Previous Article | Next Article 
The Journal of Neuroscience, February 15, 2000, 20(4):1297-1306
Identification of Residues within GABAA Receptor
Subunits That Mediate Specific Assembly with Receptor
Subunits
Pamela M.
Taylor1,
Christopher N.
Connolly1,
Josef T.
Kittler1,
George
H.
Gorrie1,
Alistair
Hosie2,
Trevor G.
Smart2, and
Stephen J.
Moss1
1 The Medical Research Council Laboratory of
Molecular Cell Biology and Department of Pharmacology, University
College, London WC1E 6BT, United Kingdom, and 2 Department
of Pharmacology, The School of Pharmacy, London WC1N 1AX, United
Kingdom
 |
ABSTRACT |
GABAA receptors can be constructed from a range of
differing subunit isoforms:
,
,
,
, and
. Expression
studies have revealed that production of GABA-gated channels is
achieved after coexpression of
and
subunits. The expression of
a
subunit isoform is essential to confer benzodiazepine sensitivity
on the expressed receptor. However, how the specificity of subunit
interactions is controlled during receptor assembly remains unknown.
Here we demonstrate that residues 58-67 within
subunit isoforms
are important in the assembly of receptors comprised of 
and


subunits. Deletion of these residues from the
1 or
6
subunits results in retention of either
subunit isoform in the
endoplasmic reticulum on coexpression with the
3, or
3 and
2
subunits. Immunoprecipitation revealed that residues 58-67 mediated
oligomerization of the
1 and
3 subunits, but were without affect
on the production of
/
complexes. Within this domain, glutamine
67 was of central importance in mediating the production of functional
1
3 receptors. Mutation of this residue resulted in a drastic
decrease in the cell surface expression of
1
3 receptors and the
resulting expression of
3 homomers. Sucrose density gradient
centrifugation revealed that this residue was important for the
production of a 9S
1
3 complex representing functional
GABAA receptors.
Therefore, our studies detail residues that specify
GABAA receptor 
subunit interactions. This domain,
which is conserved in all
subunit isoforms, will therefore play a
critical role in the assembly of GABAA receptors composed
of 
and 

subunits.
Key words:
GABAA-receptor; assembly; cell surface
expression; N-terminal; oligomerization;
subunit
 |
INTRODUCTION |
GABAA
receptors are critical mediators of fast synaptic inhibition in the
brain and are also important drug targets for a range of compounds,
including the benzodiazepines and barbiturates (MacDonald and Olsen,
1994
; Rabow et al., 1995
). GABAA receptors are
members of the ligand-gated ion channel superfamily that includes glycine, nicotinic acetylcholine (AChR), and
5-HT3 receptors (Unwin, 1993
). Molecular cloning
has revealed a range of GABAA receptor subunits
that can be divided by homology into subunit classes with multiple
members:
(1-6),
(1-3),
(1-3),
,
, and
(MacDonald and Olsen, 1994
; Rabow et al., 1995
; Davies et al., 1997
; Hedblom and
Kirkness, 1997
). There is considerable spatial and temporal variation
in subunit expression, with many neuron types expressing multiple
numbers of receptor subunits (Laurie et al., 1992
; MacDonald and Olsen,
1994
; Rabow et al., 1995
). Clearly, to delineate the true diversity of
GABAA receptor structure in the brain, it is important to gain some insights into how these receptor subunits are assembled.
Studies using heterologous expression focusing on the receptor
1,
1-2, and
2 subunits, have revealed that access to the cell
surface is limited to the combinations 
and 

2 (Angelotti and MacDonald 1993
; MacDonald and Olsen, 1994
; Rabow et al., 1995
; Connolly et al., 1996
). Most single subunits and the
1/
2,
2/
2 combinations are largely retained in the endoplasmic
reticulum (ER), where they are rapidly degraded (Connolly et al., 1996
; Gorrie et al., 1997
). Expression of
and
subunits produces GABA-gated currents, but coexpression with a
subunit is essential in conferring benzodiazepine sensitivity on expressed receptors (MacDonald and Olsen, 1994
; Rabow et al., 1995
). Interestingly, the
3 subunit, and to a lesser extent the
1 subunit, can assemble into homomeric channels that gate spontaneously in a number of heterologous expression systems (Sigel et al., 1989
; Krishek et al.,
1996
; Wooltorton et al., 1997
). Recently, four N-terminal amino acids
within the
3 subunit have been identified that control homo-oligomerization and cell surface expression of this subunit compared to
2 (Taylor et al., 1999
).
To gain further insights into GABAA receptor
assembly, we have examined the functional expression of two N-terminal
splice variants of the
6 subunit (Korpi et al., 1994
). These
variants, termed
6 long (
6L) and
6 short (
6S), differ by
the presence of amino acids 58-68, in
6L. Here we demonstrate that
residues 58-67 within both the
1 and
6 subunits are essential
for cell surface expression with receptor
and
subunits.
