 |
Previous Article | Next Article 
The Journal of Neuroscience, December 15, 2000, 20(24):9242-9251
Antinociceptive Action of Nitrous Oxide Is Mediated by
Stimulation of Noradrenergic Neurons in the Brainstem and
Activation of 2B Adrenoceptors
Shigehito
Sawamura1, 3,
Wade S.
Kingery2, 4,
M.
Frances
Davies1, 3,
Geeta S.
Agashe1, 3,
J. David
Clark1, 3,
Brian K.
Kobilka5,
Toshizaku
Hashimoto6, and
Mervyn
Maze6
Departments of 1 Anesthesia and
2 Functional Restoration, Stanford University School of
Medicine, Stanford, California 94305, 3 Anesthesiology Service and 4 Physical
Medicine and Rehabilitation Service, Veterans Affairs, Palo Alto Health
Care System, Palo Alto, California 94304, 5 Howard Hughes
Medical Institute, Stanford University, Stanford, California
94305, and 6 Magill Department of Anaesthetics,
Imperial College School of Medicine, London SW10 9NH, United Kingdom
 |
ABSTRACT |
Although nitrous oxide (N2O) has been used to
facilitate surgery for >150 years, its molecular mechanism of action
is not yet defined. Having established that N2O-induced
release of norepinephrine mediates the analgesic action at
2 adrenoceptors in the spinal cord, we now investigated
whether activation of noradrenergic nuclei in the brainstem is
responsible for this analgesic action and which 2
adrenoceptor subtype mediates this property. In rats, Fos
immunoreactivity was examined in brainstem noradrenergic nuclei after
exposure to nitrous oxide. After selective lesioning of noradrenergic
nuclei by intracerebroventricular application of the
mitochondrial toxin saporin, coupled to the antibody directed against
dopamine hydroxylase (D H-saporin), the analgesic and sedative
actions of N2O were determined. Null mice for each of the
three 2 adrenoceptor subtypes ( 2A,
2B, and 2C), and their wild-type cohorts, were tested for their antinociceptive and sedative response to N2O. Exposure to N2O increased
expression of Fos immunoreactivity in each of the pontine noradrenergic
nuclei (A5, locus coeruleus, and A7). D H-saporin treatment
eliminated nearly all of the catecholamine-containing neurons in the
pons and blocked the analgesic but not the sedative effects of
N2O. Null mice for the 2B adrenoceptor
subtype exhibited a reduced or absent analgesic response to
N2O, but their sedative response to N2O was
intact. Our results support a pivotal role for noradrenergic pontine
nuclei and 2B adrenoceptors in the analgesic, but not
the sedative effects of N2O. Previously we demonstrated
that the analgesic actions of 2 adrenoceptor agonists are mediated by the 2A subtype; taken together with
these data we propose that exogenous and endogenous 2
adrenoceptor ligands activate different 2 adrenoceptor
subtypes to produce their analgesic action.
Key words:
nitrous oxide; locus coeruleus; noradrenergic; analgesia; anesthesia; Fos immunoreactivity
 |
INTRODUCTION |
Nitrous oxide
(N2O) has been used to provide anesthetic
conditions suitable for the performance of surgery for >150 years. Because it is relatively impotent, it cannot be used as a sole anesthetic agent except when administered under hyperbaric conditions; therefore, it is most often used as an adjunctive general anesthetic agent for surgical procedures.
The state of general anesthesia encompasses a syndrome of
"behaviors" including analgesia, hypnosis-sedation, amnesia, and muscle relaxation. We have investigated the mechanisms for
N2O analgesic effect (it is more accurate to
refer to its antinociceptive effect when studies are performed in
animals who are unable to communicate the emotive experience of pain)
and demonstrated that intrathecally, but not supraspinally,
administered 2 antagonists could block the
antinociceptive action of N2O, thereby localizing the site of noradrenergic action to components within the spinal cord
(Guo et al., 1996 ).
It is not clear whether the spinally transduced antinociceptive action
of N2O originates in supraspinally located
noradrenergic neurons. Noradrenergic projections to all regions of the
spinal cord arise almost entirely from the dorsolateral pontine
catecholamine cell groups A5, the locus coeruleus (LC), and A7.
Electrical or chemical stimulation in the dorsolateral pons produces
analgesic effects mediated by spinal 2
adrenoceptors that can be differentiated from cardiovascular effects,
and such stimulation causes inhibition of nociceptive neurons in the
deep dorsal horn (Byrum et al., 1984 ; Kingery et al., 1997 ; Willis and
Westlund, 1997 ). We found that transection of the spinal cord
eliminated the antinociceptive property of N2O,
suggesting that spinal pathways were involved (Zhang et al., 1999 ).
Furthermore, exposure to N2O provoked release of
norepinephrine at the level of the dorsal horn of the spinal cord, and
when this neurotransmitter was depleted, N2O was
no longer able to produce antinociception (Zhang et al., 1999 ).
Therefore, we proposed that N2O could be
activating a descending noradrenergic pathway, which stimulates
2 adrenoceptors in the spinal cord through the
released norepinephrine. Now, using indirect measures of neuronal
activation and toxins targeted for norepinephrine-containing neurons,
we elucidate the role played by the noradrenergic nuclei in the
brainstem for the antinociceptive action of
N2O.
There are three 2 adrenoceptor subtypes
( 2A, 2B, and
2C), and each of the genes for these receptor
subtypes has been cloned (Bylund et al., 1994 ), thereby facilitating
the creation of genetically modified reagents with dysfunctional
("point mutation") or deficient ("knock-out") subtypes. Using a
moderately selective pharmacological probe in rats, as well as the D79N
mouse, which has a point mutation of the 2A
adrenoceptor gene causing its dysfunction, we showed that the 2A
subtype was not responsible for the antinociceptive effect of
N2O (Guo et al., 1999 ). Using null mice for
2A, 2B, and
2C subtypes we now reveal the precise subtype
involved in mediating the antinociceptive action of
N2O. This appears to differ from the mechanism
involved in the antinociceptive response to exogenously administered
2 adrenergic agonists.
Surprisingly, the noradrenergic mechanisms we identify as mediators of
N2O antinociception are not instrumental in the
hypnotic-sedative action of N2O and
therefore challenge the notion that the same anesthetic produces its
"continuum of effects" at a single site of action.
 |
MATERIALS AND METHODS |
Animals
These experiments were reviewed and approved by our institute's
Subcommittee on Animal Studies and were in accordance with the
provisions of the Animal Welfare Act, the Public Health Service Guide for the Care and Use of Laboratory Animals, and Veterans Affairs
Policy. All immunolesioning and immunohistochemistry experiments were
performed in adult male Sprague Dawley rats (240-260 gm) from B & K
Universal (Fremont, CA). Additional behavioral studies were performed
in adult (20-30 gm) male mice. Various genetically engineered mice
strains were examined, including: (1) D79N mice with a nonfunctioning
2A adrenoceptor because of a point mutation in
its gene substituting aspartic acid by asparagine at amino acid residue
#79, (2) 2A / null mice with a
knock-out of the 2A adrenoceptor gene,
(3) 2C / null mice with a knock-out of the
2C adrenoceptor gene, and (4) their wild-type
(WT) controls. All these strains were on a congenic C57BL/6J
background. The 2B / null mice had a
knock-out of the 2B adrenoceptor gene on a
hybrid C57BL/6J and 129SvJ background; as their controls we used
generationally matched wild-type mice on the same hybrid background
(C57BL/6J × 129SvJ). Production of the
2A / , 2B-/, 2C / , and D79N mice have been described
previously (Link et al., 1996 ; MacMillan et al., 1996 ; Altman et al.,
1999 ). Rats and mice were housed in a temperature- and
humidity-controlled environment and were maintained on a 12 hr
light/dark cycle. Food and water were available ad
libitum.
