 |
Previous Article | Next Article 
The Journal of Neuroscience, February 15, 2000, 20(4):1386-1392
Caspase-2 Mediates Neuronal Cell Death Induced by -Amyloid
Carol M.
Troy,
Sylvia A.
Rabacchi,
Wilma J.
Friedman,
Thierry F.
Frappier,
Kristy
Brown, and
Michael L.
Shelanski
Department of Pathology, Taub Institute for the Study of
Alzheimer's Disease and the Aging Brain and the Center for
Neurobiology and Behavior, Columbia University College of Physicians
and Surgeons, New York, New York 10032
 |
ABSTRACT |
-amyloid (A ) has been proposed to play a role in the
pathogenesis of Alzheimer's disease (AD). Deposits of insoluble A are found in the brains of patients with AD and are one of the pathological hallmarks of the disease. It has been proposed that A
induces death by oxidative stress, possibly through the generation of
peroxynitrite from superoxide and nitric oxide. In our current study,
treatment with nitric oxide generators protected against A -induced
death, whereas inhibition of nitric oxide synthase afforded no
protection, suggesting that formation of peroxynitrite is not critical
for A -mediated death. Previous studies have shown that aggregated
A can induce caspase-dependent apoptosis in cultured neurons. In all
of the neuronal populations studied here (hippocampal neurons,
sympathetic neurons, and PC12 cells), cell death was blocked by the
broad spectrum caspase inhibitor
N-benzyloxycarbonyl-val-ala-asp-fluoromethyl ketone and more specifically by the downregulation of caspase-2 with antisense oligonucleotides. In contrast, downregulation of caspase-1 or caspase-3 did not block A 1-42-induced
death. Neurons from caspase-2 null mice were totally resistant to
A 1-42 toxicity, confirming the importance of this
caspase in A -induced death. The results indicate that caspase-2 is
necessary for A 1-42-induced apoptosis in
vitro.
Key words:
-amyloid; neuronal cell death; caspases; caspase-2; hippocampal neurons; PC12 cells; sympathetic neurons
 |
INTRODUCTION |
The histopathological hallmarks of
Alzheimer's disease (AD) include the formation of neuritic plaques and
neurofibrillary tangles, and the loss of synapses (Masters et al.,
1985 ; Selkoe, 1990 , 1997 ). Although the temporal order in which these
events occur and their relationship to one another is not clear, a
large body of evidence points to a toxic effect of -amyloid (A ),
the major protein component of the senile plaque, on neurons (Yankner, 1996 ; Selkoe, 1997 ). In cell culture studies, a variety of effects of
-amyloid have been reported. These include induction of apoptotic neuronal death (Ii et al., 1996 ; Estus et al., 1997 ), as well as a
partial apoptotic program resulting in neuritic changes (Ferreira et
al., 1997 ; Mattson et al., 1998 ). A 1-42 has
been proposed to cause death by regulation of components of the
apoptotic pathway (Estus et al., 1997 ), to induce oxidative stress
(Pike et al., 1997 ), and to cause death by free radical-mediated
pathways (Keller et al., 1998 ; Guo et al., 1999 ). None of these studies
has identified obligate mechanisms for A -induced apoptosis. Because
synaptic loss, neuritic changes, and cell loss are all features of
Alzheimer's disease, activation of the apoptotic cascade, especially
the activation of caspases, could explain many of the features of the
disease and its progression. Knowledge of which of the 14 known
mammalian caspases (for review, see Ahmad et al., 1998 ; Hu et al.,
1998 ; Humke et al., 1998 ; Thornberry and Lazebnik, 1998 ) are activated in response to A and which among these lead to neuritic alterations and apoptotic death will define specific pathways of cellular damage
and suggest potential targets for therapeutic intervention. The work
reported here examines which of the caspases is required for A to
induce apoptosis.
 |
MATERIALS AND METHODS |
Cell culture
PC12 cells. PC12 cells were grown as described
previously (Greene and Tischler, 1976 ; Troy et al., 1997 ) on rat tail
collagen-coated dishes in RPMI 1640 medium (Life Technologies,
Gaithersburg, MD) containing 5% fetal calf serum and 10%
heat-inactivated horse serum (complete medium). NGF-primed (neuronally
differentiated) PC12 cells were grown for at least 7 d in RPMI
1640 medium plus 1% horse serum and NGF (100 ng/ml). For cell survival
assays, cells (either naive or NGF-pretreated) were extensively washed in RPMI 1640 medium containing 1% fetal calf serum and replated on
fresh collagen-coated 24-well dishes in RPMI 1640 medium 1% FCS, with
NGF for primed cells. Various concentrations of
A 1-42 were included in the medium as
indicated. Numbers of viable cells per culture were determined by
quantifying intact nuclei as described previously (Troy et al., 1997 ).
Counts were performed on triplicate cultures and reported as mean ± SEM.
Sympathetic neurons. Sympathetic neuron cultures were
prepared from 2-d-old rat pups as described previously (Troy et al., 1997 ) or from 2-d-old caspase-2 / and wild-type mouse pups
(Bergeron et al., 1998 ) (generous gifts from L. Bergeron and J. Yuan,
Harvard University, Boston, MA). Cultures were grown in 24-well
collagen-coated dishes in RPMI 1640 medium plus 10% horse serum with
mouse NGF (100 ng/ml). One day after plating, uridine and
5-fluorodeoxyuridine (10 µM each) were added to
the cultures and left for 3 d to eliminate non-neuronal cells
(<1% non-neuronal cells remain after 3 d). On the sixth day
after plating, A 1-42 was added. Each culture was scored as described previously (Troy et al., 1997 ), as numbers of
living, phase-bright neurons counted in the same field at various times. Three replicate cultures were assessed for each condition, and
data are normalized to numbers of neurons present in each culture at
the time of A 1-42 addition and reported as
mean ± SEM.
Hippocampal neurons. Primary cultures of dissociated
hippocampal neurons were prepared from embryonic day 18 (E18) rats
(Farinelli et al., 1998 ). E18 hippocampi were dissected, dissociated,
and maintained in a serum-free environment. Medium consists of a 1:1 mixture of Eagle's MEM and Ham's F12 supplemented with glucose (6 mg/ml), putrescine (60 µM), progesterone (20 nM), transferrin (100 µg/ml), selenium (30 nM), penicillin (0.5 U/ml), and streptomycin (0.5 µg/ml). Dissociates grown in this medium contain <2% glial cells
after 1 week. Cells were treated with A 1-42
after 3-5 d in culture. Survival was quantified as described above for PC12 cells.
Preparation of amyloid
Lyophilized, HPLC-purified
-amyloid1-42 was purchased from D. Teplow
(Harvard University), and reverse A 42-1 was
from Bachem (Torrance, CA). Peptides were reconstituted in sterile
water at a concentration of 400 µM. Aliquots of stocks were incubated at 37°C for 3 d to form aggregated amyloid.
Bioassay of NGF
Aliquots of RPMI with NGF (100 ng/ml) with and without
A 1-42 (10 µM) were incubated at
37°C for 30 min and then spun down. The supernatant was added to PC12
cells deprived of trophic factors as described previously (Greene et
al., 1998 ). Cells were grown for 1 d, and survival was quantified
as described above.
Superoxide dismutase-specific activity
Cells were extracted with 0.5% NP-40, and protein was measured
by the Bradford method (Troy and Shelanski, 1994 ). Total and manganese-superoxide dismutase (Mn-SOD) levels were determined with a
modification of the xanthine-xanthine oxidase system, measuring the
reduction of nitroblue tetrazolium (NBT) at 560 nm in the absence and
presence of potassium cyanide (KCN) (Troy and Shelanski, 1994 ).
