 |
Previous Article | Next Article 
The Journal of Neuroscience, February 15, 2000, 20(4):1424-1434
Molecular Cloning and Functional Expression of the
Potassium-Dependent Sodium-Calcium Exchanger from Human and Chicken
Retinal Cone Photoreceptors
Clemens F. M.
Prinsen,
Robert T.
Szerencsei, and
Paul P. M.
Schnetkamp
Department of Physiology and Biophysics and the Medical Research
Council Group on Ion Channels and Transporters, University of Calgary,
Faculty of Medicine, Calgary, Alberta, Canada T2N 4N1
 |
ABSTRACT |
Light causes a rapid lowering of cytosolic free calcium in the
outer segments of both retinal rod and cone photoreceptors. This
light-induced lowering of calcium is caused by extrusion via a Na-Ca
exchanger located in the rod and cone outer segment plasma membrane and
plays a key role in the process of light adaptation. The Na-Ca
exchanger in retinal rod outer segment was shown earlier to be a novel
Na-Ca+K exchanger (NCKX), and its cDNA was obtained by molecular
cloning from several mammalian species. On the other hand, the proper
identity of the retinal cone Na-Ca exchanger, in terms of both
functional characteristics (e.g., requirement for and transport of
potassium) and molecular identity, has not yet been elucidated. Here,
we report the molecular cloning, intraretinal localization by in
situ hybridization, and initial functional characterization of
the chicken and human cone-specific Na-Ca exchangers. In addition we
report the chicken rod-specific NCKX. We identified NCKX transcripts in
both human and chicken cones and observed strong potassium-dependent
Na-Ca exchange activity after heterologous expression of human and
chicken cone NCKX cDNAs in cultured insect cells. In
situ hybridization in chicken retina showed abundant rod NCKX
transcripts only in rod photoreceptors, whereas abundant cone NCKX
transcripts were found in most, if not all, cone photoreceptors and
also in a subpopulation of retinal ganglion cells. A detailed
comparison with the previously described retinal rod and brain NCKX
cDNAs is presented.
Key words:
sodium-calcium exchange; retina; photoreceptor cells; ganglion cells; chicken; human; calcium homeostasis; in situ
hybridization
 |
INTRODUCTION |
The outer segments of both retinal
rod and cone photoreceptors have been shown to contain an electrogenic
Na-Ca exchanger (Yau and Nakatani, 1984 ; Lagnado et al., 1988 ;
Nakatani and Yau, 1989 ). In darkness, the Na-Ca exchanger extrudes
calcium that enters rod or cone outer segments via the cGMP-gated
channels, whereas in bright light the exchanger mediates a rapid
lowering of cytosolic free calcium concentration in both rod
(McNaughton et al., 1986 ; Gray-Keller and Detwiler, 1994 ; Sampath et
al., 1998 ) and cone outer segments (Sampath et al., 1999 ). Both the kinetics and the magnitude of the light-induced decrease in free calcium concentration in cone outer segments are considerably faster
compared with those measured in rod outer segments (Sampath et al.,
1998 , 1999 ), in agreement with earlier, more indirect measurements
which suggested that for similar changes in outer segment Na-Ca
exchange current, changes in outer segment calcium concentration are
larger and faster in cones than in rods (for review, see Korenbrot,
1995 ).
The retinal rod Na-Ca exchanger protein was shown to be a Na-Ca+K
exchanger (NCKX) that uses both the inward sodium gradient and the
outward potassium gradient to drive calcium extrusion (Cervetto et al.,
1989 ; Schnetkamp et al., 1989 ). Rod NCKX1 cDNA has been cloned from
three mammalian species: bovine (Reiländer et al., 1992 ), human
(Tucker et al., 1998a ), and dolphin (Cooper et al., 1999 ). A related
NCKX2 cDNA was recently cloned from rat brain (Tsoi et al., 1998 ). Both
dolphin rod NCKX1 and rat brain NCKX2 were shown to code for a
potassium-dependent Na-Ca exchanger after heterologous expression in
human embryonic kidney (HEK) 293 cells. Both NCKX1 and NCKX2 are
distantly related to the gene family of the more common
potassium-independent Na-Ca exchangers (NCX) (Schwarz and Benzer,
1997 ) [for a recent review on NCX, see Blaustein and Lederer
(1999) ].
