 |
Previous Article | Next Article 
The Journal of Neuroscience, October 15, 2000, 20(20):7743-7751
Nav2/NaG Channel Is Involved in Control of
Salt-Intake Behavior in the CNS
Eiji
Watanabe1, 2, 3,
Akihiro
Fujikawa1,
Haruyuki
Matsunaga1,
Yasunobu
Yasoshima4,
Noritaka
Sako4,
Takashi
Yamamoto4,
Chika
Saegusa1, 3, and
Masaharu
Noda1, 2, 3
1 Division of Molecular Neurobiology, and
2 Center for Transgenic Animals and Plants, National
Institute for Basic Biology, Myodaiji-cho, Okazaki 444-8585, 3 Department of Molecular Biomechanics, The Graduate
University for Advanced Studies, Myodaiji-cho, Okazaki 444-8585,
Japan, and 4 Department of Behavioral Physiology, Faculty
of Human Sciences, Osaka University, 1-2 Yamadaoka, Suita 565-0871,
Japan
 |
ABSTRACT |
Nav2/NaG is a putative sodium channel, whose
physiological role has long been an enigma. We generated
Nav2 gene-deficient mice by inserting the lacZ gene. Analysis of the
targeted mice allowed us to identify Nav2-producing cells
by examining the lacZ expression. Besides in the lung,
heart, dorsal root ganglia, and Schwann cells in the peripheral nervous
system, Nav2 was
expressed in neurons and ependymal cells in restricted areas of the
CNS, particularly in the circumventricular organs, which are involved in body-fluid homeostasis. Under water-depleted conditions,
c-fos expression was markedly elevated in neurons in the
subfornical organ and organum vasculosum laminae terminalis compared
with wild-type animals, suggesting a hyperactive state in the
Nav2-null mice.
Moreover, the null mutants showed abnormal intakes of hypertonic saline
under both water- and salt-depleted conditions. These findings suggest
that the Nav2 channel plays an important role in the
central sensing of body-fluid sodium level and regulation of salt
intake behavior.
Key words:
sodium channel; knock-out mouse; circumventricular
organs; salt appetite; body-fluid homeostasis; osmoreceptor
 |
INTRODUCTION |
Voltage-gated sodium channels
(NaChs) generate the early inward current of action potentials in
neurons, muscles, and related electrically excitable cells, and
are thus essential for a variety of physiological processes (Noda,
1993 ; Catterall, 1995 ). The -subunit of NaCh is the major
subunit that constitutes an ion-selective channel with voltage sensor,
and it is associated with one or two distinct smaller -subunits.
Since -subunit cDNAs for brain types I, II, and III were identified
first by us (Noda et al., 1986 ; Kayano et al., 1988 ), multiple
structurally related isoforms of the -subunit have been cloned from
various mammalian tissues, forming a multigene family (Goldin, 1999 ).
In addition to the excitable cells, it has recently been found that
glial cells also express voltage-sensitive sodium currents (Ritchie,
1992 ; Sontheimer, 1994 ; Sontheimer et al., 1996 ). However, the
functional roles of these NaChs in so-called "electrically
inexcitable cells" have not yet been delineated.
Several years ago, a partial cDNA for the NaCh -subunit, designated
NaG, was cloned from a cDNA library derived from cultured rat
astrocytes (Gautron et al., 1992 ). Subsequently, similar -subunit isoforms were independently cloned from various animal species: Nav2.1 from human heart (George et al., 1992 ),
Nav2.3 from a mouse atrial tumor cell
line (Felipe et al., 1994 ), and SCL11 from rat dorsal root ganglia
(Akopian et al., 1997 ); among them, SCL11 corresponded to an
alternative splicing variant of NaG. From the sequence homology, it is
possible to assume that they are species orthologs and/or to classify
them into another -subunit subfamily of NaCh, subfamily 2 NaCh
(Nav2). The amino acid sequences were highly divergent (<50% overall identity) from those of the previously cloned voltage-gated NaChs even in the regions associated with ion
selectivity and voltage-dependent activation and inactivation, suggesting that the Nav2 has specific channel
properties. However, all the attempts to express functional
Nav2 channels using heterologous expression
systems such as Xenopus oocytes, Chinese hamster ovary cells, and human embryonic kidney 293 cells, (Felipe et al.,
1994 ; Akopian et al., 1997 ) have been unsuccessful.
NaG/SCL11 was originally thought to be one of the NaChs expressed in
astrocytes because it was cloned from cultured astrocytes, but
subsequent in situ hybridization studies revealed that NaG is expressed not in astrocytes but in Schwann cells and the spinal sensory neurons in vivo (Felts et al., 1997 ). Relatively
high levels of NaG mRNA are also detected outside of the nervous
system, particularly in lung, kidney, and heart (Gautron et al., 1992 ; Akopian et al., 1997 ).
To examine the functional role of NaG in vivo, we generated
NaG-deficient mice, in which NaG is expressed as a fusion
protein with -galactosidase at the N terminus. In this study, we
found that mouse NaG corresponds to Nav2.3.
Analysis of -galactosidase activity in the heterozygous (and
homozygous) mutants revealed the localization of the NaG channel with a
high spatiotemporal resolution. This showed for the first time that
mouse NaG was restricted to neurons and ependymal cells in a
subset of nuclei and organs in the CNS. In addition, behavioral studies
of the null mutants revealed a selective involvement of the NaG channel in central control of salt intake behavior.
 |
MATERIALS AND METHODS |
Construction of the targeting vector. Nine
independent genomic clones were isolated from mouse genomic libraries
(kindly donated by Dr. Masahiko Mori, Osaka University, Suita,
Japan) prepared from a cell line, R1, by hybridization with a 446 bp
fragment of rat NaG cDNA (nucleotide residues 11-456 encompassing the
first three coding exons: GenBank accession number Y09164). By Southern blot analysis using several restriction enzymes, all these overlapping clones were confirmed to be derived from a single genomic locus. The
hybridization-positive 3.2 and 3.7 kb HindIII fragments were subcloned into pBluescript II SK( ) (Stratagene, La Jolla, CA) and
subjected to DNA sequencing (the sequence is in GenBank under accession
number AF190472). The 3.2 kb fragment contained protein-coding exon 1 (13 bases of the 5' untranslated region and the first 238 bases in the
mNav2 protein-coding sequence; nucleotide
residues 238-490 of GenBank accession number L36179), and the 3.7 kb fragment contained exons 2 (491-609) and 3 (610-701). To construct the targeting vector, the 12.5 kb SalI fragment containing
the three exons was inserted into the XhoI site of pDT-A
(Yagi et al., 1993 ) (Fig. 1a).
The SalI-XhoI fragment of the lacZ-neo
cassette was introduced into the endogenous XhoI site
located in exon 1. An EcoRI linker sequence was inserted
beforehand into the KpnI site, which is located on the 3'
side of the SalI site in the 5' terminus of the
lacZ-neo cassette, to join the first 20 amino acids of the
mNav2 protein to the N terminus of
-galactosidase and to use it as an exogenous restriction site in
Southern blot screening analysis.

View larger version (40K):
[in this window]
[in a new window]
|
Figure 1.
Targeted disruption of
mNav2 gene. a, Restriction maps
of the targeting vector (top), endogenous
mNav2 gene locus
(middle), and recombinant gene locus
(bottom). The protein-coding exons are indicated as
closed boxes. Targeted insertion of the
lacZ-neo cassette into the first protein-coding exon was
accomplished using the targeting vector. Restriction sites shown are as
follows: B, BamHI; Bg,
BglII; E, EcoRI;
H, HindIII; and X,
XhoI. b, Southern blot analysis of
genomic DNA digested with EcoRI. Samples are derived
from tails of wild-type (+/+), heterozygous (+/ ), and homozygous
( / ) mice. Blotted membranes were hybridized with probe 1 located
outside of the 5' terminus of the targeting vector. The sizes for the
wild-type (18 kb) and recombinant (10 kb) genotypes are shown on the
right. The insertion was verified by using probe 2 located inside the targeting vector. c, Genomic PCR
analysis of wild-type, heterozygous, and homozygous mutant mice. The
sizes for the wild-type (200 bp) and recombinant (400 bp) genotypes are
shown on the right. d, Western blot
analysis using anti-mNav2 polyclonal antibody. Samples were
prepared from the lungs of wild-type, heterozygous, and homozygous
mutant mice. The position of the channel protein (220 kDa) is indicated
on the right. The sodium channel gave a broad signal,
because the protein is highly glycosylated and readily aggregates even
in the SDS-containing buffer.
|
|
Generation of Nav2/NaG deficient mice.