Briefly, cell extracts or SOD (Sigma, St. Louis, MO) were incubated in
50 mM sodium carbonate buffer at pH 10.2 containing 0.1 mM EDTA, 1 × 10 4
M xanthine, 1 mM KCN, 2.5 × 10 5 M NBT, and 2.2 × 10 9 M xanthine oxidase in a
volume of 1 ml. Reduction of NBT was measured at 560 nm. Total SOD
activity was determined from an SOD standard curve in the absence of
KCN. Copper/zinc-SOD is inhibited by KCN. Thus, only Mn-SOD activity
remains in the presence of KCN; Mn-SOD activity is reported as the
KCN-insensitive activity.
Caspase activity assay
Preparation of cell lysates. At 6 hr after
A 1-42 treatment, cells were harvested for
assays of aspartase activity or Western blotting. Cells were rinsed in
cold PBS and then collected in a buffer of 25 mM
HEPES, pH 7.5, 5 mM EDTA, 1 mM EGTA, 5 mM MgCl2, 5 mM DTT, 10 µg/ml each of pepstatin and
leupeptin, and 1 mM PMSF. The cellular material
was left for 20 min on ice and then sonicated on ice. The lysate
was centrifuged for 20 min at 160,000 × g, and the
supernatant was frozen with liquid nitrogen and stored at 80°C
(Stefanis et al., 1996 ).
Cleavage of fluorogenic substrates. Lysates (25 µg
of protein) were incubated at 37°C in a buffer of 25 mM HEPES, pH 7.5, 10% sucrose, 0.1%
3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate, and 10 mM DTT with the fluorogenic substrates
N-acetyl-Asp-Glu-Val-Asp-7-amino-4-trifluoromethylcoumarin (DEVD-AFC) (15 µM) or
benzyloxycarbonyl-Tyr-Val-Ala-Asp-7-amino-4-trifluoromethylcoumarin (YVAD-AFC) (25 µM) (Enzyme Systems Products, Dublin, CA).
Cleavage of the substrates emitted a fluorescent signal that was
measured in a Perkin-Elmer (Emeryville, CA) LS-50B fluorometer
(excitation of 400 nm, emission of 505 nm).
Synthesis of antisense oligonucleotides
Oligonucleotides bearing an SH group at their 5' end and an NH
group at their 3' end were purchased from Operon (Alameda, CA). As
described previously (Troy et al., 1996a ), oligonucleotides were
resuspended in deionized water, an equimolar ratio of Penetratin 1 (Oncor Inc., Gaithersburg, MD) was added, and the mixture was incubated
at 37°C for 1 hr. The yield of the reaction, estimated by SDS-PAGE
followed by Coomassie blue staining, was routinely above 50%. As a
control, a scrambled sequence of the antisense oligonucleotide (same
base composition, different order) was used. Antisense sequences used
were as follows: ACasp1, CCTCAGGACCTTGTCGGCCAT; ACasp2,
GCTCGGCGCCGCCATTTCCCAG; and ACasp3, GTTGTTGTCCA TGGTCACTTT.
Western blotting
Neuronal cells were harvested in lysis buffer as described above
or in SDS-containing sample buffer and immediately boiled. Equal
amounts of protein were separated by 15% PAGE, transferred to
nitrocellulose, and immunostained as described previously (Stefanis et
al., 1997 ). Anti-caspase-1 (Transduction Laboratories, Lexington, KY)
was used at a dilution of 1:500. Anti-caspase-2 (Troy et al., 1997 ) was
used at a dilution of 1:250. Anti-caspase-3 was a generous gift from
J. L. Goldstein (University of Texas Southwestern Medical Center,
Dallas, TX) (Wang et al., 1996 ) and was used at a dilution of
1:1000. Visualization was with ECL using goat-anti-rabbit peroxidase at
1:1000. The relative intensity of the protein bands was quantified using Scion NIH Image 1.55 software.
 |
RESULTS |
-Amyloid-induced neuronal cell death is not mediated
by peroxynitrite
We studied A -induced death in three different neuronal cell
types: PC12 cells, the most widely used neuronal cell line; sympathetic neurons, the neuron for which PC12 cells are a model; and hippocampal neurons, because the hippocampus is affected extensively in AD. Previous studies reporting neurotoxicity of A have used a wide range
of concentrations of different forms of A (25-35, 1-40, and 1-42)
in a variety of cell types, including cortical neurons, hippocampal
neurons, and cultured cell lines (Pike et al., 1991a ,b ; Ii et al.,
1996 ; Estus et al., 1997 ; Jordan et al., 1997 ; Kruman et al., 1997 ). We
have performed dose-response studies with aggregated A 1-42 in PC12 cells, sympathetic neurons, and
hippocampal neurons (Fig.
1A) to determine
whether these three neuronal cell types respond in a similar manner. At
a concentration of 10 µM, there was equivalent
survival (~50%) of all three neuronal cell types after 1 d of
exposure (Fig. 1A). No death was seen in PC12 cell
cultures treated with the same concentrations of
A 42-1, the inactive reverse sequence of A
(data not shown), supporting a specific effect of
A 1-42. All subsequent experiments were done
with 10 µM A 1-42.

View larger version (18K):
[in this window]
[in a new window]
|
Figure 1.
Nitric oxide protects against -amyloid-induced
death in neuronal cells. A, A 1-42
induces dose-dependent death in three different neuronal cell types.
E18 hippocampal neurons were grown in culture for 3 d and then
exposed to increasing concentrations of A 1-42. Survival
was assessed after 1 d by counting nuclei in cell lysates
(n = 3). Survival is reported relative to untreated
cultures and is given as mean ± SEM. Sympathetic neurons were
grown in culture for 5 d and then exposed to increasing
concentrations of A 1-42. Survival was assessed after
1 d by counting cells in the living cultures. Survival is reported
relative to that in the same cultures before A 1-42
treatment and is given as mean ± SEM (n = 3).
PC12 cells were exposed to increasing concentrations of
A 1-42. Survival was assessed after 1 d by counting
nuclei in cell lysates (n = 3). Survival is
reported relative to untreated cultures and is given as mean ± SEM. These are representative experiments. Comparable results were
obtained in six additional independent experiments with hippocampal
neurons, in three additional experiments with sympathetic neurons, and
in five additional experiments with PC12 cells. B,
Mn-SOD is not induced by A 1-42 treatment. PC12 cells
were treated with or without A 1-42 (10 µM) for 6 hr (n = 3). Cells were
extracted with 0.5% NP-40, and protein
was measured by the Bradford method. Total SOD and
Mn-SOD levels were determined by the xanthine-xanthine oxidase system,
with measurement of the reduction of nitroblue tetrazolium at 560 nm in
the presence and absence of KCN. Mn-SOD activity was determined from an
SOD standard curve and is reported as the KCN-insensitive activity ± SEM. C, Increasing NO protects from
A 1-42-induced neuronal cell death. PC12 cells and
sympathetic neurons were exposed to A 1-42 (10 µM) in the presence or absence of SNAP (100 µM) or L-NAME (10 µM).
Survival was assessed after 1 d as described above
(n = 3). This is a representative experiment;
comparable results were obtained in three additional independent
experiments. Survival is reported relative to untreated cultures and is
given as mean ± SEM. Similar results were obtained with cultured
sympathetic neurons.
|
|
It has been proposed that A toxicity is caused by the
induction of oxidative stress (Ii et al., 1996 ; Kruman et al., 1997 ; Pike et al., 1997 ; Keller et al., 1998 ; Guo et al., 1999 ).
Specifically, A -treated PC12 cells have been shown to produce
peroxynitrite (ONOO ), a toxic product of
the superoxide anion
(O2 ), and nitric oxide
(NO), and to be protected from A toxicity by the overexpression of
Mn-SOD the inducible, manganese-dependent form of superoxide dismutase
normally expressed in the mitochondria (Keller et al., 1998 ). Mn-SOD
has been shown to be increased in response to an increase in
O2 (Troy and Shelanski,
1994 ). Thus, changes in the specific activity of Mn-SOD may afford an
indication of O2 levels
in the cells. Treatment with A 1-42 for 6 hr
had no effect on total SOD or Mn-SOD activities in our cultures (Fig. 1B). The other component of
ONOO , NO, has been shown to be both
neurotoxic and neuroprotective depending on the type of insult to which
the cell has been exposed. If peroxynitrite is a component of the A
death pathway, then inhibition of NO production should be protective.
