Previous Article | Next Article 
The Journal of Neuroscience, November 15, 2000, 20(22):8305-8314
Dopamine D2 Long Receptor-Deficient Mice Display Alterations in
Striatum-Dependent Functions
Yanyan
Wang1,
Rong
Xu1,
Toshikuni
Sasaoka2,
Susumu
Tonegawa3,
Mei-Ping
Kung4, and
Emma-Betty
Sankoorikal1
Departments of 1 Pharmacology and
4 Radiology, University of Pennsylvania School of Medicine,
Philadelphia, Pennsylvania 19104-6084, 2 Division of
Cortical Function Disorders, National Institute of Neuroscience, 4-1-1 Ogawahigashi, Kodaira, Tokyo 187-8502, Japan, and 3 Howard
Hughes Medical Institute and Department of Biology, Massachusetts
Institute of Technology, Cambridge, Massachusetts 02139
 |
ABSTRACT |
The dopamine D2 receptor (D2) system has been implicated in several
neurological and psychiatric disorders, such as schizophrenia and
Parkinson's disease. There are two isoforms of the D2 receptor: the
long form (D2L) and the short form (D2S). The two isoforms are
generated by alternative splicing of the same gene and differ only by
29 amino acids in their protein structures. Little is known about the
distinct functions of either D2 isoform, primarily because selective
pharmacological agents are not available. We generated D2L
receptor-deficient (D2L
/
) mice by making a subtle mutation in the
D2 gene. D2L
/
mice (which still express functional D2S) displayed
reduced levels of locomotion and rearing behavior. Interestingly,
haloperidol produced significantly less catalepsy and inhibition of
locomotor activity in D2L
/
mice. These findings suggest that D2L
and D2S may contribute differentially to the regulation of certain
motor functions and to the induction of the extrapyramidal side effects
associated with the use of typical antipsychotic drugs (e.g.,
haloperidol). Quinpirole induced a similar initial suppression of
locomotor activity in both D2L
/
and wild-type mice. In addition,
the D2S receptor in the mutant mice functioned approximately equally
well as did D2L as an impulse-modulating autoreceptor. This suggests
that the functions of these two isoforms are not dependent on the
formation of receptor heterodimers. Our findings may provide novel
information for potentially developing improved antipsychotic drugs.
Key words:
dopamine D2L receptor; knock-out mice; locomotion; catalepsy; autoreceptor; haloperidol; D2S receptor
 |
INTRODUCTION |
Alterations in the dopamine D2
receptor (D2) system have been implicated in a variety of neurological
and psychiatric disorders, including schizophrenia, Parkinson's
disease, Huntington's disease, attention-deficit hyperactive disorder,
and drug addiction (Sibley et al., 1993
; Graybiel, 1995
; Jaber et al.,
1996
; Nestler and Aghajanian, 1997
; Koob et al., 1998
). Parkinsonian
patients exhibit deficits in motor function, which are attributed to
the degeneration of dopaminergic neurons in the substantia nigra (SN)
(Hornykiewicz, 1966
). Schizophrenic patients exhibit psychotic
symptoms, which may partially result from dysfunction of the
mesocortical and hippocampal dopamine (DA) systems (Carlsson and
Carlsson, 1990
; Jaskiw and Weinberger, 1992
). The drugs typically used
to treat schizophrenia and Parkinson's disease are D2 antagonists or
agonists, respectively, suggesting that the D2 receptor plays an
important role in these two neuropsychiatric diseases.
Two isoforms of the D2 receptor [the long form (D2L) and the
short form (D2S)] have been identified (Bunzow et al., 1988
; Dal Toso
et al., 1989
; Giros et al., 1989
; Monsma et al., 1989
; Chio et al.,
1990
; Mack et al., 1991
). The D2L and D2S receptors are generated from
the same gene by alternative splicing. The D2L receptor has a 29 amino
acid insertion in the third cytoplasmic loop of the protein, and this
insertion is absent in the D2S receptor. The third intracellular loop
of G-protein-coupled receptors (including DA receptors) has been shown
to be critical for their interactions with intracellular effectors
(O'Dowd et al., 1988
). In transfected cell lines, it has been shown
that D2L and D2S are coupled to, or display differential affinities
for, different inhibitory G-proteins (Dal Toso et al., 1989
; Senogles,
1994
; Guiramand et al., 1995
; Boundy et al., 1996
). The two isoforms
coexist in all brain tissue analyzed; however, the expression ratio of
D2L versus D2S varies considerably from region to region (Mack et al.,
1991
; Neve et al., 1991
). The differences in protein structure,
expression pattern, and interaction with intracellular effectors
suggest that the two D2 isoforms may have differential functions. In
addition, the etiology of motor deficits and psychoses involves
different brain regions, and the expression ratio of D2 isoforms
differs in these regions. Thus, there is a possibility that D2L and D2S may play differential roles in defining the therapeutic ratio of
antipsychotic and/or antiparkinsonian drugs.
The lack of an isoform-selective pharmacological agent has hampered the
progress toward understanding the specific function of D2L and D2S in
the mammalian CNS. Our strategy for addressing this issue is to
generate mutant mice expressing only a single D2 isoform by using
gene-targeting technology. Such mutant mice serve as unique model
systems for dissecting the function of either D2 isoform at the
molecular, cellular, and systems levels in the CNS. As an initial step,
we created mice lacking D2L but expressing functional D2S by making a
subtle mutation in the D2 gene. The present study was undertaken to
determine whether there are alterations in basal ganglia-dependent
functions in D2L receptor-deficient (D2L
/
) mice. D2L comprises
~80% of the total D2 receptor in the whole brain (including SN) of
wild-type (WT) mice, and the relative proportion of D2L is even higher
in the striatum (~90% of total D2) (Mack et al., 1991
) (for our
observations, see Fig. 1C). In contrast, D2S is the only D2
receptor expressed in D2L
/
mice. Thus, biochemical, behavioral, and
physiological analyses of D2L
/
mice may reveal novel information
concerning the potential functional roles of D2L as well as D2S.
 |
MATERIALS AND METHODS |
Subtle mutation of the D2 receptor gene to generate
D2L-deficient mice. The mouse D2 gene containing exons 3-8 was
cloned from a mouse 129/SV genomic DNA library. The targeting vector was constructed using a 15.5 kb mouse genomic D2 fragment in which exon
6 was replaced by a PGK-neo cassette (neo). In
addition, neo was flanked by loxP on both sides (should
neo disrupt the transcription process, the Cre recombinase
system is used to remove neo). The targeting vector was
transfected into embryonic stem (ES) cells (J1 from 129/terSv) by
electroporation (Silva et al., 1992
). Correctly targeted ES clones were
identified by Southern blot analysis using probes A and B (see Fig. 1)
and microinjected into C57BL/6 blastocysts to produce chimeric mice.