Immunohistochemistry on the bovine retina was use to locate bovine rod
NCKX1 exclusively to the outer segment plasma membrane, whereas no
significant amounts of NCKX1 were detected in rod disk membranes, in
rod inner segments, or in cone photoreceptors (Haase et al., 1990 ; Reid
et al., 1990 ; Kim et al., 1998 ). Thus, the molecular identity of the
Na-Ca exchanger responsible for calcium extrusion in cone outer
segments has not been identified yet, nor has it been determined
whether the Na-Ca exchanger in cones is of the NCX or NCKX type. To
identify the cone Na-Ca(+K) exchanger(s), we used the chicken
retina as a model, because birds are known to have cone-dominated
retinas with cones accounting for up to 85% of photoreceptors (Morris,
1970 ; Ramon y Cajal, 1972 ), whereas most mammals have rod-dominated
retinas. We have isolated and sequenced two distinct chicken retinal
NCKX cDNAs and localized their transcripts in the inner segments of rod
and cone photoreceptors, respectively. Subsequently, we obtained the
human cone NCKX cDNA as well. Potassium-dependent Na-Ca exchange was
observed for the chicken rod and for both human and chicken cone
NCKX proteins after heterologous expression in cultured insect cells.
 |
MATERIALS AND METHODS |
Animals. Chicks (male White Leghorns,
Gallus gallus domesticus) were obtained from a local
hatchery (Lillydale Hatchery, Linden, Alberta) and housed in the Animal
Care Facilities under 12 hr light/dark conditions, with access to water
and food ad libitum. Heads from adult chicken were obtained
from a local slaughterhouse.
Preparation of RNAs and cDNAs. Total RNA from human retinal
tissue (obtained from the Lions Eye Bank Alberta at the Rockyview General Hospital, Calgary), human hippocampus, chicken retinas, and
chicken brain was prepared by homogenization in TRIzol reagent (Life
Technologies, Burlington, Ontario) and processed according to the
manufacturer's protocol. Samples were subsequently treated with RQ1
RNase-free DNase (Promega Corporation, Madison, WI) and purified by
standard organic extraction, followed by ethanol precipitation. First-strand cDNAs were synthesized from retinal total RNA (2.5 µg)
with Superscript II reverse transcriptase (Life Technologies), using
either oligo-dT12-18 (Amersham Pharmacia
Biotech, Baie d'Urfé, Québec) or random hexanucleotides as
primers for synthesis according to the manufacturer's protocol.
First-strand cDNAs were purified on PCR spin columns (Qiagen,
Mississauga, Ontario) according to the manufacturer's directions and
diluted up to 200 µl with 10 mM Tris-HCl, pH 8.5. Two
microliters of the first-strand cDNA were used in 20 µl PCR reactions.
cDNA library screen for chicken NCKX. Two chicken retinal
cDNA libraries in lambda ZAP II vector were used: one made with oligo-dT-primed cDNA and one made with random-primed cDNA (Bönigk et al., 1993 ). As probe we used a PCR product of primers
TGAAGAGCCTCTGTCCCTGGACTGGC and TCAGACAGATACAGGACAGGATAT on bovine rod
NCKX1 cDNA, amplifying a 621 nucleotide (nt) fragment. The probe was
random-primed labeled with [ -32P]dCTP
(Prime-It II Random Primer Labeling Kit, Stratagene, La Jolla, CA).
Approximately 3 × 105 clones of each
library were screened using the conserved (621 nt) bovine NCKX1 cDNA
fragment as probe under medium stringency (100 mM sodium
phosphate, pH 7.2, 0.1% SDS at 65°C). Eighty-nine primary positive
clones were isolated, from which 13 were further characterized by
in vivo excision with ExAssist helperphage (Stratagene) and
analyzed by direct sequencing (Thermosequenase, Amersham Pharmacia Biotech). Thirty-two of the 89 primary positive clones were examined for alternative splicing variants by PCR screening with the following primer sets: CTCATCCTGTTTTTCCTAGACAGC and ACCTGATGAGCCCACCACACCA for
rod NCKX-specific amplification and GTGCGGTGATACTCCATGTAATTG and
TGAGCGGCTGGTCCTCGTCCTCT for cone NCKX-specific amplification. PCR
products were separated by electrophoresis on 1%
agarose/Tris-acetate/EDTA gels. All oligonucleotides were
synthesized on an Oligo 1000 DNA Synthesizer (Beckman
Instruments, Mississauga, Ontario). Nucleotide sequences were analyzed
using the computer program Generunner 3.0; DNA and amino acid sequence
alignments were made using ClustalW 1.7 and Boxshade 3.21, both
available from the Internet
(http://dot.imgen.bcm.tmc.edu:9331/multi-align/multi-align.html), and database searches using gapped BLAST (BLAST version 2.0) available from the NCBI Internet homepage (http://www.ncbi.nlm.nih.gov/).