Culture of embryonic stem cells (R1 cell line of 129/Sv mouse) with
G418 and screening of the targeted clones were performed as described
previously (Shintani et al., 1998 ). In brief, homologous recombination
was verified by Southern blot analysis using EcoRI digestion
with probe 1 (Fig. 1a; the 0.3 kb
EcoRI-XbaI fragment located ~8 kb upstream from
the XhoI site in exon 1). The selected clones were checked
using probe 2 (the 0.6 kb PstI fragment derived from the neo gene). The targeted locus was also verified by genomic
PCR using one sense primer (primer 1, ATGTTGACTTCCCCAGAGCC in the 5'
terminal region of exon 1) and two antisense primers (primer 2, AACCAGGCAAAGCGCCATTC in the 5'-terminal region of lacZ;
primer 3, CATCTTCCAAGGGCTCTGACA in the 3'-terminal region of exon 1). Amplification was performed in two stages with EX-Taq DNA
polymerase (Takara, Shiga, Japan) according to the manufacturer's
protocol using a programmable thermal cycler. One of the two targeted
cell lines (of 98 ES clones) was used to generate the mutant mice
through germline transmission. Generation of mutant mice was performed as described previously (Shintani et al., 1998 ). All the animal experiments were performed according to the guidelines of the National
Institute for Basic Biology (Okazaki, Japan).
Western blot. The mNav2-protein
expression in the mutant mice was examined by Western blot analysis.
Lung tissue samples were prepared according to the methods of Knittle
et al. (1996) . SDS-PAGE and immunoblotting were performed as
described previously (Shintani et al., 1998 ).
Anti-mNav2.3 antiserum (a generous gift from Dr. M. Tumkun, Colorado State University, Fort Collins, CO) was used at a 1:500 dilution in PBS. The immunoblots were incubated also with
several nonimmune sera to verify the fidelity of the antibody.
X-Gal staining. Embryos were fixed by immersion in 3.5%
formaldehyde in PBS for 1 hr at room temperature and then cut
midsagittally with a razor. The postnatal animals were perfused
transcardially under deep pentobarbital anesthesia first with PBS and
then with the fixative. The fixed brains were cut coronally at
2-mm-thick or sagittally at the midline level with a razor. Samples
were rinsed twice with PBS and incubated overnight in PBS containing 1 mg/ml X-Gal, 5 mM
K3Fe(CN)6, 5 mM
K4Fe(CN)6, 2 mM
MgCl2, and 0.2% NP-40 at 37°C. For
immunostaining, some X-Gal-stained slices were cut further into coronal
sections at 14-µm-thick with a cryostat microtome and mounted onto
gelatin-coated slides. Immunostaining was performed with rabbit
polyclonal antibodies to neurofilament 200 (N-4142; Sigma, St. Louis,
MO) or glial fibrillary acidic protein (GFAP) (sc-6170; Santa Cruz
Biotechnology, Santa Cruz, CA) as described previously (Shintani et
al., 1998 ).
Fos-immunohistochemistry. Animals were deprived of water for
0 hr (n = 4 for
mNav2+/+;
n = 4 for
mNav2 / ),
12 hr (n = 5 and 5), 24 hr (n = 6 and
7), or 48 hr (n = 6 and 5). The animals were then
perfused with the fixative as described above, and their brains were
immersed in the same fixative at 4°C overnight. Brains were cut
coronally into serial sections at 50-µm-thick on a vibratome
(VT1000S; Leica, Heerbrugg, Switzerland). Immunostaining was performed
by free floating with a goat anti-Fos polyclonal antibody (sc-52-G;
Santa Cruz Biotechnology) at a dilution of 1:1000 in PBS. Sections
containing regions of interest were chosen, and the Fos-immunopositive
nuclei were enumerated. Each area was measured by using an image
analysis system (KS400 attached to Axiophoto2; Zeiss,
Hallbergmoos, Germany). The number of nuclei present per square
millimeter was determined in five regions of the brain: organum
vasculosum laminae terminalis (OVLT), subfornical organ (SFO), median
preoptic nucleus (MnPO), supraoptic nucleus (SON), and paraventricular
nucleus (PVN).
Behavioral analyses. For all behavioral studies, male mice
at 12-24 weeks of age were used. They were individually housed under
constant room temperature, humidity, and 12 hr light/dark cycle (lights
on at 7:00 A.M.). Protocols: (1) Preference-aversion behavior was
measured with a 48 hr two-bottle preference test (see Fig. 5).
Mice were presented with a choice between distilled water and a tasting
solution for 48 hr in their home cage: the positions of the two bottles
were switched every 24 hr to avoid side preference. The total intake
for each animal in 48 hr was measured and used to calculate a
preference ratio according to the following formula: preference
ratio = volume of tasting solution (in milliliters)/total intake
volume of tasting solution and water (in milliliters). (2)
Dehydration-induced aversion to hypertonic saline was assessed with a 6 hr two-bottle preference test in the home cages (see Fig. 7). Before
testing, mice were trained to drink water from two bottles for 1 week.
On the day before dehydration, mice were presented with a choice
between water and 0.3 M NaCl at 10:00 A.M. and then
measured for fluid intake at 4:00 P.M. At 10:00 A.M. on the next day,
the bottles were removed. Dry food was placed throughout the period of
water deprivation. After 24 hr dehydration, the two bottles were
returned, and fluid intakes were measured at 4:00 P.M. In some cases,
blood was recovered by decapitation from animals before or after
dehydration, and then the concentrations of plasma electrolytes were
measured by using an electrolyte analyzer (9180; AVL Scientific,
Roswell, GA). (3) The sodium depletion-induced salt appetite test was
performed in the following way (see Fig. 8). Before testing, control
measurements of water and 0.3 M NaCl intake were performed
for several days. At 10:00 A.M., mice were injected intraperitoneally
with 0.12 ml of normal saline (0.9% NaCl). The bottle of 0.3 M NaCl was withdrawn, and sodium-depleted food was supplied
in place of a normal diet. A second injection of normal saline was
given at 4:00 P.M. On the following day, water and 0.3 M
NaCl were presented at 10:00 A.M., and intakes of 0.3 M
NaCl and water were measured at 12:00, 2:00, and 4:00 P.M. After that,
a similar protocol with furosemide injection (0.6 mg in 0.12 ml of
normal saline) was performed with a sodium-depleted food in the same
mice (acute salt-appetite condition). Finally, the same protocol,
except that normal sodium-containing food was supplied, was performed
to evaluate the effect of sodium-depleted food.
Electrophysiology. Male mice at 12-24 weeks of age were
used (four wild-type and five homozygous mice for the normal condition and three and five mice for the acute salt-appetite condition as
described above). The animals were deeply anesthetized by an intraperitoneal injection of sodium pentobarbital (60 mg/kg). Each
animal was tracheotomized and secured with a head holder. The right
chorda tympani nerve was exposed, freed from surrounding tissues, and
cut at the point of its entry to the bulla. The whole bundle of the
nerve was dissected and lifted on a platinum wire recording electrode
(0.1 mm in diameter). An indifferent electrode was attached to nearby
tissue. The nerve activities were amplified, displayed on an
oscilloscope, and monitored with an audioamplifier. The amplified
signal was passed through an integrator with a time constant of 0.3 sec
and was displayed on a slipchart recorder. The taste solutions were (in
M): 0.1 NH4Cl, 0.1 NaCl, 0.5 sucrose, 0.01 HCl, 0.02 Q-HCl, 0.1 KCl, and 0.1 CH3COONa.
These solutions were made up with distilled water or 0.1 mM
amiloride solution. Each solution and rinsing water were applied to the
anterior part of the tongue at room temperature (25 ± 2°C). The
tongue was rinsed for at least 45 sec between successive stimulations.