Immunoprecipitation revealed that these residues were important in
mediating oligomerization with the
3 subunit but did not affect
oligomerization with the
2 subunit. Sucrose density gradient
centrifugation revealed that residue Q67 within this domain was of
major significance in mediating the oligomerization of the
1 subunit
with
3 to produce functional receptors. Therefore, these studies
identify the first residues within GABAA receptor
subunits that mediate specific interaction with
but not
subunits.
 |
MATERIALS AND METHODS |
Cell culture and transfection. Human Embryonic kidney
293 (A293) cells were maintained in DMEM (Life Technologies,
Gaithersburg, MD) supplemented with 10% fetal bovine serum, 100 U/ml streptomycin (Sigma, St. Louis, MO), and 100 U/ml penicillin
(Sigma). Cells were electroporated (400 V, infinite resistance, 125 µF; Bio-Rad Gene Electroporator II) with 10 µg of DNA using
equimolar ratios of expression constructs. For electrophysiology, the
reporter plasmid for the S65T mutant jellyfish green fluorescent
protein (Heim et al., 1995) was added to the transfection
mixture. Transfected cells were maintained in culture for up to 48 hr
before use.
DNA construction. The murine GABAA
receptor cDNAs encoding the
1 subunit with the 9E10 epitope (between
amino acids 4 and 5) and the
2 and
2L subunits with the
FLAG epitope (between amino acids 4 and 5) in the
cytomegalovirus-based pGW1 expression vector have been described
previously (Connolly et al., 1996
). The
3 and
6S
subunit cDNAs in pGW1 were tagged with the FLAG epitope using the
oligonucleotides 5' CATGTTCCCGGGGT
CCTTGTCATCGTCGTCCTTGTAGTCGTTTACGCTCTGAG 3' (
3) and 5'
CTTCTACTTCCGCTGATGTTCCTGCTGCTACTGTTCTTGAAGATGAGA 3' (
6S) by
site-directed mutagenesis, as described previously (Kunkel, 1985
). An
6L cDNA construct was derived from the FLAG-tagged
6S construct
by site-directed mutagenesis using the oligonucleotide 5'
CTCATCAGTCCAAGTCTGTCGAAAGAAAACATCCATTGTGTACTCCATCTCCACATCTGA 3'.
Mutant
1 constructs were generated by site-directed mutagenesis
using the oligonucleotides 5' TTCATCCTTCCAACTCATATCGTGGTCTGA 3' for the
(9E10)
1S construct, 5'
CTTCCAACTGTAGTGCCTCAGGTAGAGGGTCATCGTAAAGTCCATATCGTG 3' for the
1/
1 construct, 5' CACATCTATTGTAAAATCCATATCGTGGT 3' for the
1(DF) construct, 5'
TGACGGAAAAACAAAGTTATTGTATACTCC 3' for the
1(TL) construct, 5'
TCCAACTTTGACGTAAATACACATCTATTGT 3' for the
1(YL) construct, 5'
TTCATCCTTCCAATAATGACGGAAAAACA 3' for the
1(HY) construct, 5'
CATCCTTCCAACTATGACGGAAAAACA 3' for the
1(H) construct, and 5'
TTCATCCTTCCAATATTGACGGAAAAAC 3' for
1(Y) construct.
Immunocytochemistry. Transfected cells plated on
poly-L-lysine (10 µg/ml
1)-coated coverslips were fixed
in 3% paraformaldehyde (in PBS) 15-18 hr after transfection,
and immunofluorescence was performed, as described previously (Connolly
et al., 1996
). When cells were permeabilized, 0.05% NP-40 was added to
all solutions after fixation. The primary antibodies were applied for 1 hr at the following concentrations: anti-FLAG (DYKDDDK) M2 mouse
monoclonal antibody (IBI Ltd.), 9 µg/ml; 9E10 supernatant
(Connolly et al., 1996
) diluted 1:2, and rabbit anti-9E10, 5 µg/ml.
An affinity-purified rabbit polyclonal sera against an intracellular
epitope of the
1 and
3 subunits (anti-
1/3; McDonald et al.,
1998
) was used at 5 µg/ml. Secondary antibodies, either fluorescein-
or rhodamine-conjugated anti-mouse or anti-rabbit IgG (Pierce,
Rockford, IL) at 1 µg/ml
1 were applied
for 45 min. Fluorescence images were analyzed by confocal microscopy
(MRC 1000; Bio-Rad, Hercules, CA).
Iodinated antibody binding. Affinity-purified 9E10 antibody
was iodinated to a specific activity of 500 Ci/mmol using Boltan and
Hunter reagents, per manufacturer's instructions (Amersham International). The iodinated antibody was titred on
(9E10)
3-transfected A293 cells and used
at saturating concentrations (10 nM) for surface binding.
The affinity of the antibody for (9E10)
3 was determined to be 0.5 nM by Scatchard analysis, as described previously (Amato et
al., 1999
). Surface binding was performed by preincubation in binding
medium (DMEM with 25 mM HEPES and 0.5% BSA, pH 7.4) for 1 hr on ice followed by incubation with iodinated antibody for 1 hr.
Cells were washed five times in binding medium, trypsinized, and
quantified by counting gamma emissions. Nonspecific binding was
determined using mock-transfected cells. Significance was determined
using the Student's t test.
Sucrose density gradient fractionation and
immunoprecipitation. Expressing cells were
L-methionine starved for 30 min before labeling with
[35S]methionine (ICN Biochemicals, Costa
Mesa, CA) at 200 µCi/ml-1 for 4 hr and lysed in lysis buffer (25 mM Tris-HCl, pH 7.6, 1 mM EDTA, 150 mM NaCl, 2% NP-40, 0.5%
deoxycholate, 50 mM NaF, 1 mM
Na3VO4, 0.1 mM
PMSF, 10 µg/ml pepstatin, 10 µg/ml leupeptin, 10 µg/ml antipain,
and 10 µg/ml aprotinin) either immediately, or after a 20 hr chase in
normal medium. Labeled receptor subunits were subjected to sucrose
density gradient fractionation on 5-20% linear sucrose density
gradients in lysis buffer (Gorrie et al., 1997
; Taylor et al., 1999
).