We have examined the role of NO in
A 1-42-treated PC12 cells and sympathetic neurons by inhibiting the generation of endogenous NO with
N-nitro-L-arginine methyl ester
(L-NAME) (10 µM), a
general inhibitor of nitric oxide synthase, and by treating the cells
with the NO generator S-nitroso penicillamine (SNAP)
(100 µM) (Fig. 1C). The
concentrations of L-NAME and SNAP were selected
based on previous work by us and by our colleagues using PC12 cells and
sympathetic neurons (Farinelli et al., 1996 ; Troy et al., 1996a ).
Inhibition of endogenous NO generation by L-NAME
did not protect PC12 cells or sympathetic neurons in the presence of
A 1-42. Conversely, concurrent treatment with
the exogenous NO generator SNAP led to complete protection in these
neurons. SNAP alone was toxic to hippocampal neurons. This protective
effect of NO is also seen in PC12 cells and sympathetic neurons
deprived of NGF (Farinelli et al., 1996 ), a death paradigm that has
been shown to require cell cycle elements.
The similarity between the protection profiles in
A 1-42 exposure and trophic factor deprivation
led us to examine whether agents that block cell cycle progression also
protect from A 1-42. Hippocampal neurons and
PC12 cells were treated with A 1-42 in the
presence or absence of the cell cycle inhibitor flavopiridol. Flavopiridol is a flavonoid derivative that inhibits cyclin-dependent kinase 1 (cdk1), cdk2, and cdk4 activities (Losiewicz et al., 1994 ; De Azevedo et al., 1996 ) and is reported to block progression from G1 to S and G2 to M phases of the cell cycle (Kaur et al., 1992 ;
Vesely et al., 1994 ). Flavopiridol provided protection against A 1-42 for both hippocampal neurons and PC12
cells (Fig. 2A). This
is in accord with the recent data that elements of the cell cycle are
required for 30 µM
A 1-40 to induce death in cortical neurons
(Giovanni et al., 1999 ).

View larger version (28K):
[in this window]
[in a new window]
|
Figure 2.
A, The cell cycle inhibitor
flavopiridol protects hippocampal neurons and neuronal PC12 cells from
A 1-42 toxicity. Hippocampal cultures and neuronal PC12
cells were treated with A 1-42 in the presence or
absence of flavopiridol (1 µM) (n = 3). Survival was assessed after 1 d as described in Figure 1, is
reported relative to untreated cultures, and is given as mean ± SEM. This is a representative experiment; comparable results were
obtained in six additional independent experiments for hippocampal
cultures and three additional experiments for PC12 cells.
B, A 1-42 does not inhibit NGF activity.
RPMI with NGF was incubated with or without A 1-42 (10 µM) for 30 min at 37°C, and A 1-42 was
removed by centrifugation. The various media were added to PC12 cells,
which had been subjected to trophic factor deprivation. Survival was
quantified at 1 d and is given as mean ± SEM
(n = 3).
|
|
The above lines of evidence support a similar mechanism of death for
A and trophic factor deprivation. Because
A 1-42 induces cell death in primed PC12 cells
and sympathetic neurons in the presence of NGF, we considered the
possibility that A might bind to NGF in the media and effectively
inactivate it, resulting in trophic factor withdrawal. Using an
established bioassay for NGF (Greene et al., 1998 ), we determined that
the neurotrophic activity of NGF was not diminished by preincubation
with A 1-42 in the media (Fig.
2B).
A 1-42-induced cell death requires caspase-2
Death induced by A is inhibited by the broad spectrum caspase
inhibitor N-benzyloxycarbonyl-val-ala-asp-fluoromethyl
ketone (zVAD-FMK), demonstrating that caspase activity is
essential for A -induced apoptosis (Jordan et al., 1997 ; Guo et al.,
1999 ). Treatment of hippocampal neurons or PC12 cells with
A 1-42 induced caspase activity within 6 hr,
as detected by cleavage of DEVD-AFC (Fig.
3A), a substrate for caspases
related to caspase-3. This peptide is not cleaved by caspase-2 and
minimally cleaved by caspase-1 family members (Talanian et al., 1997 ;
Thornberry et al., 1997 ). The DEVD-AFC cleavage activity was completely
prevented by simultaneous treatment of the cultures with A and 10 µM DEVD-FMK, the pseudosubstrate inhibitor
(Fig. 3A). There was no cleavage of YVAD-AFC, a substrate
for caspase-1 family members, by the same cell lysates (data not
shown). No specific substrate is available for caspase-2. Differential
use of caspase inhibitors can provide some information about caspase
requirements for a particular mode of death. In the studies reported
here, we have used several different competitive irreversible
pseudosubstrate caspase inhibitors: YVAD-FMK, which inhibits caspase-1,
-4, and -5; and DEVD-FMK, which is moderately specific for members of
the caspase-3 family [including caspase-3 and -7 (Talanian et al.,
1997 ; Thornberry et al., 1997 )] when used at low concentrations (10 µM) and the broad spectrum inhibitor zVAD-FMK.
Surprisingly, DEVD-FMK provided no protection against A -induced
neuronal cell death (Fig. 3B), despite the complete prevention of the DEVD cleaving activity by this concentration of the
inhibitor (Fig. 3A). No rescue from A -induced death was seen with YVAD-FMK (100 µM) (Fig.
3B) in any of the three neuronal types. Thus, it is unlikely
that caspase-1, -3, or -7 are required for the A apoptotic pathway
(caspase-4 and -5 have not been found in rodent cells; J. Angelastro,
personal communication). On the other hand, zVAD-FMK gave complete
protection (Fig. 3B), confirming that A induces a
caspase-mediated death.

View larger version (24K):
[in this window]
[in a new window]
|
Figure 3.
A, A 1-42 induces
caspase activity in hippocampal neurons and PC12 cells. Hippocampal
neurons and neuronal PC12 cells were treated with A 1-42
(10 µM) with or without DEVD-FMK (10 µM)
for 6 hr. Cells were lysed, and 25 µg of protein of each treatment
was incubated with the fluorogenic substrate DEVD-AFC (15 µM). The release of AFC was quantified in an LS50B
fluorometer. This is a representative experiment; comparable results
were obtained in three additional independent experiments.
B, Differential protection by caspase inhibitors from
A 1-42-induced death. Cultures of hippocampal neurons,
PC12 cells, and sympathetic neurons were exposed to
A 1-42 (10 µM) in the presence or absence
of the indicated inhibitors (n = 3): YVAD-FMK at
100 µM, DEVD-FMK at 10 µM, and zVAD-FMK at
50 µM. Cells were counted after 1 d as described in
Figure 1. Survival is reported relative to untreated cultures and is
given as mean ± SEM.
|
|
Because the inhibitors can only provide circumstantial evidence about
specific caspase activation during death, we used Western blotting with
antibodies specific for caspase-1, -2, and -3 to determine whether any
of these caspases was activated by A 1-42 treatment. All three of the caspases were detected in untreated hippocampal neurons (Fig. 4), as well as
in PC12 cells and sympathetic neurons (Troy et al., 1997 ) (data not
shown). Hippocampal neurons were treated with
A 1-42 for 2, 6, and 18 hr, and cell lysates were analyzed by Western blotting. The antiserum to caspase-2 detects
the proform and a p37 peptide, which is an intermediate cleavage
product in the formation of the p20 active peptide (Stefanis et al.,
1997 , 1998 ). The p37 peptide was detected after 6 hr treatment, a time
at which there was a concomitant decrease in the proform caspase-2p51
(Fig. 4A). Caspase-3 also showed an increase in
appearance of the p18 active peptide (Fig. 4B),
consistent with the changes in DEVD-AFC cleaving activity described
above (Fig. 3A). However, the proform of caspase-3,
caspase-3p32, also increased over the time course (Fig.