The magnitude of the whole nerve response was measured as the height of
the integrated response from the baseline at 10 sec after onset of stimulation. Responses to taste stimuli were expressed as relative values with the magnitude of the response to 0.1 M
NH4Cl taken as the standard.
 |
RESULTS |
Mouse Nav2.3 is the ortholog of
rat NaG/SCL11
To construct the targeting vector (Fig. 1a), we cloned
mouse genomic fragments containing protein-coding exons 1, 2, and 3 with a rat NaG/SCL11 probe. The DNA sequence encoding the three exons
was identical to that of mouse
Nav2.3 cDNA cloned by Tamkun and
coworkers (Felipe et al., 1994 ). The cloned genomic fragments showed
identical restriction maps with mouse genomic DNA on Southern blot
analysis with four restriction enzymes (BamHI,
BglII, EcoRI, and HindIII; data not
shown). This finding indicates that mouse Nav2.3
is the ortholog of rat NaG. In this paper, we designate Nav2.3/NaG/SCL11 as
Nav2.
Targeted disruption of mNav2 gene
The lacZ gene was designed to be inserted in-frame into
the protein-coding exon 1 of the mNav2
gene: the N-terminal 20 amino-acid sequence of
mNav2 is fused with -galactosidase. The
original genomic structure of mNav2 gene
was not modified in the targeting vector except for the insertion of
the lacZ-neo cassette (Fig. 1a) to
make sure that the lacZ gene is expressed in place of the mNav2 gene in the targeted mice. The gene
replacement was confirmed by genomic Southern blot hybridization (Fig.
1b) and PCR (Fig. 1c) analysis and the absence of
mNav2 protein expression by immunoblot analysis
with anti-mNav2 antibody (Fig. 1d).
Approximately half of the normal amount of mNav2
protein in heterozygous mutant
(mNav2+/ ) mice
and no mNav2 protein in homozygous mutant
(mNav2 / )
mice was detected in lung membrane preparations, indicating that the
allele was a null mutation.
Figure 2a shows X-Gal staining
of a whole-mount
mNav2+/ embryo
at embryonic day 15 (E15). Intensive -galactosidase activity was
observed in the trigeminal and dorsal root ganglia (DRG). In E15 mice,
lacZ expression was evident also in the lung. In these
organs, the expression of lacZ persisted into adulthood. When DRGs were cut into thin sections after X-Gal staining,
-galactosidase activity was detected in spinal sensory neurons with
various cellular diameters (Fig. 2b). Signals were confined
to the somata of neurons within the DRG, and they were not detected in
axons. A similar pattern of lacZ expression was observed in
tissue sections of the trigeminal ganglia. Positive expression was also
observed in Schwann cells in the adult sympathetic trunk (Fig.
2c), cardiac autonomic nerves, lingual nerves, nonmyelinated
nerve fibers beneath the taste buds, and uterine nerves (data not
shown). These patterns of lacZ expression agreed well with
the results of Northern blot, RT-PCR, RNase protection, and
in situ hybridization studies on rNav2 and
mNav2 expressions (Gautron et al., 1992 ;
Akopian et al., 1997 ; Felts et al., 1997 ), indicating that the
lacZ gene expression is duly under the control of the
regulatory elements of the mNav2
gene.

View larger version (134K):
[in this window]
[in a new window]
|
Figure 2.
The distribution pattern of lacZ
expression in the peripheral organs. a,
LacZ expression in whole-mount E15 embryos of
mNav2+/ mice.
E15 embryo was cut midsagittally and then stained with X-Gal. The
blue signals represent the site expressing
lacZ. The arrow points to DRGs, the
arrowhead points to a trigeminal ganglion, and the
asterisk shows the lung. b, An
X-Gal-stained cryostat tissue section of dorsal root ganglion of
postnatal day 2 mNav2+/
mice. Nerve tracts are shown by asterisks.
c, A cryostat section of adult sympathetic nerve trunk
in the thoracic region. Based on the appearance, distribution, and size
of the cell bodies, the numerous intensely stained cells are likely to
be Schwann cells. Arrowheads identify the somata of
Schwann cells. Scale bar, 50 µm.
|
|
The null mutant animals
(mNav2 / )
were healthy, fertile, and apparently normal. The genotypic analysis of
458 4-week-old offspring obtained from breeding heterozygous animals
showed an approximately Mendelian ratio between wild-type (29.5%,
n = 135), heterozygous mutant (48.2%,
n = 221), and homozygous mutant (22.3%,
n = 102) animals. This suggests that embryonic
development and body functions were not significantly impaired in
either heterozygous or homozygous mutant animals. It was reported that
mNav2 shows acute and transient expression
in the perinatal uterine smooth muscle (Felipe et al., 1994 ; Knittle et
al., 1996 ). In fact, myometrium of the pregnant uterus at days 18 and
20 was significantly positive for lacZ (data not shown).
However, noteworthily, pups were delivered normally in
mNav2 / .
The pattern of lacZ expression in the null mutants was
identical to that in the heterozygous mutants except for the intensity
of the expression, suggesting that deficiency of
mNav2 does not affect the differentiation
or viability of the mNav2-expressing cells.
Expression pattern of mNav2 gene in
the CNS
For designing an experimental strategy to elucidate the
physiological roles of mNav2, we surveyed the
lacZ expression throughout the CNS using fixed brains of
mNav2+/ and
mNav2 /
mice. Interestingly, clusters of lacZ expression were
limited to specific loci in the CNS (Fig.
3a-f): the medial
preoptic, anterior, and dorsomedial part of the hypothalamic area (MPO, AH, and DMH, respectively), dorsomedial part of the interpeduncular nucleus (IPDM), medial part of the median raphe (MMR, so-called rhabdoid nucleus), mesencephalic nucleus of V (MeV), medial habenular nucleus (MH), median eminence (ME), SFO, OVLT, and
neurohypophysis (NHP). The four midline structures, ME, SFO, OVLT, and
NHP, are known as the circumventricular organs (CVOs), having unusual
dense and permeable capillary networks that facilitate secretion or tissue penetration of circulating substances (Johnson and Gross, 1993 ).
Relatively weak lacZ expression was detected in the cerebral cortex (CX) in layer IV of the lateral area (from the most anterior portion to the end of the posterior portion of the cortex) and the
basolateral amygdala (BLA) in
mNav2+/ mice
(data not shown). The intensity of the lacZ expression in these areas was more evident in
mNav2 /
mice, expectedly (Fig. 3f).

View larger version (105K):
[in this window]
[in a new window]
|
Figure 3.
mNav2 was expressed in
specialized neurons and ependymal cells in the adult CNS.
LacZ expression in the CNS of
mNav2+/
(a-e) and
mNav2 /
(f) mutant mice. Fixed adult brains were cut
coronally at 2 mm (a, b, d-f) or into halves
midsagittally (c) and then stained with X-Gal. In
c, the skull under the brain was not removed. In
e, homozygous mutant mice were used for the analysis to
detect the locus of low-level expression. AH, Anterior
hypothalamic area; MH, medial habenular nucleus;
ME, median eminence; OVLT, organum vasculosum
laminae terminalis; MPO, medial preoptic area;
DMH, dorsomedial hypothalamus; IPDM,
interpeduncular nucleus of the dorsomedial part; MMR, medial
part of the median raphe; NHP, neurohypophysis;
SFO, subfornical organ; CX, cerebral cortex;
BLA, basolateral amygdala. In c, OVLT was removed
from the CNS and attached to the skull. The coronal semi-whole-mount
brains were cut 50-µm-thick using cryostat microtome and then stained
with anti-neurofilament (g, h), anti-GFAP
(i) polyclonal antibodies, or cresyl violet
(j). Brown signals are the site that
reacted with the antibodies. The samples are AH
(g), SFO (h,i), and ME
(j). Arrowheads indicate double-positive
neurons. The asterisk in j indicates the third
ventricle. The dorsal side is toward the top of the panels.