Chimeric mice were crossed with C57BL/6 mice (Taconic, Germantown, NY)
to produce heterozygous mice. Heterozygous mice (D2L+/
; F1) were then
intercrossed to produce homozygous mice (F2) on a hybrid background
(129/terSv × C57BL/6). To minimize the variation of genetic
background, D2L+/
mice were also backcrossed to the C57BL/6 strain
for five generations to establish an incipient congenic B6 line (N5/B6)
(Banbury Conference on Genetic Background in Mice, 1997
).
Reverse transcriptase-PCR. Total RNA isolated from
the striatum of D2L
/
or WT littermates was reverse-transcribed into
cDNA using oligonucleotide primers complementary to exon 8 of the D2 gene. The resulting cDNA was used in a PCR reaction with
oligonucleotide primers complementary to exon 5 [5'-(d
GAGTGTATCATTGCCAACCCTGCC)] and exon 7 [5'-(d TGGTGCTTGACAGCATCTCC)]
on the D2 gene. Conditions for the PCR were 94°C for 30 sec, 60°C
for 1 min, and 72°C for 3.5 min for 35 cycles. Total striatal RNA was
obtained from three or four mice for each genotype on two separate
occasions. The experiments were repeated five times.
Receptor autoradiography. Three WT and three D2L
/
mice
were killed by cervical dislocation, and the brains were removed. The
brains were placed in OTC embedding medium (Miles, Elkhart, IN) and frozen in powdered dry ice. Coronal sections (20 µm
thickness) were cut on a cryostat microtome (Hacker Instruments,
Fairfield, NJ) and thaw-mounted onto gelatin-coated glass slides. Brain
sections were obtained from mouse forebrain, which corresponded to
plates 19-24 (Franklin and Paxinos, 1996
). Thus, the sections included cerebral cortex, caudate-putamen, nucleus accumbens, olfactory tubercle
and the islands of Calleja. The sections were desiccated at 4°C for 3 hr and then kept at
20°C until use. Before the assay, sections were
thawed, dried at room temperature, and preincubated for 30 min at room
temperature in buffer containing 50 mM Tris-HCl, pH 7.0. After preincubation, the sections were labeled in coplin jars with 0.05 nM [125I]NCQ298 (for
dopamine D2 and D3 receptors) and 0.2 nM
[125I]5-OH-PIPAT (for the
dopamine D3 receptor). [125I]NCQ298
labeling was performed in buffer containing 50 mM Tris-HCl, pH 7.4, and 120 mM NaCl at room temperature for 120 min,
followed by two 20 min washes at 4°C. Nonspecific binding was
determined in the presence of 2 µM (+)-butaclamol.
[125I]5-OH-PIPAT labeling was performed
in the buffer containing 50 mM Tris-HCl, pH 6.8, 2 mM EDTA, and 120 mM NaCl at room temperature for 120 min, followed by two washes, each 1.5 hr in duration at 4°C.
Nonspecific binding was defined in the presence of 1 µM
(±)7-OH-DPAT. After the wash procedure was completed, the
sections were dipped in ice-cold distilled water to remove buffer salts
before drying with a stream of cold air. Dried sections were exposed to
either Kodak X-OMAT AR or DuPont Cronex MRF 34 films for
18 hr, and the analysis of the autoradiograms was performed using a
computer-based image analysis system (NIH Image, version 1.61). The
binding sites were expressed in units of optical density in the linear range.
Receptor binding assays. Saturation binding assays of
[3H]YM-09151-2 were performed as
described previously with slight modifications (Xu et al., 1996
; Zhang
et al., 1996
). Briefly, striatal tissue was homogenized in ice-cold
buffer (15 mM Tris-HCl and 5 mM EDTA, pH 7.4).
The homogenate was centrifuged twice at 35000 × g for 40 min at 4°C and then stored at
20°C. The protein concentration of membrane homogenates was determined using the Bradford reagent (Sigma, St. Louis, MO). Aliquots of striatal membrane homogenates containing 60 µg of protein were incubated in duplicate with
[3H]YM-09151-2 (specific activity, 85.5 Ci/mmol; NEN Life Science Products, Boston, MA) in a volume of 1 ml at
25°C for 40 min. Concentrations of
[3H]YM-09151-2 ranging from 0.01 to 0.8 nM were used. The incubations were terminated by
rapid filtration through Whatman GF/B filters. The filters were rinsed
three times with 4 ml of cold binding buffer (50 mM Tris-HCl, 120 mM NaCl, 5 mM KCl, 1.5 mM
CaCl2, 5 mM
MgCl2, and 0.1% ascorbic acid, pH 7.4).
Nonspecific binding was defined in the presence of spiperone (5 µM). Striatal tissue from four mice of each
genotype was used for each experiment. Saturation binding assays of
[3H]SCH23390 were performed using
a similar method except that aliquots of striatal membrane homogenates
containing 60 µg of protein were incubated in duplicate with
[3H]SCH23390 (specific activity, 86 Ci/mmol; Amersham Life Science, Arlington Heights, IL) in a volume of 1 ml at 30°C for 60 min. Nonspecific binding was defined in the
presence of (+)-butaclamol (10 µM). Binding
data were analyzed using the Prism program (Graph Pad Software, San
Diego, CA). Spiperone and (+)-butaclamol were obtained from Research
Biochemicals (Natick, MA).
Behavioral studies. Male mice (3-7 months old) on either
the hybrid (mainly F2) or congenic B6 genetic background (N5/B6) were
used. Animals were maintained on a 12 hr light/dark cycle (7:00
A.M./7:00 P.M.). Behavioral experiments were conducted in an isolated
room under dim light between 10:00 A.M. and 5:00 P.M. Animal behaviors
were recorded with a video camera. All experiments were conducted blind
in the sense that the experimenters had no knowledge of the genotypes
and the treatment of the mice.
For the open-field test, a mouse was placed in the center of a
Plexiglas chamber (50 × 50 cm; divided by lines on the floor into
25 equal squares). Nine inner squares were defined as the central area.
Locomotion (ambulation) was measured as the number of squares crossed
by the mouse within 5 or 10 min (Baik et al., 1995
). Rearing responses
(raising of both forefeet and extension of the body) were monitored at
the same time.
For measuring the activity of animals during a 24 hr period, mice
housed individually in standard plastic cages were brought to the room
24 hr before testing. The mouse cage was positioned in an automated
open-field activity monitor, consisting of an open-field chamber
(17 × 17 inch) with three 16-beam I/R arrays and
48-channel control (MED Associates, Inc.). Data were collected continuously by the computer for 24 hr.
