[Abstract/Free Full Text].
-
Erzurumlu RS,
Jhaveri S
(1995)
Target influences on the morphology of trigeminal axons.
Exp Neurol
135:1-16[Web of Science][Medline].
-
Fan G,
Jaenisch R,
Kucera J
(1999)
A role for p75 receptor in neurotrophin-3 functioning during the development of limb proprioception.
Neuroscience
90:259-268[Web of Science][Medline].
-
Frade JM,
Rodriguez-Tebar A,
Barde Y-A
(1996)
Induction of cell death by endogenous nerve growth factor through its p75 receptor.
Nature
383:166-168[Medline].
-
Fundin BT,
Silos-Santiago I,
Ernfors P,
Fagan AM,
Aldskogius H,
DeChiara TM,
Phillips HS,
Barbacid M,
Yancopoulos GD,
Rice FL
(1997)
Differential dependency of cutaneous mechanoreceptors on neurotrophins, trk receptors, and p75 LNGFR.
Dev Biol
190:94-116[Web of Science][Medline].
-
Gallo G,
Letourneau PC
(1998)
Localized sources of neurotrophins initiate axon collateral sprouting.
J Neurosci
18:5403-5414[Abstract/Free Full Text].
-
Hallböök F,
Ayer-LeLievre C,
Ebendal T,
Persson H
(1990)
Expression of nerve growth factor receptor mRNA during early development of the chicken embryo: emphasis on cranial ganglia.
Development
108:693-704[Abstract/Free Full Text].
-
Hantzopoulos PA,
Suri C,
Glass DJ,
Goldfarb MP,
Yancopoulos GD
(1994)
The low affinity NGF receptor, p75, can collaborate with each of the Trks to potentiate functional responses to the neurotrophins.
Neuron
13:187-201[Web of Science][Medline].
-
Huber LJ,
Chao MV
(1995)
A potential interaction of p75 and trkA NGF receptors revealed by affinity crosslinking and immunoprecipitation.
J Neurosci Res
40:557-563[Web of Science][Medline].
-
Jessen KR,
Mirsky R
(1991)
Schwann cell precursors and their development.
Glia
4:185-194[Web of Science][Medline].
-
Kaplan DR,
Miller FD
(1997)
Signal transduction by the neurotrophin receptors.
Curr Opin Cell Biol
9:213-221[Web of Science][Medline].
-
Lee K-F,
Li E,
Huber LJ,
Landis SC,
Sharpe AH,
Chao MC,
Jaenisch R
(1992)
Targeted mutation of the gene encoding the low affinity NGF receptor p75 leads to deficits in the peripheral sensory nervous system.
Cell
69:737-749[Web of Science][Medline].
-
Lee K-F,
Bachman K,
Landis S,
Jaenisch R
(1994a)
Dependence on p75 for innervation of some sympathetic targets.
Science
263:1447-1449[Abstract/Free Full Text].
-
Lee K-F,
Davies AM,
Jaenisch R
(1994b)
p75-deficient embryonic dorsal root sensory and neonatal sympathetic neurons displayed decreased sensitivity to NGF.
Development
120:1027-1033[Abstract].
-
Lom B,
Cohen-Cory S
(1999)
Brain-derived neurotrophic factor differentially regulates retinal ganglion cell dendritic and axonal arborization in vivo.
J Neurosci
19:9928-9938[Abstract/Free Full Text].
-
Mahanthappa NK,
Anton ES,
Matthew WD
(1996)
Glial growth factor 2, a soluble neuregulin, directly increases Schwann cell motility and indirectly promotes neurite outgrowth.
J Neurosci
16:4673-4683[Abstract/Free Full Text].
-
McAllister AK,
Katz LC,
Lo DC
(1999)
Neurotrophins and synaptic plasticity.
Annu Rev Neurosci
22:295-318[Web of Science][Medline].
-
Morris JK,
Lin W,
Hauser C,
Marchuk Y,
Getman D,
Lee K-F
(1999)
Genetic rescue of cardiac defect in erbB2 null mutant mice reveals essential roles of erbB2 in development of the peripheral nervous system.