Drugs
The anti-dopamine -hydroxylase-saporin (D H-saporin)
immunotoxin was produced by conjugating saporin, a
ribosome-inactivating protein, with a mouse monoclonal antibody for
D H (Advanced Targeting Systems, San Diego, CA). D H, a key enzyme
for the synthesis of norepinephrine, is only present in noradrenergic
and adrenergic neurons. The membrane-bound subunit of D H is exposed
during exocytotic release of norepinephrine, allowing the anti-D H
antibody to attach and to be endocytosed. When the D H-saporin
conjugate is injected intracerebroventricularly in rats, it is taken up
in the axon terminals of catecholaminergic neurons, undergoing
retrograde transport to the neuronal cell bodies where it arrests
protein synthesis. This technique gradually destroys the noradrenergic neurons in the locus coeruleus and in the A5 and A7 brainstem nuclei,
taking 14 d to complete the selective neurolytic process (Rohde
and Basbaum, 1998 ; Martin et al., 1999 ). Once the neuronal cell bodies
are destroyed, the lesion is permanent (Wrenn et al., 1996 ). The
D H-saporin immunotoxin was diluted in saline (1 µg/µl).
Behavioral testing
All behavioral testing was performed in a blinded manner, and
the experimental groups were mixed together during each testing session
to ensure identical gas exposure conditions. Using a heating blanket,
the tail and paw temperatures were maintained within 0.5°C of 32°C.
A K-type fine wire contact thermistor (5SC-66-K-30-36) and a
multimeter thermometer (HHM25; Omega, Bridgeport, NJ) were used
to measure the plantar paw surface and volar tail surface temperatures
for each baseline and N2O exposure nociceptive
threshold test. During the 30 min exposure to
N2O, both rats and mice exhibited increased motor
activity. This made tail-flick testing more difficult during
N2O exposure, but using patience and care to calm
the animals before testing we could confirm that the animals were
withdrawing from the noxious heat stimulus during the tail-flick assay
and not simply spontaneously moving their tails.
Tail-flick latencies were determined from the mean of three (in rats)
or two (in mice) consecutive latencies using a tail-flick apparatus
(Columbus Instruments, Columbus, OH). The interstimulus interval was
~60-90 sec. A high-intensity light was focused on the ventral
surface of the tail, and the time for the animal to move its tail
from the light beam was recorded. A different patch of the
middle (rat) or distal (mice) third of the tail was exposed to the
light beam each time to minimize the risk of tissue damage. The same
light stimulus intensity was used for all experiments in a given
strain, having been preset at an intensity that elicited a mean latency
of 2.9-3.2 sec in room air. To avoid the possibility of tissue damage,
a cutoff time of 10 sec was used; if no response had occurred by this
time, a value of 10 sec was assigned to the experimental subject. The
tail-flick latency in both rats and mice was performed, whereas the
animal was gently held under a towel. The animals were trained to stay
under the towel, which was tented up under the investigator's hand
like a cloth burrow. Latency measurements were taken only when the rat
or mouse was calmly resting with tail protruding from underneath the towel.
Hot-plate latencies were determined from the mean of two consecutive
latencies on a hot-plate device set at a constant 55°C surface
temperature (Columbus Instruments). The latency was determined when the
mouse first licked a hindpaw, and the cutoff time for this test was 30 sec. No mouse was used for more than one test session on the hot-plate
assay, because repeated test sessions result in frequent jumping
behavior, sometimes within seconds of being placed on the hot plate.
The loss of righting reflex (LORR) was measured by placing the rat on
its back and determining if the animal could right itself. The
calculation of the ED50 for LORR was determined
for each rat, based on interpolation of the gas concentrations that
bracketed the righting response (Koblin et al., 1979 ). LORR testing was performed inside a large (3.66-m-diameter, 4.58-m-height) clinical hyperbaric chamber, with the entire Plexiglas gas exposure chamber and
the investigator inside the hyperbaric chamber.
For the measurement of the sedation response, mice were placed on a
rotarod (IITC; Life Sciences Instruments, Woodland Hills, CA) turning
at 10 rpm (Lakhlani et al., 1997 ). The mice learned to remain on the
rod for 60 sec during the course of three training sessions. Drug-naive
D79N, 2A / ,
2B / , 2C / and
their respective wild-type mice were indistinguishable in their ability
to remain on the rod. Each mouse was tested once for its ability to
remain on the rod at one of three exposure conditions [air, 35%, and 70% atmospheres absolute (ATA) N2O]. The
cutoff time was 60 sec.
Normobaric gas exposures
Behavioral studies were performed in a Plexiglas chamber
(91-cm-long, 48-cm-wide, and 38-cm-high) with a sliding door for insertion of the animals. The investigator's forearms could be inserted through two circular openings on the side of the chamber, which were sealed with rubber flap iris diaphragm air seals. The chamber was large enough to contain the tail-flick and hot-plate devices. Antinociceptive testing was always performed after 30 min
N2O exposure because we had previously
demonstrated a maximal antinociceptive effect in mice and rats at this
time interval (Guo et al., 1999 ; Fender et al., 2000 ).
Fresh gas flow (rate varied between 3 and 10 l/min) was introduced into
the chambers via an inflow port; a fan was used to achieve adequate
mixing within the chamber, and gases were purged by vacuum set to
aspirate at the same rate as the fresh gas inflow. Oxygen concentration
in the chamber was maintained between 25 and 30% ATA, and the
N2O concentration was maintained at 70% ATA. Control exposure was with room air. An airway gas monitor (model 254;
Datex, Helsinki, Finland) was used to continuously monitor the
concentrations of N2O, oxygen, and carbon dioxide
in the chamber, and flow rates were adjusted to maintain the desired
concentrations. Temperature in the chamber was controlled by a heating
blanket, and the tail and paw temperatures were monitored before each
behavioral test.
Hyperbaric gas exposures
During hyperbaric studies, the gas mix inside the gas chamber
was kept at 70% v/v of N2O and 30% v/v of
oxygen. The chamber pressure was increased in 0.3 atmosphere increments
to generate 91, 112, and 133% ATA of N2O over a
90 min testing session. After a 15 min exposure at each
N2O% ATA the LORR testing was performed. Rectal
temperature was monitored and maintained within 0.5°C of 36.5°C
with a heating pad.
Immunohistochemistry
After 90 min exposure to 70% ATA N2O,
rats were anesthetized with pentobarbital (100 mg/kg, i.p.) and
transcardially perfused with 100 ml of sodium PBS 0.1 M, followed by 500 ml of paraformaldehyde 4% in sodium
phosphate buffer (PB) 0.1 M. After decapitation, the whole
brain was removed and submerged in the same fixative for 4 hr. Tissues
were then stored in 30% sucrose solution in 0.1 M PB at
4°C overnight for cryoprotection. The brainstem was sliced into
40-µm-thick sections with a cryotome (CM1800; Leica, Heidelberg,
Germany) at 15°C. Every third section of the brainstem (from caudal
periaqueductal gray to rostral medulla) was retained and placed in the
PB solution.
Sections were stained using antibodies for Fos and tyrosine hydroxylase
(TH; a catecholamine-synthesizing enzyme) in sequence as follows.
Sections were first incubated for 1 hr in blocking solution (3% normal
goat serum and 0.3% Triton X-100 in PBS) and then incubated
overnight with rabbit Fos antibody (1:20,000; Santa Cruz Biotechnology,
Santa Cruz, CA) diluted in 1% normal goat serum and 0.3% Triton X-100
in PBS (buffer 1). After vigorous rinsing in buffer 1, sections were
incubated for 1 hr in biotinylated goat anti-rabbit Ig (1:200;
Chemicon, Temecula, CA) in buffer 1. Sections were vigorously rinsed
with 0.3% Triton X-100 in 0.1 M PBS (buffer 2), then
incubated for 1 hr in avidin-biotin-peroxidase complex (Vectra Elite
ABC; Vector Laboratories, Burlingame, CA) in buffer 2. Visualization of
the reaction product was achieved by incubation for 4 min with
diaminobenzidine (DAB) and nickel-ammonium sulfate to which hydrogen
peroxide was added (DAB kit; Vector Laboratories). Sections were rinsed
in PB and subsequently reacted with rabbit TH antibody (1:50,000;
Chemicon) by the same procedures as for Fos immunostaining, except that
DAB reaction was performed for 2 min without nickel-ammonium sulfate.