Spontaneous immobility was measured by placing the mice on a ring that
is 5.5 cm in diameter and 16 cm above the base (the ring test)
(Pertwee, 1972
). The ring test was chosen because it has been widely
used in measuring the spontaneous (or basal) immobility of mutant mice
(Xu et al., 1994
), including D2-null knock-out mice (Baik et al.,
1995
). The length of time that animals remained immobile on the ring
was recorded, with a cutoff time of 3 min. On the basis of our pilot
study, each mouse was given a maximum of two consecutive trials in the
ring test to minimize the possibility that animals did not perform a
test by chance. The best performance (i.e., the trial with the longest
duration of immobility) was used in the data analysis.
The elevated zero-maze was made from a dark gray polyvinyl chloride
(PVC) annular platform (60 cm in diameter and 7 cm in width) elevated
60 cm above the floor. The zero-maze is divided into four equal
sectors: two opposite open sectors and two opposite closed sectors. The
two closed sectors are enclosed by dark gray PVC walls (19 cm high) on
both the inner and outer edges of the platform. For testing, a mouse
was initially placed on an open sector just in front of a closed sector
and left for 5 min (Konig et al., 1996
). The analysis of the data was
performed according to the standard methods described by Shepherd et
al. (1994)
and Konig et al. (1996)
, using the following criteria:
(1) The percentage of time in the open areas. This is the time
that animals spent in the open sectors with all four paws divided by
the total testing time. (2) General activity. This activity was
measured as the number of different sectors crossed by animals. (3)
Head dips. The number of head dips was counted when animals looked over
or down the edge of the runway. (4) Stretched attend postures. The number of stretched attend postures was counted when animals, on the
closed sector side at the interface between the closed and open
sectors, displayed an elongated body posture stretched toward the open
sector. The zero-maze, a modified version of the plus-maze, is a
standard method for measuring the anxiety of rodents. The merits of
this method as compared with the plus-maze have been reviewed
extensively by Shepherd et al. (1994)
.
Catalepsy induced by haloperidol was measured by placing the forepaws
of the mice on a 5-cm-high horizontal bar (the bar test) (Ushijima et
al., 1995
). The length of time that animals held the bar without any
voluntary movement was recorded, with a cutoff time of 3 min. The bar
test was chosen because it is commonly used in studying the effects of
haloperidol on the cataleptic behavior of rodents. Our pilot study
indicated that most of the wild-type mice exhibited maximal catalepsy
(i.e., 3 min of immobility) in response to haloperidol treatment only
after repeated trials. Thus, each mouse was given a maximum of five
consecutive trials to exhibit haloperidol-induced catalepsy. If
a mouse remained immobile for 180 sec (cutoff time) on the bar at any
given trial, the mouse was removed from the testing device and returned
to a normal mouse cage. All mice received vehicle injection a few days
before drug treatment to minimize the injection or vehicle effect. A
few days later, mice received haloperidol or the second vehicle
injection (see Fig. 8B). Some mice on a hybrid
background (one +/+ and six
/
mice) exhibited significant
immobility in response to vehicle injection in the bar test. These
animals were therefore excluded from further testing because they had
showed immobility previously for a duration close to the cutoff time and no drug-induced catalepsy could be detected within the 3 min testing time. Importantly, none of the WT and D2L
/
mice on a congenic B6 background displayed any immobility in response to vehicle
injection, and none of these animals were excluded from the study.
Haloperidol (Research Biochemicals) was dissolved in 0.9% NaCl
containing 0.03-0.1% lactic acid and adjusted to pH 5.2 by adding
NaOH. The vehicle solution injected was 0.9% NaCl containing 0.03-0.1% lactic acid. (
)-Quinpirole (Research Biochemicals) was
dissolved in 0.9% saline. Drugs were administrated intraperitoneally, and the injection volume was 5 ml/kg of body weight. Drug doses were
administrated in ascending order, starting with the respective vehicle
injection, with 3-7 d between injections or doses to avoid potential
carryover effects. Some animals received only one dose of drugs, some
received two different doses, and some received repeated vehicle
injection. Groups of animals were randomly assigned, depending on the
availability of animals at the time of the experiments. The effects of
haloperidol on catalepsy or locomotion were tested 30 min after the
injection. The effect of quinpirole on locomotion was tested 10 min
after the injection.
The protocol used for the rotarod test in mice was that recommended by
the manufacturer (Basile, Comerio, Italy), using the Rotarod Treadmill
with accelerating speed (Basile; Stoelting). It has been reported that
an accelerating speed in this test reduces the variability of the data
(Jones and Roberts, 1968
). The rotation speed of the rod was increased
from 2 to 20 rpm within 5 min, which was also the cutoff time. A timer
automatically recorded the length of time each mouse stayed on the
rotating rod. Mice were tested on 2 consecutive days. On day 1, each
mouse was given three trials, with an interval of ~2.25 hr between
each trial. On day 2, the test was stopped after the second trial
because the mice had reached and maintained their ceiling performance.
Electrophysiological recordings. The methods for preparation
and maintenance of brain slices were similar to those described previously (Wang and Aghajanian, 1990
; Stevens and Wang, 1994
). Briefly, coronal slices containing the substantia nigra (~300 µm)
were cut with a vibratome (WPI, Sarasota, FL). The slices were then
incubated in artificial CSF (ACSF) at room temperature for at least 1 hr. A single slice was transferred to a submerged type of recording
chamber with continuous perfusion of ACSF at ~32°C. The ACSF,
equilibrated with 95% O2/5%
CO2, was composed of (in mM): NaCl
126, KCl 5, NaH2PO4 1.25, glucose 10, NaHCO3 26, MgSO4 1.3, and CaCl2 2.4. The zona compacta of the substantia nigra (SNc) was identified
according to Franklin and Paxinos (1996)
. Dopaminergic neurons were
identified on the basis of their electrophysiological characteristics
(Grace and Bunney, 1983
) and response to dopamine. Spontaneous
extracellular potentials of dopaminergic neurons were recorded by means
of electrodes filled with ACSF. The electrophysiological experiments
were conducted using an Axoclamp-2B (Axon Instruments, Foster City,
CA). Data were collected and analyzed using pClamp6 program (Axon
Instruments). (
)-Sulpiride was obtained from Research Biochemicals,
and dopamine was from Sigma.
 |
RESULTS |
Generation of dopamine D2L receptor-deficient mice
D2L-deficient mice were produced by deleting a small region of the
D2 gene that contains the exon 6 (87 bp) encoding the D2L insert region
of 29 amino acids in the third intracellular loop (Fig.
1A). In this way, the
gene fragment encoding the D2S receptor remained intact. Homozygous
mice were identified by Southern blot analysis (Fig.