Before loading, cell extracts were clarified by centrifugation
(100,000 × g for 10 min). Gradients were calibrated by
loading parallel gradients with marker proteins (1 mg/ml) of known
sedimentation coefficients; BSA, 4.3 S; aldolase, 7.4 S; catalase, 11.2 S. Gradients were centrifuged in a Beckman SW55Ti rotor at 40,000 rpm
for 14.14 hr at 4°C. The gradients were fractionated into 14, 350 µl fractions, and receptor subunit sedimentation was analyzed by
immunoprecipitation, as described previously (Gorrie et al., 1997
;
Taylor et al., 1999
).
Western blotting. Receptor subunits were detected in cell
lysates using purified 9E10 antibody at 10 µg/ml. Western blotting was performed as described previously (Connolly et al., 1996
) using an
enhanced chemiluminescent substrate (Supersignal substrate; Pierce).
When appropriate, levels of chemiluminescence were quantified using a
Bio-Rad phosphoimager within the appropriate linear range.
Electrophysiological analysis. Whole-cell membrane currents
were recorded from single A293 cells using the patch-clamp technique in
conjunction with a List EPC7 amplifier. Patch electrodes (1-5 M
)
were filled with a solution containing (in mM): 140 KCl, 2 MgCl2, 1 CaCl2, 10 HEPES,
11 EGTA, and 2 adenosine triphosphate, pH 7.2 Cells were continuously
superfused with a Krebs' solution containing (in mM): 140 NaCl, 4.7 KCl, 1.2 MgCl2, 2.5 CaCl2, 10 HEPES, and 11 glucose, pH 7.4. Cells
were used 24-48 hr after transfection and voltage-clamped at
40 mV
with membrane currents. Drugs and Krebs' solution were rapidly applied
(exchange rate, ~30 msec) to single cells using a modified U-tube
(Wooltorton et al., 1997
). GABA equilibrium concentration-response
curve data were fitted to the following
equation:
|
(1)
|
where I and Imax
represent the peak GABA-activated current by a concentration,
A, and by a saturating concentration of GABA, respectively.
The EC50 defines the GABA concentration,
producing a half-maximal response. nH
represents the Hill coefficient. Data (mean ± SEM) were analyzed
using Origin 4.1 (MicroCal) and FigP (Biosoft).
 |
RESULTS |
6S and
6L subunits differ in their capacity to access the
cell surface with receptor
subunits
To assess the possible role of the
6 subunit splice variants in
mediating GABAA receptor assembly, the
6L and
6S subunit isoforms were modified with reporter epitopes between
amino acids 4 and 5 of the mature polypeptides. Previous studies have
demonstrated that addition of reporter epitopes to this domain of
receptor subunits is functionally silent (Connolly et al., 1996
).
9E10-tagged
6L and
6S were then expressed in human embryonic
kidney cells (A293) with the (FLAG)
3
subunit. The subcellular localization of the expressed subunits was
then determined using immunofluorescence with and without membrane
permeabilization. Coexpression of
(9E10)
6L with
(FLAG)
3 resulted in robust expression
of both the (9E10)
6L and
(FLAG)
3 subunits on the cell surface
(Fig. 1) as defined by staining in
unpermeabilized cells. In contrast,
(9E10)
6S was unable to access the cell
surface on expression with (FLAG)
3, as
determined by the lack of signal with 9E10 antisera in unpermeabilized
cells. The (9E10)
6S subunit could be
detected in permeabilized cells and was retained in an intracellular
organelle resembling the ER (Fig. 1B). However, the
(FLAG)
3 subunit was clearly able to
access the cell surface in the presence of
6S (Fig. 1), as defined
by robust FLAG staining in unpermeabilized cells. The ER retention of
6S after coexpression with the
3 subunit is consistent with the
observations of Korpi et al. (1994)
, who also demonstrated that
coexpression of the
6S subunit with both the
2 and
2 subunit
does not produce functional GABAA receptors.

View larger version (109K):
[in this window]
[in a new window]
|
Figure 1.
Coexpression of (9E10) 6L,
(9E10) 6S, and (9E10) 1S with the
(FLAG) 3 subunit in A293 cells. The subcellular
localization of receptors composed of
(9E10) 6L/(FLAG) 3,
(9E10) 6S/(FLAG) 3, and
(9E10) 1S/(FLAG) 3 subunits was determined
by immunofluorescence on both permeabilized and nonpermeabilized A293
cells 24 hr after transfection. Coexpressing cells were stained with
rabbit anti-9E10 antisera and a mouse anti-FLAG M2 monoclonal antibody
in the absence ( ) or presence (+) of membrane permeabilization.