Scale bar: g-i, 30 µm; j, 100 µm.
|
|
To examine the cell types expressing lacZ, the
semi-whole-mount brains stained with X-Gal were cut into tissue
sections with a cryostat microtome and subsequently immunostained with
anti-neurofilament or anti-GFAP polyclonal antibodies or stained with
cresyl violet. Most of the cells expressing lacZ were
positive for neurofilament in the PO, AH (Fig. 3g), IPDM,
MMR, MH, and MeV. GFAP-positive cells were negative for the
lacZ expression, suggesting that astrocytes are negative for
mNav2. The distribution of
lacZ-expressing cells in the CVOs was of particular interest
to us. In the ME, the lacZ-expressing cells lined the floor
of the third ventricle (Fig. 3j). This distribution corresponds to the location of nonciliated ependymal cells, tanycytes, which are characteristic cells providing a morphological connection between CSF, nerve cells and blood vessels (Pilgrim, 1978 ). They are thought to be involved in exchange of substances between the CSF
and pericapillary space. The lacZ-positive cells were
sparsely distributed all over the SFO, and most of them were
colocalized with neurofilaments (Fig. 3h) and negative for
GFAP (Fig. 3i). Intensive lacZ-positive cells
also populated the lining of the entire third ventricle, suggesting
that they are ependymal cells. The profiles in the OVLT were very
similar to those observed in the SFO. In the NHP, the X-Gal signals
were densely clustered. We could not identify the cell types, however,
they are likely to correspond to so-called pituicytes (Hatton, 1988 ),
which are a mixture of several unidentified cell types.
Abnormal increase of Fos-immunoreactivity in the CVOs
Analysis of the lacZ expression clearly demonstrated
that mNav2 was expressed in the four CVOs
and several minor nuclei in the CNS. Because the
mNav2-expressing cells were thus diverse not only in tissue distribution but also in cell types, it is difficult
to obtain a unified view of channel function or property simply from
the distribution. However, among them, the four CVOs are thought to be
involved in body-fluid homeostasis (Andersson, 1978 ; Johnson and Gross,
1993 ; Ferguson and Bains, 1996 ; Bourque and Oliet, 1997 ; Fitzsimons,
1997 ; Johnson et al., 1999 ). If the mNav2 channel
functions in the sensory circuits for body-fluid osmolarity, it was
expected that the activity and gene expression in these organs would be
affected in the mNav2 mutant mice.
Therefore, we next examined the effects of water deprivation on the
central expression of a nuclear protein, Fos, the product of the
c-fos proto-oncogene. Fos is a marker of changes in neural
activity in response to the extracellular fluid balance in mice and
rats (Ueta et al., 1995 ; Chae and Heideman, 1998 ; Morien et al., 1999 ). Figure 4 shows the time course of
changes in Fos-immunopositive cell density in five regions of the brain
under water-satiated and dehydrated conditions. In the water-satiated
condition, Fos-immunopositive cells were not detected in any
region examined (the MnPO, OVLT, SFO, PVN, and SON) in
mNav2+/+ and
mNav2 /
mice (Fig. 4a). At 12, 24, and 48 hr after water
deprivation, cell numbers with Fos-immunopositive nuclei were
remarkably increased in these regions in both mice. However, in the SFO
and OVLT, approximately twofold increases in Fos-immunopositive nuclei
were observed in mNav2 /
mice as compared with in
mNav2+/+ mice. In
the MnPO, PVN, and SFO, on the other hand, the rates of increase in
Fos-immunopositive cells were comparable between the two groups (Fig.
4b).

View larger version (31K):
[in this window]
[in a new window]
|
Figure 4.
Abnormal increases of Fos-immunopositive nuclei
were selectively observed in the SFO and OVLT of the null mutants under
conditions of thirst. Wild-type or null mutant mice were dehydrated for
0, 12, 24, and 48 hr, and then fixed. The fixed brains were cut
coronally into 50-µm-thick sections and then stained with anti-Fos
polyclonal antibody. a, Typical examples of tissue
sections containing the OVLT derived from euhydrated or 24 hr
dehydrated wild-type (+/+) and null mutant ( / ) mice. Scale bar, 200 µm. b, Mean numbers of Fos-immunopositive cells per
square millimeter in the SFO, OVLT, SON, PVN, and MnPO during water
deprivation were plotted. Vertical bars indicate SE. *t
test analyses revealed a significant difference
(p < 0.05) between
mNav2 /
and mNav2+/+
mice.
|
|
The taste reception of
mNav2 /
mice is not impaired
We next examined the effect of mNav2-channel
deficiency on mouse behavior, focusing on water and salt intakes. For
the behavioral study, the mutant mice were backcrossed with C57BL/6J
for four generations to verify that the behavior was identical between the F1 and the N4 mice and was not influenced by the 129/Sv genetic background of the ES cells. Because Schwann cell clusters that are
located and associated with nerve fibers beneath the taste buds were
intensely positive for lacZ (data not shown), we carefully examined whether there exist abnormalities in the taste reception in
mNav2 / mice.
The taste preferences of the homozygous mutant, heterozygous mutant,
and wild-type littermates were first examined by a 48 hr two-bottle
preference test against pure water. Under the condition satiated with
water and salt, the concentration sensitivity to a series of NaCl
solutions was comparable among the three groups of mice (Fig.
5a). All the groups showed
maximum preference to 0.1 M NaCl and evasiveness
to 0.3 M NaCl or more. Preference ratios to sweet
(0.5 M sucrose), sour (0.01 M HCl), and bitter [0.02 M
quinine (Q)-HCl] tastants were not different among the groups (Fig. 5b).

View larger version (20K):
[in this window]
[in a new window]
|
Figure 5.
The null mutants showed normal preferences to
various tastants under the condition satiated with water and salt.
Preference ratios for NaCl solutions with a series of concentrations
(a) or three fundamental tastants with fixed
concentrations (b) were examined by a 48 hr
two-bottle preference test. n = 5 (+/+), 5 (+/ ),
and 5 ( / ). Vertical bars indicate SE.
|
|
To further verify the normality in taste responses in the null mutants,
electrophysiological analysis was performed on a taste-afferent nerve
tract, the chorda tympani nerve, which is known to be the nerve fiber
responsible for tasting NaCl (Fig. 6).
The neurophysiological responses to (in M): 0.1 NaCl, 0.1 KCl, 0.1 CH3COONa, 0.5 sucrose, 0.01 HCl, and
0.02 quinine-HCl were of similar intensity between the null-mutant and
wild-type mice. Responses to 0.1 M NaCl and 0.1 M CH3COONa were decreased to the same
degree by amiloride application in both groups of mice, indicating that
amiloride-sensitive channels in taste buds in the mutant mice
function normally. Similar results were observed in the null-mutant and
wild-type mice under the acute salt appetite condition (data not
shown). These findings, together with the normal behavioral response to
various tastants under water- and salt-sufficient conditions (Fig. 5),
indicate that the taste reception of the null mutants is not
impaired.

View larger version (25K):
[in this window]
[in a new window]
|
Figure 6.
Normal responses to various tastant stimuli in the
chorda tympani nerve of the null mutants. a, Sample
recording of the integrated chorda tympani responses to (in M):
0.1 ammonium chloride (NH4Cl), 0.1 sodium chloride
(NaCl), 0.1 NaCl with 0.1 mM amiloride, 0.1 KCl, 0.1 sodium
acetate (AcNa), 0.1 AcNa with 0.1 mM amiloride, 0.5 sucrose, 0.01 hydrochloric acid (HCl), and 0.02 quinine hydrochloride
(Q-HCl) in the wild-type and mNav2 null
mutant mice. b, Mean magnitude of responses to various
taste stimuli. The values are expressed relative to the magnitude of
the response to 0.1 M NH4Cl.
n = 4 (+/+) and 5 ( / ).
|
|
Abnormal intake of hypertonic saline under thirst and salt
appetite conditions
In the dehydrated condition, animals take in a large quantity of
water and avoid hypertonic saline to recover from the hypertonic state.
