Previous Article | Next Article 
The Journal of Neuroscience, December 1, 2000, 20(23):8643-8650
GABAC Receptor Sensitivity Is Modulated by
Interaction with MAP1B
Daniela
Billups1, 2,
Jonathan G.
Hanley1,
Mariam
Orme1,
David
Attwell2, and
Stephen J.
Moss1
1 Laboratory for Molecular Cell Biology and Department
of Pharmacology, and 2 Department of Physiology, University
College London, London, WC1E 6BT, United Kingdom
 |
ABSTRACT |
GABAC receptors contain
subunits and mediate
feedback inhibition from retinal amacrine cells to bipolar cells. We
previously identified the cytoskeletal protein MAP1B as a
1 subunit
anchoring protein. Here, we analyze the structural basis and functional significance of the MAP1B-
1 interaction. Twelve amino acids at the C
terminus of the large intracellular loop of
1 (and also
2) are
sufficient for interaction with MAP1B. Disruption of the MAP1B-
interaction in bipolar cells in retinal slices decreased the
EC50 of their GABAC receptors, doubling the
receptors' current at low GABA concentrations without affecting their
maximum current at high concentrations. Thus, anchoring to the
cytoskeleton lowers the sensitivity of GABAC receptors and
provides a likely site for functional modulation of GABAC
receptor-mediated inhibition.
Key words:
GABA;
subunit; MAP1B; EC50; retina; bipolar; uptake
 |
INTRODUCTION |
Ionotropic
-aminobutyric acid
receptors are divided into two classes, GABAA and
GABAC, both of which gate chloride channels but
have different properties and expression patterns (Rabow et al., 1995
;
Lukasiewicz, 1996
). GABAC receptors are present
mainly in the retina, with lower levels in the brain and spinal cord (Cutting et al., 1991
; Feigenspan et al., 1993
; Qian and Dowling, 1993
;
Enz et al., 1995
; Ogurusu et al., 1995
). They are enriched on retinal
bipolar cell axon terminals where they receive GABAergic input from
amacrine cells (Tachibana and Kaneko, 1987
; Feigenspan et al., 1993
).
GABAC receptor activation inhibits release of
glutamate from bipolar cells onto retinal ganglion and amacrine cells
and tunes the dynamic range, temporal resolution, and spatial contrast of retinal responses to visual stimuli (Pan and Lipton, 1995
; Dong and
Werblin, 1998
; Euler and Masland, 2000
; Shields et al., 2000
).
GABAA receptors are hetero-oligomers, formed from
1-6,
1-3,
1-3,
,
,
, and
subunits (Rabow et
al., 1995
; Bonnert et al., 1999
), whereas GABAC
receptors contain distinct
subunits that, when expressed in
Xenopus oocytes, exhibit properties similar to those of
retinal GABAC receptors (Shimada et al., 1992
;
Feigenspan et al., 1993
; Wang et al., 1994
). Three
subunits have
been cloned that can form functional homo-oligomeric receptors (Cutting
et al., 1991
; Wang et al., 1994
; Shingai et al., 1996
) but may also form hetero-oligomers with each other or with some
GABAA receptor subunits (Zhang et al., 1995
;
Hackam et al., 1997
; Qian and Ripps, 1999
). Clustering of
subunits
occurs at synapses on bipolar axon terminals (Enz et al., 1996
; Koulen
et al., 1998
). We previously reported an interaction between
1 and
the microtubule-associated protein MAP1B (heavy chain) as a likely
mechanism for anchoring GABAC receptors to the
cytoskeleton to maintain this clustered distribution (Hanley et al.,
1999
).
In addition to interacting with MAP1B,
1 subunits can bind to a
glycine transporter splice variant, GLYT-1E/F (Hanley et al., 2000
).
These interactions suggest similarities to the organization at the
postsynaptic density of excitatory synapses, where an array of
multimolecular interactions is involved in the anchoring and signaling
of AMPA, NMDA, and metabotropic receptors (Ziff, 1997
; Kim and Huganir,
1999
). For NMDA receptors, interaction with the cytoskeletal protein
-actinin-2 tethers the receptor and also modulates its inactivation
(Wyszynski et al., 1997
; Zhang et al., 1998
; Krupp et al., 1999
). It is
unknown whether proteins anchoring inhibitory receptors also modulate
channel properties.
Here, we identify the binding site for MAP1B on
1 as a 12 amino acid
motif, RI(D/N)THAIDKYSR, at the C-terminal end of the intracellular
loop between transmembrane regions three and four. Dialysis of retinal
bipolar cells with peptides containing this motif, to competitively
disrupt the binding of MAP1B to
1, decreases the
EC50 of GABAC receptors,
doubling the amount of current that they produce at low GABA
concentrations. These data show, for the first time for an inhibitory
synapse, that binding of receptors to the cytoskeleton controls the
functional properties of the receptors.
 |
MATERIALS AND METHODS |
Antibodies. MAP1B was detected using Anti-MAP1B,
clone AA6 (Sigma, St. Louis, MO).
1myc
was detected using supernatant from 9E10 hybridoma cells.
Glutathione S-transferase fusion protein
production. Glutathione S-transferase-MAP1B is a fusion
of GST with amino acids 460-585 of MAP1B [similar to the fusion with
residues 460-565 used by Hanley et al. (1999)
]. GST-GLYT-1E/F
contains the C-terminal 58 amino acids of GLYT-1E/F [GST-clone 6 of
Hanley et al. (2000)
]. GST-
1 contains the intracellular part of
human
1 between transmembrane domains 3 and 4 (amino acids
355-454), and GST-
2,
1,
3, and
2 were equivalent
constructs. GST fusions of
1 truncation mutants were constructed by
PCR cloning of cDNA fragments into pGEX-4T3, using primers as follows:
1355-444, 5' sense primer:
CGTGGATCCGAGTATGCGGCCGTCAAC; 3' antisense primer: GTGGAATTCTCAGTCGATTCTCATGCT;
1355-449, 5' sense primer:
CGTGGATCCGAGTATGCGGCCGTCAAC; 3' antisense primer: GTAGAATTCTCAATCAATGGCGTGGGT;
2, 5' sense
primer: GTGGGATCCGAGTATGCGGCTGTCAAC; 3' antisense primer:
TATGAATTCTCACCTAGAGTATTTGTC. Subsequent synthesis and purification of
GST fusions was performed as described by Smith and Johnson (1988)
.