Subunit expression was then visualized using anti-rabbit
fluorescein-conjugated secondary antibodies and anti-mouse
rhodamine-conjugated antisera, respectively. Scale bar, 10 µm.
|
|
The 10 amino acids that differ between the
6S and
6L subunits,
EYTMDVFFRQ, are conserved in all
subunits (MacDonald and Olsen,
1994
; Rabow et al., 1995
). The only variant amino acid is the
methionine residue present in
4 and
6 subunits that is substituted by an isoleucine in the
1,
2,
3, and
5
subunits. To examine the potential role of these residues in
controlling the assembly of other
subunit isoforms, residues 58-67
were deleted from (9E10)
1 to yield
(9E10)
1S. This construct was then
expressed with (FLAG)
3 in A293 cells,
and localization was monitored by immunofluorescence using 9E10
antisera. (9E10)
1S was unable to access
the cell surface on coexpression with (FLAG)
3 (Fig. 1), as defined by the
absence of 9E10 staining in unpermeabilized cells (Fig. 1). The
(9E10)
1S subunit could be detected in
permeabilized cells and was retained within the ER (Fig. 1). The
(FLAG)
3 subunit was able to access the
cell surface in the presence of
(9E10)
1S (Fig. 1), as defined by FLAG
staining in the absence of permeabilization, consistent with the
results seen with (9E10)
6S and also
with the ability of
3 to form functional homomeric receptors (Fig.
1; Connolly et al., 1996
; Wooltorton et al., 1997
, Taylor et al.,
1999
). In contrast, the wild-type
1 subunit can readily assemble
with
3 to form functional GABA-gated channels (MacDonald and Olsen,
1994
; Rabow et al., 1995
). Identical ER retention of
(9E10)
1S was seen on coexpression with
both the
3 and
2 subunits (data not shown). Because the
1S and
6S subunits appear to share the same defect in cell surface
expression, these observations suggest a potential role for amino acids
58-67 in controlling the assembly of all
subunit isoforms.
Cells expressing the
1S and
3 subunits express functional
3 homomers
Expression of
1S and
3 subunits in A293 cells produced
receptors displaying a distinctive pharmacological profile. The
expressed receptors were insensitive to GABA up to 2 mM but
could be activated by the allosteric modulator pentobarbitone (1 mM), which produced a desensitizing inward current with
characteristic "rebound current" after application of the ligand
(Fig. 2). Given that the
1S subunit is
retained within the ER, the cell surface (Fig. 1) expressed receptors
are likely to be composed of predominantly
3 subunits forming
homomeric receptors (Davies et al., 1997
; Wooltorton et al.,
1997
), which would account for the direct action of pentobarbitone (Fig. 2B). Homomeric
3 receptors also exhibit a
degree of spontaneous gating in the absence of any ligand, which can be
inhibited by Zn2+ (Wooltorton et al.,
1997
). Although in some cells (n = 3 of 8) 10 µM Zn2+ induced a
small outward current, the majority of expressing cells failed to
demonstrate any response to Zn2+ (Fig.
2A). Overall, the level of expression of the
3
homomers in the
1S
3 cDNA-transfected cells was quite low compared
to control cells transfected with only
3 cDNAs (data not shown; Wooltorton et al., 1997
). This may indicate why the
pentobarbitone-activated currents are small and may also explain the
difficulty in observing outward currents to
Zn2+ that are indicative of spontaneous
gating. It is therefore possible that the
1S subunit, while not
capable of accessing the cell membrane, may hinder the functional
expression of homomeric
3 subunits.

View larger version (21K):
[in this window]
[in a new window]
|
Figure 2.
Functional properties of GABAA
receptors produced by coexpression of 1S and 3 subunits in A293
cells. A, Bar graph of transfected A293 cell sensitivity
to 1 mM GABA, 1 mM pentobarbitone
(PB), and 10 µM Zn2+.
These concentrations produce maximal inward (GABA and
PB) or outward (Zn2+)
currents for  heteromers. The results illustrate ligand-activated
currents from n = 6 1S 3 and n = 5 1 3 GABAA receptors. Error bars indicate the mean
and SEM. Note the split ordinate axis. B, Membrane
currents evoked by 1 mM GABA (gray
bar), and 1 mM PB (hatched bar)
and for 1S 3 (columns 1 and 2) and 1 3 (columns 3 and
4).
|
|
Amino acids 58-67 control the oligomerization of GABAA
receptor
1 and
3 subunits
The failure of the
1S and
6S subunits to be expressed on the
cell surface with the
3 subunits could result from an inability to
oligomerize blocking the subsequent formation of functional receptors.
To address this issue, the ability of the
(9E10)
1S subunit to coimmunoprecipitate
(FLAG)
3 was assessed after metabolic
labeling with [35S]methionine. Cells
were labeled for 4 hr before lysis without a cold chase. This labeling
period is sufficient to allow efficient oligomerization of
GABAA receptor subunits to be detected (Moss et
al., 1992
; Krishek et al., 1994
; Connolly et al., 1996
; McDonald et
al., 1998
). (FLAG)
3 was observed to
migrate as two bands of 57-59 kDa, whereas (9E10)
1 migrated as three variable
bands of 48-52 kDa (Fig. 3A;
Connolly et al., 1996
; Gorrie et al., 1997
; McDonald et al., 1998
). An additional band of 40 kDa was sometimes observed, regardless of the
antibody used (Connolly et al., 1996
). These three forms of (9E10)
1 differ in their levels of
N-linked glycosylation, however all forms are able to oligomerize with
receptor
subunits (Connolly et al., 1996
; Gorrie et al., 1997
).
Using 9E10 antibody, the (FLAG)
3
subunit coprecipitated with the (9E10)
1
subunit (Fig. 3A). However, smaller amounts of
(FLAG)
3 were seen coprecipitating with
(9E10)
1S (Fig. 3A). This
difference was quantified using a phospoimager, and ~10-fold lower
amounts of (FLAG)
3 were seen
coprecipitating with (9E10)
1S compared
to (9E10)
1. Importantly, similar
amounts of (9E10)
1 and
(9E10)
1S were precipitated with the
9E10 antibody (Fig. 3A), demonstrating that both proteins
are expressed at similar levels. Similar low levels of the
1S
subunit were seen coprecipitating with the
3 subunit using FLAG
antibody (see Fig. 6).