All the incubations were performed at room temperature. After these
staining procedures, the sections were rinsed in water and placed on a
slide glass. The sections were dehydrated in 100% ethanol, cleared in
100% xylene, and covered.
For those sections subjected only to TH staining, sections were exposed
to rabbit TH antibody (1:20,000) and reacted with DAB-nickel solution
for 4 min.
Quantitation
The sections were examined by light microscopy. The Fos-positive
neurons were identified by dense black staining of the nucleus. The
TH-positive neurons were identified by yellow-orange staining of the
cytoplasm. The brainstem regions were located according to a rat brain
atlas (Paxinos and Watson, 1986 ). The A5, LC, and A7 noradrenergic
neurons were easily identified by TH staining of the cytoplasm. For
each region, all the Fos-positive nuclei in TH-positive cytoplasm were
counted for each section, and the four sections with the highest counts
were pooled, giving a count that was the sum of all the double-stained
neurons in those four sections. At the time of quantitation, the
investigator performing the Fos counting was unaware of the origin of
the sections.
In the D H-saporin study, TH-positive neurons in the A5, LC, and A7
nuclei were counted and totaled for all sections for each nucleus in
each rat. Again, the investigator performing the counting was blinded
as to treatment.
Intracerebroventricular injections
Rats were anesthetized with intraperitoneal injection of
pentobarbital (50 mg/kg). While the skull was fixed in a stereotaxic apparatus, the animal was injected with D H-saporin (3 µg/3 µl) or saline (3 µl) into the lateral cerebral ventricle according to
coordinates obtained from Paxinos and Watson (1986) (anteroposterior, 1.0 mm; lateral, 1.5 mm from bregma; dorsoventral, 4.3 mm from skull surface) (Paxinos and Watson, 1986 ). The location of the injection site was confirmed in a pilot study by direct visualization of Evans blue dye injected into the lateral ventricle using these coordinates. The intracerebroventricular injections were performed with
a 27 gauge needle connected via PE-20 catheter (25-cm-long) to a 10 µl Hamilton syringe that was manually injected. A small air bubble (1 µl) separated the injectant from the saline-filled catheter to
visualize the injection. The injection of 3 µl of immunotoxin or
saline was performed over 2 min, and the needle was left in place for
an additional 10 min after the injection to avoid reflux.
RT-PCR
Total RNAs were isolated from the kidney, spinal cord, and heart
of the wild-type mouse (Chomczynski and Sacchi, 1987 ). For each sample,
total RNA concentration was assessed by measuring the absorption at
260-280 nm with a spectrophotometer. The quality of total RNA for each
sample was examined by fractionating 10 mg of total RNA stained with
ethidium bromide in formaldehyde/1% agarose gel by electrophoresis to
confirm clear bands for 28s and 18s ribosomal RNAs. Total RNA (2 mg
each) from each sample was reverse-transcribed in 20 ml of solution
consisting of 2.5 µM random primer, 5 mM
MgCl2, 1× PCR buffer, 1 mM of dNTP,
1 U of RNase inhibitor, and 2.5 U of reverse transcriptase. The
reaction conditions were 42°C for 15 min, 99°C for 5 min, and 5°C
for 5 min. The products were then subjected to PCR using 15 µM backward primer (5'CTGGAAGCCAAGATGTACCAGG 3') and 15 µM forward primer (5'TCATCCTCTTCACCATTTTCGG 3') in 100 ml
of a solution consisting of 2 mM
MgCl2, 1× PCR buffer, and 2.5 U of AmpliTaq
polymerase. The expected PCR product size was 466 nucleotide pairs. The
PCR conditions were: 1 cycle of 95°C for 2 min, 35 cycles of 95°C for 1 min, 60°C for 1 min, and 72°C for 30 sec, terminated by 1 cycle of 72°C for 7 min. PCR products (16 ml each) were then fractionated by 1% agarose gel (with ethidium bromide)
electrophoresis, and Polaroid pictures were taken on a UV transilluminator.
Statistical analysis
All data are presented as the mean ± the SEM, and
differences are considered significant with a p value < 0.05. The immunohistochemistry (Fos and TH staining) quantitation
data were analyzed using unpaired t tests. The tail-flick
latencies were compared using paired (air vs N2O)
and unpaired (saline vs D H-saporin) t tests. The LORR ED50 values were compared between the saline and
D H-saporin-treated rats using the Mann-Whitney U test.
A one-way ANOVA was performed on the hot-plate latencies when
comparing groups of mice, and a t test was used to test for
contrasts. Figures comparing N2O analgesic
effects between groups of mice or rats show the mean latency changes as
the percentage of the maximum possible effect (%MPE): %MPE = ([post-gas latency baseline latency]/[cutoff latency baseline latency]) × 100. The cutoff latencies were 10 sec on
tail-flick and 30 sec on hot-plate.
Experimental protocols
N2O and Fos. We used Fos and
TH double-staining in the brainstem to determine whether
N2O exposure activated the catecholaminergic neurons in the A5, LC, and A7 nuclei. Before the Fos experiment, the
rats were habituated to the experimental conditions to minimize background Fos expression induced by the stimulus of a novel
environment. For 7 consecutive days the rats were taken to the
laboratory and individually placed in the Plexiglas test chamber (open
to room air) for 90 min. Gas exposures of N2O or
air were performed on rats individually housed in an airtight
cylindrical Plexiglas chamber (20 cm in diameter, 30 cm in height) for
90 min.
Noradrenergic lesioning and N2O
analgesia. To determine whether the noradrenergic brainstem
neurons mediated N2O analgesia, D H-saporin
was injected to destroy the noradrenergic neurons in the brain. Rats
were injected with the immunotoxin D H-saporin (3 µg/3 µl) or
with saline intracerebroventricularly (n = 14 for each
group). Fifteen days after the intracerebroventricular injection, the
analgesic effect of N2O was evaluated by
measuring the tail-flick latency before and during
N2O exposure. After the tail-flick measurement, the rat was anesthetized, and brain was harvested and single-stained for TH to evaluate the efficacy of noradrenergic lesioning.
Noradrenergic lesioning and N2O
hypnosis. We used another group of rats to determine whether the
noradrenergic brainstem neurons mediated N2O
hypnosis. Rats were injected with the immunotoxin D H-saporin (3 µg/3 µl) or with saline intracerebroventricularly (n = 14 for each group). Fifteen days after the
intracerebroventricular injection, the sedative effect of
N2O was evaluated by measuring the LORR
ED50 in a hyperbaric chamber.
N2O antinociception in
2 adrenoceptor subtype-deficient
mice. In a pilot study we were unable to demonstrate robust
N2O antinociception for the tail-flick assay in
the C57BL/6J WT mice used as controls for the D79N,
2A / , and 2C /
mice. The 2B / knock-out mice were on a
different genetic background (C57BL/6J × 129 SvJ hybrid); in
pilot studies their genetically matched WT controls consistently exhibited significant N2O antinociception in the
tail-flick assay. Therefore the antinociceptive action of
N2O on tail-flick latencies was compared in the
C57BL/6J × 129 SvJ WT and the 2B /
knock-out mice. Significant N2O antinociception
was evident in the hot-plate assay in both the C57BL/6J and the
C57BL/6J × 129 SvJ WT controls. Hot-plate testing was performed
in 2A / , 2B / ,
2C / , and D79N mice, and in their
respective WT controls. Baseline latencies were determined in the gas
chamber under room air conditions, thereafter the mice were removed
from the chamber, which was then equilibrated with the test gas mixture
(70% ATA of N2O). After 30 min, the mice were
placed back in the gas chamber and exposed to the test gas mixture for
30 min. The nociceptive testing was then repeated.