COS cell transfections. COS cells were cultured at
37°C, 5% CO2, in DMEM (Life Technologies,
Gaithersburg, MD) containing 10% fetal calf serum (Life
Technologies), 2 mM L-glutamine (Life Technologies), penicillin, and streptomycin. Cells were grown to
50-70% confluency, and transfected by electroporation. Ten milligram
cytomegalovirus (CMV) promoter-driven expression constructs were used
per transfection.
Affinity purification (pull-down assay). This was performed
from retinal extract or from transfected COS cells as described previously (Hanley et al., 1999
, 2000
). Briefly, retinae or transfected COS cells were lysed in 1% Triton X-100 lysis buffer, and insoluble material was removed by centrifugation. Lysates were incubated with GST
fusion proteins bound to glutathione-agarose beads at 4°C with
rotation for 2 hr. Beads were then washed three times with lysis buffer
and resuspended in SDS-PAGE sample buffer, and bound proteins were
detected by Western blotting.
Site-directed mutagenesis. Mutations were made in a CMV
promoter-driven
1myc construct
(full-length
with the myc tag EQKLISEEDL between amino
acids 4 and 5 of the mature peptide) by the Transformer Site-Directed Mutagenesis Kit (Clontech, Cambridge, UK),
using the following mutagenic primers: VSM
KKT:
AGCAGCTATAAGAAGACTAGAATCGATACC; RID
FNS:
GTGAGCATGTTTAACTCGACCCACGCCATT; THA
VSK:
ATGAGAATCGATGTATCAAAAATTGATAAATAC; KY
RL: CACGCCATTGATCGTCTATCCAGGATC.
Peptide competition assays. Peptides were synthesized by
Altabioscience and stored at
20°C in DMSO at 40 mg/ml. Pull-down assays were performed as above in a volume of 1 ml, followed by washing
beads once in lysis buffer. Beads were resuspended in 400 ml lysis
buffer, and peptide was added to varying final concentrations. After
rotation at 4°C for 15 min, the beads were washed an additional three
times in lysis buffer and then resuspended in SDS-PAGE sample buffer,
and bound proteins were analyzed by Western blotting. The normal
peptide used containing the (rat) binding site amino acids had the
sequence X-RINTHAIDKYSR (where X was the antennapedia sequence RQIKIWFQNRRMKWKK, biotinylated at the N terminus;
X promotes peptide entry into cells, but this property was not used in
the experiments reported here). The peptide with the scrambled version of the binding site had the sequence X-HRTSKINIYRDA. The N-terminally truncated peptide used, THAIDKYSR, did not have the antennapedia sequence added.
Isolated bipolar cells. Approximately one-quarter of an
isolated retina from an adult [postnatal day 35 (P35)] rat was
incubated at 34°C for 20 min in 2 ml of solution containing (in
mM): NaCl 101, KCl 3.7, NaHCO3 25, NaH2PO4 10, Na-pyruvate 1, glucose 15, DL-cysteine 10, plus papain (Sigma P3125, 15 µl/2 ml), then washed four times in extracellular solution and
triturated through a Pasteur pipette, before plating into the recording chamber.
Retinal slices. Retinal slices from adult (P35) rats were
prepared as described by Werblin (1978)
for salamander retina. Briefly, retinal pieces ~2 mm square were laid on Millipore filter paper, ganglion cell side down; the sclera was gently removed, and the tissue
was covered with normal external solution (lacking
CoCl2). The retina was then cut into
200-µm-thick slices, each still attached to a strip of Millipore,
with a hand-operated razor blade. The slices were rotated through
90°, and the attached Millipore was embedded in lines of Vaseline to
hold the slice so that all cell types were visible for patch-clamping
using an upright, fixed-stage microscope. ON-bipolar cells were
identified, both before whole-cell clamping and after filling with
Lucifer yellow from the patch pipette, by the location of their soma in
the inner nuclear layer close to the outer plexiform layer, with
dendrites ascending to the outer plexiform layer and an axon descending
to terminate in the inner part of the inner plexiform layer. Most were
probably rod bipolars, or the morphologically similar type 8 and 9 cone ON bipolars in the classification of Euler and Wässle (1998)
. Experiments were at room temperature (21-25°C).
Electrodes. Electrodes had a resistance of 5-10 M
in
external solution. The series resistance in whole-cell mode was ~25 M
, giving series resistance voltage errors <3 mV for currents <0.1 nA.
Solutions for electrophysiology. Extracellular solution
contained (in mM): NaCl 130, KCl 2.5, MgCl2 2, HEPES 10, glucose 10, CaCl2 2, bicuculline 0.3 (to block
GABAA receptors), pH set to 7.4 with NaOH,
bubbled with O2. For experiments on slices,
CaCl2 was replaced by CoCl2
(4 mM) to block synaptic transmission (Euler et al., 1996
).
Intracellular solution contained (in mM): KCl 135, CaCl2 0.5, Na2EGTA 5, HEPES
10, MgCl2 2, MgATP 2, pH set to 7.2 with KOH, and
Lucifer yellow (di-potassium salt) 0.2%. In addition, the solution
contained 100 µM of either a peptide including the binding site for MAP1B on
1, X-RINTHAIDKYSR, or a peptide containing a scrambled version of the binding site X-HRTSKINIYRDA (see
above). In some experiments, the peptidase inhibitors bestatin (10 µM), leupeptin (100 µM), and pepstatin (1 µM) were included to prevent peptide breakdown, with no
significant effect on the results.
Peptide diffusion time to bipolar cell axon terminal.
The diffusion constant of the peptides was estimated as
D = 1.07 × 10
10
m2/sec by scaling the value for
somatostatin (Holladay and Puett, 1976
) in proportion to the square
root of the ratio of its molecular weight (1638) to that of the
peptides used here (3945). For an axon of length L = 50 µm, the diffusion time from the soma to the axon terminal is
~L2/2D = 12 sec. Thus, once inside the cell soma, the peptides used should
equilibrate through the cell relatively quickly. The time constant for
the peptide to equilibrate between the patch pipette and the cell
volume is given by
= VRs/(D
) (Marie and
Attwell, 1999
), where the cell volume V is ~850
µm3 (for a 10-µm-diameter soma, 100 µm total length of axon plus dendrites of diameter 2 µm, and a
synaptic terminal of diameter 3 µm), the series resistance
Rs is 25 M
, and the resistivity of
the pipette solution
is 0.8
m. With these numbers,
= 248 sec.