4B). There was no activation of caspase-1 apparent at
6 hr (Fig. 4C), concurring with the lack of YVAD-AFC
cleaving activity in the lysates prepared at this same time.

View larger version (32K):
[in this window]
[in a new window]
|
Figure 4.
Caspase-2 and caspase-3 are activated in
hippocampal neurons after A 1-42 treatment. Hippocampal
cultures were incubated with or without A 1-42 for the
indicated times. Cell lysates (equal amounts of protein, determined by
the Bradford method) were subjected to Western blotting using the
indicated antisera. Ponceau staining confirmed equal loading. These are
representative blots; comparable results were obtained in three
independent experiments. A, Caspase-2. B,
Caspase-3. C, Caspase-1.
|
|
To assess the role of each of these caspases in mediating
A 1-42-induced death Penetratin1-conjugated
antisense oligonucleotides were used to downregulate caspase-1,
caspase-2, and caspase-3 independently. Each oligonucleotide
specifically downregulates the respective caspase by at least 70% in
PC12 cells after 6 hr treatment (Fig.
5A). There is no cross
regulation of the other caspases; that is, V-ACasp2 does not affect
caspase-1 or caspase-3 levels, etc. (Troy et al., 1997 ) (data not
shown). Scrambled oligonucleotides (same base composition) had no
effect on protein levels (Troy et al., 1997 ) (data not shown). When the
three antisense oligonucleotides were tested, only the antisense
caspase-2 (V-ACasp2) (Fig. 5B) protected from
A 1-42 damage; cells were treated
simultaneously with the antisense oligonucleotides and
A 1-42. The requirement for caspase-2 in
A -induced death was confirmed using cultured sympathetic neurons
from caspase-2 null mice (Fig. 6).
Sympathetic neurons from postnatal day 1 wild-type and caspase-2
null mice (Bergeron et al., 1998 ) were grown in culture for 5 d
and then treated with A 1-42 (10 µM), and survival was quantified daily. Neurons
from wild-type mice had 55% survival after 1 d and only 25%
survival after 4 d treatment. Neurons from caspase-2 null mice
were completely resistant to A 1-42 treatment, even after 4 d of exposure (Fig. 6). The sympathetic neurons from caspase-2 null mice were also resistant to 30 µM A 1-42, a
concentration that gave 20% survival of wild-type neurons after 1 d of treatment, and no survival after 4 d treatment (data not shown).

View larger version (26K):
[in this window]
[in a new window]
|
Figure 5.
Caspase-2 is necessary for
A 1-42-induced neuronal cell death. A,
Specific downregulation of caspase-1, -2, or -3. PC12 cells were
treated with the indicated antisense oligonucleotides (240 nM) for 6 hr. Cells lysates were subjected to Western
blotting using the appropriate antisera, i.e., anti-caspase-1 for
V-ACasp1-treated cells. B, Only downregulation of
caspase-2 protects against A 1-42-induced neuronal cell
death. Cultures of hippocampal neurons, PC12 cells, and sympathetic
neurons were treated with 10 µM A 1-42 in
the presence or absence of the indicated antisense oligonucleotides,
each at a concentration of 240 nM (n = 3). Survival was quantified after 1 d, is reported relative to
untreated cultures, and is given as mean ± SEM. This is a
representative experiment; comparable results were obtained in three
additional independent experiments with hippocampal cultures, as well
as three additional experiments each with PC12 cells and sympathetic
neurons.
|
|

View larger version (16K):
[in this window]
[in a new window]
|
Figure 6.
Sympathetic neurons from caspase-2 null mice are
resistant to A 1-42 toxicity. Sympathetic neuron
cultures from 1-d-old wild-type or caspase-2 null pups were treated
with A 1-42 (n = 3). Survival was
quantified daily, as described in Figure 1. Survival is reported
relative to that in the same cultures before A 1-42
treatment and is given as mean ± SEM (n = 3).
This is a representative experiment; comparable results were obtained
in four additional independent experiments.
|
|
 |
DISCUSSION |
The role of A in the pathogenesis and progression of
Alzheimer's disease has not yet been fully determined. It is clear
that deposits of insoluble A are found in plaques in the brains,
particularly the hippocampus, of patients with AD and that insoluble
A can induce apoptotic neuronal cell death in vitro
(Selkoe, 1990 ; Pike et al., 1991b ). If indeed A plays an important
role in AD, knowledge of the mechanisms used by A to induce neuronal
cell death will identify potential molecular targets for development of
therapies for AD. Study of model systems of A -induced neuronal cell
death allows the delineation of the molecular pathways traversed by A to induce neuronal cell death. A variety of laboratories have presented work showing A induction of apoptosis in multiple cell types in culture (Pike et al., 1991a ; Li et al., 1996 ; Estus et al.,
1997 ; Jordan et al., 1997 ; Pike et al., 1997 ; Mattson et al., 1998 ),
and apoptosis is seen in human AD brains as well (Cotman et al., 1994 ;
Cotman and Su, 1996 ). Recent work from our laboratory has shown that
differing insults to neurons result in activation of apoptotic
pathways, which use different caspases (Troy et al., 1996b , 1997 ) (Fig.
7). The studies presented here show that
A 1-42 mediated death in three different
neuronal cell types requires the presence of caspase-2 and is
accompanied by caspase-2 activation. Although caspase-3 activation
occurs, it does not mediate cell death in this paradigm. The activation
of caspase-3 may be occurring in parallel with that of caspase-2, or
caspase-2 may be activating caspase-3. However, it is clear that the
activated caspase-3 is not executing death in our model. Caspases have
been classified in several ways, based on both structure and function.
Caspase-2 has been classified as either an effector, together with
caspase-3 and caspase-7 (Thornberry et al., 1997 ), or as an initiator
(Thornberry and Lazebnik, 1998 ). Our data would support a role for
caspase-2 as an initiator, which then activates other effector caspases or autoactivates so that caspase-2 can act as both initiator and effector to lead to death (Fig. 7).

View larger version (20K):
[in this window]
[in a new window]
|
Figure 7.
Caspase specificities in different paradigms of
cell death. Schematic illustration of the pathways to cell death for
-amyloid, trophic factor deprivation, and free radical-mediated
oxidative stress.
|
|
AD hippocampus has been shown to have both an increase in caspase-3
immunoreactivity (Masliah et al., 1998 ; Gervais et al., 1999 ), as well
as appearance of activated caspase-3 reactivity (Chan et al., 1999 ).
The work of Gervais (1999) showed that caspase-3 can cleave the
amyloid precursor protein and cause an increase in secretion of A ,
measured as picomolar quantities in cell media; cell death was
not measured in that study. In our system, exogenous aggregated
A 1-42 is added at a concentration of 10 µM, many fold higher than that produced by caspase-3
activation. Additionally, the A produced by caspase-3 would most
likely be in the less toxic soluble form over the time course of our
experiments. Thus, blockade of caspase-3 activity would be expected to
have little effect on cell survival in our model. In more chronic
paradigms, caspase-3 may play a larger role in potentiating death by
enhancing production of A . Additionally, caspase-3 activation could
play a role in proteolytic remodeling of the cytoskeleton and neuritic breakdown seen in these cells.
We found little evidence in our studies that free radicals play a key
role in A 1-42-induced apoptosis in culture.
The lack of protection by the nitric oxide synthase inhibitor
L-NAME and the protection from death by SNAP argue against
peroxynitrite mediation of apoptosis. The protection by SNAP supports
the possibility that there is inhibition of caspase activity by
nitrosylation, as has been seen in other models of cell death (Mannick
et al., 1999 ). These findings do not preclude a contributory role for oxidative damage in Alzheimer's disease but argue against their role
in these acute apoptotic models.
The protection by SNAP, the NO generator, from
A 1-42 toxicity and the requirement for
caspase-2 activity in this death pathway are elements shared with the
death pathway for trophic factor deprivation, a pathway that also uses
elements of the cell cycle. We have found that both hippocampal neurons
and neuronal PC12 cells were protected by flavopiridol, a cell cycle
inhibitor. This extends the recently published work showing protection
of cortical neurons from A 1-40 death by
inhibition of the cell cycle (Giovanni et al., 1999 ).