Molecular cloning of the human cone NCKX cDNA. Using sets of
primers derived from the chicken cDNA, PCR amplification
was performed on random-primed human retina cDNA (primer sets
AGGAACAGCATCTTCCAGCTCATG and TTTGTTCATCCTCCACTTGCAG;
GAATGATTTACATGTTCATAGCCTTAGC and CACATGACATTTCTTCTTGGCG; GAATGATTTACATGTTCATAGCCTTAGC and TTTGTTCATCCTCCACTTGCAG). DNA sequence
analysis was performed using the thermosequenase kit (Thermosequenase,
Amersham Pharmacia Biotech). Subsequently, the 5' and 3'
rapid amplification of cDNA ends (RACE) technique was used to identify
the cDNA ends of the partial human cDNA. The first-strand cDNAs, as
described in Preparation of RNAs and cDNAs, were used. A poly(A) tail
was added using terminal deoxynucleotide transferase (10 U; Life
Technologies) in the presence of 1 mM dATP for 10 min at
37°C. Second-strand synthesis was performed in the same way, except
that the synthetic anchor primer
TGACTGGACTATGGTCTCGACATGGCGTAGTCG(T)18, instead
of oligo-dT, was used as the primer. First-round PCR was performed
using the 5' anchor-specific primer GGGTGACTGGACTATGGTCT and a
cDNA-specific primer AGGAAGTTTTTTCCCATCACGTTCT complementary to
positions 1548-1572 of the complete human cone NCKX nucleotide sequence. PCR was performed in standard buffers with 50 ng of double-stranded cDNA, with an annealing temperature of 60°C for 35 cycles of 90 sec extension each. Second-round PCR (3' RACE) was
performed with the 3' anchor-specific primer GGGCTCGACATGGCGTAGTC and
TCACGTTCTTTGGCTCCATTACC, a cDNA-specific primer complementary to
positions 1564-1586 of the sequence, with 0.1 µl of the first-round product as template, for 35 cycles using the same PCR conditions. A
band of ~1.5 kb was observed after agarose gel electrophoresis of the
second-round PCR products. This band was gel-isolated, sequenced, and
found to contain the complete 3' coding sequence of the cDNA as well as
3' flanking sequences. 5' RACE was performed with primers
AAACCACATAGCAAAAATAAGCTGTT (position 872-897) and nested primer
GAGAAGCAAGCTTTCCCACCACAT (position 846-869) and the anchor-specific
primer. 5' RACE products of 500-1000 nt were gel-isolated and
direct-sequenced.
Northern blot analysis. Tissues and cell lines were used to
extract total RNA using the TRIzol reagent (Life Technologies). Equal
amounts of total RNAs (based on optical density at 260 nm) were
analyzed on 1% agarose/formaldehyde gels, and RNAs were transferred to
Hybond N+ membranes (Amersham Pharmacia Biotech). Northern hybridization was performed using randomly labeled
[ -32P]dCTP-labeled cDNA probes
(Prime-It II Random Primer Labeling Kit) in ExpressHyb hybridization
solution (Clontech laboratories, Palo Alto, CA) at 68°C. A human
normal brain mRNA blot loaded with mRNAs from the frontal lobe,
temporal lobe, parietal lobe, occipital lobe, cerebellum, and lung
(Northern Territory, Act-N, Invitrogen, Carlsbad, CA) was used
according to the manufacturer's directions.