N2O sedation in
2 adrenoceptor subtype knock-out
mice. To determine whether 2 adrenoceptor
subtype contributes to N2O sedation, we used the
rotarod latency assay. Rotarod testing was performed in
2A / , 2B / ,
2C / , and D79N mice and in their respective WT controls. Baseline latencies were determined in the gas chamber under room air conditions; thereafter the mice were removed from the
chamber, which was then equilibrated with the test gas mixture (either
35 or 70% ATA of N2O). After 30 min, the mice
were placed back in the gas chamber and exposed to the test gas mixture
for 30 min. The rotarod testing was then repeated.
 |
RESULTS |
N2O-activated catecholaminergic neurons in the A5, LC,
and A7 nuclei
Rats exposed to 70% ATA of N2O exhibited a
robust increase in Fos immunoreactivity in the TH-stained neurons in
the A5, LC, and A7 brainstem nuclei (Fig.
1). Representative Fos staining in each
noradrenergic nucleus is shown after room air or
N2O exposure (Figs.
2, 3,
4, 5).
These data demonstrate that N2O can activate the
noradrenergic pontine cell groups that send ascending and descending
projections into the brain and spinal cord, respectively (Figs. 3,
5).

View larger version (12K):
[in this window]
[in a new window]
|
Figure 1.
Effect of N2O on Fos induction in the
neurons of the A5, LC, and A7 noradrenergic nuclei. Rats were exposed
for 90 min to 70% ATA N2O (n = 7) or
room air (n = 7), then transcardially perfused, and
the brain was removed. Pontine sections were stained for Fos and
TH. The double-stained neurons in each region were counted
section by section, and the four sections with the highest counts were
summed for each rat. Nitrous oxide exposure dramatically increased Fos
expression in the A5 (14 ± 3 vs 5 ± 1 in air), LC (124 ± 17 vs 35 ± 7 in air), and A7 (5 ± 1 vs 0.1 ± 0.1 in air) noradrenergic neurons. **p < 0.01;
***p < 0.001 versus air.
|
|

View larger version (90K):
[in this window]
[in a new window]
|
Figure 2.
TH (light brown) and Fos
(blue) staining in A5 neurons. A,
Immunohistochemistry after exposure to air. B,
Arrow points to double-stained neuron in A5 cell group
of rat exposed to N2O. Note the increase in double-labeled
neurons with N2O exposure.
|
|

View larger version (70K):
[in this window]
[in a new window]
|
Figure 3.
TH (light brown) and Fos
(blue) staining in LC noradrenergic neurons.
A, Representative section in rat exposed to air.
B, Marked increase in double-stained neurons after
N2O exposure. Also note the numerous Fos-positive nuclei in
the LC region in TH-negative cells.
|
|

View larger version (107K):
[in this window]
[in a new window]
|
Figure 4.
TH (light brown) and Fos
(blue) staining in LC noradrenergic neurons. A
Fos-positive nucleus is clearly seen in a TH-positive LC neuron
(arrow).
|
|

View larger version (88K):
[in this window]
[in a new window]
|
Figure 5.
TH (light brown) and Fos
(blue) staining in A7 sections. A,
Representative section in rat exposed to air. B, Marked
increase in double-stained neurons after N2O exposure. Also
note the numerous Fos-positive nuclei in TH-negative cells.
|
|
D H-saporin treatment destroyed pontine noradrenergic neurons
and blocked the analgesic but not the sedative effects of
N2O
Using TH to label catecholaminergic neurons in the brainstem, we
examined the effect of D H-saporin immunolesioning on the pontine
noradrenergic cell groups. After D H-saporin treatment, the
TH-positive noradrenergic neurons in locus coeruleus completely disappeared; however, some residual staining was observed in the A5 and
the A7 noradrenergic neurons (Figs. 6,
7, 8,
9).

View larger version (24K):
[in this window]
[in a new window]
|
Figure 6.
Immunolesioning of brainstem noradrenergic neurons
with intracerebroventricular D H-saporin. Rats were injected with
saline (3 µl) or D H-saporin (3 µg/3 µl; n = 14 for each group). Two weeks after injection the rats underwent
behavioral testing and then were transcardially perfused, and the brain
was removed. The brainstem sections were stained for TH, and the number
of TH-positive neurons in A5 and A7 were totaled for all sections. Data
were standardized by the mean of the saline group. Approximately 30%
of noradrenergic neurons survived in A5 (31 ± 6%) and A7
(28 ± 6%) after lesioning. Counting was not performed for the LC
region because TH-positive neurons are densely packed and are difficult
to count in the LC. Furthermore, not a single neuron survived in LC
region after D H-saporin treatment. ***p < 0.001 versus saline-treated.
|
|

View larger version (76K):
[in this window]
[in a new window]
|
Figure 7.
Immunohistochemistry of noradrenergic neurons in
the A5 cell group. A, TH of a saline-treated rat.
B, Profound reduction in TH-stained neurons in the
immunolesioned rat.
|
|

View larger version (52K):
[in this window]
[in a new window]
|
Figure 8.
Immunohistochemistry of noradrenergic neurons in
the LC. A, Very dense TH staining is observed in the LC
region of the saline-treated rat. B, No immunoreactivity
is observed after D H-saporin treatment.
|
|

View larger version (66K):
[in this window]
[in a new window]
|
Figure 9.
Immunohistochemistry of noradrenergic neurons in
the A7 cell group. A, TH immunohistochemistry in the A7
cell group of a saline-treated rat. B, Note the absence
of TH-stained neurons in the immunolesioned rat.
|
|
Whereas there was no significant difference in baseline tail-flick
latencies between control and immunolesioned rats (Fig. 10A), the tail-flick
latency was significantly prolonged only in control rats after
N2O exposure; D H-saporin-treated rats
exhibited no antinociceptive response to N2O.
These data support the hypothesis that activation of noradrenergic
pontine neurons mediates the antinociceptive response to
N2O.

View larger version (18K):
[in this window]
[in a new window]
|
Figure 10.
Effect of noradrenergic lesioning on the
antinociceptive and sedative effects of nitrous oxide.
A, Tail-flick latency was measured before (air) and
after N2O exposure. There was no significant difference in
baseline latencies of the saline (n = 11)- and
D H-saporin (n = 12)-treated rats, using the
same intensity setting for the radiant heat source. The N2O
antinociceptive effect was observed in the saline treatment group
(27.7 ± 6.1%MPE), but not in the D H-saporin-treated rats
(1.0 ± 6.7%MPE). Three rats in the control group and two rats in
the LC lesion group were excluded from the tail-flick data because of
an excessive change in tail temperature after N2O exposure.
B, There was no difference between saline
(n = 10; 112 ± 3%)- and D H-saporin
(n = 10; 116 ± 3%)-treated rats in the
sedative effect of N2O, as measured by the concentration
(ATA), which prevented a righting reflex in half the rats
(ED50 LORR). *p < 0.05 versus air;
###p < 0.001 versus saline.
|
|
Loss of righting reflex was used to evaluate the sedative properties of
N2O in the control and immunolesioned rats. No
difference was observed in the LORR ED50 values
of the control and the D H-saporin-treated rats, indicating that
activation of these noradrenergic neurons do not mediate the sedative
properties of N2O (Fig.
10B).
The 2B adrenoceptor subtype was required for
N2O analgesia but not for N2O-evoked
sedation
The antinociceptive effects of N2O with the
hot-plate assay in the 2A / ,
2B / , 2C / , and
D79N mice, and in their respective WT controls are shown in Figure
11A. The
N2O response for the hot-plate assay was reduced
by 65% in the 2B / mice (vs WT controls), suggesting that the 2B adrenoceptor subtype
mediates N2O antinociception for this
behaviorally complex hindpaw-licking response to nocifensive heat.