We then examined the preference to hypertonic saline (0.3 M
NaCl) of the three genotypes before and after 24 hr dehydration. In
contrast to the wild-type and heterozygous mutant mice, which showed
markedly decreased preference ratios to hyper-salt solution after
dehydration, the null mutants showed no change in the preference ratio
(Fig. 7a). Total water intake
(water plus 0.3 M NaCl) did not differ among the
groups both before and after 24 hr dehydration. The total water intake
of all the groups showed a more than fourfold increase after
dehydration (Fig. 7b). The electrolyte concentrations in the
serum before and after dehydration were normal in both wild-type and
homozygous-mutant mice (n = 6): before dehydration: 153.6 ± 0.6 and 153.0 ± 1.2 mM for
Na+, respectively; 4.6 ± 0.1 and
4.7 ± 0.1 mM for
K+; 118.5 ± 0.6 and 118.3 ± 0.9 mM for Cl ;
after dehydration: 151.6 ± 0.8 and 150 ± 0.3 for
Na+; 6.5 ± 0.2 and 6.7 ± 0.2 for K+; 116.0 ± 1.0 and 116.4 ± 0.8 for Cl . This suggests that the
null mutants immediately excreted excessive amounts of sodium into
urine, and thus the renal function of null mutants works normally.

View larger version (21K):
[in this window]
[in a new window]
|
Figure 7.
The null mutants showed an abnormal ingestion of
hypertonic saline under the thirst condition. Preference ratio for 0.3 M NaCl solution (a) and total fluid intake
(b) per 6 hr was measured before and after 24 hr
dehydration; n = 6 (+/+), 6 (+/ ), and 6( / ).
Vertical bars indicate SE. *t test analyses revealed a
significant difference (p < 0.05) between
mNav2 /
and mNav2+/+
mice.
|
|
Furthermore, motivated salt appetite was induced by intraperitoneal
injection of a diuretic drug, furosemide, and a sodium-free diet. The
ingested volumes of pure water and 0.3 M NaCl are shown in
cumulative values for every 2 hr (Fig.
8). Under the control condition, in which
isotonic saline was injected in place of a furosemide solution, the
ingested volumes of water and 0.3 M NaCl were comparable
among the three groups (two graphs at the top). Under the acute salt
appetite condition induced by furosemide injection intraperitoneally
with a sodium-depleted diet, however, the null mutants showed an
approximately twofold increase in the ingestion of 0.3 M
NaCl compared with the wild-type and heterozygous mutant mice (middle).
This abnormal ingestion of hypertonic saline stopped when a
sodium-containing conventional food was provided (bottom).

View larger version (30K):
[in this window]
[in a new window]
|
Figure 8.
The null mutants showed an excessive ingestion of
hypertonic saline under the acute salt appetite condition. An acute
salt appetite was induced by feeding a sodium-depleted diet combined
with furosemide injection intraperitoneally. As a control, normal
saline was injected intraperitoneally instead of the furosemide
solution. As another control, a sodium-containing diet was given
instead of the sodium-depleted diet. The behavioral study was
sequentially performed on alternate days as follows: sodium-depleted
diet combined with normal saline injection (top),
sodium-depleted diet combined with furosemide injection
(middle), and sodium-repleted diet combined with furosemide
injection (bottom). Mean cumulative intakes of 0.3 M NaCl (right) and water
(left) per 2 hr on the day just after each experimental
procedure were plotted; n = 10 (+/+), 10 (+/ ),
and 10 ( / ). Vertical bars indicate SE. *t test
analyses revealed a significant difference
(p < 0.05) between
mNav2 /
and mNav2+/+
mice.
|
|
 |
DISCUSSION |
In this study, we applied a gene knock-out strategy to know
physiological roles of subfamily 2 NaChs (Nav2),
because all the attempts to functionally express
Nav2 have not been successful. Here, we found
that mouse NaG/SCL11 gene corresponds to Nav2.3. This finding suggests that Nav2 members
identified to date from different species are species orthologs. The
null mutant animals (mNav2 / )
were healthy, fertile, and apparently normal. Thus, the phenotype is
quite distinct from those of subfamily 1 NaCh-deficient mice, for
instance SCN2A and SCN8A, which were reported to die postnatally because of neuronal defects in electrical activities (Burgess et al.,
1995 ; Planells-Cases et al., 2000 ). Here, detailed expression of
Nav2 in the CNS was revealed, for the
first time, from the lacZ expression analysis of the
gene-targeted mice. Furthermore, interestingly,
Nav2-deficient mice showed abnormal salt-intake behavior under water- and salt-depleted conditions without affecting the taste reception. This is probably attributable to a failure to
detect circulating sodium concentration in the CNS.
To maintain water and mineral homeostasis, the role of central
osmosensitive and sodium-sensitive neurons in water- and sodium-intake behaviors is critical (Denton et al., 1996 ; Bourque and Oliet, 1997 ).
Osmo- and sodium-regulatory responses are thought to be controlled by a
group of specialized neurons that sense changes in the external osmotic
pressure and sodium concentration and elicit appropriate electrical
signals. Changes in systemic osmolarity and sodium concentration are
known to be detected mainly by the central CVOs, i.e., MnPO, OVLT, SFO,
and SON. Neurons in the CVOs are located outside the blood-brain
barrier, where the brain can monitor various substance levels in the
plasma and CSF, either directly or indirectly.
The OVLT, SFO, MnPO, SON, and PVN are known to be the sites where
c-fos expression is upregulated in animals under thirst and
acute salt-appetite conditions (Rawland, 1998 ). We found that mNav2-null mutants showed a similar
increase of c-fos expression in these areas except for SFO
and OVLT, where the increase was approximately twofold that of the wild
type (Fig. 3). Furthermore, the null mutants showed abnormal behavior
in ingestion of hypertonic saline under thirst and acute salt-appetite
conditions (Figs. 7, 8). Here, it was evident that this abnormality is
caused by a defect in the central control because sensing of various
tastes in the peripheral organ was normal including salt taste (Figs. 5, 6). Under both conditions, the abnormality was observed in salt
intake, but not in total water intake, indicating that these two
behaviors are controlled separately in the CNS and the
mNav2 channel is essential for the regulation of
salt intake behavior.
The cephalic receptors were first hypothesized to be osmoreceptors in
the light of Verney's elegant demonstration of anti-diuretic hormone
(Verney, 1947 ). The magnocellular neurosecretory cells in the SON
appear to exhibit intrinsic osmosensitivity (Leng, 1980 ). The increase
in firing rate observed in the vasopression-secreting cells after
direct application of hypertonic saline is thought to be related to a
reduction in cell volume (Oliet and Bourque, 1993 ). However,
mNav2 was not expressed in SON, and therefore magnocellular neurons are negative for mNav2
(Fig. 3). Glial cells in the SON and PVN have a striking morphological
appearance with long astrocytic processes radiating between the
magnocellular neurons. The glial-specific distribution of the water
channels aquapolin-4 (AQP-4) in SON (Nielsen et al., 1997 ) implies that it may be glial cells, rather than neurons, that exhibit intrinsic osmosensitivity. Thus, glial cells might function as the primary "vesicular osmometer", conveying information on the state of water homeostasis to the neural elements by transcellular water movement. Of
note is that glial cells were negative for
mNav2 expression (Fig. 3).
This may not be true for the SFO, where the distribution of AQP-4 is
restricted to the basolateral membrane of ependymal cells lining the
ventricles (Nielsen et al., 1997 ). Here, transmembrane water movement
might be a prerequisite driven by an ionic gradient established with
CSF, and thus osmosensitive neurons in the SFO may respond to the ionic
composition of the CSF. This mechanism may not be confined to the SFO,
but may be a common feature of the other CVOs, including OVLT. On the
contrary, neurons in the OVLT and MnPO have also been shown to be
intrinsically osmosensitive, and the integrity of the neural connection
linking the SON, OVLT, and MnPO is necessary for SON neurons to respond
to osmotic stimulation (Honda et al., 1990 ). In vivo
analyses (Gutman et al., 1988 ; Honda et al., 1990 ) and
electrophysiological experiments using slices or explants have revealed
that a majority of neurons within the SFO (Sibbald et al., 1988 ) and
OVLT (Nissen et al., 1993 ) are actually excited or inhibited on
exposure to hypertonic or hypotonic NaCl solutions. Noteworthy is that
the saline solutions are more effective in activating cells of the OVLT
than the mannitol-containing equiosmolar solutions (Vivas et
al., 1990 ).