The caspase specificities for different cell death paradigms are
presented schematically in Figure 7. By studying three paradigms in
different neuronal cells, we can conclude that caspase specificity is
determined by the death stimulus as opposed to the neuronal cell type.
Although there are similarities between death induced by
A 1-42 and by trophic factor deprivation,
including protection by nitric oxide and by the cell cycle inhibitor
flavopiridol and use of caspase-2 as a mediator of cell death, there
are also differences. Most notable is the lack of protection against
A -induced death by NGF in PC12 cells and sympathetic neurons, as
well as the susceptibility of sympathetic neurons from caspase-2 null
mice to trophic factor deprivation (Bergeron et al., 1998 ).
Therefore, the death pathways for these two stimuli are not identical.
Our data using caspase inhibitors, specific antisense
oligonucleotides, and caspase-2 null mice implicate caspase-2 as a
mediator of A 1-42-induced death. AD is both a
devastating disease and an increasing health problem. The development
of specific therapies that target caspase-2 may allow more effective
treatment for AD.
 |
FOOTNOTES |
Received Oct. 11, 1999; revised Nov. 30, 1999; accepted Dec. 7, 1999.
This work was supported by grants from the National Institutes of
Health (C.M.T., W.J.F., M.L.S.) and the Muscular Dystrophy Association
(C.M.T.). We thank Christine Le for technical assistance.
Correspondence should be addressed to Carol M. Troy, College of
Physicians and Surgeons of Columbia University, Department of
Pathology, 630 West 168th Street, New York, NY 10032. E-mail: cmt2{at}columbia.edu.
 |
REFERENCES |
-
Ahmad M,
Srinivasula SM,
Hegde R,
Mukattash R,
Fernandes-Alnemri T,
Alnemri ES
(1998)
Identification and characterization of murine caspase-14, a new member of the caspase family.
Cancer Res
58:5201-5205[Abstract/Free Full Text].
-
Bergeron L,
Perez GI,
Macdonald G,
Shi L,
Sun Y,
Jurisicova A,
Varmuza S,
Latham KE,
Flaws JA,
Salter JC,
Hara H,
Moskowitz MA,
Li E,
Greenberg A,
Tilly JL,
Yuan J
(1998)
Defects in regulation of apoptosis in caspase-2-deficient mice.
Genes Dev
12:1304-1314[Abstract/Free Full Text].
-
Chan SL,
Griffin WS,
Mattson MP
(1999)
Evidence for caspase-mediated cleavage of AMPA receptor subunits in neuronal apoptosis and Alzheimer's disease.
J Neurosci Res
57:315-323[Web of Science][Medline].
-
Cotman CW,
Su JH
(1996)
Mechanisms of neuronal death in Alzheimer's disease.
Brain Pathol
6:493-506[Web of Science][Medline].
-
Cotman CW,
Whittemore ER,
Watt JA,
Anderson AJ,
Loo DT
(1994)
Possible role of apoptosis in Alzheimer's disease.
Ann NY Acad Sci
747:36-49[Web of Science][Medline].
-
De Azevedo Jr WF,
Mueller-Dieckmann HJ,
Schulze-Gahmen U,
Worland PJ,
Sausville E,
Kim SH
(1996)
Structural basis for specificity and potency of a flavonoid inhibitor of human CDK2, a cell cycle kinase.
Proc Natl Acad Sci USA
93:2735-2740[Abstract/Free Full Text].
-
Estus S,
Tucker HM,
van Rooyen C,
Wright S,
Brigham EF,
Wogulis M,
Rydel RE
(1997)
Aggregated amyloid-beta protein induces cortical neuronal apoptosis and concomitant "apoptotic" pattern of gene induction.
J Neurosci
17:7736-7745[Abstract/Free Full Text].
-
Farinelli SE,
Park DS,
Greene LA
(1996)
Nitric oxide delays the death of trophic factor-deprived PC12 cells and sympathetic neurons by a cGMP-mediated mechanism.
J Neurosci
16:2325-2334[Abstract/Free Full Text].
-
Farinelli SE,
Greene LA,
Friedman WJ
(1998)
Neuroprotective actions of dipyridamole on cultured CNS neurons.
J Neurosci
18:5112-5123[Abstract/Free Full Text].
-
Ferreira A,
Lu Q,
Orecchio L,
Kosik KS
(1997)
Selective phosphorylation of adult tau isoforms in mature hippocampal neurons exposed to fibrillar A beta.
Mol Cell Neurosci
9:220-234[Web of Science][Medline].
-
Gervais FG,
Xu D,
Robertson GS,
Vaillancourt JP,
Zhu Y,
Huang J,
LeBlanc A,
Smith D,
Rigby M,
Shearman MS,
Clarke EE,
Zheng H,
Van Der Ploeg LH,
Ruffolo SC,
Thornberry NA,
Xanthoudakis S,
Zamboni RJ,
Roy S,
Nicholson DW
(1999)
Involvement of caspases in proteolytic cleavage of Alzheimer's amyloid-beta precursor protein and amyloidogenic A beta peptide formation.
Cell
97:395-406[Web of Science][Medline].
-
Giovanni A,
Wirtz-Brugger F,
Keramaris E,
Slack R,
Park DS
(1999)
Involvement of cell cycle elements, cyclin-dependent kinases, pRb, and E2F.DP, in B-amyloid-induced neuronal death.
J Biol Chem
274:19011-19016[Abstract/Free Full Text].
-
Greene LA,
Tischler AS
(1976)
Establishment of a noradrenergic clonal line of rat adrenal pheochromocytoma cells which respond to nerve growth factor.
Proc Natl Acad Sci USA
73:2424-2428[Abstract/Free Full Text].
-
Greene LA,
Cunningham ME,
Farinelli SE,
Park DS
(1998)
Methodologies for the culture and experimental use of the PC12 rat pheochromocytoma line.
In: Culturing nerve cells (Banker G,
Goslin K,
eds), pp 161-188. Cambridge, MA: MIT.
-
Guo Q,
Sebastian L,
Sopher BL,
Miller MW,
Ware CB,
Martin GM,
Mattson MP
(1999)
Increased vulnerability of hippocampal neurons from presenilin-1 mutant knock-in mice to amyloid beta-peptide toxicity: central roles of superoxide production and caspase activation.
J Neurochem
72:1019-1029[Web of Science][Medline].
-
Hu S,
Snipas SJ,
Vincenz C,
Salvesen G,
Dixit VM
(1998)
Caspase-14 is a novel developmentally regulated protease.
J Biol Chem
273:29648-29653[Abstract/Free Full Text].
-
Humke EW,
Ni J,
Dixit VM
(1998)
ERICE, a novel FLICE-activatable caspase.
J Biol Chem
273:15702-15707[Abstract/Free Full Text].
-
Ii M,
Sunamoto M,
Ohnishi K,
Ichimori Y
(1996)
beta-Amyloid protein-dependent nitric oxide production from microglial cells and neurotoxicity.
Brain Res
720:93-100[Web of Science][Medline].
-
Jordan J,
Galindo MF,
Miller RJ
(1997)
Role of calpain- and interleukin-1 beta converting enzyme-like proteases in the beta-amyloid-induced death of rat hippocampal neurons in culture.
J Neurochem
68:1612-1621[Web of Science][Medline].
-
Kaur G,
Stetler-Stevenson M,
Sebers S,
Worland P,
Sedlacek H,
Myers C,
Czech J,
Naik R,
Sausville E
(1992)
Growth inhibition with reversible cell cycle arrest of carcinoma cells by flavone L86-8275.
J Natl Cancer Inst
84:1736-1740[Abstract/Free Full Text].