Furthermore, N2O had no antinociceptive effect on
the tail-flick assay in the 2B / mice,
indicating that the 2B adrenoceptor subtype
also mediates N2O analgesia for this nociceptive
spinal reflex (Fig. 11B).

View larger version (29K):
[in this window]
[in a new window]
|
Figure 11.
A, N2O antinociceptive
effect on hot-plate assay was reduced in 2BKO. This
figure illustrates the antinociceptive effects of N2O on
the hot-plate assay in the 2A / ,
2C / knock-out mice ( 2AKO and
2CKO), the D79N mutant mice with nonfunctional
2A adrenoceptors, and in their genetically matched WT
controls (on a C57BL/6J congenic background). The
2B / ( 2BKO) mice were on a different
genetic background (C57BL/6J × 129SvJ hybrid), so they required
their own genetically matched WT controls (WT for
2B). There were no differences in baseline
hot-plate latencies between the various mouse strains (data not shown).
Only the 2BKO mice had reduced N2O
antinociception on the hot-plate assay (reduced 65%, 24 ± 9 vs
69 ± 9%MPE in WT for 2B), indicating that
the 2B adrenoceptor subtype mediates N2O
antinociception for this supraspinal response. The N2O
antinociceptive responses (%MPE) in the other knock-out and mutant
mouse strains were: WT, 62 ± 10; 2AKO, 62 ± 11; 2CKO, 49 ± 18; and D79N, 72 ± 9 (n = 16 for each group). B,
N2O antinociceptive effect on tail-flick assay was lost in
2BKO. There were no differences in baseline tail-flick
latencies of the 2BKO mice and their WT controls. The WT
for 2B mice had a significant N2O
antinociceptive effect on the tail-flick assay (14.7 ± 6.2%MPE),
but the 2BKO mice had no N2O antinociceptive
response on the tail-flick assay (1.3 ± 2.1%MPE), indicating
that the 2B adrenoceptor subtype mediates
N2O antinociception (n = 10 for each
group). N2O had no effect on tail-flick latencies in the
C57BL/6J WT controls for the D79N, 2AKO and
2CKO mice, so these strains were not tested for
N2O tail-flick effects. *p < 0.05;
**p < 0.01 versus air; #p < 0.05; ###p < 0.001 versus genetically matched WT
controls.
|
|
In no instance was the sedative action of N2O
diminished when one of the three 2
adrenoceptor subtypes was knocked out or rendered dysfunctional (Fig.
12). Therefore, although no
antinociceptive action can be elicited in 2B
/ mice, their response in the rotarod test is identical to that of
their wild-type control mice. At the lower concentration of
N2O, the sedative effect of
N2O appeared to be modestly enhanced in
2C / mice.

View larger version (35K):
[in this window]
[in a new window]
|
Figure 12.
N2O sedative effect was intact in the
2B / knock-out mice. The sedative effects of
N2O (35 and 70% ATA) in the 2A / ,
2B / , and 2C / knock-out mice
(A KO, B KO, and C KO, respectively), the
D79N mice, and in their respective WT controls (n = 8 for each group). There were no differences in baseline rotarod
latencies among the various mouse strains. The sedative effect was
observed on the rotarod assay in all the mouse strains including the B
KO mice. An enhanced sedative effect was observed in the C KO mice with
the lower concentration of N2O. *p < 0.05 versus air.
|
|
2B adrenoceptor mRNA was present in the spinal cord
of wild-type mice
RT-PCR assays were repeated twice with kidney, spinal cord, and
heart tissues from wild-type mice, and Figure
13 illustrates representative results
from these assays. The RT-PCR methods used allow relative quantitation;
a large 2B adrenoceptor mRNA signal was
detected from the kidney, whereas almost none could be detected in the
heart (top panel). An intermediate amount of
2B adrenoceptor mRNA signal was detected in
the spinal cord. The bottom panel demonstrates that total RNA from each
of these tissues was of similar quality and yielded the expected
ribosomal bands.

View larger version (83K):
[in this window]
[in a new window]
|
Figure 13.
Detection of mRNA for 2B
adrenoceptor in various tissues from wild-type mice
(n = 2). RT-PCR analysis of total RNA prepared from
kidney, spinal cord, and heart tissue revealed detectable levels of
message for this receptor were found in the kidney and spinal cord but
not in heart tissue. The bottom panel demonstrates that
total RNA from each of these tissues was of similar quality and yielded
the expected ribosomal bands after ethidium staining.
|
|
 |
DISCUSSION |
Exposure to N2O increased expression of Fos
in TH-positive neurons in the pontine noradrenergic nuclei (A5, LC, and
A7) of rats. After eliminating all of the TH-positive neurons in the LC
and >70% in each of A5 and A7, the antinociceptive response to
N2O was blocked. In contrast, the sedative
response to N2O is maintained under these
conditions. Null mice for the 2B adrenoceptor subtype had no N2O antinociceptive effect on tail
flick and a diminished effect for the hot plate assay, whereas their WT
cohorts and null mice for the other subtypes exhibited a normal
antinociceptive response to N2O. Normal sedative
responses to N2O were evident in all the
genetically modified mice.
The use of the immediate early gene product, Fos protein, as a
biochemical marker of sustained neuronal activation in the brainstem
catecholaminergic neurons has been validated using a wide range of
stimuli (Monnikes et al., 1997 ; Jordan, 1998 ; Hahn and Bannon, 1999 ; Li
et al., 1999 ). The time course of its appearance (i.e., within 60 min
of its provocation) ideally suits its application in these experiments
(Presley et al., 1990 ). Other investigators have demonstrated that a
wide variety of anesthetic agents (although no studies involved nitrous
oxide) can evoke Fos protein in discrete sites of the nervous system,
including the noradrenergic (A1 and A2) and adrenergic (C1) medullary
nuclei (Krukoff et al., 1992 ; Miura et al., 1994 ; Takayama et al.,
1994 ; Clement et al., 1998 ). Significantly, none of these previous
studies have observed anesthetic evoked Fos expression in the pontine
noradrenergic nuclei (A5, LC, and A7). Whereas we have shown that
N2O activates pontine noradrenergic neurons, the
mechanism by which this occurs has not been established. At the ion
channel level, N2O is known to block NMDA
channels (Jevtovic-Todorovic et al., 1998 ), which would tend to reduce
cell excitability; however, its possible role in the activation of
noradrenergic neurons has not been addressed.
Saporin is a ribosome inactivating protein that ultimately results in
cell death and destruction. By coupling this toxin to an antibody
directed against a key synthetic enzyme, we are able to selectively
destroy only those neurons containing this enzyme (Wrenn et al., 1996 ).
Because dopamine- -hydroxylase only exists in noradrenergic or
adrenergic neurons, only these cells will be selectively destroyed
(Martin et al., 1999 ). In this manner we have isolated the role of
activation of noradrenergic pathways in the behavioral responses to
N2O. Whereas activation of noradrenergic pathways
is causally linked to the antinociceptive action of
N2O, it does not appear to play any role in the
sedative response to N2O.
The processes whereby activation of noradrenergic pathways produce
antinociception in rodents has been investigated by our laboratory.
Previously, we have shown that descending noradrenergic pathways are a
pivotal component in the antinociceptive response to
N2O because both spinal cord transection as well
as depletion of norepinephrine in the spinal cord will prevent this
behavioral response (Zhang et al., 1999 ). Furthermore,
N2O provokes release of spinal norepinephrine
over the same time course as it produces its antinociceptive action and
intrathecal administration of an 2 antagonist
blocks N2O evoked antinociception (Guo et al.,
1996 ). Collectively, these data indicate that N2O
can stimulate noradrenergic bulbospinal neurons, resulting in spinal
norepinephrine release and activation of dorsal horn
2 adrenoceptors, thus inducing antinociception
(Kingery et al., 1997 ).
Norepinephrine is a nonselective agonist at adrenergic receptors.