Here, it should be recalled that water intake behavior was normal in
the mutants (Figs. 7, 8). The mutants appear to be able to somehow
detect hyperosmolarity because they showed increase in the total water
intake under thirst conditions. The SFO and OVLT were selectively
hyperactive in the CVOs in the mutant mice under thirst conditions
(Fig. 4). Activities of the SFO and OVLT are known to affect both water
and salt intake behavior (Andersson, 1978 ; Johnson et al., 1999 ).
Sensory information on the systemic body-fluid condition is integrated
in the higher central area, which controls separately salt and water
intake behavior. This implies that osmosensitive and sodium-sensitive
neurons make up different populations in these areas. Lesion
experiments have shown that the central nucleus of the amygdala
selectively regulates salt appetite, but not water-drinking behavior,
induced by angiotensin II (ANG II) or sodium depletion (Galaverna et
al., 1992 , 1993 ; Zardetto-Smith et al., 1994 ). The expression of
mNav2 in amygdala was restricted to the
basolateral nucleus and did not overlap with the central nucleus (Fig.
3f), suggesting that mNav2
channel deficiency in the amygdala would not directly affect salt
intake behavior. Because there exists direct efferents from the lamina terminalis, particularly from the SFO, projecting to the central nucleus of the amygdala (Johnson et al., 1999 ), it is possible that the
hyperactivated neurons, with strong c-fos expression of the
SFO and OVLT in null mutants under conditions of thirst, selectively
regulate the activity of the central nucleus. We envisage that these
are probably sodium-sensitive neurons, and mNav2
channel is involved in the sensing mechanism for the extracellular
sodium concentration. In addition, the mNav2
channels expressed in the ependymal cells might also contribute to the
sodium-absorption activity from the extracellular space. As described
above, a water channel, AQP-4, is reported to be involved in the
transportation of water through ependymal cells in the central
ventricular systems (Wells, 1998 ). It is thus possible to envisage that
the deficiency of mNav2 channels in ependymal
cells also altered the extracellular sodium concentration surrounding
the central sensory neurons.
A similar situation was observed in the alveolar epithelium: an
intensive expression of mNav2 was observed
in alveolar type II (ATII) cells of the pulmonary alveolus (our
unpublished data). These cells actively absorb sodium ion (Matalon and
O'Brodovich, 1999 ) and water (Verkman, 1998 ) and regulate alveolar
surface fluid conditions. Water moves mainly across alveolar type I
(ATI) cells and airway epithelium into the capillaries through water channels. The sodium ion influx through nonselective cation channels and sodium ion-selective channels on the apical membrane of ATII cells
seemed to be the driving force. It is thus possible to assume that the
mNav2 channel is one of the molecular entitities
of these cation currents detected in the ATII cells.
In gene-targeting studies, the background genotypes should be
considered (Gerlai, 1996 ). A recent electrophysiological study showed
that there exists a prominent difference between mouse strains in the
presence of the amiloride-sensitive component of the salt-sensing
system (Ninomiya et al., 1989 ). However, our electrophysiological study
demonstrated the existence of the amiloride-sensitive component in the
null mutants generated by backcrossing four times onto a pure C57BL/6J
background (Fig. 5). As for the amiloride-sensitive channel, the
presence of the -, -, and -subunits of the epithelial sodium
channel (Garty and Palmer, 1997 ) mRNAs in similar amounts as the wild
type was verified by RT-PCR analysis using tongue tissue of the null
mutants (data not shown). Some investigators reported that there exist
differences in voluntary NaCl intake between mouse strains (Ninomiya et
al., 1989 ; Bachmanov et al., 1998 ). However, as far as we examined, the
behavior of the null mutants of different stages in the genetic
background (F1 and N4) was identical.
Body-fluid homeostasis is controlled also by the endocrine system. ANG
II is a powerful stimulus of thirst and sodium appetite (Fitzsimons,
1997 ). The three CVOs, SFO, OVLT, and area postrema, are rich in ANG II
receptors (Lenkei et al., 1997 ), where the mNav2 expression is also positive.
However, an increase in induction of the circulating ANG II or
transportation to sensitive neurons through tanycytes (Fitzsimons,
1997 ) seemed not to occur in the null mutant for the following reasons:
(1) the action of ANG II on the sensory CVOs helps to increase the
intake of both water and salt (Buggy and Fisher, 1974 ). However, the
mNav2 null mutants showed an increase only
in the intake of salt solution when thirsty, and the total fluid intake
was normal. (2) When measured before and after the thirst experiment,
systolic blood pressure was comparable between the null mutant and
wild-type mice (our unpublished data). The adrenal mineralocorticoids,
represented by aldosterone, are also known to induce salt intake
(Denton, 1984 ). To recover the depleted sodium, they enhance
reabsorption of sodium in the kidney and the motivation to consume
salt. However, the levels of plasma aldosterone just after 24 hr water
deprivation were comparable between the null mutant and wild-type mice
(our unpublished data), and receptive loci of aldosterone (Birmingham
et al., 1984 ) do not overlap with mNav2
expression in the CNS. Therefore, the involvement of circulating
aldosterone in the abnormal salt intake of the null mutants can be excluded.
In summary, our results suggest that the central
mNav2 channel is involved in controlling the
activities of neurons in the sensory CVOs responsible for the
regulation of salt-intake behavior. The
Nav2-deficient mice showed abnormal NaCl
intake behavior, as if the water-depleted signal was confused with the
sodium-depleted signal, and the salt-intake signal was hyperactive in
moments of need. This is not surprising because the central sensing and integration mechanisms for osmotic pressure and the sodium level in
cerebral arterial plasma and CSF are closely interrelated as described above, although the details are still not known. Sensory neurons in the SFO and OVLT, which showed marked c-fos
expression in the
mNav2 /
mouse, seem to positively regulate the salt-intake behavior, however,
it is not clear at present whether they directly or indirectly project
to the amygdala. In addition, it is also necessary to examine whether
these neurons correspond to the cells expressing mNav2 in these organs. Because the
functional reconstruction of this channel in vitro has not
been successful, the channel properties and characteristics have
remained obscure. Electrophysiological studies on
mNav2-positive cells (tissues) comparing
the mNav2-null mutant with the wild-type
would be a promising approach to this issue.
 |
FOOTNOTES |
Received May 30, 2000; revised July 20, 2000; accepted July 25, 2000.
This work was supported by grants-in-aid from Japan Science and
Technology Corporation (CREST), the Ministry of Education, Science,
Sports and Culture of Japan, and the Human Frontier Science Program. We
are very grateful to Dr. Yoheved Berwald-Netter for providing rat NaG
probes, Drs. Andras Nagy and Hisato Kondoh for R1 cells, Dr. Michael
Tumkun for anti-mNav2.3 antibody, Dr. Masahiko Mori for a
129 mouse genomic library, Drs. Takeshi Yagi, Masaru Okabe, Masazumi
Takahashi, Toshiyuki Takai, and Goro Katsuura for technical advice, Ms.
Masae Mizoguchi and Mie Yasuda for technical assistance, and Ms. Akiko
Kodama for secretarial assistance.
Correspondence should be addressed to Masaharu Noda, Division of
Molecular Neurobiology, National Institute for Basic Biology, 38 Nishigonaka, Myodaiji-cho, Okazaki 444-8585, Japan. E-mail: madon{at}nibb.ac.jp.
 |
REFERENCES |
-
Akopian AN,
Souslova V,
Sivilotti L,
Wood JN
(1997)
Structure and distribution of a broadly expressed atypical sodium channel.
FEBS Lett
400:183-187[Web of Science][Medline].
-
Andersson B
(1978)
Regulation of water intake.
Physiol Rev
58:582-603[Free Full Text].
-
Bachmanov AA,
Tordoff MG,
Beauchamp GK
(1998)
Voluntary sodium chloride consumption by mice: differences among five inbred strains.
Behav Genet
28:117-124[Web of Science][Medline].