1B). D2L mRNA was not detectable by reverse
transcriptase-PCR (RT-PCR) analysis in homozygous mice (Fig.
1C). In contrast, D2S mRNA in D2L
/
mice was clearly
present and expressed at an increased level (Fig. 1C).
Northern blot analysis further suggested that D2S was upregulated to a
level similar to that of total D2 mRNA in WT mice. Indeed, the density
of D2 receptor was similar between D2L
/
mice and their normal
littermates in various brain regions, as determined by
immunohistochemistry with a specific D2 receptor antibody (data not
shown) and receptor autoradiography with
[125I]NCQ298, a ligand with high
affinity for the D2 and D3 receptors (Vessotskie et al., 1997a
). There
was no significant difference in the total number of binding sites
labeled with [125I]NCQ298 (D2 + D3)
between WT and D2L
/
mice (84.78 ± 11.63 and 75.43 ± 7.43, respectively; p > 0.16, Student's t
test) (Fig. 2A).
Similarly, the D3 binding sites labeled with
[125I]5-OH-PIPAT, which selectively
labeled the D3 receptor under the assay conditions described in
Materials and Methods, were not affected in D2L
/
mice (154.0 ± 11.54 and 153.6 ± 17.24 for +/+ and
/
mice, respectively;
p > 0.11) (Fig. 2B). Previous studies have shown that the expression and/or sensitivity of the D3 and
D4 receptors are not affected in D2 receptor-null knock-out mice that
lack both D2 isoforms (Baik et al., 1995
; Kelly et al., 1998
).
Therefore, it is unlikely that the potential alteration in D3 would be
a major compensatory mechanism in the more subtle D2L
/
mutant
mice.

View larger version (29K):
[in this window]
[in a new window]
|
Figure 1.
Targeted disruption of the D2L gene.
A, Targeting vector. For gene targeting of the D2L
locus, exon 6 (solid box, enlarged for visualization)
was replaced by a PGK-neo cassette that was flanked by loxP
(arrowheads). H,
HindIII; K, KpnI;
Sc, ScaI. B, Southern blot
analysis of genomic DNA from mouse tails ( / , homozygote; +/ ,
heterozygote; +/+, wild type). Tail DNAs were either digested with
KpnI and hybridized with the external probe A or
digested with ScaI and hybridized with the external
probe B. C, Detection of two forms of D2 mRNA by RT-PCR.
PCR products, differing by 87 base pairs and corresponding to the
alternatively spliced isoforms of D2 mRNAs, were shown (numbering from
the left) in lanes 2-4 (+/+ mice; 235 bp, D2S; 322 bp, D2L) and in lanes 5-7 ( / mice).
The size marker (M) was a 123 bp DNA
ladder (lane 1; Life Technologies, Gaithersburg, MD).
D, Northern blot analysis of D2 receptor RNA levels in
the striatum of +/+ (lane 1, left) and /
(lane 2) mice. The probe used was a DNA fragment
complementary to exon 7 of the D2 gene and thus hybridized to RNA from
both WT and D2L / mice. Total striatal RNA used for Northern
analysis was obtained from three to four mice for each genotype on two
separate occasions. The data were quantified with densitometric
analysis using a scanner (UMAX Astra 2400S) and the IQ Mae
program. The data were repeated four times. After normalization to the
intensity of -actin, the amount of D2 mRNA from +/+ (1.04 ± 0.04 U; n = 4) was not significantly different from
the amount of D2 mRNA from / (1.06 ± 0.05 U;
n = 4; p > 0.8, Student's
t test). Note that the D2 mRNA from mutant mice was
present at the predicted smaller size, which is comparable with the
size of D2S mRNA. The size marker indicated by the
arrows was Millennium RNA size marker (Ambion, Austin,
TX). -Actin RNA levels were simultaneously monitored as an internal
control.
|
|

View larger version (53K):
[in this window]
[in a new window]
|
Figure 2.
Representative autoradiographic localizations of
[125I]NCQ298 (A) and
[125I]5-OH-PIPAT (B) binding
in WT (+/+) and D2L / ( / ) mice.
[125I]NCQ298 revealed D2 and D3 receptor binding
sites, and [125I]5-OH-PIPAT, under these assay
conditions, only labeled D3 receptor binding sites (Kung et al., 1994 ;
Vessotskie et al., 1997b ). Both D2 and D3 binding sites were present in
+/+ and / animals. There was no significant difference in the
number of sites labeled with either ligand between +/+ and / mice.
CPu, Caudate-putamen, which contains mainly the D2
receptor (Civelli et al., 1993 ); ICjM, major islands of
Calleja, which contain the D3 receptor but not other D2-like receptors
(Civelli et al., 1993 ).
|
|
To confirm further the levels of the D2 receptor in the mutant mice, we
performed saturation binding assays of
[3H]YM-09151-2 (a standard D2
radioligand and D2 antagonist) using striatal tissue. Radioligand
binding assays are a quantitative method to determine receptor numbers.
Striatum was chosen because D2L is the predominant D2 isoform in this
region (~90% of total D2) in WT mice, whereas D2S is the only D2
isoform in D2L
/
mice (see Fig. 1C). The number of D2
receptor sites (Bmax values) of YM-09151-2 was not significantly different between WT (458.2 ± 34.2 fmol/mg of protein; n = 4 independent experiments)
and D2L
/
(422.5 ± 10.0 fmol/mg of protein; n = 4 independent experiments) mice (Fig.
3A) (p > 0.35, Student's t test). In contrast, the affinities
(Kd values) of
[3H]YM-09151-2 were significantly
different between WT (81.3 ± 0.7 pM) and
D2L
/
(125.6 ± 7.3 pM; p < 0.005) (Fig. 3A), values that are comparable with the
Kd values of YM-09151-2 for D2L and D2S in
recombinant cell lines (Vile et al., 1995
). Together, these data
further indicate that D2S is upregulated and expressed on the cell
surface in the mutant mice. It has been reported that in the absence of
both D2 isoforms, D1 receptor density is either unchanged (Baik et al.,
1995
) or reduced (Kelly et al., 1998
). To determine whether the levels
of the D1 receptor are altered in the absence of D2L, we performed
saturation binding assays of
[3H]SCH23390 using striatal tissue.
There were no significant differences either in the affinity or in the
number of D1 receptor sites in D2L
/
versus WT mice (Fig.
3B). Taken together, these data suggest that the possible
alterations in other DA receptor systems are negligible in D2L
/
mice.

View larger version (23K):
[in this window]
[in a new window]
|
Figure 3.
D2 and D1 ligand binding assays. A,
Saturation binding curve of [3H]YM-09151-2 to the
D2 receptor in striatal membranes from +/+ (open
diamonds) and / (solid circles) mice.