Intrathecal administration of a selective 2
antagonist (atipamezole) blocked the N2O
antinociceptive response (Guo et al., 1996 ), suggesting this class of
spinal adrenoceptors mediates the action. Earlier studies had revealed
that spinal 2 adrenoceptors are capable of
transducing antinociception from supraspinal activation (Jones, 1991 ;
West et al., 1993 ; Willis and Westlund, 1997 ). Yet prazosin, a
prototypic 1 antagonist, also blocked the
antinociceptive response to N2O (Guo et al.,
1999 ). This effect may be because of its ability to block
2B and 2C
adrenoceptors, although it has no activity at the
2A subtype (MacDonald and Scheinin, 1995 ). Further corroboration that the 2A adrenoceptor
subtype is not involved was provided by data from studies in which the
D79N transgenic animals, which have dysfunctional
2A adrenoceptor subtypes, exhibit dose-dependent antinociception in response to N2O
exposure (Guo et al., 1999 ). Now we report that mice deficient in
either the 2A or the
2C adrenoceptor subtype respond normally to
N2O. However, mice that are deficient in the
2B adrenoceptor subtype exhibit little (Fig.
11A) or no (Fig. 11B)
antinociceptive effect. The quantitative difference in these two assays
may relate to the fact that the tail-flick assay measures pain
processing in the spinal cord, exclusively; supraspinal events may
impact on the hot-plate test. Therefore, these data suggest that the
2B adrenoceptor mediates the antinociceptive
response to the endogenously released norepinephrine in the dorsal horn
of the spinal cord, which we have shown to contain message for
2B subtype.
Much of the earlier pharmacological evidence pointed to activation of
2A subtype for 2
adrenoceptor-mediated antinociception (Millan, 1992 ; Millan et al.,
1994 ). However, a prazosin-sensitive 2
adrenoceptor subtype was shown to inhibit release of substance P in a
spinal cord preparations, suggesting a role for the
2B or 2C adrenoceptor
subtypes in antinociception (Ono et al., 1991 ). Furthermore, ST-91, a
non- 2A subtype-preferring
2 agonist, was shown to induce antinociception
in rats when it was administered intrathecally, and again this effect
was blocked by prazosin (Graham et al., 1997 , 2000 ; Takano et al.,
1992a ; Takano and Yaksh, 1992b ). Inability to reconcile these disparate
findings highlights the difficulties involved in using pharmacological
approaches, especially when these probes lack subtype selectivity. The
development of genetically modified reagents has facilitated
subtype-specific approaches. Studies using D79N mice, in which the gene
for 2A adrenoceptor subtype has been mutated
rendering the expressed protein dysfunctional, established a role for
the 2A subtype for the thermal analgesic
response to the potent 2 adrenoceptor agonist
dexmedetomidine (Hunter et al., 1997 ; Lakhlani et al., 1997 ). However,
the D79N mice do exhibit some residual 2
adrenoceptor agonist-induced effects on spinal analgesia in the
intrathecal substance P-induced pain model (Stone et al., 1997 ) and for
tail-flick analgesia after the administration of the
2 agonist moxonidine (Fairbanks and Wilcox,
1999 ). Furthermore, intrathecally administered 2C antisense oligodeoxynucleotides decreased
mechanical antinociception induced by clonidine and other
antinociceptive agents in the rat, suggesting that the
2C subtype is also involved in
antinociception; however, confirmatory evidence that expression of only
the 2C subtype was decreased was not provided
(Aley and Levine, 1997 ). It should be acknowledged that studies on
genetically modified reagents may provide misleading information. In
the case of the knock-out models, these animals not only lack the
protein of interest but the organisms have had an opportunity to adapt
to this deficiency during their development. These putative adaptive
responses to the knock-out remain largely undocumented.
Whereas the 2B adrenergic receptor subtype has
been found to mediate some physiological responses (Link et al., 1996 ),
its role in antinociception has not been previously established using transgenic animals. In the rat spinal cord and dorsal root ganglion, mRNA for the 2A, 2B
and 2C subtypes have been identified; in the
spinal cord 2A mRNA is abundant in lamina I,
II, and V, whereas the 2C exhibit a weaker and
less distinct signal throughout the dorsal horn, and the
2B are occasionally seen in lamina II (Zeng and Lynch, 1991 ; Nicholas et al., 1993 ; Shi et al., 1999 ). In the
dorsal root ganglia, mRNA for the 2C subtype
predominates (80% of neuron profiles), whereas
2A are seen in ~20% of neurons, and the
2B mRNA is found only in small numbers of
neurons (Nicholas et al., 1993 ; Cho et al., 1997 ; Gold et al., 1997 ;
Shi et al., 2000 ). However, the low prevalence of
2B mRNA in the rat spinal cord and dorsal root
ganglion may not necessarily reflect a lack of functional importance
(Nicholas et al., 1996 ).
We have demonstrated that there is a robust signal for
2B mRNA in the spinal cord of mice. One
possible site at which this receptor subtype may play a role in
antinociception may be at the level of the GABAergic interneurons in
lamina III; these interneurons have long been known to have a role in
descending inhibition (Willis et al., 1997 ). It is notable that a
strong signal for 2B mRNA has been detected in
lamina I-V in the spinal cord of humans (Smith et al., 1995 ) and that
2 adrenoceptors in this region are upregulated after spinal cord transection (Giroux et al., 1999 ), suggesting that
these may be coupled to descending inhibitory pathways.
Finally, the data from these studies indirectly refute the "unitary
hypothesis for anesthetic action." In this study we provide clear
evidence that the sedative and the antinociceptive actions of
N2O appear to be mediated by different molecular
mechanisms. Whereas the antinociceptive response clearly requires the
participation of both noradrenergic pathways and
2B adrenoceptors, neither mechanism is needed
for the hypnotic-sedative action of N2O.
Therefore, we posit that not only are different anesthetic agents not
acting via the same mechanism, but the same anesthetic compound
transduces different aspects of the anesthetic state at different sites.
 |
FOOTNOTES |
Received June 30, 2000; revised Sept. 22, 2000; accepted Oct. 2, 2000.
This work was supported by National Institutes of Health Grant GM30232,
a Veteran Affairs Merit Review, and the Medical Research Council. We
thank the Clinical Investigation Facility of the
60th Medical Group at Travis Air Force Base and
especially Master Sergeant Jonathan Gorum for assisting with the
hyperbaric chamber study. We also thank Prof. Lee E. Limbird for
providing us with the D79N transgenic mice.
Correspondence should be addressed to Prof. Mervyn Maze, Magill
Department of Anaesthetics, Chelsea and Westminster Hospital, 369 Fulham Road, London SW10 9NH, UK. E-mail: m.maze{at}ic.ac.uk.
 |
REFERENCES |
-
Aley KO,
Levine JD
(1997)
Multiple receptors involved in peripheral alpha 2, mu, and A1 antinociception, tolerance, and withdrawal.
J Neurosci
17:735-744[Abstract/Free Full Text].
-
Altman JD,
Trendelenburg AU,
MacMillan L,
Bernstein D,
Limbird L,
Starke K,
Kobilka BK,
Hein L
(1999)
Abnormal regulation of the sympathetic nervous system in alpha2A-adrenergic receptor knockout mice.
Mol Pharmacol
56:154-161[Abstract/Free Full Text].
-
Bylund DB,
Eikenberg DC,
Hieble JP,
Langer SZ,
Lefkowitz RJ,
Minneman KP,
Molinoff PB,
Ruffolo RR,
Trendelenburg U
(1994)
International union of pharmacology nomenclature of adrenoceptors.
Pharmacol Rev
46:121-135[Web of Science][Medline].
-
Byrum CE,
Stornetta R,
Guyenet PG
(1984)
Noradrenergic projections to all regions of the spinal cord arise almost entirely from the dorsolateral pontine catecholamine cell groups the locus coeruleus (LC), A5 and A7 that all play a role in antinociception.
Brain Res
303:15-29[Web of Science][Medline].