-
Birmingham MK,
Sar M,
Stumpf WE
(1984)
Localization of aldosterone and corticosterone in the central nervous system, assessed by quantitative autoradiography.
Neurochem Res
9:333-350[Web of Science][Medline].
-
Bourque CW,
Oliet SH
(1997)
Osmoreceptors in the central nervous system.
Annu Rev Physiol
59:601-619[Web of Science][Medline].
-
Buggy J,
Fisher AE
(1974)
Evidence for a dual central role for angiotensin in water and sodium intake.
Nature
250:733-735[Medline].
-
Burgess DL,
Kohrman DC,
Galt J,
Plummer NW,
Jones JM,
Spear B,
Meisler MH
(1995)
Mutation of a new sodium channel gene, Scn8a, in the mouse mutant "motor endplate disease".
Nat Genet
10:461-465[Web of Science][Medline].
-
Catterall WA
(1995)
Structure and function of voltage-gated ion channels.
Annu Rev Biochem
64:493-531[Web of Science][Medline].
-
Chae HE,
Heideman PD
(1998)
Water-deprived white-footed mice express c-fos on a day/night cycle graded according to the duration of deprivation.
Brain Res
791:1-10[Web of Science][Medline].
-
Denton DA
(1984)
In: The hunger for salt: an anthropological, physiological and medical analysis. New York: Springer-Verlag.
-
Denton DA,
McKinley MJ,
Weisinger RS
(1996)
Hypothalamic integration of body fluid regulation.
Proc Natl Acad Sci USA
93:7397-7404[Abstract/Free Full Text].
-
Felipe A,
Knittle TJ,
Doyle KL,
Tamkun MM
(1994)
Primary structure and differential expression during development and pregnancy of a novel voltage-gated sodium channel in the mouse.
J Biol Chem
269:30125-30131[Abstract/Free Full Text].
-
Felts PA,
Black JA,
Dib-Hajj SD,
Waxman SG
(1997)
NaG: a sodium channel-like mRNA shared by Schwann cells and other neural crest derivatives.
Glia
21:269-276[Web of Science][Medline].
-
Ferguson AV,
Bains JS
(1996)
Electrophysiology of the circumventricular organs.
Front Neuroendocrinol
17:440-475[Web of Science][Medline].
-
Fitzsimons JT
(1997)
Angiotensin, thirst, and sodium appetite.
Physiol Rev
78:583-686[Abstract/Free Full Text].
-
Galaverna O,
De Luca LAJ,
Schulkin J,
Yao SZ,
Epstein AN
(1992)
Dificits in NaCl ingestion after damage to the central nucleus of the amygdala in the rat.
Brain Res Bull
28:89-98[Web of Science][Medline].
-
Galaverna OG,
Seeley RJ,
Berridge KC,
Grill HJ,
Epstein AN,
Schulkin J
(1993)
Lesions of the central nucleus of the amygdala. I. Effects on taste reactivity, taste aversion learning and sodium appetite.
Behav Brain Res
59:11-17[Web of Science][Medline].
-
Garty H,
Palmer LG
(1997)
Epitherial sodium channels: Function, structure, and regulation.
Physiol Rev
77:359-396[Abstract/Free Full Text].
-
Gautron S,
Dos Santos G,
Pinto-Henrique D,
Koulakoff A,
Gros F,
Berwald-Netter Y
(1992)
The glial voltage-gated sodium channel: cell- and tissue-specific mRNA expression.
Proc Natl Acad Sci USA
89:7272-7276[Abstract/Free Full Text].
-
George ALJ,
Knittle TJ,
Tamkun MM
(1992)
Molecular cloning of an atypical voltage-gated sodium channel expressed in human heart and uterus: evidence for a distinct gene family.
Proc Natl Acad Sci USA
89:4893-4897[Abstract/Free Full Text].
-
Gerlai R
(1996)
Gene-targeting studies of mammalian behavior: is it the mutation of the background genotype?
Trends Neurosci
19:177-181[Web of Science][Medline].
-
Goldin AL
(1999)
Diversity of mammalian voltage-gated sodium channels.
In: Molecular and diversity of ion channels and receptors (Rudy B,
Seeburg P,
eds), pp 38-50. New York: New York Academy of Sciences.
-
Gutman MB,
Ciriello J,
Mogeson GJ
(1988)
Effects of plasma angiotensin and hypernatoremia on subfornical neurons.
Am J Physiol
254:R746-R754[Abstract/Free Full Text].
-
Hatton GI
(1988)
Pituicytes, glia and control of terminal secretion.
J Exp Biol
139:67-79[Abstract/Free Full Text].
-
Honda K,
Negoro H,
Dyball REJ,
Higuchi T,
Takano S
(1990)
The osmoreceptor complex in the rat: evidence for interactions between the supraoptic and other diencephalic nuclei.
J Physiol (Lond)
431:225-241[Abstract/Free Full Text].
-
Johnson AK,
Gross PM
(1993)
Sensory circumventricular organs and brain homeostatic pathways.
FASEB J
7:678-686[Abstract].
-
Johnson AK,
de Olmos J,
Pastsuskovas CV,
Zardetto-Smith AM,
Vivas L
(1999)
The extended amygdala and salt appetite.
Ann NY Acad Sci
877:258-280[Web of Science][Medline].
-
Kayano T,
Noda M,
Flockerzi V,
Takahashi H,
Numa S
(1988)
Primary structure of rat brain sodium channel III deduced from the cDNA sequence.
FEBS Lett
228:187-194[Web of Science][Medline].
-
Knittle TJ,
Doyle KL,
Tamkun MM
(1996)
Immunolocalization of the mNav2.3 Na+ channel in mouse heart: upregulation in myometrium during pregnancy.
Am J Physiol
270:C688-C696[Abstract/Free Full Text].
-
Leng G
(1980)
Rat supraoptic neurones: the effects of locally applied hypertonic saline.
J Physiol (Lond)
304:405-414[Abstract/Free Full Text].
-
Lenkei Z,
Palkovits M,
Corvol P,
Llorens-Cortes C
(1997)
Expression of angiotensin type-1 (AT1) and type-2 (AT2) receptor mRNAs in the adult rat brain: a functional neuroanatomical review.
Front Neuroendocrinol
18:383-439[Web of Science][Medline].
-
Matalon S,
O'Brodovich H
(1999)
Sodium channels in aveolar epithelial cells: molecular characterization, biophysical properties, and physiological significance.
Annu Rev Physiol
61:627-661[Web of Science][Medline].
-
Morien A,
Garrard L,
Rowland NE
(1999)
Expression of Fos immunoreactivity in rat brain during dehydration: effect of duration and timing of water deprivation.
Brain Res
816:1-7[Web of Science][Medline].
-
Nielsen S,
Nagelhus EA,
Amirty-Moghaddam M,
Bourque C,
Agre P,
Ottersen OP
(1997)
Specialized membrane domains for water transport in glial cells: High resolution immunogold cytochemistry of aquaporin-4 in rat brain.
J Neurosci
17:171-180[Abstract/Free Full Text].
-
Ninomiya Y,
Sako N,
Funakoshi M
(1989)
Strain differences in amiloride inhibition of NaCl responses in mice, Mus musculus.
J Comp Physiol [A]
166:1-5[Medline].
-
Nissen R,
Bourque CW,
Renaud LP
(1993)
Membrane properties of organum vasculosum lamina terminalis neurons recorded in vitro.
Am J Physiol
264:R811-R815[Abstract/Free Full Text].
-
Noda M
(1993)
Structure and function of sodium channels.
Ann NY Acad Sci
707:20-37[Web of Science][Medline].
-
Noda M,
Ikeda T,
Kayano T,
Suzuki H,
Takeshima H,
Kurasaki M,
Takahashi H,
Numa S
(1986)
Existence of distinct sodium channel messenger RNAs in rat brain.
Nature
320:188-192[Medline].
-
Oliet SHR,
Bourque CW
(1993)
Mechanosensitive channels transduce osmosensitivity in supraoptic neurons.
Nature
364:341-343[Medline].
-
Pilgrim C
(1978)
Transport function of the hypothalamic tanycyte ependyma: how good is the evidence?
Neuroscience
3:277-283[Web of Science][Medline].