Neuron
23:273-283[Web of Science][Medline].
-
Rabizadeh S,
Oh J,
Zhong L-T,
Yang J,
Bitler CM,
Butcher LL,
Bredesen DE
(1993)
Induction of apoptosis by the low-affinity NGF receptor.
Science
261:345-348[Abstract/Free Full Text].
-
Rice FL,
Albers KM,
Davis BM,
Silos-Santiago I,
Wilkinson GA,
LeMaster AM,
Ernfors P,
Smeyne RJ,
Aldskogius H,
Phillips HS,
Barbacid M,
DeChiara TM,
Yancopoulos GD,
Dunne CE,
Fundin BT
(1998)
Differential dependency of unmyelinated and A delta epidermal and upper dermal innervation on neurotrophins, trk receptors, and p75LNGFR.
Dev Biol
198:57-81[Web of Science][Medline].
-
Riethmacher D,
Sonnenberg-Riethmacher E,
Brinkmann V,
Yamaai T,
Lewin GR,
Birchmeier C
(1997)
Severe neuropathies in mice with targeted mutations in the ErbB3 receptor.
Nature
389:725-730[Medline].
-
Rodríguez-Tébar A,
Dechant G,
Barde Y-A
(1990)
Binding of brain-derived neurotrophic factor to the nerve growth factor receptor.
Neuron
4:487-492[Web of Science][Medline].
-
Rodríguez-Tébar A,
Dechant G,
Götz R,
Barde Y-A
(1992)
Binding of neurotrophin-3 to its neuronal receptors and interactions with nerve growth factor and brain-derived neurotrophic factor.
EMBO J
11:917-922[Web of Science][Medline].
-
Sandrock Jr AW,
Matthew WD
(1987)
Identification of a peripheral nerve neurite growth-promoting activity by development and use of an in vitro bioassay.
Proc Natl Acad Sci USA
84:6934-6938[Abstract/Free Full Text].
-
Snider WD
(1994)
Functions of the neurotrophins during nervous system development: what the knockouts are teaching us.
Cell
77:627-638[Web of Science][Medline].
-
Taniuchi M,
Clark HB,
Schweitzer JB,
Johnson EM
(1988)
Expression of nerve growth factor receptors by Schwann cells of axotomized peripheral nerves: ultrastructural location, suppression by axonal contact, and binding properties.
J Neurosci
8:664-681[Abstract].
-
Tuttle R,
Matthew WD
(1991)
An in vitro bioassay for neurite growth using cryostat sections of nervous tissue as a substratum.
J Neurosci Med
39:193-202.
-
Twiss JL,
Wada HG,
Fok KS,
Chan SDH,
Verity AN,
Baxter GT,
Shooter EM,
Sussman HH
(1998)
Duration and magnitude of nerve growth factor signaling depend on the ratio of p75LNTR to TrkA.
J Neurosci Res
51:442-453[Web of Science][Medline].
-
Verdi JM,
Birren S,
Ibanez CF,
Persson H,
Kaplan DR,
Benedetti M,
Chao M,
Anderson D
(1994)
p75LNGFR regulates Trk signal transduction and NGF-induced neuronal differentiation in MAH cells.
Neuron
12:733-745[Web of Science][Medline].
-
Walsh GS,
Krol KM,
Kawaja MD
(1999)
Absence of the p75 neurotrophin receptor alters the pattern of sympathosensory sprouting in the trigeminal ganglia of mice overexpressing nerve growth factor.
J Neurosci
19:258-273[Abstract/Free Full Text].
-
Wheeler EF,
Bothwell M
(1992)
Spatiotemporal patterns of expression of NGF and the low-affinity NGF receptor in rat embryos suggest functional roles in tissue morphogenesis and myogenesis.
J Neurosci
12:930-945[Abstract].
-
Woldeyesus MT,
Britsch S,
Riethmacher D,
Xu L,
Sonnenberg-Riethmacher E,
Abou-Rebyeh F,
Harvey R,
Caroni P,
Birchmeier C
(1999)
Peripheral nervous system defects in erbB2 mutants following genetic rescue of heart development.