Effect of uptake on GABAC receptor EC50
changes. To quantify how uptake reduces the GABA concentration
outside bipolar cells in retinal slices,
[GABA]o, below the concentration applied in the
bulk solution, [GABA]B, we treat a simplified
model of the slice in which the bulk solution is separated from the
extracellular space by a diffusion barrier of permeability
P. GABA enters the extracellular space at a rate:
|
(1)
|
and at equilibrium this must equal the rate of uptake into
cells:
|
(2)
|
where U and KU are
the maximum rate and Michaelis-Menten constant of uptake. From
Equations 1 and 2:
|
(3)
|
Thus, when the bulk solution [GABA]B is at a value
that makes [GABA]o equal the EC50, so a
half-maximal current is generated:
|
(4)
|
Because [GABA]o = EC50 = 11 µM (measured in isolated
cells in cobalt/zero Ca2+ solution; see
Results), when the applied [GABA]B = 40.4 µM (mean EC50 measured for the GABA
concentration applied to slices; see Results), and
KU ~30 µM
for GAT-1 and GAT-3 in rat (Borden et al., 1994
), Equation 4 gives
U/P = 109.6 µM.
For a 32% reduction (from 40.4 µM) of the
[GABA]B generating a half-maximal current, as
seen experimentally with the peptide disrupting the MAP1B-
interaction (see Results), solving Equation 4 gives an
EC50 value of 6.9 µM, i.e., reduced
from 11 µM by 37%. Thus, fractional changes in the bulk
solution EC50 underestimate fractional changes of
the real EC50 by a factor of 32/37 = 0.86, i.e., a 14% underestimate. The presence of uptake therefore has no
effect on the conclusion (see Results) that disrupting the
-MAP1B
interaction approximately doubles the current at low GABA concentrations.
 |
Data analysis |
The Hill equation (Eq. 5) was fitted to dose-response data
using SigmaPlot. Data are presented as mean ± SEM.
 |
RESULTS |
MAP1B binds at the C-terminal end of the
1 subunit
intracellular domain
We have previously demonstrated that MAP1B binds to the C-terminal
quarter of the TM3-TM4 loop of the human
1 subunit, between amino
acid residues S434 and
R454 (Hanley et al., 1999
). To analyze the
binding site further, we constructed two C-terminal truncations of the
GST fusion protein with the full-length TM3-TM4 loop (GST-
1); we
have shown previously that the GST fusion with the full loop binds
MAP1B (Hanley et al., 1999
, their Fig. 2e). These polypeptides, which
start at E355 and terminate at
I449 or I444,
were tested for interaction with MAP1B from retinal extract in
pull-down assays. The 10 amino acid truncation
(E355-I444)
showed no MAP1B binding (Fig.
1B), indicating that
crucial residues for the interaction are located within the region
D445-R454.
The five amino acid truncation
(E355-I449)
showed an extremely low level of MAP1B binding, but it was still higher
than the GST control (Fig. 1C). Taken together, these data indicate that the residues required for strong binding to MAP1B are
present within the final five amino acids
(D450KYSR454)
of the intracellular loop and that there are also contributing residues
among amino acids
D445THAI449.

View larger version (44K):
[in this window]
[in a new window]
|
Figure 1.
MAP1B binds to the extreme C terminus of the 1
TM3-TM4 intracellular loop. Immobilized GST fusion proteins
corresponding to C-terminal truncations of the 1 intracellular loop
were incubated with retinal extract in pull-down assays. MAP1B binding
was determined by Western blotting. A, Sequences of the
GST fusions with the C-terminal half of 1 intracellular loop
( 1402-454), with a 10 amino acid truncation
(355-454) and a five amino acid truncation (355-449).
B, Binding of MAP1B to the 10 amino acid truncation
fusion protein, compared with binding to the C-terminal half of the
intracellular loop 1402-454. Other
lanes show lack of binding to GST and the input to the
assay. in represents the MAP1B present in 1% of the
input. C, Same as B but for the five
amino acid truncated fusion protein.
|
|
Identification of residues required for MAP1B binding on the
1 subunit
To investigate the importance of specific amino acids in
1 for
interaction with MAP1B, we performed site-directed mutagenesis of a
mammalian expression construct encoding full-length human myc-tagged
1. COS cells transfected with these constructs
were lysed, and binding to GST-MAP1B [containing amino acids 460-585 of MAP1B (Hanley et al., 1999
)] was analyzed in pull-down assays. Figure 1 demonstrates that residues at the extreme C terminus of the
intracellular
1 loop are crucial for the interaction, so we mutated
residues in this region adjacent to TM4. We have previously
demonstrated that the
1,
3, and
2 subunits of
GABAA receptors do not interact with MAP1B in
pull-down assays (Hanley et al., 1999
), so we chose to mutate residues
in
1 to those in
1. Mutations were performed in groups of three
residues as shown in Figure
2A. Of the six most
C-terminal residues of this region, IDKYSR, four are identical in
1
(and also homologous to a range of other ionotropic GABA receptor
subunits), so only two of these six amino acids were mutated
(KY
RL).

View larger version (39K):
[in this window]
[in a new window]
|
Figure 2.
Identification of amino acid residues in the 1
intracellular loop important for MAP1B binding. Immobilized GST fusion
protein corresponding to the 1-binding region of MAP1B was incubated
with extracts of COS cells transfected with mutants of full-length
1myc in pull-down assays. Groups of residues in
1 were mutated to the equivalent sequence of the 1 subunit
of GABAA receptors. A, Alignment of extreme
C-terminal regions of intracellular TM3-TM4 loop of 1 and 1
subunits. Amino acid substitutions are shown in boxes;
identical amino acids were not mutated. B, Binding of
1myc mutants to GST-MAP1B as determined by
Western blotting. For each construct, in represents the
1myc present in 5% of the input, and
bd represents protein bound to GST-MAP1B;
GST shows lack of binding of 1myc
to GST alone.
|
|
The most N-terminal mutation, VSM
KKT, did not affect binding of
1myc to GST-MAP1B, indicating that
these residues are outside the critical binding site. The RID
FNS and
THA
VSK mutants both display a reduced interaction with GST-MAP1B,
indicating that these residues are important contributors to the
interaction. The most C-terminal mutation, KY
RL, abolished binding
to undetectable levels. Thus, of the five most C-terminal amino acids
shown in Figure 1 to be important for binding to MAP1B, the
lysine-tyrosine motif makes a crucial contribution.