-
Keller JN,
Kindy MS,
Holtsberg FW,
St. Clair DK,
Yen HC,
Germeyer A,
Steiner SM,
Bruce-Keller AJ,
Hutchins JB,
Mattson MP
(1998)
Mitochondrial manganese superoxide dismutase prevents neural apoptosis and reduces ischemic brain injury: suppression of peroxynitrite production, lipid peroxidation, and mitochondrial dysfunction.
J Neurosci
18:687-697[Abstract/Free Full Text].
-
Kruman I,
Bruce-Keller AJ,
Bredesen D,
Waeg G,
Mattson MP
(1997)
Evidence that 4-hydroxynonenal mediates oxidative stress-induced neuronal apoptosis.
J Neurosci
17:5089-5100[Abstract/Free Full Text].
-
Li YP,
Bushnell AF,
Lee CM,
Perlmutter LS,
Wong SK
(1996)
Beta-amyloid induces apoptosis in human-derived neurotypic SH-SY5Y cells.
Brain Res
738:196-204[Web of Science][Medline].
-
Losiewicz MD,
Carlson BA,
Kaur G,
Sausville EA,
Worland PJ
(1994)
Potent inhibition of CDC2 kinase activity by the flavonoid L86-8275.
Biochem Biophys Res Commun
201:589-595[Web of Science][Medline].
-
Mannick JB,
Hausladen A,
Liu L,
Hess DT,
Zeng M,
Miao QX,
Kane LS,
Gow AJ,
Stamler JS
(1999)
Fas-induced caspase denitrosylation.
Science
284:651-654[Abstract/Free Full Text].
-
Masliah E,
Mallory M,
Alford M,
Tanaka S,
Hansen LA
(1998)
Caspase dependent DNA fragmentation might be associated with excitotoxicity in Alzheimer disease.
J Neuropathol Exp Neurol
57:1041-1052[Web of Science][Medline].
-
Masters CL,
Multhaup G,
Simms G,
Pottgiesser J,
Martins RN,
Beyreuther K
(1985)
Neuronal origin of a cerebral amyloid: neurofibrillary tangles of Alzheimer's disease contain the same protein as the amyloid of plaque cores and blood vessels.
EMBO J
4:2757-2763[Web of Science][Medline].
-
Mattson MP,
Partin J,
Begley JG
(1998)
Amyloid beta-peptide induces apoptosis-related events in synapses and dendrites.
Brain Res
807:167-176[Web of Science][Medline].
-
Pike CJ,
Walencewicz AJ,
Glabe CG,
Cotman CW
(1991a)
Aggregation-related toxicity of synthetic beta-amyloid protein in hippocampal cultures.
Eur J Pharmacol
207:367-368[Web of Science][Medline].
-
Pike CJ,
Walencewicz AJ,
Glabe CG,
Cotman CW
(1991b)
In vitro aging of beta-amyloid protein causes peptide aggregation and neurotoxicity.
Brain Res
563:311-314[Web of Science][Medline].
-
Pike CJ,
Ramezan-Arab N,
Cotman CW
(1997)
Beta-amyloid neurotoxicity in vitro: evidence of oxidative stress but not protection by antioxidants.
J Neurochem
69:1601-1611[Web of Science][Medline].
-
Selkoe DJ
(1990)
Deciphering Alzheimer's disease: the amyloid precursor protein yields new clues.
Science
248:1058-1060[Free Full Text].
-
Selkoe DJ
(1997)
Alzheimer's disease: genotypes, phenotypes, and treatments.
Science
275:630-631[Free Full Text].
-
Stefanis L,
Park DS,
Yan CY,
Farinelli SE,
Troy CM,
Shelanski ML,
Greene LA
(1996)
Induction of CPP32-like activity in PC12 cells by withdrawal of trophic support. Dissociation from apoptosis.
J Biol Chem
271:30663-30671[Abstract/Free Full Text].
-
Stefanis L,
Troy CM,
Qi H,
Greene LA
(1997)
Inhibitors of trypsin-like serine proteases inhibit processing of the caspase Nedd-2 and protect PC12 cells and sympathetic neurons from death evoked by withdrawal of trophic support.
J Neurochem
69:1425-1437[Web of Science][Medline].
-
Stefanis L,
Troy CM,
Qi H,
Shelanski ML,
Greene LA
(1998)
Caspase-2 (Nedd-2) processing and death of trophic factor-deprived PC12 cells and sympathetic neurons occur independently of caspase-3 (CPP32)- like activity.
J Neurosci
18:9204-9215[Abstract/Free Full Text].
-
Talanian RV,
Quinlan C,
Trautz S,
Hackett MC,
Mankovich JA,
Banach D,
Ghayur T,
Brady KD,
Wong WW
(1997)
Substrate specificities of caspase family proteases.
J Biol Chem
272:9677-9682[Abstract/Free Full Text].
-
Thornberry NA,
Lazebnik Y
(1998)
Caspases: enemies within.
Science
281:1312-1316[Abstract/Free Full Text].
-
Thornberry NA,
Rano TA,
Peterson EP,
Rasper DM,
Timkey T,
Garcia-Calvo M,
Houtzager VM,
Nordstrom PA,
Roy S,
Vaillancourt JP,
Chapman KT,
Nicholson DW
(1997)
A combinatorial approach defines specificities of members of the caspase family and granzyme B. Functional relationships established for key mediators of apoptosis.
J Biol Chem
272:17907-17911[Abstract/Free Full Text].
-
Troy CM,
Shelanski ML
(1994)
Down-regulation of copper/zinc superoxide dismutase causes apoptotic death in PC12 neuronal cells.
Proc Natl Acad Sci USA
91:6384-6387[Abstract/Free Full Text].
-
Troy CM,
Derossi D,
Prochiantz A,
Greene LA,
Shelanski ML
(1996a)
Downregulation of Cu/Zn superoxide dismutase leads to cell death via the nitric oxide-peroxynitrite pathway.
J Neurosci
16:253-261[Abstract/Free Full Text].
-
Troy CM,
Stefanis L,
Prochiantz A,
Greene LA,
Shelanski ML
(1996b)
The contrasting roles of ICE family proteases and interleukin-1beta in apoptosis induced by trophic factor withdrawal and by copper/zinc superoxide dismutase down-regulation.
Proc Natl Acad Sci USA
93:5635-5640[Abstract/Free Full Text].
-
Troy CM,
Stefanis L,
Greene LA,
Shelanski ML
(1997)
Nedd2 is required for apoptosis after trophic factor withdrawal, but not superoxide dismutase (SOD1) downregulation, in sympathetic neurons and PC12 cells.
J Neurosci
17:1911-1918[Abstract/Free Full Text].
-
Vesely J,
Havlicek L,
Strnad M,
Blow JJ,
Donella-Deana A,
Pinna L,
Letham DS,
Kato J,
Detivaud L,
Leclerc S,
Mieijer L
(1994)
Inhibition of cyclin-dependent kinases by purine analogues.
Eur J Biochem
224:771-786[Web of Science][Medline].
-
Wang X,
Zelenski NG,
Yang J,
Sakai J,
Brown MS,
Goldstein JL
(1996)
Cleavage of sterol regulatory element binding proteins (SREBPs) by CPP32 during apoptosis.
EMBO J
15:1012-1020[Web of Science][Medline].
-
Yankner BA
(1996)
Mechanisms of neuronal degeneration in Alzheimer's disease.
Neuron
16:921-932[Web of Science][Medline].
Copyright © 2000 Society for Neuroscience 0270-6474/00/2041386-07$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
P. Porayette, M. J. Gallego, M. M. Kaltcheva, R. L. Bowen, S. Vadakkadath Meethal, and C. S. Atwood
Differential Processing of Amyloid-{beta} Precursor Protein Directs Human Embryonic Stem Cell Proliferation and Differentiation into Neuronal Precursor Cells
J. Biol. Chem.,
August 28, 2009;
284(35):
23806 - 23817.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. A. Yankner and T. Lu
Amyloid {beta}-Protein Toxicity and the Pathogenesis of Alzheimer Disease
J. Biol. Chem.,
February 20, 2009;
284(8):
4755 - 4759.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Niizuma, H. Endo, C. Nito, D. J. Myer, G. S. Kim, and P. H. Chan
The PIDDosome mediates delayed death of hippocampal CA1 neurons after transient global cerebral ischemia in rats
PNAS,
October 21, 2008;
105(42):
16368 - 16373.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. M. Troy and E. M. Ribe
Caspase-2: Vestigial Remnant or Master Regulator?