Genes Dev
13:2538-2548[Abstract/Free Full Text].
-
Wolf DE,
McKinnon CA,
Daou M-C,
Stephens RM,
Kaplan DR,
Ross AH
(1995)
Interaction with TrkA immobilizes gp75 in the high affinity nerve growth factor receptor complex.
J Biol Chem
270:2133-2138[Abstract/Free Full Text].
-
Wright DE,
Snider WD
(1995)
Neurotrophin receptor mRNA expression defines distinct populations of neurons in rat dorsal root ganglia.
J Comp Neurol
351:329-338[Web of Science][Medline].
-
Yamashita T,
Tucker KL,
Barde Y-A
(1999)
Neurotrophin binding to the p75 receptor modulates Rho activity and axonal outgrowth.
Neuron
24:585-593[Web of Science][Medline].
-
Yan Q,
Johnson Jr EM
(1988)
An immunohistochemical study of the nerve growth factor receptor in developing rats.
J Neurosci
8:3481-3498[Abstract].
-
Zimmer DB,
Cornwall EH,
Landar A,
Song W
(1995)
The S100 protein family: history, function, and expression.
Brain Res Bull
37:417-429[Web of Science][Medline].
-
Zimmermann A,
Sutter A
(1983)
-Nerve growth factor (NGF) receptors on glial cells. Cell-cell interaction between neurons and Schwann cells in cultures of chick sensory ganglia.
EMBO J
2:879-885[Web of Science][Medline].
Copyright © 2000 Society for Neuroscience 0270-6474/00/20207706-10$05.00/0
This article has been cited by other articles:
|
|
|
|
 
T. G. Bengoechea, Z. Chen, D. A. O'Leary, E. Masliah, and K.-F. Lee
p75 reduces {beta}-amyloid-induced sympathetic innervation deficits in an Alzheimer's disease mouse model
PNAS,
May 12, 2009;
106(19):
7870 - 7875.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Xiao, A. W. Wong, M. M. Willingham, S. K. Kaasinen, I. A. Hendry, J. Howitt, U. Putz, G. L. Barrett, T. J. Kilpatrick, and S. S. Murray
BDNF Exerts Contrasting Effects on Peripheral Myelination of NGF-Dependent and BDNF-Dependent DRG Neurons
J. Neurosci.,
April 1, 2009;
29(13):
4016 - 4022.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Ben-Zvi, L. Ben-Gigi, H. Klein, and O. Behar
Modulation of Semaphorin3A Activity by p75 Neurotrophin Receptor Influences Peripheral Axon Patterning
J. Neurosci.,
November 21, 2007;
27(47):
13000 - 13011.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. F Reichardt
Neurotrophin-regulated signalling pathways
Phil Trans R Soc B,
September 29, 2006;
361(1473):
1545 - 1564.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. Tapinos and A. Rambukkana
Insights into regulation of human Schwann cell proliferation by Erk1/2 via a MEK-independent and p56Lck-dependent pathway from leprosy bacilli
PNAS,
June 28, 2005;
102(26):
9188 - 9193.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. L. Hempstead
Coupling neurotrophins to cell migration through selective guanine nucleotide exchange factor activation
PNAS,
April 19, 2005;
102(16):
5645 - 5646.