Although, theoretically, the mutations and truncations described above
could be preventing the binding of MAP1B to
1 by altering the
conformation of a binding site in a distant part of the
1 protein,
the results of the experiments described in the next section make this
extremely unlikely: a peptide mimicking the C-terminal part of the
1
intracellular loop competes with
1 for binding to MAP1B.
Block of MAP1B binding to
1 by competition with a binding
site peptide
The data above suggest that MAP1B binds to the region
RI(D/N)THAIDKYSR in
1 (where D/N denotes the human/rat sequence). To further confirm that this sequence represents the binding site, we
synthesized a peptide containing this sequence (see Materials and
Methods; rat version, as it would be used for biochemical and
electrophysiological experiments on rat tissue, as described below). To
investigate whether this peptide is sufficient to bind to MAP1B, we
performed pull-down assays from rat retinal extract using GST-
1. If
the peptide is capable of binding to MAP1B, then it will compete with
GST-
1 for the binding site on MAP1B and result in a reduced level of
MAP1B binding to GST-
1 beads. The peptide was added to the assay at
varying concentrations, and the levels of MAP1B were analyzed by
Western blotting (Fig. 3A). Peptide at 50 nM had little effect on the amount of MAP1B
bound, but 100 nM significantly reduced the
binding, and at 250 nM no binding was detected to
GST-
1. This competitive inhibition of binding of the human
1
sequence to MAP1B using a peptide with the rat
1 sequence shows that
the one amino acid difference in these sequences (D/N) does not prevent
binding. A peptide containing a scrambled version of the binding site,
HRTSKINIYRDA, was used as a control (see Materials and Methods); this
did not compete for MAP1B binding, even at the highest concentration
(250 nM). We also synthesized an N-terminally
truncated peptide corresponding to the sequence THAIDKYSR and tested
this in a similar pull-down assay (Fig. 3B). This peptide
was insufficient to compete for MAP1B binding, demonstrating that, in
addition to the KY pair identified above, one or more of the amino acid
residues RIN are required for the interaction with MAP1B (interaction
of
2 with MAP1B, described below, suggests that it is the N and not
the RI that is important).

View larger version (53K):
[in this window]
[in a new window]
|
Figure 3.
Competitive inhibition of MAP1B binding to by
peptides. The peptide containing the motif RINTHAIDKYSR
(A) but not that containing THAIDKYSR
(B) competes for MAP1B binding in retinal
pull-down assays. A, Immobilized GST- 1 was incubated
first with retinal extract, followed by 50-250 nM MAP1B
binding site peptide or 250 nM scrambled control peptide.
MAP1B bound to beads after this treatment was determined by Western
blotting. B, Same as in A, but with
truncated binding-site peptide. C, Pull-down assay from
retinal lysate using immobilized GST alone or GST fusions of 1,
2, 1, 3, and 2 subunit intracellular loops. For all panels,
lane labeled GST shows no binding of MAP1B to GST alone,
and in represents MAP1B present in 1% of input.
|
|
We previously reported that MAP1B does not interact with the
1,
3, or
2 subunits of GABAA receptors, nor
does it interact with the
2 subunit of GABAC
receptors in the yeast two-hybrid system (Hanley et al., 1999
). The
sequence of
2 at the extreme C terminus of the TM3-TM4 loop is
FQNTHAIDKYSR, which is identical to
1 with the exception of FQ. To
test the possibility that
2 can interact with MAP1B, we constructed
a GST fusion protein with the TM3-TM4 loop of
2 and analyzed
binding to MAP1B from retinal extract using a pull-down assay (Fig.
3C). MAP1B bound to GST-
2 at similar levels to
1 in
this assay. This apparent discrepancy with the previous negative result
for
2 in yeast (Hanley et al., 1999
) is likely to reflect
limitations of the yeast two-hybrid system, because the pull-down assay
is performed under more native conditions. Confirming earlier pull-down
and immunoprecipitation data (Hanley et al., 1999
), in which
2 was
not tested, MAP1B did not interact with
1,
3, and
2 (Fig.
3C).
The glycine transporter GLYT-1E/F and MAP1B bind to different
regions of
1
To investigate whether GLYT-1E/F binds to the same region of
1
as MAP1B or has a different binding site, we performed assays pulling
down myc-tagged
1 from COS cells using GST-MAP1B and GST-GLYT-1E/F
[containing the 58 most C-terminal amino acids of the bovine
transporter (Hanley et al., 2000
)]. In each case, the reactions were
treated with 250 nM of the peptide corresponding to the
MAP1B binding site, or of the scrambled control peptide, and the
binding of
1 to GST-MAP1B and GST-GLYT-1E/F was determined by
Western blotting (Fig.
4A). The binding site
peptide competed for binding to GST-MAP1B, confirming that this
1
sequence is the site of interaction with MAP1B. However, the peptide
did not compete for binding to GST-GLYT-1E/F, indicating that the
transporter binds to a different region of
1. To confirm this
result, the MAP1B binding site mutants of
1myc were tested for binding to
GST-GLYT-1E/F in pull-down assays from transfected COS cell lysate
(Fig. 4B). All four mutants show a similar level of
binding compared with input, indicating that they bind equally well to
GST-GLYT-1E/F and implying that the GLYT-1E/F binding site differs from
that for MAP1B.

View larger version (49K):
[in this window]
[in a new window]
|
Figure 4.