-
Cho H-J,
Kim D-S,
Lee N-H,
Kim J-K,
Lee K-M,
Han K-s,
Kang Y-N,
Kim K-J
(1997)
Changes in the alpha2-adrenergic receptor subtypes gene expression in rat dorsal root ganglion in an experimental model of neuropathic pain.
NeuroReport
8:3119-3122[Medline].
-
Chomczynski P,
Sacchi N
(1987)
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:156-159[Web of Science][Medline].
-
Clement CI,
Keay KA,
Bandler R
(1998)
Medullary catecholaminergic projections to the ventrolateral periaqueductal gray region activated by halothane anesthesia.
Neuroscience
86:1273-1284[Web of Science][Medline].
-
Fairbanks CA,
Wilcox GL
(1999)
Moxonidine, a selective alpha2-adrenergic and imidazoline receptor agonist, produces spinal antinocicieption in mice.
J Pharmacol Exp Ther
290:403-412[Abstract/Free Full Text].
-
Fender C,
Fujinaga M,
Maze M
(2000)
Strain differences in the antinociceptive effect of nitrous oxide on the tail flick test in rats.
Anesth Analg
90:195-199[Abstract/Free Full Text].
-
Giroux N,
Rossignol S,
Reader TA
(1999)
Autoradiographic study of alpha1- and alpha2-noradrenergic and serotonin1a receptors in the spinal cord of normal and chronically transected cats.
J Comp Neurol
406:402-414[Web of Science][Medline].
-
Gold MS,
Dastmalchi S,
Levine JD
(1997)
Alpha-2 adrenergic receptor subtypes in rat dorsal root and superior cervical ganglion neurons.
Pain
69:179-190[Web of Science][Medline].
-
Graham BA,
Hammond DL,
Proudfit HK
(1997)
Differences in the antinociceptive effects of alpha-2 adrenoceptor agonists in two substrains of Sprague-Dawley rats.
J Pharmacol Exp Ther
283:511-519[Abstract/Free Full Text].
-
Graham BA,
Hammond DL,
Proudfit HK
(2000)
Synergistic interactions between two alpha 2-adrenoceptor agonists, dexmedetomidine and ST-91, in two substrains of Sprague-Dawley rats.
Pain
85:135-143[Medline].
-
Guo TZ,
Poree L,
Golden W,
Stein W,
Fujinaga J,
Maze M
(1996)
Antinociceptive response to nitrous oxide is mediated by supraspinal opiate and spinal alpha 2 adrenergic receptors in the rat.
Anesthesiology
85:846-852[Web of Science][Medline].
-
Guo TZ,
Davies MF,
Kingery WS,
Patterson AJ,
Limbird LE,
Maze M
(1999)
Nitrous oxide produces antinociceptive response via alpha 2B and/or alpha 2C adrenoceptors subtypes in mice.
Anesthesiology
90:470-476[Web of Science][Medline].
-
Hahn MK,
Bannon MJ
(1999)
Stress-induced c-fos expression in the rat locus coeruleus is dependent on neurokinin 1 receptor activation.
Neuroscience
94:1183-1188[Web of Science][Medline].
-
Hunter JC,
Fontana DJ,
Hedley LR,
Jasper JR,
Lewis R,
Link RE,
Secchi R,
Sutton J,
Eglen RM
(1997)
Assessment of the role of alpha2-adrenoceptor subtypes in the antinociceptive, sedative and hypothermic actions of dexmedetomidine in transgenic mice.
Br J Pharmacol
122:1339-1344[Web of Science][Medline].
-
Jevtovic-Todorovic V,
Todorovic SM,
Mennerick S,
Powell S,
Dikranian K,
Benshoff N,
Zorumski CF,
Olney JW
(1998)
Nitrous oxide (laughing gas) is an NMDA antagonist, neuroprotectant and neurotoxin.
Nat Med
4:460-463[Web of Science][Medline].
-
Jones SL
(1991)
Descending noradrenergic influences on pain.
Prog Brain Res
88:381-394[Web of Science][Medline].
-
Jordan LM
(1998)
Initiation of locomotion in mammals.
Ann NY Acad Sci
16:83-93.
-
Kingery WS,
Davies MF,
Maze M
(1997)
Molecular mechanisms for the analgesic properties of alpha-2 adrenergic agonists.
In: Molecular neurobiology of pain (Borsook D,
ed), Vol 9, pp 275-304. Seattle: IASP.
-
Koblin DD,
Dong DE,
Eger EI
(1979)
Tolerance of mice to nitrous oxide.
J Pharmacol Exp Ther
211:317-325[Abstract/Free Full Text].
-
Krukoff TL,
Morton TL,
Harris KH,
Jhamandas JH
(1992)
Expression of c-fos protein in rat brain elicited by electrical stimulation of the pontine parabrachial nucleus.
J Neurosci
12:3582-3590[Abstract].
-
Lakhlani PP,
MacMillan LB,
Guo TZ,
McCool BA,
Lovinger DM,
Maze M,
Limbird LE
(1997)
Substitution of a mutant alpha 2A-adrenergic receptor via "hit and run" gene targeting reveals the role of this subtype in sedative, analgesic, and anesthetic-sparing responses in vivo.
Proc Natl Acad Sci USA
94:9950-9955[Abstract/Free Full Text].
-
Li C,
Chen P,
Smith MS
(1999)
Neural populations in the rat forebrain and brainstem activated by the suckling stimulus as demonstrated by cFos expression.
Neuroscience
94:117-129[Web of Science][Medline].
-
Link RE,
Desai K,
Hein L,
Stevens ME,
Chruscinski A,
Bernstein D,
Barsh GS,
Kobilka BK
(1996)
Cardiovascular regulation in mice lacking alpha 2-adrenergic receptor subtypes B and C.
Science
273:803-805[Abstract].
-
MacDonald E,
Scheinin M
(1995)
Distribution and pharmacology of alpha 2-adrenoceptors in the central nervous system.
J Physiol Pharmacol
46:241-258[Web of Science][Medline].
-
MacMillan LB,
Hein L,
Smith MS,
Piascik MT,
Limbird LE
(1996)
Central hypotensive effects of the alpha 2A-adrenergic receptor subtype.
Science
273:801-803[Abstract].
-
Martin WJ,
Gupta NK,
Loo CM,
Rohde DS,
Basbaum AI
(1999)
Differential effects of neurotoxic destruction of descending noradrenergic pathways on acute and persistent nociceptive processing.
Pain
80:57-65[Web of Science][Medline].
-
Millan MJ
(1992)
Evidence that an alpha2A-adrenoceptor subtype mediates antinociception in mice.
Eur J Pharmacol
215:355-356[Web of Science][Medline].
-
Millan MJ,
Bervoets K,
Rivet J-M,
Widdowson P,
Renouard A,
LeMarouille-Girardon S,
Gobert A
(1994)
Multiple alpha-2 adrenergic receptor subtypes. II. Evidence for a role of rat alpha-2A adrenergic receptors in the control of nociception, motor behavior and hippocampal synthesis of noradrenaline.
J Pharmacol Exp Ther
270:958-972[Abstract/Free Full Text].
-
Miura M,
Takayama K,
Okada J
(1994)
Neuronal expression of Fos protein in the rat brain after baroreceptor stimulation.
J Auton Nerv Syst
50:31-43[Web of Science][Medline].
-
Monnikes H,
Lauer G,
Bauer C,
Tebbe J,
Zittel TT,
Arnold R
(1997)
Pathways of fos expression in locus coeruleus, dorsal vaga complex, and PVN in response to intestinal lipid.
Am J Physiol
273:R2059-R2071[Abstract/Free Full Text].
-
Nicholas AP,
Pieribone V,
Hokfelt T
(1993)
Distributions of mRNAs for alpha-2 adrenergic receptor subtypes in rat brain: an in situ hybridization study.
J Comp Neurol
328:575-594[Web of Science][Medline].
-
Nicholas AP,
Hokfelt T,
Pieribone VA
(1996)
The distribution and significance of CNS adrenoceptors examined with in situ hybridization.