Inset, A Scatchard transformation of the data. The
fit lines were created from
Kd and Bmax
values determined by nonlinear regression. The data shown are from a
single representative experiment. B, Saturation binding
curve of [3H]SCH23390 to the D1 receptor in
striatal membranes. Inset, A Scatchard transformation of
the data. Kd values of
[3H]SCH23390 were 93.1 ± 3.3 pM for +/+ (n = 3 experiments) and
101.6 ± 7.7 pM for / (n = 3) (p > 0.3, Student's t
test). Bmax values of
[3H]SCH23390 were 1657.3 ± 37.2 fmol/mg of
protein for +/+ and 1594.3 ± 27.1 fmol/mg of protein for /
(p > 0.2). The data shown are from a single
representative experiment. B, Bound; F,
free.
|
|
D2-null knock-out mice have been reported to exhibit stunted growth and
low fertility (Baik et al., 1995
; Yamaguchi et al., 1996
), to have a
darkened coat color (Yamaguchi et al., 1996
; Kelly et al., 1997
),
or to have a skewed Mendelian genotype ratio of
/
mice (Kelly et
al., 1997
). In contrast to these observations, D2L
/
mice had
normal fertility and body weight, in comparison with WT mice (examined
up to the age of 7 months). Homozygous mice were obtained with
Mendelian frequency and appeared healthy. The coat color of D2L
/
mice was indistinguishable from that of their normal littermates.
Examination of serial brain sections revealed no gross neuroanatomical
abnormalities. Taken together, the data suggest that any potential
alterations in growth and development of D2L
/
mice (which still
express the D2S isoform) are less severe than are those of D2-null
knock-outs (which lack both D2L and D2S isoforms). This lack of gross
abnormalities enabled us to study the role of the D2L isoform in
behavioral and physiological responses in adult animals.
D2L-deficient mice exhibit reduced levels of locomotion
and rearing
Because the D2 receptor in the basal ganglia is involved in the
regulation of motor functions (Graybiel et al., 1994
), we first
examined whether D2L
/
mice displayed any alterations in motor
behavior. Locomotor activity was assessed using the open-field test. As
shown in Figure 4, both locomotion and
rearing behavior were significantly reduced in D2L
/
mice compared
with WT littermates. It is interesting to note that baseline levels of
rearing were different between mice with different genetic backgrounds.
However, it is well known that different strains of wild-type mice
exhibit different degrees of behavioral responses to the same types of tests. The purpose of these studies was to compare mutant mice with
wild-type mice on a similar background. There was no significant difference in the amount of time spent in the central area between the
two genotypes, suggesting that D2L
/
mice did not show more thigmotaxis (a behavior associated with increased fear) than did WT
mice. These results suggest that D2L may have a larger impact on
locomotion and rearing.

View larger version (17K):
[in this window]
[in a new window]
|
Figure 4.
Behavior of wild-type (+/+) and D2L-deficient
( / ) mice in the open-field test, measured within 5 min.
A, Locomotion (number of squares crossed).
B, Percentage of time animals spent in the central area.
C, Total number (no.) of rears displayed
within the observed period. All data are expressed as the mean ± SEM. Asterisks indicate significant differences between
+/+ and / groups at the level of **p < 0.001 or ***p < 0.0001 (Student's t
test). Hybrid represents mice on a hybrid background,
and N5/B6 represents mice on a congenic B6 background.
Open bars, Hybrid +/+ (n = 12);
solid bars, hybrid / (n = 17);
hatched bars, N5/B6 +/+ (n = 14);
crosshatched bars, N5/B6 / (n = 14).
|
|
Spontaneous (or basal) immobility was measured using the ring test.
D2L
/
mice on a hybrid background displayed significantly longer
periods of immobility than did their WT littermates (Fig. 5). Although the mutant mice on a
congenic B6 background showed longer periods of basal immobility than
did WT mice, the difference did not reach statistical significance
(Fig. 5). One possible explanation for the discrepancy in the
immobility between the hybrid
/
and the congenic B6
/
mice is
that the variation of genetic background contributed to the immobility
exhibited in the hybrid mutants. Another possibility is that the impact of lacking D2L was greater in animals on a hybrid background.

View larger version (17K):
[in this window]
[in a new window]
|
Figure 5.
Basal immobility in mice. Basal immobility is
expressed as the duration of immobilization (in seconds) in the ring
test. The open bar represents the hybrid +/+
(n = 12), and the solid bar
represents the hybrid / (n = 17)
(p < 0.005, Mann-Whitney test). The
hatched bar represents the N5/B6 +/+
(n = 13), and the crosshatched bar
represents the N5/B6 / (n = 14).
|
|
The reduction in locomotion and rearing behavior and the increased
duration of immobility could be interpreted as being caused by an
increased state of apprehension, rather than by a deficiency in motor
function in the mutant mice. Therefore, we evaluated anxiety behavior
using the elevated zero-maze (Konig et al., 1996
). As illustrated in
Figure 6, there were no significant
differences in the percentage of time spent in the open sectors, the
general activity, and the number of head dips between mutant and WT
mice. In contrast, D2L
/
mice displayed significantly less stretched attend postures than did WT mice. It has been reported that a decrease
in stretched attend postures is associated with decreased levels of
anxiety (Shepherd et al., 1994
). Thus, these results suggested that
D2L
/
mice did not have increased anxiety as compared with WT mice
and may even have reduced anxiety.

View larger version (33K):
[in this window]
[in a new window]
|
Figure 6.
Behavior of mice on a congenic B6 background in
the zero-maze test. A, Percentage of time that mice
spent in open sectors (% Time in open area).
B, General activity (i.e., total entries to different
sectors). C, Number of stretched attend postures
displayed by animals. D, Number of head dips displayed
by animals. Data are presented as the mean ± SEM. Open
bars, +/+ (n = 11); crosshatched
bars, / (n = 11). There were no
significant differences between +/+ and / mice in either the
percent of time in the open area (p > 0.7;
Student's t test), general activity
(p > 0.2), or the number of head dips
(p > 0.7). However, there was a significant
difference between +/+ and / mice in the number of stretched attend
postures (*p < 0.02).
|
|
We examined the ability of mice to perform the rotarod test, which is
widely used to evaluate motor coordination in rodents. The greater the
duration of time the animals were able to stay on a rotating rod, the
better motor coordination the animals had. As shown in Figure
7, on day 1, D2L
/
mice initially
performed this test poorly. However, the performance of D2L
/
mice
in the subsequent trials was not significantly different from that of WT mice (p > 0.3, Mann-Whitney test). On day
2, both WT and mutant mice maintained their ability to perform the
rotarod test, learned from the previous day, and there was no
significant difference in the time remaining on the rod between WT and
D2L
/
mice (p > 0.4). These results
suggested that D2L
/
mice were not deficient in the motor
coordination measured with the rotarod test. The neurobiological basis
of motor coordination measured with the rotarod test may be complex, in
that it may involve a large cerebellar component. On the other hand,
the locomotor behavior may involve a large basal ganglion component.