Tissue dissection, fixation, and sectioning. Between 7 and
10 d after hatching, chicks were killed by chloroform
inhalation. Eyes were removed from the orbit, and most of the attached
connective tissues and muscles were trimmed away. Eyes were hemisected
equatorially, and the gel vitreous was removed from the posterior eye
cup. Eye cups were fixed for 24 hr at 4°C in buffered neutral
formalin (10%) (BDH, Toronto, Ontario). Fixed samples were washed
three times in PBS (0.05 M phosphate buffer and 195 mM NaCl, pH 7.4), dehydrated in a graded ethanol series,
and embedded in paraffin. Vertical sections (5 µm) were mounted on
Micro Slides Superfrost Plus slides (VWR Canlab, Mississauga, Ontario),
dried at room temperature for 18 hr, and stored at 20°C.
cRNA probes. The full-length chicken rod NCKX and cone NCKX
cDNAs in Bluescript were linearized using NotI and
HindIII (rod NCKX) and BamHI and
Acc65I (cone NCKX) (New England Biolabs, Mississauga, Ontario) for in vitro transcription using T7 and T3 RNA
polymerase, respectively. A 860 nt chicken rhodopsin cDNA cloned in
Bluescript was used to make antisense and sense probes using T3 and T7
RNA polymerase, respectively. Transcription reactions were performed according to the manufacturer's instructions using either T7 or T3 RNA
polymerase in the presence of 11-digoxygenin UTP [DIG RNA labeling kit
(SP6/T7), Boehringer Mannheim, Laval, Québec]. The yields of the
labeling products after purification were quantified using dot-blotting
and agarose gel electrophoresis.
In situ hybridization. The RNA in situ
hybridization method was performed as described (Schaeren-Wiemers and
Gerfin-Moser, 1993 ; Breitschopf and Suchanek, 1996 ). Briefly, sections
were hybridized with probe (400 ng/ml) in 50% formamide/5 × sodium chloride-sodium citrate-phosphate (SSCP)/40 µg/ml
salmon sperm DNA for 18 hr at 65°C under parafilm (American National
Can, Chicago, IL). Posthybridization washes were two in 2 × SSCP for a total of 30 min at 65°C; and two in 0.2 × SSCP
for a total of 1 hr at 65°C. Incubation with Fab fragments from an
anti-digoxigenin antibody (1:5000) from sheep, conjugated with alkaline
phosphatase (Boehringer Mannheim, Indianapolis, IN) for 2 hr at 22°C
was used for the detection of the digoxigenin-labeled riboprobes.
Precipitation of the reaction products of nitroblue
tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (Life
Technologies) was allowed for 3-5 d, with a daily change of substrate
solution. Slides were mounted with Glycergel (Dako, Mississauga,
Ontario). Results were documented with Elite Chrome 160 Thungsten
(Eastman Kodak, New Haven, CT) at ASA 160.
Construction of the pIE1/153A-chicken cone and rod NCKX, and
human cone NCKX vectors. Full-length chicken rod and cone NCKX and
the alternative spliced cone NCKX cDNAs were cut out of their original
vectors pBluescript with the restriction enzyme EcoRI, blunt-ended with DNA polymerase I, large (Klenow) fragment (Life Technologies), and gel-isolated (QIAquick Gel Extraction Kit, Qiagen).
The vector pIE1/153A (Lu et al., 1997 ) was digested with SmaI, treated with Calf Intestinal Alkaline Phosphatase
(Life Technologies), and purified on PCR spin columns (Qiagen).
Ligations were performed according to the manufacturer's protocol
(Rapid DNA ligation kit, Boehringer Mannheim). The orientation of the cDNAs was verified by sequencing vector/insert boundaries. Unique BstX1 and EcoN1 restriction sites in the
pIE1/153A-cone NCKX clones were used to replace a 1442 nt partial cone
NCKX cDNA fragment with the 1493 nt BstX1-EcoN1
fragment of the full-length cone NCKX cDNA, as a control for
differences in uncoding regions between the two cone NCKX cDNAs. Both
the full-length human cone NCKX and its splice variant were inserted in
the same insect expression vector pIE1/153A using SmaI and
BamHI restriction sites, and clones were checked for correct
orientation as above.