GLYT-1E/F and MAP1B interact with different
regions of the 1 intracellular loop. A, Immobilized
GST-GLYT-1E/F or GST-MAP1B were incubated first with extract of COS
cells transfected with 1myc, followed by 250 nM of the MAP1B binding site peptide (+) containing
RINTHAIDKYSR, or of the peptide containing a scrambled version ( ) of
the binding site. 1myc bound to beads after this
treatment was determined by Western blotting. GST shows
lack of binding of 1myc to GST alone, and
in represents the 1myc present in
5% of the input. B, Immobilized GST-GLYT-1E/F was
incubated with extracts of COS cells transfected with mutants of
1myc subunit in pull-down assays. Groups of
residues in 1 were mutated to the equivalent sequence of 1
subunit of GABAA receptors (Fig. 2). For each construct,
in represents the 1myc present in
5% of the input, and bd represents protein bound to
GST-MAP1B; GST shows lack of binding of
1myc to GST alone.
|
|
Disrupting the
-MAP1B interaction decreases the
EC50 of GABAC receptors
To determine whether the interaction of
subunits with MAP1B
affects the function of GABAC receptors, we
whole-cell-clamped rat retinal bipolar cells. Included in the pipette
solution, and thus dialyzed into the cells, were peptides (100 µM) including the sequence of the MAP1B-binding domain on
1 or a scrambled version of it (see Materials and Methods). The aim,
as in the experiments of Figures 3A and
4A, was for the binding site peptide to compete with
endogenous
1 for binding to MAP1B and thus displace MAP1B from
1,
allowing the effect of MAP1B binding on GABAC
receptor-generated currents to be investigated. This strategy has been
used successfully previously to disrupt interactions of endogenous
proteins with AMPA receptors and glutamate transporters (Nishimune et
al., 1998
; Marie and Attwell, 1999
). Experiments were performed at
60
mV, with the Nernst potential for Cl
near 0 mV, so GABA-evoked currents are inward.
Applying GABA either to isolated bipolar cells or to bipolar cells in
retinal slices (see Materials and Methods), in the presence of
bicuculline (300 µM) to block GABAA
receptors, generated a current that was blocked by the
GABAC receptor blocker
(1,2,5,6-tetrahydropyridine-4-yl)methylphosphinic acid (TPMPA) (Fig.
5A). Block by TPMPA was only
slowly reversible. The response to 30 µM GABA
was reduced by 97 ± 2% (n = 4 cells in slices) by 200 µM TPMPA, whereas 2 mM TPMPA reduced the current generated by 300 µM GABA by 93 ± 3%
(n = 2).

View larger version (15K):
[in this window]
[in a new window]
|
Figure 5.
GABAC receptor-evoked currents in
retinal bipolar cells with no peptide included in the pipette solution.
A, Membrane current of a cell in a slice, clamped to
60 mV, during repeated application of 30 µM GABA in the
presence of 300 µM bicuculline to block GABAA
receptors. The GABAC receptor blocker TPMPA (200 µM) greatly reduces the response to GABA. This block was
only slowly removed on washing out TPMPA. B,
Dose-response curve for the application of GABA to isolated bipolar
cells in the presence of 300 µM bicuculline (normalized
to the response to 10 µM GABA in each cell and then
rescaled to a saturating response of 1). Curve is a Hill equation (Eq. 5) with n = 1.6 and a mean EC50 of 3 µM. Data from seven cells. C,
Dose-response curves for five bipolar cells in slices, in the presence
of 300 µM bicuculline and 4 mM
Co2+/0 mM Ca2+,
initially in normal conditions (control) and then in the presence of
100 µM SKF89976A (GAT-1 blocked). Hill equations through
the data have n = 1.6 and an EC50 of 51 µM in control conditions (mean value was 51.0 ± 3.7 µM) and 13.4 µM with
GAT-1 blocked (mean value was 13.4 ± 2.2 µM).
|
|
In isolated bipolar cells, GABAC receptors showed
an EC50 for GABA of 3.0 ± 0.2 µM (n = 7) (Fig.
5B), similar to the 4.2 µM obtained
by Feigenspan and Bormann (1994a)
. However, as found previously
(Karschin and Wässle, 1990
), whole-cell-clamped isolated cells
stayed healthy for only a few minutes, which is not long enough to
dialyze into the cell the peptide disrupting the MAP1B-
1 interaction. We therefore studied the effect of disrupting this interaction in bipolar cells in retinal slices, which could be clamped
for up to 30 min with no deterioration in health. Slice bipolars were
also preferred because the cytoskeleton with which the
GABAC receptors interact is likely to be less
disrupted than in the isolated cells that have been enzyme-treated and
triturated. Cobalt chloride (4 mM) was included
in the extracellular solution, and calcium was omitted, to block
synaptic transmission and ensure that the GABA-evoked currents seen
were generated by the recorded cell (Euler et al., 1996
).
In bipolar cells in situ in slices, the
EC50 for GABA applied in the superfusate was
larger than in isolated cells. Dose-response curves for the
GABA-evoked current, I, could be fitted approximately by the
Hill equation:
|
(5)
|
where Imax is the maximum current
at saturating [GABA], the Hill coefficient, N, was 1.6, and the EC50 varied between cells (range 26-80
µM) with a mean value of 40.4 ± 1.9 µM in 14 cells. Blocking the
mainly neuronal GABA transporter GAT-1 with SKF89976A (100 µM) (Borden et al., 1994
)
decreased the EC50 by fourfold (Fig.
5C), making it much closer to the value in isolated cells, showing that the presence of GABA uptake (Johnson et al., 1996
), which
lowers the GABA concentration around the cells within the slice, is
partly responsible for the higher EC50 in slices.
The residual difference in EC50, between slice
bipolar cells with GAT-1 blocked and isolated bipolar cells, may
reflect the use of solution containing cobalt and zero calcium to block
synaptic transmission in the slice (Euler et al., 1996
): in five
isolated bipolar cells this solution increased the
EC50 to 11 ± 2 µM [data not shown; cf. Kaneda et al.
(1997)
]. Mathematical analysis (see Materials and Methods) shows that,
although uptake increases the EC50 measured in
the slice, the fractional change of EC50 induced by disrupting the MAP1B-
1 interaction is similar to that which would
be measured if uptake were absent (the fractional change is
underestimated by 14%).