These reflect two different motor abilities, which are not necessary to
be correlated. This is also true for D2-null knock-out mice that
displayed reduced locomotor activity and relatively normal motor
coordination measured with the rotarod test with training (Kelly et
al., 1998
).

View larger version (15K):
[in this window]
[in a new window]
|
Figure 7.
Rotarod performance in wild-type and D2L / mice
on a congenic B6 background. Data are expressed as means ± SEM
for each trial on 2 consecutive days. For day 1, solid
triangles, +/+ (n = 8); solid
circles, / (n = 11). The same groups of
mice were tested again on day 2. For day 2, open
triangles, +/+; open circles, / .
|
|
D2L-deficient mice have reduced sensitivity to
haloperidol-induced catalepsy
To assess the role of D2L in the actions of typical antipsychotic
drugs, we examined the effect of haloperidol treatment on catalepsy
using the bar test. Haloperidol is representative of a typical
antipsychotic drug that elicits the extrapyramidal side effects (EPS)
(Seeman and Tallerico, 1998
). Catalepsy is considered to be useful for
detecting the EPS of antipsychotic drugs, at least for haloperidol
(Hoffman and Donovan, 1995
). Thirty minutes after intraperitoneal
administration of haloperidol, the bar test was conducted. WT mice
displayed strong haloperidol-induced catalepsy, whereas D2L
/
mice
showed much less catalepsy at the doses of haloperidol tested (Fig.
8). We also observed that just before the
bar test (~29 min after haloperidol injection), WT mice showed a
large reduction in spontaneous movement in the open field whereas the
mutant mice in general showed only a small reduction in this activity.

View larger version (13K):
[in this window]
[in a new window]
|
Figure 8.
Haloperidol-induced catalepsy in WT (+/+) and
D2L / ( / ) mice, as determined with the bar test.
A, Haloperidol-induced cataleptic behavior of mice on a
hybrid background. Catalepsy is expressed as the duration of immobility
(in seconds). Solid squares, +/+ (n = 8; 0.5 mg/kg haloperidol); open squares, /
(n = 8; 0.5 mg/kg haloperidol); solid
diamonds, +/+ (n = 9; 1.0 mg/kg
haloperidol); open diamonds, /
(n = 8; 1.0 mg/kg haloperidol). Haloperidol induced
significantly less catalepsy in D2L / mice on a hybrid background
(p < 0.02 for 0.5 mg/kg haloperidol
treatment; p < 0.01 for 1.0 mg/kg haloperidol
treatment, Mann-Whitney test, two-tailed). B,
Haloperidol-induced catalepsy of mice on a congenic B6 background. Mice
that received haloperidol injection (1.0 mg/kg) are indicated as
follows: solid circles, +/+ (n = 7);
open circles, / (n = 9).
Additional groups of mice received the second vehicle injection instead
of drug treatment (i.e., vehicle-vehicle treatment; see Materials and
Methods): open triangles, +/+ (n = 8); open inverted triangles, /
(n = 8). The horizontal scale for
mice receiving the second vehicle injection was arbitrarily shifted a
little for visibility. The vertical scale represents the
accumulative duration of immobility (mean ± SEM) exhibited by
each group of mice. Haloperidol induced significantly less catalepsy in
D2L / mice on a congenic B6 background (p < 0.01, Mann-Whitney test). Repeated vehicle treatment did not
produce any significant immobility.
|
|
To confirm further that D2L
/
mice were less sensitive to
haloperidol, we examined the effects of haloperidol treatment on the
locomotor activity of D2L
/
mice. The degree of immobility induced
by haloperidol in the open field generally reflected the degree of
catalepsy of animals. Thirty minutes after intraperitoneal administration of haloperidol, the open-field test was conducted. Haloperidol dose-dependently inhibited locomotion and rearing behaviors
(Fig. 9). In all cases, haloperidol
produced significantly less inhibition in D2L
/
mice. Taken
together, these results suggest that D2L may contribute more to
haloperidol-induced catalepsy.

View larger version (16K):
[in this window]
[in a new window]
|
Figure 9.
Effects of haloperidol on behaviors of mice
on a congenic B6 background in the open-field test, measured within 10 min. A, Basal activity of mice used in this series of
experiments (no., number of corresponding activity). In
agreement with the results shown in Figure 4, D2L / mice ( / )
displayed significantly lower levels of locomotion (Loc;
***p < 0.0001) and rearing behavior
(**p < 0.001) than did WT mice (+/+).
B, Inhibitory effect of haloperidol on locomotion. The
ED50 value of haloperidol for D2L / (2.33 mg/kg) was
approximately sixfold higher than that for WT mice (0.38 mg/kg).
ED50 values were assessed with the Prism program.
C, Inhibitory effect of haloperidol on rearing behavior.
Vehicle injection (Veh) was normalized as 100%. All
other data were expressed as the percentage of the respective vehicle
injection. Haloperidol produced significantly less inhibition in
locomotion [F(1,63) = 60.96;
p < 0.0001, two-way ANOVA] and rearing
[F(1,63) = 11.00;
p = 0.0015] in D2L / than in WT mice. Data
shown are the mean ± SEM. Numbers in
parentheses represent numbers of mice. Open
triangles, +/+; solid circles, / . The mice
used for 0.3 and 0.6 mg/kg haloperidol injection were the same groups
of mice, except that two additional mice for each genotype were also
used for 0.6 mg/kg haloperidol. Different groups of mice were
used for 1.0 mg/kg haloperidol, and different groups of mice were used
for 3.0 mg/kg haloperidol injection. Additional groups of mice
(n = 7 for +/+; n = 8 for
/ ) received repeated vehicle injections; V-1
represents the first vehicle treatment, and V-2
represents the second vehicle treatment that was given a few days later
(see Materials and Methods). Locomotion of V-1 was
normalized as 100%, and V-2 was expressed as a
percentage of V-1. Inset, B, No
significant effect on locomotion with repeated vehicle injections (+/+,
V-1 vs V-2, p > 1.0;
/ , V-1 vs V-2, p > 0.2, Student's t test).
|
|
D2L-deficient mice express a functional D2S receptor
Analysis of genomic DNA and mRNA revealed that the gene structure
of the D2S receptor is normal in D2L
/
mice (Fig. 1). Receptor binding (Fig. 3A), immunohistochemical experiments, and
receptor autoradiographic analysis (Fig. 2A)
confirmed that the D2S receptor is expressed on the cell surface in the
mutant mice. To determine whether D2L
/
mice express a functional
D2S receptor, we examined the effects of quinpirole, a D2 agonist, on
locomotor activity. It has been shown that quinpirole induces an
initial suppression of locomotor activity across a range of doses in
rodents (Eilam and Szechtman, 1989
; Frantz and Hartesveldt, 1995
). Ten
minutes after injection of quinpirole, locomotor activity was assessed using the open-field test. The quinpirole-elicited dose-dependent suppression of locomotion was not significantly different between D2L
/
and WT mice (Fig. 10). These
results suggest that the D2S receptor is functional in mutant mice.