View larger version (24K):
[in this window]
[in a new window]
|
Figure 3.
Coimmunoprecipitation of 3 and
2L subunits with 1 and 1S subunits. Transfected A293 cells
were [35S]methionine-labeled and
immunoprecipitated using 9E10 antibody or anti-FLAG M2 mouse monoclonal
antibody coupled to protein A-Sepharose. Immune complexes were
separated by SDS-PAGE using 8% gels. The molecular weights of
marker proteins are indicated. A, Cells expressing
(FLAG) 3 were immunoprecipitated using FLAG-antibody, and
cells expressing (9E10) 1, (9E10) 1S,
(FLAG) 3, (9E10) 1 + (FLAG) 3, or (9E10) 1S + (FLAG) 3 were immunoprecipitated using 9E10-antibody.
B, Cells expressing (FLAG) 2L,
(FLAG) 2L + (9E10) 1S,
(FLAG) 2L + (9E10) 1,
(9E10) 1, or (9E10) 1S were
immunoprecipitated using FLAG antibody. Immunoprecipitation was also
performed on untransfected methionine-labeled cells
(c) using 9E10 or FLAG antibodies, as shown in
A and B.
|
|
To further examine the role of residues 58-67 within
1, the
potential interaction with the (FLAG)
2L
subunit was tested. Previous studies have revealed that although the
1 and
2L subunits are capable of efficient oligomerization,
1/
2 complexes are ER retained and do not produce functional cell
surface receptors (Connolly et al., 1996
, 1999
). Immunoprecipitation of
(FLAG)
2L using FLAG antibody yielded a
broad smear of 42-49 kDa, as described previously (Fig. 3B;
Connolly et al., 1996
). Similar migration of the
2 subunit has been
seen previously in recombinant preparations and for the
2 subunit
expressed in neuronal membranes (Stephenson et al., 1990
;
Connolly et al., 1996
, 1999
; Tretter et al., 1997
). Both
(9E10)
1 and
(9E10)
1S coprecipitated with
(FLAG)
2L at similar levels (Fig.
3B). Importantly, the level of
(FLAG)
2L present in each sample was
comparable. This result suggests that
(9E10)
1 and
(9E10)
1S proteins are able to
oligomerize with (FLAG)
2L at similar
efficiencies (Fig. 3B).
Together, these observations suggest that amino acids 58-67 conserved
within all
subunit isoforms are important in controlling oligomerization with receptor
subunits but not the
2 subunit. Moreover this suggests that residues 58-67 are likely to constitute a
subunit specific assembly signal rather than affecting gross subunit
folding (Hammond and Helenius, 1995
).
Exchange of amino acids 58-68 within the
1 subunit by the
corresponding residues from
1 subunit prevents assembly with the
3 subunit
To further examine the role of amino acids 58-67 of the
1
subunit in mediating receptor assembly, a chimeric approach was taken.
These amino acids were exchanged for the corresponding region of the
GABAC receptor
1 subunit (Fig.
4A). The
1 subunit shares ~30% sequence identity with GABAA
receptor subunits (Cutting et al., 1991
; MacDonald and Olsen, 1994
;
Rabow et al., 1995
). However, despite the coexistence of the
1
subunit in retinal neurons with GABAA receptor
subunits (Cutting et al., 1991
; Enz et al., 1996
; Koulen et al., 1998
),
the
1 subunit does not appear to assemble with
GABAA receptor
or
subunits (Hackam et
al., 1996
, 1997
). Therefore, if amino acids 57-67 of
1 are
important in promoting specific association with receptor
subunits,
substitution of these residues with those from the
1 subunit may be
expected to disrupt the assembly of
/
receptors. To test this,
residues 57-69 from the
1 subunit were exchanged for the
corresponding residues in
1 (Fig. 4A). This
construct centered on methionine 57 and tryptophan 69, which are
conserved in all GABAA and
GABAC receptor subunits (Fig.
4A). The resulting
(9E10)
1/
1 construct was then
expressed with (FLAG)
3 in A293 cells,
and surface expression was measured using 9E10 and FLAG antibodies via
immunofluorescence. (FLAG)
3 could be
detected on the cell surface of unpermeabilized cells (Fig.
4B). In contrast, the
(9E10)
1/
1 construct was poorly
expressed on the cell surface with the
(FLAG)
3 subunit in unpermeabilized
cells. However, (9E10)
1/
1 could be
readily detected in permeabilized cells with a predominant perinuclear
localization, consistent with retention of this protein within the ER
(Fig. 4B). Furthermore, the
(9E10)
1/
1 construct was expressed at
similar levels to (9E10)
1, as
determined by Western blotting (data not shown).

View larger version (26K):
[in this window]
[in a new window]
|
Figure 4.
Production and expression of the 1/ 1 subunit
chimera. A, Sequence alignment of 1 and 1 subunits
between residues 57 and 69. B, Cell surface of
(9E10) 1/ 1 subunit chimeras as determined by
immunofluorescence. A293 cells transfected with the
(FLAG) 3 and (9E10) 1/ 1 subunits were
stained with either 9E10 or FLAG antibodies with (+) and without ( )
membrane permeabilization.
|
|
Together, these results further support a role for residues 58-68 in
promoting specific assembly of the
1 subunit with receptor
subunits.