Trends Pharmacol Sci
17:245-254[Medline].
-
Ono H,
Mishima A,
Ono S,
Fukuda H,
Vasko MR
(1991)
Inhibitory effects of clonidine and tizanidine on release of substance P from slices of rat spinal cord and antagonism by alpha-adrenergic receptor antagonists.
Neuropharmacology
30:585-589[Web of Science][Medline].
-
Paxinos G,
Watson C
(1986)
In: The rat brain in stereotaxic coordinates, Ed 2. Sydney: Academic.
-
Presley RW,
Menetrey D,
Levine JD,
Basbaum AI
(1990)
Systemic morphine suppresses noxious stimulus-evoked Fos protein-like immunoreactivity in the rat spinal cord.
J Neurosci
10:323-335[Abstract].
-
Rohde DS,
Basbaum AI
(1998)
Activation of coeruleospinal noradrenergic inhibitory controls during withdrawal from morphine in the rat.
J Neurosci
18:4393-4402[Abstract/Free Full Text].
-
Shi T-JS,
Winzer-Serhan U,
Leslie F,
Hokfelt T
(1999)
Distribution of alpha2-adrenoceptor mRNAs in the rat lumbar spinal cord in normal and axotomized rats.
NeuroReport
10:2835-2839[Web of Science][Medline].
-
Shi T-JS,
Winzer-Serhan U,
Leslie F,
Hokfelt T
(2000)
Distribution and regulation of alpha2-adrenoceptors in rat dorsal root ganglia.
Pain
84:319-330[Medline].
-
Smith MS,
Schambra UB,
Wilson KH,
Page SO,
Hulette C,
Light AR,
Schwinn DA
(1995)
Alpha 2-adrenergic receptors in human spinal cord: specific localized expression of mRNA encoding alpha 2-adrenergic receptor subtypes at four distinct levels.
Mol Brain Res
34:109-117[Medline].
-
Stone LS,
MacMillan LB,
Kitto KF,
Limbird LE,
Wilcox GL
(1997)
The alpha2A adrenergic receptor subtype mediates spinal analgesia evoked by alpha2 agonists and is necessary for spinal adrenergic-opioid synergy.
J Neurosci
17:7157-7165[Abstract/Free Full Text].
-
Takano M,
Takano Y,
Yaksh TL
(1992a)
The effect of intrathecally administered imiloxan and WB4101: possible role of alpha2-adrenoceptor subtypes in the spinal cord.
Eur J Pharmacol
219:465-468[Web of Science][Medline].
-
Takano Y,
Yaksh TL
(1992b)
Characterization of the pharmacology of intrathecally administered alpha-2 agonists and antagonists in rats.
J Pharmacol Exp Ther
261:764-772[Abstract/Free Full Text].
-
Takayama K,
Suzuki T,
Miura M
(1994)
The comparison of effects of various anesthetics on expression of Fos protein in the rat brain.
Neurosci Lett
176:59-62[Web of Science][Medline].
-
West WL,
Yeomans DC,
Proudfit HK
(1993)
The function of noradrenergic neurons in mediating antinociception induced by electrical stimulation of the locus coeruleus in two different sources of Sprague-Dawley rats.
Brain Res
626:127-135[Web of Science][Medline].
-
Willis WD,
Westlund KN
(1997)
Neuroanatomy of the pain system and of the pathways that modulate pain.
J Clin Neurophysiol
14:2-31[Web of Science][Medline].
-
Wrenn CC,
Picklo MJ,
Lappi DA,
Robertson D,
Wiley RG
(1996)
Central noradrenergic lesioning using anti-DBH-saporin: anatomical findings.
Brain Res
740l:175-184[Web of Science][Medline].
-
Zeng D,
Lynch KR
(1991)
Distribution of alpha2-adrenergic receptor mRNAs in the rat CNS.
Mol Brain Res
10:219-225[Medline].
-
Zhang C,
Davies MF,
Guo TZ,
Maze M
(1999)
The analgesic action of nitrous oxide is dependent on the release of norepinephrine in the dorsal horn of the spinal cord.
Anesthesiology
91:1401-1407[Web of Science][Medline].
Copyright © 2000 Society for Neuroscience 0270-6474/00/20249242-10$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
L. S. Stone, K. F. Kitto, J. C. Eisenach, C. A. Fairbanks, and G. L. Wilcox
ST91 [2-(2,6-Diethylphenylamino)-2-imidazoline Hydrochloride]-Mediated Spinal Antinociception and Synergy with Opioids Persists in the Absence of Functional {alpha}-2A- or {alpha}-2C-Adrenergic Receptors
J. Pharmacol. Exp. Ther.,
December 1, 2007;
323(3):
899 - 906.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Irifune, N. Kikuchi, T. Saida, T. Takarada, Y. Shimizu, C. Endo, K. Morita, T. Dohi, T. Sato, and M. Kawahara
Riluzole, a Glutamate Release Inhibitor, Induces Loss of Righting Reflex, Antinociception, and Immobility in Response to Noxious Stimulation in Mice
Anesth. Analg.,
June 1, 2007;
104(6):
1415 - 1421.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Katayama, M. Irifune, N. Kikuchi, T. Takarada, Y. Shimizu, C. Endo, T. Takata, T. Dohi, T. Sato, and M. Kawahara
Increased {gamma}-Aminobutyric Acid Levels in Mouse Brain Induce Loss of Righting Reflex, but Not Immobility, in Response to Noxious Stimulation
Anesth. Analg.,
June 1, 2007;
104(6):
1422 - 1429.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. F. Antognini, R. J. Atherley, R. C. Dutton, M. J. Laster, E. I. Eger II, and E. Carstens
The Excitatory and Inhibitory Effects of Nitrous Oxide on Spinal Neuronal Responses to Noxious Stimulation
Anesth. Analg.,
April 1, 2007;
104(4):
829 - 835.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Himukashi, H. Takeshima, S. Koyanagi, T. Shichino, and K. Fukuda
The involvement of the nociceptin receptor in the antinociceptive action of nitrous oxide.
Anesth. Analg.,
September 1, 2006;
103(3):
738 - 741.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. L. LeDuc, R. Atherley, S. L. Jinks, and J. F. Antognini
Nitrous oxide depresses electroencephalographic responses to repetitive noxious stimulation in the rat
Br. J. Anaesth.,
February 1, 2006;
96(2):
216 - 221.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Paris, J. Mantz, P. H. Tonner, L. Hein, M. Brede, and P. Gressens
The Effects of Dexmedetomidine on Perinatal Excitotoxic Brain Injury are Mediated by the {alpha}2A-Adrenoceptor Subtype
Anesth. Analg.,
February 1, 2006;
102(2):
456 - 461.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. K. Georgiev, A. Wakai, T. Kohno, T. Yamakura, and H. Baba
Actions of Norepinephrine and Isoflurane on Inhibitory Synaptic Transmission in Adult Rat Spinal Cord Substantia Gelatinosa Neurons
Anesth. Analg.,
January 1, 2006;
102(1):
124 - 128.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Brede, G. Nagy, M. Philipp, J. B. Sorensen, M. J. Lohse, and L. Hein
Differential Control of Adrenal and Sympathetic Catecholamine Release by {alpha}2-Adrenoceptor Subtypes
Mol. Endocrinol.,
August 1, 2003;
17(8):
1640 - 1646.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Philipp, M. Brede, and L. Hein
Physiological significance of alpha 2-adrenergic receptor subtype diversity: one receptor is not enough
Am J Physiol Regulatory Integrative Comp Physiol,
August 1, 2002;
283(2):
R287 - R295.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. P. Zalunardo, D. Serafino, P. Szelloe, F. Weisser, A. Zollinger, B. Seifert, and T. Pasch
Preoperative Clonidine Blunts Hyperadrenergic and Hyperdynamic Responses to Prolonged Tourniquet Pressure During General Anesthesia
Anesth. Analg.,
March 1, 2002;
94(3):
615 - 618.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|