Sci. Signal.,
September 23, 2008;
1(38):
pe42 - pe42.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Song, H. Lee, T.-I. Kam, M. L. Tai, J.-Y. Lee, J.-Y. Noh, S. M. Shim, S. J. Seo, Y.-Y. Kong, T. Nakagawa, et al.
E2-25K/Hip-2 regulates caspase-12 in ER stress-mediated A{beta} neurotoxicity
J. Cell Biol.,
August 25, 2008;
182(4):
675 - 684.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L.-y. Yu, M. Saarma, and U. Arumae
Death Receptors and Caspases But Not Mitochondria Are Activated in the GDNF- or BDNF-Deprived Dopaminergic Neurons
J. Neurosci.,
July 23, 2008;
28(30):
7467 - 7475.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. H. Davis, T. L. Cuellar, S. M. Koch, A. J. Barker, B. D. Harfe, M. T. McManus, and E. M. Ullian
Conditional Loss of Dicer Disrupts Cellular and Tissue Morphogenesis in the Cortex and Hippocampus
J. Neurosci.,
April 23, 2008;
28(17):
4322 - 4330.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Fukui, F. Diaz, S. Garcia, and C. T. Moraes
Cytochrome c oxidase deficiency in neurons decreases both oxidative stress and amyloid formation in a mouse model of Alzheimer's disease
PNAS,
August 28, 2007;
104(35):
14163 - 14168.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Murakami, E. Aizu-Yokota, Y. Sonoda, S. Ohta, and T. Kasahara
Suppression of Endoplasmic Reticulum Stress-induced Caspase Activation and Cell Death by the Overexpression of Bcl-xL or Bcl-2
J. Biochem.,
March 1, 2007;
141(3):
401 - 410.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. C. Biswas, Y. Shi, J.-P. G. Vonsattel, C. L. Leung, C. M. Troy, and L. A. Greene
Bim Is Elevated in Alzheimer's Disease Neurons and Is Required for {beta}-Amyloid-Induced Neuronal Apoptosis
J. Neurosci.,
January 24, 2007;
27(4):
893 - 900.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Malagelada, E. J. Ryu, S. C. Biswas, V. Jackson-Lewis, and L. A. Greene
RTP801 Is Elevated in Parkinson Brain Substantia Nigral Neurons and Mediates Death in Cellular Models of Parkinson's Disease by a Mechanism Involving Mammalian Target of Rapamycin Inactivation
J. Neurosci.,
September 27, 2006;
26(39):
9996 - 10005.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. R. Siafakas, L. C. Wright, T. C. Sorrell, and J. T. Djordjevic
Lipid Rafts in Cryptococcus neoformans Concentrate the Virulence Determinants Phospholipase B1 and Cu/Zn Superoxide Dismutase
Eukaryot. Cell,
March 1, 2006;
5(3):
488 - 498.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. R. Parathath, S. Parathath, and S. E. Tsirka
Nitric oxide mediates neurodegeneration and breakdown of the blood-brain barrier in tPA-dependent excitotoxic injury in mice
J. Cell Sci.,
January 15, 2006;
119(2):
339 - 349.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Culmsee, N. Gerling, S. Landshamer, B. Rickerts, H.-J. Duchstein, K. Umezawa, S. Klumpp, and J. Krieglstein
Nitric Oxide Donors Induce Neurotrophin-Like Survival Signaling and Protect Neurons against Apoptosis
Mol. Pharmacol.,
October 1, 2005;
68(4):
1006 - 1017.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Puzzo, O. Vitolo, F. Trinchese, J. P. Jacob, A. Palmeri, and O. Arancio
Amyloid-{beta} Peptide Inhibits Activation of the Nitric Oxide/cGMP/cAMP-Responsive Element-Binding Protein Pathway during Hippocampal Synaptic Plasticity
J. Neurosci.,
July 20, 2005;
25(29):
6887 - 6897.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Lesne, C. Gabriel, D. A. Nelson, E. White, E. T. MacKenzie, D. Vivien, and A. Buisson
Akt-dependent Expression of NAIP-1 Protects Neurons against Amyloid-{beta} Toxicity
J. Biol. Chem.,
July 1, 2005;
280(26):
24941 - 24947.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-Y. Park and A. Ferreira
The Generation of a 17 kDa Neurotoxic Fragment: An Alternative Mechanism by which Tau Mediates {beta}-Amyloid-Induced Neurodegeneration
J. Neurosci.,
June 1, 2005;
25(22):
5365 - 5375.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. E. Pedraza, P. Podlesniy, N. Vidal, J. C. Arevalo, R. Lee, B. Hempstead, I. Ferrer, M. Iglesias, and C. Espinet
Pro-NGF Isolated from the Human Brain Affected by Alzheimer's Disease Induces Neuronal Apoptosis Mediated by p75NTR
Am. J. Pathol.,
February 1, 2005;
166(2):
533 - 543.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Hitomi, T. Katayama, Y. Eguchi, T. Kudo, M. Taniguchi, Y. Koyama, T. Manabe, S. Yamagishi, Y. Bando, K. Imaizumi, et al.
Involvement of caspase-4 in endoplasmic reticulum stress-induced apoptosis and A{beta}-induced cell death
J. Cell Biol.,
May 10, 2004;
165(3):
347 - 356.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Tinel and J. Tschopp
The PIDDosome, a Protein Complex Implicated in Activation of Caspase-2 in Response to Genotoxic Stress
Science,
May 7, 2004;
304(5672):
843 - 846.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Li, L. Yang, K. Lindholm, Y. Konishi, X. Yue, H. Hampel, D. Zhang, and Y. Shen
Tumor Necrosis Factor Death Receptor Signaling Cascade Is Required for Amyloid-{beta} Protein-Induced Neuron Death
J. Neurosci.,
February 18, 2004;
24(7):
1760 - 1771.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K.-C. Suen, M.-S. Yu, K.-F. So, R. C.-C. Chang, and J. Hugon
Upstream Signaling Pathways Leading to the Activation of Double-stranded RNA-dependent Serine/Threonine Protein Kinase in {beta}-Amyloid Peptide Neurotoxicity
J. Biol. Chem.,
December 12, 2003;
278(50):
49819 - 49827.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. C. Gamblin, F. Chen, A. Zambrano, A. Abraha, S. Lagalwar, A. L. Guillozet, M. Lu, Y. Fu, F. Garcia-Sierra, N. LaPointe, et al.