Residue Q67 mediates cell surface expression of the
1 subunit
with
3
To further delineate the region of
1 subunit between residues
58 and 67 that are important for functional expression with
subunits, more refined (9E10)
1/
1
constructs were made. An alignment of residues 57-69 in
1 with the
same region of
1 reveals nine variant amino acids (Fig.
4A). The isoleucine residue at position 61 in
1
was not mutated, because
6 and
1 both contain methionine at
position 61 (Fig. 1). Four constructs were made in which pairs of
residues in
1 were substituted for those within
1. These
constructs
(9E10)
1(DF),
(9E10)
1(TL),
(9E10)
1(YL),
and
(9E10)
1(HY),
were then coexpressed with
3 in A293 cells, and surface expression was monitored by fluorescence using 9E10 antibody without
permeabilization. (9E10)
1(DF),
(9E10)
1(TL),
and
(9E10)
1(YL)
could all be detected robustly on the cell surface. In contrast, (9E10)
1(HY)
could not be detected in the majority of expressing cells, as defined
by very weak signals in nonpermeabilized cells (Fig.
5A). However, in some
experiments the occasional cell showed detectable cell surface levels
of
(9E10)
1(HY).
In contrast,
(9E10)
1(HY)
could be readily detected in permeabilized cells where it appeared to
be retained within the ER (Fig. 5A). All four
1 subunit
variants were expressed to similar levels according to Western blotting using 9E10 antibody (Fig. 5B). Quantification of blots using
a phosphoimager within the linear range failed to demonstrate
significant differences in expression between the
1 subunit mutants
in three separate experiments. Furthermore, none of these
(9E10)
1 subunit variants were able to
access the cell surface on homomeric expression (data not shown).

View larger version (21K):
[in this window]
[in a new window]
|
Figure 5.
Coexpression of 1 double and single point
mutants with the 3 subunit. A, The subcellular
localization of (9E10) 1(DF),
(9E10) 1(TL),
(9E10) 1(YL), and
(9E10) 1(HY) on coexpression with the
(FLAG) 3 subunit in A293 cells was determined by
immunofluorescence using the 9E10 antibody with or without membrane
permeabilization. B, The expression levels of
(9E10) 1, (9E10) 1(DF),
(9E10) 1(TL),
(9E10) 1(YL), and
(9E10) 1(HY) after coexpression with
the 3 subunit were determined by Western
blotting with 9E10 antibody. Lysates from untransfected
cells (con) were also included as a control. Migration
of molecular weight markers is indicated. C, Cell
surface expression levels of (9E10) 1
(n = 4), (9E10) 1/ 1
(n = 4),
(9E10) 1(DF) (n = 4), (9E10) 1(YL)
(n = 3),
(9E10) 1(TL) (n = 3), (9E10) 1(HY)
(n = 3),
(9E10) 1(H) (n = 3), and (9E10) 1(Y)
(n = 5) on coexpression with 3 were determined
in live cells by 125I 9E10 antibody binding. 9E10 binding
was also performed on untransfected cells (con). Cell
surface 9E10 levels were then compared to cells expressing
(9E10) 1 + 3, which was given a value of 100%.
Significance from wild-type (9E10) 1-expressing cells
(p > 0.05) was seen for
(9E10) 1/ 1,
(9E10) 1(HY),
(9E10) 1(H), and
(9E10) 1(Y).
|
|
To further examine the role of residues Q67 and S68, cell surface
levels of selected (9E10)
1 constructs
on expression with the
3 subunit were quantified using
125I 9E10 antibody binding. Cell surface
levels of 9E10 were then normalized to that for
(9E10)
1
3 receptors. Cell surface
expression of
(9E10)
1(HY)
was fourfold lower than that for
1
3 receptors (Fig.
5C; p > 0.05). However, cell surface levels
of
(9E10)
1(HY)
were still significantly higher than those observed for the
1/
1 chimera (Fig. 5C; p > 0.05). In contrast,
the
(9E10)
1(DF),
(9E10)
1(TL),
and
(9E10)
1(YL)
constructs showed similar levels of surface expression when coexpressed with the
3 subunit, as observed with
(9E10)
1 subunit. The effect of
individually mutating Q67 and S68 to the corresponding residues within
the
1 subunits H67 and Y68, respectively, was also analyzed. The
(9E10)
1(H)
and
(9E10)
1(Y)
constructs were expressed with
3, and cell surface 9E10 levels were
then compared to those for (9E10)
1.
Mutation of Q67 had a large effect on cell surface expression, because
surface levels of
(9E10)
1(H)
were reduced approximately fourfold compared to
(9E10)
1 (Fig. 5C;
p > 0.05). Interestingly, the values for surface expression of
(9E10)
1(H)
were not significantly different from those seen for
(9E10)
1(HY)
(Fig. 5C; p > 0.05). This results suggests
that Q67 is of more significance for assembly of the
1 subunit with
3 than S68. In agreement with this observation, mutation of S68
alone had a much smaller effect on cell surface expression of the
(9E10)
1 subunit.
Therefore, together our observations suggest a major role for residue
Q67 within the
1 subunit in mediating cell surface expression with
the
3 subunit.
Reduced oligomerization of
(9E10)
1(HY) with the
3 subunit
To further analyze the role of Q67 and S68 in promoting
GABAA receptor assembly, selected
(9E10)
1 constructs were coexpressed
with (FLAG)
3, expressing cells
were labeled with [35S]methionine,
chased for 4 hr, and lysed immediately or chased for 20 hr.