When the peptide mimicking the MAP1B binding site was introduced into
slice bipolar cells, the GABA responses changed with time after
starting whole-cell clamping, with low GABA doses producing an
increased current at later times but the response to high doses changing little (Fig.
6A,B).
This corresponds to a decrease of EC50 of the
dose-response curve (Fig. 6C). By contrast, including the
scrambled peptide in the pipette resulted in either no time-dependent change of the GABA responses or a reduction of the fractional response
to low [GABA] (Fig. 6D).

View larger version (30K):
[in this window]
[in a new window]
|
Figure 6.
Effect of dialysis with MAP1B binding site peptide
on the GABA dose-response curve in retinal bipolar cells.
A, Specimen current responses to different GABA
concentrations (in the presence of bicuculline) 5 min after going to
whole-cell mode, with the binding site peptide in the pipette.
B, Dose-response curve in the same cell as
A, 25 min after starting whole-cell clamping. Responses
in A and B have been scaled to be the
same for 300 µM GABA, to compensate for a slight decline
with time (Fig. 7A), and to facilitate comparison of the
dose dependence of the responses. The relative responses to low doses
of GABA are much larger in B than in A.
C, Dose-response data from A and
B, normalized to the current produced by 300 µM GABA, fitted with the Hill equation (Eq. 5) with a
Hill coefficient of 1.6. At 5 min the EC50 is 79 µM; at 25 min it is 31 µM.
d, Specimen dose-response data as in C,
but from a cell clamped with the scrambled peptide in the pipette.
Fitting the Hill equation (with a Hill coefficient of 1.6) gives an
EC50 of 37 µM at 5 min and 53 µM at 25 min after starting whole-cell clamping.
|
|
To quantify the change of GABAC receptor
properties, we fitted Equation 5 to dose-response data obtained at
different times after starting whole-cell clamping, to derive the
EC50 and Imax for the receptors. The maximum current showed no significant difference in behavior when the active or scrambled peptides were introduced (Fig.
7A). Both showed a slow
decrease with time that may reflect an alteration of internal milieu by
the non-peptide components of the pipette solution (cf. Feigenspan and
Bormann, 1994b
). To quantify the change of receptor sensitivity, for
each cell we normalized the EC50 values by the
EC50 measured at the start of whole-cell
recording. This procedure was adopted to remove variability in the
initial value of the EC50 (see above) and thus
allow us to monitor solely the time-dependent change of
EC50 produced by the peptide. Figure
7B shows that the binding site peptide led to a decrease of
EC50, whereas the scrambled peptide produced no
significant change. The data for the two peptides differ significantly after 15 and 25 min recording. Furthermore, this difference is underestimated by our data, because the "initial" value of
EC50 by which the subsequent data were normalized
was measured 5 min after starting whole-cell clamping, by which time
the binding site peptide may already have had some effect. The time
constant for filling of the cell by the dialyzed peptides is estimated to be ~4 min (see Materials and Methods), so the time course of the
changes seen with the binding site peptide in Figure 7B may reflect both this filling time and the time needed for competitive displacement of endogenous
1 from MAP1B by the peptide.

View larger version (16K):
[in this window]
[in a new window]
|
Figure 7.
Time-dependent changes in the properties of
GABAC receptors induced by competitive removal of MAP1B
binding. Maximum current (A) and EC50
(B) derived from fitting the Hill equation (Eq. 5) to dose-response data measured at different times after starting
whole-cell clamping with pipette solution containing the MAP1B binding
site peptide ( ) or a scrambled version of it ( ). Data from each
cell were normalized to their values measured 5 min after starting
whole-cell clamping, before averaging for these graphs. Data in
A are not significantly different for the two peptides.
The p values in B are from two-tailed
t tests. Eight to thirteen cells contribute to each data
point.
|
|
The mean data in Figure 7B show that the binding site
peptide reduces the EC50 at 25 min after starting
whole-cell clamping to 68% of its value with the scrambled peptide,
implying a 1.9-fold increase of the current evoked by low doses of GABA
(e.g., see specimen data in Fig. 6C). Thus, in the absence
of the dialyzing peptide, the interaction with MAP1B roughly halves the
size of the current that low doses of GABA generate.
Glycine does not alter GABAC responses
Although the cellular location of GLYT-1E/F transporters is not
known, their interaction in vitro with
1 suggests that,
if these transporters are present in bipolar cells, the rate of glycine uptake could alter GABAC receptor properties (or
vice versa). However, we found that applying 300 µM glycine (in the presence of 10 µM strychnine to block glycine receptors) had
no effect on the GABAC response of retinal
bipolar cells to 30 µM GABA (subsaturating so
that we might observe changes in either EC50 or
maximum current; five cells; data not shown). No glycine uptake current
was detectable in the bipolar cells, so we could not test the effect of
GABAC receptor activation on glycine uptake.
 |
DISCUSSION |
Our analysis of the binding site for MAP1B on the
1 subunits of
GABAC receptors suggests that MAP1B binds to the
sequence RI(D/N)THAIDKYSR, where D/N denotes the human/rat sequence. Of these residues, the section KY is crucial, because mutating it prevents
binding (Fig. 2B) but is not sufficient,
because the truncated peptide THAIDKYSR does not prevent binding (Fig.
3B) and because mutating THA or RID to the homologous
residues in
1 subunits also reduces binding, suggesting that these
residues also contribute to binding. Binding occurs whether the residue present at the D/N position is either D or N, because the rat sequence
peptide (N) competes well with human
1 (D) for binding to MAP1B
(Fig. 3A). This may be allowed because although D is charged
whereas N is polar, they both have small side chains. The more
C-terminal residues ID and SR may contribute to binding but are present
in
and
subunits of GABAA receptors, which do not bind MAP1B. The binding site may not extend N-terminally beyond
R443 (in the human sequence) because
1myc binds efficiently to GST-MAP1B
even when
V440SM442
are mutated to KKT.
The motif RI(D/N)THAIDKYSR in its entirety is not found in any other
proteins in the database, but the
2 subunit has an equivalent 12 amino acid motif of FQNTHAIDKYSR, which also binds MAP1B in pull-down
assays (Fig. 3C). The first two amino acids of these sequences differ, suggesting a minimal binding motif of NTHAIDKYSR. The
3 subunit, which was not analyzed, contains the sequence LENNHVIDTYSR. The major GABAA receptor subunits
do not show high homology with
in this region, the most similar
being the
subunits (e.g.,
3: LTDVNAIDRWSR). The absence of
MAP1B binding to GABAA receptors, which has been
demonstrated by pull-down assay and immunoprecipitation from retina
(Hanley et al., 1999
), is consistent with these differing sequences.