Stable expression of rod and cone NCKX in insect cells. A
novel lepidopteran insect cell expression system was used to establish stable transfected BTI-TN-5B1-4 cells (High Five, Invitrogen) insect
cells (Farrell et al., 1998 ). Stable transfected cell lines were
generated when High Five cells were initially cotransfected with two
vectors: one expression plasmid containing the various NCKX cDNAs and
the second plasmid conferring resistance to hygromycin B using
lipofectin (Life Technologies) as transfection reagents. After 2 d
the transfection was followed by antibiotic selection in 1.0 mg/ml
hygromycin B and establishment of positive clonal cell lines. High Five
cells were subcultured at 28°C in IPL-41 insect medium (Life
Technologies) supplemented with 0.2 gm/l L-glutamine, 1.0 gm/l D-glucose, 10% heat-inactivated fetal bovine serum
(Life Technologies), and penicillin-streptomycin-fungizone (Life
Technologies). As a control for mRNA expression, the total RNAs of
several clonal cell lines were isolated, and Northern hybridization
with the chicken rod or cone NCKX cDNA as probe was performed.
Measurement of 45Ca2+ uptake.
Potassium-dependence of calcium uptake was measured in High Five cells
after stable transfection with the full-length rod chicken NCKX cDNA
and the full-length and alternative spliced chicken and human cone NCKX
cDNA. Cells were loaded with sodium by incubation for 15 min in 150 mM NaCl, 80 mM sucrose, 20 mM
HEPES, pH 7.4, 0.2 mM EDTA, and 2.5 µM
monensin (Sigma-Aldrich, Oakville, Ontario). The cation exchange
ionophore monensin was subsequently removed by washing twice in the
above medium without monensin, but containing 1% BSA, followed by
washing twice in medium in which LiCl replaced NaCl (Schnetkamp et al., 1995 ). The final cell pellet was resuspended in 150 mM
LiCl, 80 mM sucrose, 20 mM HEPES, pH 7.4, and
0.05 mM EDTA and left at 25°C until use.
45Ca2+
(0.5-1.0 µCi per experiment) (Amersham Pharmacia Biotech) uptake experiments were performed in the indicated media, and external 45Ca2+ was
removed by a rapid filtration over borosilicate glass fiber filters as
described previously (Schnetkamp et al., 1991b ); the washing medium
contained (in mM): 140 KCl, 80 sucrose, 20 HEPES, pH 7.4, 5 MgCl2, and 1 EGTA. In some experiments
45Ca2+ uptake
was measured in choline chloride medium, in which case cells were
washed and resuspended in choline chloride medium containing (in
mM): 150 choline chloride, 80 sucrose, 20 HEPES, pH 7.4, and 0.05 EDTA. NaCl, KCl, LiCl, and choline chloride were all
SigmaUltra grade (Sigma-Aldrich). Protein content of cell samples was
determined with the Bio-Rad protein assay (Bio-Rad Laboratories,
Mississauga, Ontario).
 |
RESULTS |
Cloning NCKX cDNAs from a chicken retinal cDNA library
The main objective of this study was to identify and isolate the
retinal cone-specific Na-Ca exchanger. Our hypothesis was that cones,
as has been shown for rods, would express a potassium-dependent Na-Ca
exchanger of the NCKX type. Therefore, we used the cDNA coding for
transmembrane segments H6 to H11 region of bovine rod NCKX1 as a probe
to screen chicken retinal cDNA libraries [characterized before by
Bönigk et al. (1993) ]. In earlier studies we identified this
region as one that is the most highly conserved among mammalian rod
NCKX1 proteins (Tucker et al., 1998a ; Cooper et al., 1999 ). We
identified 89 primary positive clones, from which 13 were randomly picked and further characterized; 12 of the 13 clones contained a
full-length open reading frame. Three types of clones were detected: coding for three different proteins containing 662/663 residues (Type
I, five clones), 651 residues (Type IIA, two clones), and 634 residues
(Type IIB, five clones), respectively. Type IIA and IIB are identical,
except for a 17 amino acid residue deletion in Type IIB, and are likely
to represent two different splice variants of the same gene. The only
polymorphism found in the chicken Type I clones was an Ala insertion at
position 393 in three of five cDNA clones sequenced. To evaluate the
presence of splice variants in the two NCKX cDNA types, 32 of the 89 primary positive chicken cDNA clones were screened by PCR, using primer sets specific for the two types of NCKX clones. Nine of the 32 clones
(28%) were positive for Type I, 14 (44%) were positive for Type II,
and 9 were negative for both sets, presumably incomplete clones or
false positive clones. All positives for a particular primer set showed
a PCR product of similar size; only the 17 amino acid deletion splice
variant of the Type II NCKX could be detected on agarose gels (data not
shown). From these results we conclude that other splice variants of
both types of NCKX proteins are absent or very rare in the chicken retina.