Caspase cleavage of tau: Linking amyloid and neurofibrillary tangles in Alzheimer's disease
PNAS,
August 19, 2003;
100(17):
10032 - 10037.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. A. Marques, U. Keil, A. Bonert, B. Steiner, C. Haass, W. E. Muller, and A. Eckert
Neurotoxic Mechanisms Caused by the Alzheimer's Disease-linked Swedish Amyloid Precursor Protein Mutation: OXIDATIVE STRESS, CASPASES, AND THE JNK PATHWAY
J. Biol. Chem.,
July 18, 2003;
278(30):
28294 - 28302.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Doonan, M. Donovan, and T. G. Cotter
Caspase-Independent Photoreceptor Apoptosis in Mouse Models of Retinal Degeneration
J. Neurosci.,
July 2, 2003;
23(13):
5723 - 5731.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Qahwash, K. L. Weiland, Y. Lu, R. W. Sarver, R. F. Kletzien, and R. Yan
Identification of a Mutant Amyloid Peptide That Predominantly Forms Neurotoxic Protofibrillar Aggregates
J. Biol. Chem.,
June 13, 2003;
278(25):
23187 - 23195.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Al-Molawi, V. A. Beardmore, M. J. Carter, G. E. N. Kass, and L. O. Roberts
Caspase-mediated cleavage of the feline calicivirus capsid protein
J. Gen. Virol.,
May 1, 2003;
84(5):
1237 - 1244.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. J. Ryu, H. P. Harding, J. M. Angelastro, O. V. Vitolo, D. Ron, and L. A. Greene
Endoplasmic Reticulum Stress and the Unfolded Protein Response in Cellular Models of Parkinson's Disease
J. Neurosci.,
December 15, 2002;
22(24):
10690 - 10698.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Fath, J. Eidenmuller, and R. Brandt
Tau-Mediated Cytotoxicity in a Pseudohyperphosphorylation Model of Alzheimer's Disease
J. Neurosci.,
November 15, 2002;
22(22):
9733 - 9741.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. V. Vitolo, A. Sant'Angelo, V. Costanzo, F. Battaglia, O. Arancio, and M. Shelanski
Amyloid beta -peptide inhibition of the PKA/CREB pathway and long-term potentiation: Reversibility by drugs that enhance cAMP signaling
PNAS,
October 1, 2002;
99(20):
13217 - 13221.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Luo, J. V. Smith, V. Paramasivam, A. Burdick, K. J. Curry, J. P. Buford, I. Khan, W. J. Netzer, H. Xu, and P. Butko
Inhibition of amyloid-beta aggregation and caspase-3 activation by the Ginkgo biloba extract EGb761
PNAS,
September 17, 2002;
99(19):
12197 - 12202.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. L. Wellington, L. M. Ellerby, C.-A. Gutekunst, D. Rogers, S. Warby, R. K. Graham, O. Loubser, J. van Raamsdonk, R. Singaraja, Y.-Z. Yang, et al.
Caspase Cleavage of Mutant Huntingtin Precedes Neurodegeneration in Huntington's Disease
J. Neurosci.,
September 15, 2002;
22(18):
7862 - 7872.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. M. Troy, J. E. Friedman, and W. J. Friedman
Mechanisms of p75-mediated Death of Hippocampal Neurons. ROLE OF CASPASES
J. Biol. Chem.,
September 6, 2002;
277(37):
34295 - 34302.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Zhang, D. M. Rosenbaum, A. R. Shaikh, Q. Li, P. S. Rosenbaum, D. J. Pelham, and S. Roth
Ischemic Preconditioning Attenuates Apoptotic Cell Death in the Rat Retina
Invest. Ophthalmol. Vis. Sci.,
September 1, 2002;
43(9):
3059 - 3066.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. H. Han, D. Xu, J. Choi, Y. Han, S. Xanthoudakis, S. Roy, J. Tam, J. Vaillancourt, J. Colucci, R. Siman, et al.
Selective, Reversible Caspase-3 Inhibitor Is Neuroprotective and Reveals Distinct Pathways of Cell Death after Neonatal Hypoxic-ischemic Brain Injury
J. Biol. Chem.,
August 9, 2002;
277(33):
30128 - 30136.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z.-S. Ji, R. D. Miranda, Y. M. Newhouse, K. H. Weisgraber, Y. Huang, and R. W. Mahley
Apolipoprotein E4 Potentiates Amyloid beta Peptide-induced Lysosomal Leakage and Apoptosis in Neuronal Cells
J. Biol. Chem.,
June 7, 2002;
277(24):
21821 - 21828.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. E. Bamberger and G. E. Landreth
Inflammation, Apoptosis, and Alzheimer's Disease
Neuroscientist,
June 1, 2002;
8(3):
276 - 283.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Xie, M. Wei, T. E. Morgan, P. Fabrizio, D. Han, C. E. Finch, and V. D. Longo
Peroxynitrite Mediates Neurotoxicity of Amyloid beta -Peptide1-42- and Lipopolysaccharide-Activated Microglia
J. Neurosci.,
May 1, 2002;
22(9):
3484 - 3492.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Qiu, M. J. Whalen, P. Lowenstein, G. Fiskum, B. Fahy, R. Darwish, B. Aarabi, J. Yuan, and M. A. Moskowitz
Upregulation of the Fas Receptor Death-Inducing Signaling Complex after Traumatic Brain Injury in Mice and Humans
J. Neurosci.,
May 1, 2002;
22(9):
3504 - 3511.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Paroni, C. Henderson, C. Schneider, and C. Brancolini
Caspase-2 Can Trigger Cytochrome c Release and Apoptosis from the Nucleus
J. Biol. Chem.,
April 19, 2002;
277(17):
15147 - 15161.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Mohr, X. Xi, J. Tang, and T. S. Kern
Caspase Activation in Retinas of Diabetic and Galactosemic Mice and Diabetic Patients
Diabetes,
April 1, 2002;
51(4):
1172 - 1179.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Williamson, T. Scales, B. R. Clark, G. Gibb, C. H. Reynolds, S. Kellie, I. N. Bird, I. M. Varndell, P. W. Sheppard, I. Everall, et al.
Rapid Tyrosine Phosphorylation of Neuronal Proteins Including Tau and Focal Adhesion Kinase in Response to Amyloid-beta Peptide Exposure: Involvement of Src Family Protein Kinases
J. Neurosci.,
January 1, 2002;
22(1):
10 - 20.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. M. Troy, S. A. Rabacchi, J. B. Hohl, J. M. Angelastro, L. A. Greene, and M. L. Shelanski
Death in the Balance: Alternative Participation of the Caspase-2 and -9 Pathways in Neuronal Death Induced by Nerve Growth Factor Deprivation
J. Neurosci.,
July 15, 2001;
21(14):
5007 - 5016.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. J. Friedman
Neurotrophins Induce Death of Hippocampal Neurons via the p75 Receptor
J. Neurosci.,
September 1, 2000;
20(17):
6340 - 6346.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-N. Wang, C.-W. Chi, Y.-L. Lin, C.-F. Chen, and Y.-J. Shiao
The Neuroprotective Effects of Phytoestrogens on Amyloid beta Protein-induced Toxicity Are Mediated by Abrogating the Activation of Caspase Cascade in Rat Cortical Neurons
J. Biol. Chem.,
February 9, 2001;
276(7):
5287 - 5295.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Stoka, B. Turk, S. L. Schendel, T.-H. Kim, T. Cirman, S. J. Snipas, L. M. Ellerby, D. Bredesen, H. Freeze, M. Abrahamson, et al.
Lysosomal Protease Pathways to Apoptosis. CLEAVAGE OF Bid, NOT PRO-CASPASES, IS THE MOST LIKELY ROUTE
J. Biol. Chem.,
January 26, 2001;
276(5):
3149 - 3157.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Tong, P. L. Thornton, R. Balazs, and C. W. Cotman
beta -Amyloid-(1-42) Impairs Activity-dependent cAMP-response Element-binding Protein Signaling in Neurons at Concentrations in Which Cell Survival Is Not Compromised
J. Biol. Chem.,
May 11, 2001;
276(20):
17301 - 17306.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. M. Kajkowski, C. F. Lo, X. Ning, S. Walker, H. J. Sofia, W. Wang, W. Edris, P. Chanda, E. Wagner, S. Vile, et al.
beta -Amyloid Peptide-induced Apoptosis Regulated by a Novel Protein Containing a G Protein Activation Module
J. Biol. Chem.,
May 25, 2001;
276(22):
18748 - 18756.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Bonfoco, E. Li, F. Kolbinger, and N. R. Cooper
Characterization of a Novel Proapoptotic Caspase-2- and Caspase-9-binding Protein
J. Biol. Chem.,
July 27, 2001;
276(31):
29242 - 29250.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Perini, V. Della-Bianca, V. Politi, G. Della Valle, I. Dal-Pra, F. Rossi, and U. Armato
Role of p75 Neurotrophin Receptor in the Neurotoxicity by {beta}-amyloid Peptides and Synergistic Effect of Inflammatory Cytokines
J. Exp. Med.,
April 1, 2002;
195(7):
907 - 918.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|