GABAA receptors may be anchored to the
cytoskeleton through the tubulin binding proteins gephyrin and GABARAP
(Essrich et al., 1998
; Wang et al., 1999
), although direct binding of
gephyrin to GABAA receptor subunits has not been
shown. The existence of the different tethering molecules for
GABAA and GABAC receptors
may help to explain their specific location at different synapses and
their lack of colocalization in bipolar cells (Koulen et al., 1998
).
Interestingly, GABARAP shows 31% identity to light-chain-3 of MAP1A
and MAP1B, and it binds to
2 subunits in a C-terminal region of
their TM3-TM4 loop at an equivalent position to the MAP1B binding site
on
1/
2.
Dialyzing retinal bipolar cells with a peptide mimicking the MAP1B
binding motif, which we have shown to competitively disrupt MAP1B-
1
binding (Fig. 3A), led to a 32% decrease in the
EC50 of the cells' GABAC
receptors, which is sufficient to approximately double the GABA-evoked
current at low GABA concentrations (Fig. 6C). At the same
time, there was no change of the maximum GABA-evoked current,
suggesting that binding of MAP1B to
does not alter the number of
receptors in the membrane (in contrast to the effect of binding of NSF
to AMPA receptors) (Nishimune et al., 1998
; Luscher et al., 1999
). It
is likely that the binding of MAP1B to
alters the energetics of the
conformation changes that occur when the receptor binds GABA and opens
its channel, and in this way MAP1B alters the
EC50. A similar phenomenon has been observed for
glutamate transporters (Marie and Attwell, 1999
). Because MAP1B
aggregates
1 subunits (Hanley et al., 1999
), it is possible that, in
addition to changing the EC50, disruption of the
MAP1B-
interaction may allow GABAC receptors
to disperse to a more extrasynaptic location; however, it is likely
that the change in EC50 occurs as soon as the
subunits detach from MAP1B.
In the retina, the feedback inhibition of bipolar cells by amacrine
cells, mediated largely by GABAC receptors,
increases the dynamic range of the ganglion cells and produces temporal and spatial shaping of the visual signal, making signals more transient
and enhancing edge detection (Dong and Werblin, 1998
; Jacobs and
Werblin, 1998
; Euler and Masland, 2000
; Roska et al., 2000
; Shields et
al., 2000
). GABAC receptors produce long duration IPSCs in bipolar cells when amacrine cells release GABA (Lukasiewicz and Shields, 1998
; Shields et al., 2000
). Lowering the
EC50 of GABAC receptors is
expected to increase the duration of the synaptic current in the
following circumstances. First, if after the peak of the IPSC the
extracellular GABA concentration falls slowly compared with the
receptor and channel gating kinetics, then if the
EC50 is lower the GABA concentration will have to
fall to a lower level before the receptors can deactivate, which will take longer. Alternatively, if the GABA concentration falls to zero
rapidly (compared with the GABA unbinding/channel gating kinetics),
then a lower EC50 is predicted to prolong the
IPSC decay provided that the effect of MAP1B on the
EC50 is mediated by an alteration of the rate
constant for GABA unbinding or for channel opening or closing [but
there will be no effect on the IPSC decay if the
EC50 is lowered by increasing the GABA binding rate (cf. Jones et al., 1998
]. To illustrate this quantitatively, we
performed calculations based on the GABAC
receptor kinetic scheme of Chang and Weiss (1999)
with channel opening
occurring when three GABA molecules are bound. Individual rate
constants were altered to decrease the EC50 by
32%, as we found [in the Chang and Weiss (1999)
model, we used an
absolute change from 0.83 µM, when interacting with
MAP1B, to 0.56 µM (their standard parameters) in the
absence of MAP1B]. Producing this EC50 change by
decreasing the GABA unbinding rate, decreasing the channel closing
rate, or increasing the channel opening rate led to the IPSC decay time
constant being increased by 40, 114, or 89%, respectively.
A prolongation of the IPSC will increase the spatiotemporal filtering
mediated by this feedback synapse. In addition, doubling the
GABAC receptor-mediated current at the low GABA
concentrations likely to be continually present in the retina, where
most synapses mediate graded potentials and are tonically active, would
produce an extra tonic inhibition of glutamate release from bipolar
cell synaptic terminals and thus decrease ganglion cell firing. For such an alteration of information processing to occur, for example during light adaptation, the interaction between MAP1B and
subunits would have to be modulated. This could potentially occur by
phosphorylation of either of the serine residues in the
1 sequence,
which are within or flank the MAP1B binding site defined above
(S441 and
S453 in the human sequence;
S441 is a consensus site for PKC phosphorylation).
The MAP1B binding site peptide does not compete for binding of
1 to
the C-terminal tail of the glycine transporter GLYT-1E/F, and none of
the MAP1B binding site mutations in
1myc affected binding to GST-GLYT-1E/F
(Fig. 4), indicating that the transporter binds to a region on
1
distinct from the MAP1B binding site. This suggests that MAP1B and
GLYT-1E/F may be able to interact with
1 simultaneously, perhaps
allowing
1 and GLYT-1E/F to be anchored to the cytoskeleton as a
complex. The location of GLYT-1E/F in the retina has not yet been
determined: previous studies of glycine transporter location have used
antibodies raised against transporter C and N termini, which are not
present in GLYT-1E/F. Because some bipolar cells accumulate glycine,
but not via GLYT-1A or -B (Pow and Hendrickson, 1999
), it is possible
that GLYT-1E/F is colocalized in bipolar cell synaptic terminals with
1 subunits. Application of glycine had no effect on
GABAC receptor-mediated currents, implying that
if GLYT-1E/F transporters are present, their linkage to
1 subunits
does not result in transporter activity modulating
GABAC receptor properties [it also shows that
the potentiation of homomeric
1 receptor activity by glycine seen in
oocyte expression experiments (Calvo and Miledi, 1995
) does not occur
for bipolar cell GABAC receptors]. We have been
unable to test whether activation of GABAC
receptors modulates glycine uptake into bipolar cells, because the
glycine uptake present in these cells is too small to generate a
detectable current.