Detergent-soluble cell extracts were then fractionated on sucrose
density gradients. Receptor subunits were isolated from gradient
fractions by immunoprecipitation. Each gradient fraction was divided
into two samples that were separately immunoprecipitated with either
9E10 or FLAG antibodies against either
(9E10)
1 or
(FLAG)
3. Precipitated material was then
resolved by SDS-PAGE; the distinct migration of
9E10)
1 and
(FLAG)
3 (Fig. 3) allows
coimmunoprecipitation to be easily assessed. After a 4 hr labeling
period, (9E10)
1 (52 kDa) and
(FLAG)
3 (57 kDa) subunits could be seen
coimmunoprecipitating using either antibody in gradient fractions 7-10
(Fig. 6A). The levels of (9E10)
1 and
(FLAG)
3 proteins in each gradient
fraction precipitated using FLAG antibody were quantified using a
phosphoimager (Fig. 6A,B). Quantitation of the
gradients revealed that both proteins exhibited 9 S sedimentation coefficients, as previously described for functional
GABAA receptors composed of 
or 

subunits (Fig. 6A,B; Mamalaki et al., 1987
, 1989
;
Hadingham et al., 1992
; Gorrie et al., 1997
; Tretter et al., 1997
). In
contrast, unassembled
or
subunits have 5 S sedimentation
coefficients (Gorrie et al., 1997
; Tretter et al., 1997
). To assess the
stability of the 9 S
1
3 complexes, expressing cells were labeled
with [35S]methionine and chased for 20 hr before fractionation on sucrose density gradients. At 20 hr,
coimmunoprecipitation of (9E10)
1 and
(FLAG)
3 was still evident using either
antisera (Fig. 6A-C). Both subunits exhibited 9 S
sedimentation coefficients, as seen at 0 hr (Fig. 6B,C). Quantification of the levels of
(9E10)
1 and
(FLAG)
3 precipitating with FLAG
antibody (Fig. 6B,C) revealed that over this 20 hr
period ~50% of the (9E10)
1 and
(FLAG)
3 subunits were degraded (Fig.
7B). This suggests a half life of 20 hr for
1
3 receptors in good agreement with that reported for
1/
2 receptors (24 hr, Gorrie et al., 1997
). Similar
association and stability of the
1 and
3 subunits was seen in two
other experiments.

View larger version (40K):
[in this window]
[in a new window]
|
Figure 6.
Sucrose gradient analysis of
(9E10) 1(FLAG) 3 and
(9E10) 1(HY) (FLAG) 3 receptor
complexes. Lysates from [35S]methionine-labeled
A293 cells, cotransfected with (9E10) 1 and
(FLAG) 3 subunits (A) or
(9E10) 1(HY) and
(FLAG) 3 subunits (B) were
separated on 5-20% linear sucrose gradients and fractionated into 14 equal fractions. (9E10) 1 (A) or
(9E10) 1(HY) (D)
subunits were immunoprecipitated from half of each fraction using the
9E10 antibody, and the (FLAG) 3 subunit was precipitated
from the other half of each fraction using anti-FLAG. The precipitated
proteins were resolved on 8% polyacrylamide gels and detected using
autoradiography. For the 0 time point, cells were lysed immediately
after a 4 hr labeling period, and for the 20 hr time point, labeled
cells were incubated in normal medium for 20 hr before being lysed. The
migration of the (FLAG) 3 subunit (57-59 kDa) and the
(9E10) 1 and
(9E10) 1(HY) subunits (50 kDa) are
indicated. The vertical arrows represent the migration
of standard proteins: from left to right,
BSA (4.3 S), Aldolase (7.4 S), and Catalase (11.2 S), respectively. The
levels of (9E10) 1 and (FLAG) 3 subunits
precipitated with FLAG antibody were quantified from gradient fractions
after a 4 hr labeling period (B) or a 4 hr
labeling period followed by a 20 hr chase (C)
were determined using a Bio-Rad phosphoimager. Background was
subtracted using the same volume that was used to integrate the subunit
signals; , (FLAG) 3; , (9E10) 1. The
levels of 9E10) 1 and (FLAG) 3
precipitating with FLAG antibody were also analyzed after a 4 hr
labeling period (E), or a 4 hr labeling period
with a 20 hr Chase (F); ,
(FLAG) 3; ,
(9E10) 1(HY). Quantification of
subunit levels was as above. The arrows in
B, C, E, and
F represent the sedimentation of protein standards from
right to left; BSA (4.3 S), Aldolase (7.4 S), and Calalase (11.2 S), respectively.
|
|

View larger version (23K):
[in this window]
[in a new window]
|
Figure 7.
Functional properties of
(9E10) 1(HY) 3 GABAA
receptors. A, Bar graph illustrating the sensitivity to
1 mM GABA, 1 mM pentobarbitone
(PB), and 10 µM Zn2+ in
A293 cells transfected with
(9E10) 1(HY) 3 (left)
or (9E10) 1(HY) 3
(right) cDNAs. The ligand-activated currents have been
normalized to the response evoked by 1 mM GABA for each
receptor construct (1), and Zn2+ induces outward
currents in (9E10) 1(HY) 3
GABAA receptors. Note the split ordinate axis.