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. Salama-Cohen, M.-A. Arevalo, J. Meier, R. Grantyn, and A. Rodriguez-Tebar
NGF Controls Dendrite Development in Hippocampal Neurons by Binding to p75NTR and Modulating the Cellular Targets of Notch
Mol. Biol. Cell,
January 1, 2005;
16(1):
339 - 347.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Karabay, W. Yu, J. M. Solowska, D. H. Baird, and P. W. Baas
Axonal Growth Is Sensitive to the Levels of Katanin, a Protein That Severs Microtubules
J. Neurosci.,
June 23, 2004;
24(25):
5778 - 5788.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Yamauchi, J. R. Chan, and E. M. Shooter
Neurotrophins regulate Schwann cell migration by activating divergent signaling pathways dependent on Rho GTPases
PNAS,
June 8, 2004;
101(23):
8774 - 8779.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Gehler, G. Gallo, E. Veien, and P. C. Letourneau
p75 Neurotrophin Receptor Signaling Regulates Growth Cone Filopodial Dynamics through Modulating RhoA Activity
J. Neurosci.,
May 5, 2004;
24(18):
4363 - 4372.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. C. Kanning, M. Hudson, P. S. Amieux, J. C. Wiley, M. Bothwell, and L. C. Schecterson
Proteolytic Processing of the p75 Neurotrophin Receptor and Two Homologs Generates C-Terminal Fragments with Signaling Capability
J. Neurosci.,
July 2, 2003;
23(13):
5425 - 5436.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
W. Tan, S. Rouen, K. M. Barkus, Y. S. Dremina, D. Hui, J. A. Christianson, D. E. Wright, S. O. Yoon, and R. T. Dobrowsky
Nerve Growth Factor Blocks the Glucose-induced Down-regulation of Caveolin-1 Expression in Schwann Cells via p75 Neurotrophin Receptor Signaling
J. Biol. Chem.,
June 13, 2003;
278(25):
23151 - 23162.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Tcherpakov, F. C. Bronfman, S. G. Conticello, A. Vaskovsky, Z. Levy, M. Niinobe, K. Yoshikawa, E. Arenas, and M. Fainzilber
The p75 Neurotrophin Receptor Interacts with Multiple MAGE Proteins
J. Biol. Chem.,
December 13, 2002;
277(51):
49101 - 49104.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. K. Winseck, J. Caldero, D. Ciutat, D. Prevette, S. A. Scott, G. Wang, J. E. Esquerda, and R. W. Oppenheim
In Vivo Analysis of Schwann Cell Programmed Cell Death in the Embryonic Chick: Regulation by Axons and Glial Growth Factor
J. Neurosci.,
June 1, 2002;
22(11):
4509 - 4521.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. S. McQuillen, M. F. DeFreitas, G. Zada, and C. J. Shatz
A Novel Role for p75NTR in Subplate Growth Cone Complexity and Visual Thalamocortical Innervation
J. Neurosci.,
May 1, 2002;
22(9):
3580 - 3593.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. B. Brann, M. Tcherpakov, I. M. Williams, A. H. Futerman, and M. Fainzilber
Nerve Growth Factor-induced p75-mediated Death of Cultured Hippocampal Neurons Is Age-dependent and Transduced through Ceramide Generated by Neutral Sphingomyelinase
J. Biol. Chem.,
March 15, 2002;
277(12):
9812 - 9818.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Fiorentini, N. Guerra, M. Facchetti, A. Finardi, L. Tiberio, L. Schiaffonati, P. Spano, and C. Missale
Nerve Growth Factor Regulates Dopamine D2 Receptor Expression in Prolactinoma Cell Lines via p75NGFR-Mediated Activation of Nuclear Factor-{kappa}B
Mol. Endocrinol.,
February 1, 2002;
16(2):
353 - 366.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. W. Harrington, J. Y. Kim, and S. O. Yoon
Activation of Rac GTPase by p75 Is Necessary for c-jun N-Terminal Kinase-Mediated Apoptosis
J. Neurosci.,
January 1, 2002;
22(1):
156 - 166.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. R. Chan, J. M. Cosgaya, Y. J. Wu, and E. M. Shooter
Neurotrophins are key mediators of the myelination program in the peripheral nervous system
PNAS,
November 15, 2001;
(2001)
251543398.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. Khursigara, J. Bertin, H. Yano, H. Moffett, P. S. DiStefano, and M. V. Chao
A Prosurvival Function for the p75 Receptor Death Domain Mediated via the Caspase Recruitment Domain Receptor-Interacting Protein 2
J. Neurosci.,
August 15, 2001;
21(16):
5854 - 5863.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. R. Chan, J. M. Cosgaya, Y. J. Wu, and E. M. Shooter
Inaugural Article: Neurotrophins are key mediators of the myelination program in the peripheral nervous system
PNAS,
December 4, 2001;
98(25):
14661 - 14668.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION
Gene