In summary, by identifying a motif for MAP1B binding to
subunits,
we have shown for the first time that inhibitory
GABAC receptors have their
EC50 modulated by attachment to the cytoskeleton and that they can potentially interact simultaneously with MAP1B and
with a glycine transporter. This suggests that the postsynaptic density
at inhibitory synapses is likely to comprise as complicated a web of
interacting receptors and signaling proteins as occurs at excitatory
synapses (Ziff, 1997
; Kim and Huganir, 1999
).
 |
FOOTNOTES |
Received July 5, 2000; revised Sept. 13, 2000; accepted Sept. 18, 2000.
This work was supported by the Wellcome Trust and the Medical Research Council.
J.G.H and D.B. contributed equally to this work.
Correspondence should be addressed to S. J. Moss, Medical Research
Council-Laboratory for Molecular Cell Biology and Department of
Pharmacology, University College London, Gower Street, London, WC1E
6BT, UK. E-mail: Steve.Moss{at}ucl.ac.uk.
 |
REFERENCES |
-
Bonnert TP,
McKernan RM,
Farrar S,
Le Bourdelles B,
Heavens RP,
Smith DW,
Hewson L,
Rigby MR,
Sirinathsinghji DJS,
Brown N,
Wafford KA,
Whiting PJ
(1999)
, a novel
-aminobutyric acid type A receptor.
Proc Natl Acad Sci USA
96:9891-9896[Abstract/Free Full Text]. -
Borden LA,
Dhar TGM,
Smith KE,
Weinshank RL,
Branchek TA,
Gluchowski C
(1994)
Tiagabine, SK&F 89976-A, CI-966 and NNC-711 are selective for the cloned GABA transporter GAT-1.
Eur J Pharmacol
269:219-224[ISI][Medline].
-
Calvo DJ,
Miledi R
(1995)
Activation of GABA
1 receptors by glycine and
-alanine.
NeuroReport
6:1118-1120[ISI][Medline]. -
Chang Y,
Weiss DS
(1999)
Channel opening locks agonist onto the GABAC receptor.
Nat Neurosci
2:219-225[ISI][Medline].
-
Cutting GR,
Lu L,
O'Hara BF,
Kasch LM,
Montrose-Rafizadeh C,
Donovan DM,
Shimada S,
Antonarakis SE,
Guggino WB,
Uhl GR,
Kazazian Jr HH
(1991)
Cloning of the
-aminobutyric acid (GABA)
1 cDNA: a GABA receptor subunit highly expressed in the retina.
Proc Natl Acad Sci USA
88:2673-2677[Abstract/Free Full Text]. -
Dong CJ,
Werblin FS
(1998)
Temporal contrast enhancement via GABAC feedback at bipolar terminals in the tiger salamander retina.
J Neurophysiol
79:2171-2180[Abstract/Free Full Text].
-
Enz R,
Brandstaetter JH,
Hartveit E,
Wässle H,
Bormann J
(1995)
Expression of GABA receptor
1 and
2 subunits in the retina and brain of the rat.
Eur J Neurosci
7:1495-1501[ISI][Medline]. -
Enz R,
Brandstaetter JH,
Wässle H,
Bormann J
(1996)
Immunocytochemical localisation of the GABAC receptor
subunits in the mammalian retina.
J Neurosci
16:4479-4490[Abstract/Free Full Text]. -
Essrich C,
Lorez M,
Benson JA,
Fritschy J-M,
Luescher B
(1998)
Postsynaptic clustering of major GABAA receptor subtypes requires the
2 subunit and gephyrin.
Nat Neurosci
1:563-571[ISI][Medline]. -
Euler T,
Masland RH
(2000)
Light-evoked responses of bipolar cells in a mammalian retina.
J Neurophysiol
83:1817-1829[Abstract/Free Full Text].
-
Euler T,
Schneider H,
Wässle H
(1996)
Glutamate responses of bipolar cells in a slice preparation of the rat retina.
J Neurosci
16:2934-2944[Abstract/Free Full Text].
-
Euler T,
Wässle H
(1998)
Different contributions of GABAA and GABAC receptors to rod and cone bipolar cells in a rat retinal slice preparation.
J Neurophysiol
79:1384-1395[Abstract/Free Full Text].
-
Feigenspan A,
Bormann J
(1994a)
Differential pharmacology of GABAA and GABAC receptors on rat retinal bipolar cells.
Eur J Pharmacol
288:97-104[ISI][Medline].
-
Feigenspan A,
Bormann J
(1994b)
Modulation of GABAC receptors in retinal bipolar cells by protein kinase C.
J Physiol (Lond)
481:325-330[ISI][Medline].
-
Feigenspan A,
Wässle H,
Bormann J
(1993)
Pharmacology of GABA receptor Cl
channels in rat retinal bipolar cells.
Nature
361:159-161[Medline]. -
Hackam AS,
Wang T-L,
Guggino WB,
Cutting GR
(1997)
The N-terminal domain of human GABA receptor
1 subunits contains signals for homooligomeric and heterooligomeric interaction.
J Biol Chem
272:13750-13757[Abstract/Free Full Text]. -
Hanley JG,
Koulen P,
Bedford FK,
Gordon-Weeks PR,
Moss SJ
(1999)
The protein MAP1B links GABAC receptors to the cytoskeleton at retinal synapses.
Nature
397:66-69[Medline].
-
Hanley JG,
Jones EMC,
Moss SJ
(2000)
GABAC receptors interact with a novel splice variant of the glycine transporter, GLYT-1.
J Biol Chem
275:840-846[Abstract/Free Full Text].
-
Holladay LA,
Puett D
(1976)
Somatostatin conformation: evidence for a stable intramolecular structure from circular dichroism, diffusion, and sedimentation equilibrium.
Proc Natl Acad Sci USA
73:1199-1202[Abstract/Free Full Text].
-
Jacobs AL,
Werblin FS
(1998)
Spatiotemporal patterns at the retinal output.
J Neurophysiol
80:447-451[Abstract/Free Full Text].
-
Johnso