View larger version (17K):
[in this window]
[in a new window]
|
Figure 10.
Dose-dependent effect of quinpirole on mice on a
congenic B6 background in the open-field test, measured within 10 min.
There was no significant difference between D2L / ( / ) and WT
(+/+) mice in the quinpirole-induced suppression of locomotor
activity [F(1,78) = 0.17;
p = 0.6775, two-way ANOVA]. The responses to
quinpirole treatment were expressed as the percentage of saline
injection that was normalized to 100%. Six to eight mice of each
genotype were used for each dose. Open diamonds, +/+;
solid circles, / .
|
|
Because quinpirole also binds to the D3 receptor, we assessed the
electrophysiological effect of dopamine on the neurons of the zona
compacta of the substantia nigra to determine further whether D2L
/
mice express a functional D2S receptor. It has been well documented
that dopamine exerts an inhibitory effect on SNc dopaminergic neurons
and that this effect is mediated specifically by the D2 receptor
(Bunney et al., 1973
; Pinnock, 1984
; Sanghera et al., 1984
; Lacey et
al., 1987
; Yamaguchi et al., 1996
; Mercuri et al., 1997
). Spontaneous
firing of SNc neurons was recorded extracellularly in brain slices
(Wang and Aghajanian, 1987
, 1989
). Dopamine (3-100 µM),
applied by superfusion, elicited a similar concentration-dependent
reduction in the spontaneous firing rate of SNc neurons from both WT
and D2L
/
mice (Fig.
11A). There was also
no significant difference in the basal firing rates of SNc neurons
between WT (3.60 ± 0.37 Hz; n = 8) and mutant
(3.55 ± 0.35 Hz; n = 11) mice
(p > 0.93). The electrophysiological
characteristics of dopaminergic neurons recorded extracellularly in SNc
from both genotypes were indistinguishable. The inhibitory effect of
dopamine (100 µM) on the spontaneous firing of
SNc neurons was markedly attenuated or completely blocked by the
inclusion of 1 µM (
)-sulpiride, a D2 receptor
antagonist (Fig. 11B). These studies further
demonstrated that D2S was fully functional in D2L
/
mice and suggest
that D2S functions approximately equally well as D2L as an
impulse-modulating autoreceptor in the SNc (for review, see Wolf and
Roth, 1987
). These results provide additional evidence that the total
D2 receptor density is similar between mutant and WT mice.

View larger version (18K):
[in this window]
[in a new window]
|
Figure 11.
Inhibitory effect of dopamine on the firing rate
of SNc neurons and the blockade of dopamine-induced inhibition by
sulpiride. A, Dose-response relationship is shown for
dopamine-induced inhibition of the firing rate of SNc neurons from WT
(n = 8 neurons from 6 +/+ mice) and D2L /
(n = 11 neurons from 9 / mice). In most cases,
at least three doses of DA were tested on the same cells. Data are
expressed as the mean ± SEM with the numbers of
neurons represented by each data point indicated in
parentheses. The dose-response curves of DA inhibition
are not significantly different between +/+ and / mice
[F(1,53) = 1.19; p > 0.28, two-way ANOVA]. Inset, A sample
trace of extracellular spike is shown. Calibration: 0.5 mV, 5 msec. Basal firing rate (Bsl) was
normalized as 100%. B, Sulpiride
(Sul) antagonized the effects of DA. DA
(100 µM) inhibited the SNc neuronal firing (solid
bars). ( )-Sulpiride (1 µM) primarily attenuated
or completely blocked the effect of DA (hatched bars).
Data shown represent n = 3 neurons from two +/+
mice and n = 5 neurons from five / mice.
Sulpiride by itself elicited small increases in firing rate (4.4 ± 2.2% for +/+; 7.7 ± 4.0% for / ). In some cells, dopamine
was applied again after 1-2 hr of washing out sulpiride
(n = 2 from 2 +/+ mice; n = 3 from 3 / mice). The inhibitory effect of DA was primarily restored
(DA/Re; open bars).
|
|
D2L-deficient mice exhibit reduced motor activity in the
home cage
To study further the motor behavior of D2L
/
mice, we examined
the spontaneous basal motor activity of animals in their home cages
during the 24 hr circadian cycle. The activity of D2L
/
mice was
reduced in the diurnal as well as the nocturnal period, particularly
during the diurnal period (Fig. 12);
however, the circadian pattern of the mutant mice was not different
from that of WT mice. These results suggest that the reduction in
locomotor activity of D2L
/
mice in a novel environment is caused,
at least partially, by a general decrease in motor activity.

View larger version (11K):
[in this window]
[in a new window]
|
Figure 12.
Motor activity in the home cage.
A, The activity of D2L / ( / ; open
diamonds; n = 7) and WT (+/+; solid
diamonds; n = 6) on a congenic B6
background in the home cage during a 24 hr period. Data are expressed
as average counts during each 1 hr time block. B, The
total activity of animals over 24 hr in the home cage. Data are
expressed as the mean ± SEM. There was a significant difference
in activity between / (open bar) and +/+
(solid bar) mice (*p < 0.05, Student's t test).
|
|
 |
DISCUSSION |
We found that D2L
/
mice (expressing exclusively D2S) displayed
deficiencies in locomotion and rearing behavior but not in anxiety,
motor coordination measured with the rotarod test, and impulse-modulating autoreceptor function. Interestingly, D2L
/
mice
were less sensitive to haloperidol-induced catalepsy and locomotor
inhibition. However, D2L
/
and WT mice were approximately equally
sensitive to quinpirole-induced initial locomotor suppression. These
results have several implications: (1) that D2L might have a bigger
impact on certain types of motor functions, (2) that blockade of D2L
might contribute more than blockade of D2S to the extrapyramidal side
effects (or parkinsonism) that are commonly associated with typical
antipsychotic drugs, and (3) that the functions of these two isoforms
were not dependent on the formation of receptor heterodimers. Note that
our findings could not have been achieved using pharmacological
methods, because no D2 isoform-selective compounds are available.