-
Planells-Cases R,
Caprini M,
Zhang J,
Rockenstein EM,
Rivera RR,
Murre C,
Masliah E,
Montal M
(2000)
Neuronal death and perinatal lethality in voltage-gated sodium channel
(II)-deficient mice.
Biophys J
78:2878-2891[Web of Science][Medline]. -
Rawland NE
(1998)
Brain mechanisms of mammalian fluid homeostasis: insights from use of immediate early gene mapping.
Neurosci Biobehav Rev
23:49-63[Web of Science][Medline].
-
Ritchie JM
(1992)
Voltage-gated ion channels in Schwann cells and glia.
Trends Neurosci
15:345-351[Web of Science][Medline].
-
Shintani T,
Watanabe E,
Maeda N,
Noda M
(1998)
Neurons as well as astrocytes express proteoglycan-type protein tyrosine phosphatase
/RRTP : analysis of mice in which the PTP /RRTP gene was replaced with the lacZ gene.
Neurosci Lett
247:135-138[Web of Science][Medline]. -
Sibbald JR,
Hubbard JE,
Sirrett NE
(1988)
Resposes from osmosensitive neurons of the rat subfornical organ in vitro.
Brain Res
461:205-214[Web of Science][Medline].
-
Sontheimer H
(1994)
Voltage-dependent ion channels in glial cells.
Glia
11:156-172[Web of Science][Medline].
-
Sontheimer H,
Black JA,
Waxman SG
(1996)
Voltage-gated sodium channels in glia: Properties and possible functions.
Trends Neurosci
19:325-332[Web of Science][Medline].
-
Ueta Y,
Yamashita H,
Kawata M,
Koizumi K
(1995)
Water deprivation induces regional expression of c-fos protein in the brain of inbred polydipsic mice.
Brain Res
677:221-228[Web of Science][Medline].
-
Verkman AS
(1998)
Role of aquaporin water channels in kidney and lung.
Am J Med Sci
316:310-320[Web of Science][Medline].
-
Verney EB
(1947)
The antidiuretic hormone and the factors which determine its release.
Proc R Soc Lond B Biol Sci
135B:25-106[Abstract/Free Full Text].
-
Vivas L,
Chiaraviglio E,
Carrer HF
(1990)
Rat organum vasculosum laminae terminalis in vitro: responses to changes in sodium concentration.
Brain Res
519:294-300[Web of Science][Medline].
-
Wells T
(1998)
Vesicular osmometers, vasopression secretion and aquaporin-4: a new mechanism for osmoreception?
Mol Cell Endocrinol
136:103-107[Web of Science][Medline].
-
Yagi T,
Nada S,
Watanabe N,
Tamemoto H,
Kohmura N,
Ikawa Y,
Aizawa S
(1993)
A novel negative selection for homologous recombinants using diphtheria toxin A fragment gene.
Anal Biochem
214:77-86[Web of Science][Medline].
-
Zardetto-Smith AM,
Beltz TG,
Johnson AK
(1994)
Role of the central nucleus of the amygdala and bed nucleus of the stria terminalis in experimentally-induced salt appetite.
Brain Res
645:123-134[Web of Science][Medline].
Copyright © 2000 Society for Neuroscience 0270-6474/00/20207743-09$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
E. Lazartigues, P. Sinnayah, G. Augoyard, C. Gharib, A. K. Johnson, and R. L. Davisson
Enhanced water and salt intake in transgenic mice with brain-restricted overexpression of angiotensin (AT1) receptors
Am J Physiol Regulatory Integrative Comp Physiol,
November 1, 2008;
295(5):
R1539 - R1545.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Chen, T. J. Maures, H. Jin, J. S. Huo, S. A. Rabbani, J. Schwartz, and C. Carter-Su
SH2B1{beta} (SH2-B{beta}) Enhances Expression of a Subset of Nerve Growth Factor-Regulated Genes Important for Neuronal Differentiation Including Genes Encoding Urokinase Plasminogen Activator Receptor and Matrix Metalloproteinase 3/10
Mol. Endocrinol.,
February 1, 2008;
22(2):
454 - 476.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. C. Geerling and A. D. Loewy
Central regulation of sodium appetite
Exp Physiol,
February 1, 2008;
93(2):
177 - 209.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. N. Orlov and A. A. Mongin
Salt-sensing mechanisms in blood pressure regulation and hypertension
Am J Physiol Heart Circ Physiol,
October 1, 2007;
293(4):
H2039 - H2053.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Godino, L. A. De Luca Jr., J. Antunes-Rodrigues, and L. Vivas
Oxytocinergic and serotonergic systems involvement in sodium intake regulation: satiety or hypertonicity markers?
Am J Physiol Regulatory Integrative Comp Physiol,
September 1, 2007;
293(3):
R1027 - R1036.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Noda
Hydromineral Neuroendocrinology: Hydromineral neuroendocrinology: mechanism of sensing sodium levels in the mammalian brain
Exp Physiol,
May 1, 2007;
92(3):
513 - 522.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Madia, P. Striano, E. Gennaro, M. Malacarne, R. Paravidino, R. Biancheri, M. Budetta, M. R. Cilio, R. Gaggero, M. Pierluigi, et al.
Cryptic chromosome deletions involving SCN1A in severe myoclonic epilepsy of infancy.
Neurology,
October 10, 2006;
67(7):
1230 - 1235.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Watanabe, T. Y. Hiyama, H. Shimizu, R. Kodama, N. Hayashi, S. Miyata, Y. Yanagawa, K. Obata, and M. Noda
Sodium-level-sensitive sodium channel Nax is expressed in glial laminate processes in the sensory circumventricular organs
Am J Physiol Regulatory Integrative Comp Physiol,
March 1, 2006;
290(3):
R568 - R576.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Noda
The Subfornical Organ, a Specialized Sodium Channel, and the Sensing of Sodium Levels in the Brain
Neuroscientist,
February 1, 2006;
12(1):
80 - 91.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Shima, M. Zubair, S. Ishihara, Y. Shinohara, S. Oka, S. Kimura, S. Okamoto, Y. Minokoshi, S. Suita, and K.-i. Morohashi
Ventromedial Hypothalamic Nucleus-Specific Enhancer of Ad4BP/SF-1 Gene
Mol. Endocrinol.,
November 1, 2005;
19(11):
2812 - 2823.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Noda and T. Y. Hiyama
Sodium-level-sensitive Sodium Channel and Salt-Intake Behavior
Chem Senses,
January 1, 2005;
30(suppl_1):
i44 - i45.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Y. Hiyama, E. Watanabe, H. Okado, and M. Noda
The Subfornical Organ is the Primary Locus of Sodium-Level Sensing by Nax Sodium Channels for the Control of Salt-Intake Behavior
J. Neurosci.,
October 20, 2004;
24(42):
9276 - 9281.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Nassar, L. C. Stirling, G. Forlani, M. D. Baker, E. A. Matthews, A. H. Dickenson, and J. N. Wood
Nociceptor-specific gene deletion reveals a major role for Nav1.7 (PN1) in acute and inflammatory pain
PNAS,
August 24, 2004;
101(34):
12706 - 12711.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Grob, G. Drolet, and D. Mouginot
Specific Na+ Sensors Are Functionally Expressed in a Neuronal Population of the Median Preoptic Nucleus of the Rat
J. Neurosci.,
April 21, 2004;
24(16):
3974 - 3984.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Vialou, A. Amphoux, R. Zwart, B. Giros, and S. Gautron
Organic Cation Transporter 3 (Slc22a3) Is Implicated in Salt-Intake Regulation
J. Neurosci.,
March 17, 2004;
24(11):
2846 - 2851.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. L. Goldin
Evolution of voltage-gated Na+ channels
J. Exp. Biol.,
March 1, 2002;
205(5):
575 - 584.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. H. Meisler, J. Kearney, A. Escayg, B. T. Macdonald, and L. K. Sprunger
Sodium Channels and Neurological Disease: Insights from Scn8a Mutations in the Mouse
Neuroscientist,
April 1, 2001;
7(2):
136 - 145.
[Abstract]
[PDF]
|
 |
|
|

|