B, Whole-cell membrane currents recorded from a A293
cell expressing (9E10) 1(HY) 3 and
superfused with 1 mM GABA (gray bar),
1 mM PB (hatched bar), and 10 µM Zn2+ (black
bar).
|
|
The sedimentation of
(9E10)
1(HY)
on coexpression with (FLAG)
3 was also
assessed via immunoprecipitation with both 9E10 and FLAG antibodies (Fig. 6D). After a 4 hr labeling period,
precipitation with FLAG antibody revealed large amounts of the
(FLAG)
3 subunit present in gradient
fractions 8-14 (Fig. 6D). However, only small
amounts of
1(HY) could be detected
coprecipitating with (FLAG)
3, which is
in contrast to the results seen with
(9E10)
1 (Fig.
6A).
Quantification of the material precipitated with FLAG antibody (Fig.
6E) revealed only low levels of
(9E10)
1(HY)
coprecipitating with (FLAG)
3.
Furthermore,
(9E10)
1(HY)
was found uniformly distributed throughout the gradient and did not
exhibit a 9 S sedimentation coefficient, as seen for
(9E10)
1 (Fig. 6E).
This distribution may reflect nonspecific aggregation, or
(9E10)
1(HY)
may be interacting with chaperone molecules such as BiP and calnexin that participate in GABAA receptor assembly
(Connolly et al., 1996
). Interestingly,
(FLAG)
3 exhibited two distinct
sedimentation coefficients of 9 S and 11 S (Fig. 6E).
These peaks must predominately represent
(FLAG)
3 homomers that have 9 S
sedimentation coefficients (Taylor et al., 1999
), given the low levels
of the
(9E10)
1(HY)
subunit that coprecipitated with
(FLAG)
3. The 11 S peak may possibly
represent nonspecific aggregates of the
(FLAG)
3 subunit. After a 20 hr chase
period, very low levels of (FLAG)
3
could be detected via precipitation with FLAG antisera, and trace
levels of
(9E10)
1(HY)
could be detected associating with this protein on long exposures (Fig.
6D,E). (FLAG)
3
exhibited a predominant 9 S sedimentation coefficient after a 20 hr
chase period, however the 11 S species was still evident. In contrast,
no
(9E10)
1(HY)
protein was detectable in any gradient fractions using precipitation with 9E10 antibody after a 20 hr chase (Fig. 6F).
Identical behavior of the
(9E10)
1(HY)
and (FLAG)
3 subunits was seen in two
other separate experiments.
Together, these results demonstrate that Q67 and S68 within the
1
subunit are critical in mediating assembly with
3 to form 9S
complexes, representing functional cell surface receptors (Mamalaki et
al., 1987
, 1989
; Hadingham et al., 1992
; Gorrie et al., 1997
; Tretter
et al., 1997
).
(9E10)
1(HY)
subunits appear to oligomerize less efficiently with
(FLAG)
3 compared to
(9E10)
1 and are rapidly degraded as
previously described for unassembled wild-type
1 subunits (Gorrie et
al., 1997
).
Functional properties of
1(HY)/
3,
1(H)/
3, and
1(Y)/
3
receptors
Expression of
1(HY)
3 subunit
GABAA receptors in A293 cells resulted in a range
of sensitivities to GABA, pentobarbitone, and Zn2+ that were used to assess the
expression of 
heteromers or
3 homomers. Most expressing cells
(n = 17 of 20) exhibited limited sensitivity to GABA
(0.01-1000 µM). In comparison to GABA, the sensitivity to pentobarbitone was far higher with 1 mM pentobarbitone (maximally effective
concentration) producing almost 20- to 30-fold larger currents than a
maximal concentration of GABA (1 mM; Fig. 7).
Furthermore, the size of the pentobarbitone currents suggested that
receptor expression was not compromised by the
1(HY) mutation. Thus, the expressed
receptors also exhibited clear sensitivity to
Zn2+, resulting in outward currents in
accordance with some spontaneous gating of these receptors. The limited
sensitivity to GABA and clear effects of pentobarbitone and
Zn2+ all indicated the likely presence of
a small number of 
heteromers and a larger population of
3
homomers. The presence of large rebound currents after
application of pentobarbitone was also indicative of the presence of
3 homomeric receptors. In comparison,
1
3 wild-type
GABAA receptors exhibited larger currents to 1 mM GABA compared to 1 mM
pentobarbitone and virtually zero sensitivity to
Zn2+, as expected of a population of
predominantly 
heteromers (Fig. 7).
Analysis of the GABA concentration-response curve for the
1(HY)
3 subunit receptor revealed a
GABA EC50 of 5.1 ± 0.94 µM
and Hill coefficient of 0.8 ± 0.1 (n = 3; Fig.
8). These values are in accordance with a
typical
1
3 receptor profile (Yemer et al., 1989
) and suggest that
the mutation HY does not interfere per se with the ability of GABA to
bind to the receptor and activate the ion channel. It therefore appears
likely that the reduced responsiveness to GABA is a result of limited
numbers of functional cell surface 
heteromers. This is
consistent with the reduced surface levels of the
1(HY) construct on coexpression with
the
3 subunit compared to
1
3 receptors (Fig. 5). Furthermore,
the presence of
3 homomers on expression with
1(HY) is in agreement with the low
levels of oligomerization seen for
3 and
1(HY) subunits, as revealed by sucrose
density gradient centrifugation (Fig. 6).

View larger version (15K):
[in this window]
[in a new window]
|
Figure 8.
Functional properties of
1(H) and 1(Y) mutant
GABAA receptors. Equilibrium concentration-response curves
for GABA constructed for
(9E10) 1(HY) 3 ( ),
(9E10) 1(H) 3 ( ), and
(9E10) 1(Y) 3 ( |
|