The behavioral phenotypes observed in D2L
/
mice were not
attributable to an overall reduction in D2 receptor density. No significant differences were observed between the mutant and WT mice in
either total striatal D2 mRNA, as measured by Northern blot, or D2
receptor density, as measured by
[3H]YM-09151-2 binding and D2-mediated
electrophysiological responses. These measurements indicated a
compensatory increase in D2S expression levels in mice lacking D2L.
We further demonstrated that the D2S receptor is functional in D2L
/
mice, using both behavioral and physiological assays. The inhibitory
effect of DA on SNc neurons is mediated specifically by D2 because it
is completely blocked by D2 antagonists (Bunney et al., 1973
; Pinnock,
1984
; Sanghera et al., 1984
; Lacey et al., 1987
) and it is absent in
D2-null knock-out mice (Yamaguchi et al., 1996
; Mercuri et al., 1997
).
The inhibitory effect of DA on SNc neurons is not mediated by D3 or D4,
because the effect of DA is intact in D3 knock-out mice (Koeltzow et
al., 1998
) and there is no detectable D4 expression in SN (Bouthenet et
al., 1991
). This effect is also not mediated by D1, because a specific D1 antagonist does not block the DA effect (Lacey et al., 1987
).
Unlike D2-null knock-out mice that do not show a response to 2 mg/kg
quinpirole (Kelly et al., 1998
), D2L
/
and WT mice had similar
sensitivities to quinpirole. It has been established that low doses of
D2 agonists (e.g., quinpirole) suppress locomotor activity in rodents
(Eilam and Szechtman, 1989
). This effect is thought to be
mediated by stimulation of DA autoreceptors located in the midbrain
(Aghajanian and Bunney, 1977
; White and Wang, 1984
). Higher doses of D2
agonists produce biphasic effects on locomotion, initially decreasing
and later increasing locomotor activity (Eilam and Szechtman, 1989
;
Frantz and Hartesveldt, 1995
). It has been suggested that the initial
suppression of locomotion by higher doses of D2 agonists is also
mediated by autoreceptors. Our results are consistent with the idea
that the initial suppression of locomotor activity induced by
quinpirole is mediated by D2 autoreceptors, because this effect was
correlated with our electrophysiological data showing that dopamine had
inhibitory effects on SNc neurons.
Some of the behavioral changes such as locomotion may be primarily
dependent on the nucleus accumbens, whereas some such as catalepsy may
be dependent on both the caudate-putamen and the nucleus accumbens. In
all references to "striatum" in this paper, we refer to the entire
striatum, i.e., the dorsal striatum (including the caudate nucleus and
putamen) and the ventral striatum (including the nucleus accumbens,
olfactory tubercle, and the ventral part of caudate-putamen). It is
likely that both the nigrostriatal and mesolimbic dopamine systems are
involved in the behavioral changes studied here.
Are the phenotypic behaviors shown here caused by the lack of D2L or by
the upregulation of D2S? We favor the former possibility for the
following reasons: (1) If hypolocomotion observed in the mutant is the
consequence of the upregulation of D2S, then D2S would have a
functional effect opposite that of D2L. Studies in transfected cell
lines have shown that the two isoforms of D2 receptor either both
inhibit adenylyl cyclase, although to a different degree, or are both
coupled to different Gi-proteins (Dal Toso et
al., 1989
; Senogles, 1994
; Picetti et al., 1997
). This suggests that
these two alternatively spliced variants and highly structurally homologous proteins function in a complementary and synergistic manner,
rather than an antagonistic one. (2) The reduced spontaneous movement
observed in D2L
/
mice resembles the phenotypic behavior reported in
D2-null knock-out mice (which are deficient in both D2 isoforms) (Baik
et al., 1995
; Yamaguchi et al., 1996
; Kelly et al., 1998
). In
particular, the locomotor activity of D2L
/
mice on a congenic B6
background was ~50% lower than that of WT mice, which is comparable
with the degree of reduction in locomotion observed in D2-null
knock-outs on a similar genetic background (Kelly et al., 1998
). This
suggests that the reduced locomotor activity seen in D2L
/
mice is
mainly caused by the absence of D2L. (3) As illustrated in Figure 9,
haloperidol produced a dose-dependent inhibition of locomotion and
rearing behaviors of both WT and D2L
/
, although to a much lesser
degree in D2L
/
mice. This further suggests that D2S is unlikely to
have effects on locomotor activity that oppose those of D2L; otherwise,
the reverse behavioral phenotype would be predicted. Could the function
of D2S be dependent on the presence of D2L? We observed that the
effects of quinpirole, dopamine, and sulpiride were intact in D2L
/
mice. This suggests that D2S can function independently, at least with
respect to drug treatment. Taken together, the evidence suggests that
the phenotypic behaviors examined here are likely attributed to the lack of D2L in the mutant mice. We cannot, however, exclude the possibility that the upregulation of D2S might have effects on other
animal behaviors that were not examined in this study. In the future,
it will be of interest to compare WT with D2S
/
mice (when these
animals become available) and to compare D2L
/
with D2S
/
. Such
studies will further improve our understanding of the specific
functions of each isoform. The profound phenotypic differences we
characterized in this study, comparing D2L
/
with WT mice, represent
an important and promising first step in defining unique functional
roles of individual D2 isoforms in the CNS.
Are some behavioral changes caused by the compensatory changes in the
D1 receptor? At this stage, we cannot completely exclude a possible
compensatory change in the D1 receptor in D2L
/
mice. However, our
receptor binding data indicate that the D1 receptor sites and affinity
remain unchanged in the mutant mice. In addition, it has been reported
that there is no detectable upregulation in other components of central
dopaminergic systems in D2-null knock-out mice and a possible change in
the D1 receptor cannot be a major adaptation mechanism (Baik et al.,
1995
; Kelly et al., 1998
). If the D1 receptor has not been shown to be
a major compensatory mechanism in D2-null knock-out mice in which the
entire D2 gene was deleted, it is unlikely that the potential
alteration in the D1 receptor would be a major compensatory mechanism
in the more subtle D2L
/
mutant mice. In the future, it will be of
interest to study the functional interaction between the D1 and D2L or D2S receptor. It is possible that the D1 receptor system per se may not
be changed in our mutant; however, the interaction between D2S and D1
may differ from that of D2L and D1.
The D2 receptor system has been implicated in both schizophrenia and
Parkinson's disease (Carlsson and Carlsson, 1990
; Graybiel, 1995
;
Jaber et al., 1996
). Levodopa (a DA precursor) and D2 agonists effectively relieve the motor symptoms of Parkinson's disease but can
also elicit psychosis in parkinsonian patients (Snyder, 1972
). D2
receptor antagonists alleviate the psychotic symptoms of schizophrenia.
However, s