All three different NCKX transcripts present in chick retina code for
proteins of similar length when compared with rat brain NCKX2 (670 residues) but are significantly shorter than the mammalian rod NCKX
proteins (1013-1216 residues). Kyte-Doolittle hydropathy analysis of
the three types of chicken protein shows 12 hydrophobic segments
arranged in two large sets of transmembrane-spanning segments (H1-5
and H6-11) and two large hydrophilic segments, one between H0 and H1
(proposed to be extracellular) and one between H5 and H6 (proposed to
be cytosolic). This predicted topology is identical to that proposed
for the mammalian rod NCKX sequences (Tucker et al., 1998a ; Cooper et
al., 1999 ) and for the rat brain NCKX2 sequence (Tsoi et al., 1998 ).
The difference in length between our chicken NCKX proteins and
mammalian rod NCKX proteins is mostly accounted for by the difference
in length of the large hydrophilic segment between H0 and H1 (~130
residues compared with ~445 residues). We compared the
sequence identity of the two sets of transmembrane spanning segments of
our two types of chicken clones (Type IIA and IIB are identical within
these regions) with those of bovine rod NCKX1 and rat brain NCKX2. The
chicken Type I protein displays 89.8% identity with bovine rod NCKX1
and 81.7% with rat brain NCKX2. Conversely, the chicken type II
proteins show 80.8% identity with bovine rod NCKX1 and 91.6% identity
with rat brain NCKX2. The two types of chicken NCKX proteins show an
overall amino acid identity of 58.5%, but when only the two sets of
transmembrane-spanning segments are considered this identity increases
up to 82.6%.
Cloning of the Type II NCKX ortholog from human retina
The chicken type I NCKX cDNA showed greatest homology to mammalian
rod NCKX1. We earlier cloned the human retinal rod NCKX cDNA (Tucker et
al., 1998a ). Here, we describe molecular cloning of the human ortholog
of chicken Type II retinal NCKX. A partial human NCKX Type II sequence
was obtained by PCR amplification from human retinal cDNA. Using 5' and
3' RACE techniques, the full-length human cone NCKX cDNA, coding for a
protein of 661 amino acid residues, was completed. The human Type II
retinal NCKX showed 76.5 and 89.6% amino acid identity compared with
chicken Type II retinal NCKX and rat brain NCKX2, respectively (Fig.
1). Chicken and human Type II NCKX and
rat brain NCKX2 are spliced at exactly the same position, and the
17-residue-long splice-out shows only one amino acid change (the
chicken clone has an Asn at position 7 compared with a Lys residue in
the human and rat clones). The hydropathy plot places the alternatively
spliced region in the large hydrophilic loop in the cytosol; the
spliced-out region does not contain consensus sequences for kinases or
other regulatory factors.

View larger version (80K):
[in this window]
[in a new window]
|
Figure 1.
Comparison of chicken retinal rod and
cone NCKX with rat brain NCKX2 and human retinal cone NCKX.
Hu-Cone, Human cone NCKX; RaBrain, rat
brain NCKX2 (Tsoi et al., 1998 ); Ch-Cone, chicken cone
NCKX; Ch-Rod, chicken rod NCKX amino acid sequences. The
putative transmembrane segments are underlined. Regions
of alternative splicing for the two cone NCKX and brain NCKX2 are
double underlined. Alignments were made using ClustalW
1.7 and Boxshade 3.21. Black boxed amino acid indicates
identity in at least three proteins; gray boxed
indicates a conserved amino acid substitution with at least two
identical residues in the three other proteins.
|
|
Expression and distribution of NCKX mRNA in chicken retina
We used in situ hybridization to localize Type I and II
NCKX transcripts within the chicken retina. The chicken retina contains one type of rod and five types of cones. Rods are found at considerably lower density: one rod/three cones in the peripheral retina and one
rod/five cones in central retina (Morris, 1970 ). Using whole-mount in situ hybridization, the spatial and temporal aspects of
photoreceptor-specific molecules in the chick have been reported (Bruhn
and Cepko, 1996 ): the center of the retina has a rod-free zone (area
centralis) and contains all the cone types. Our Type II NCKX antisense
riboprobe strongly labeled the inner segments of the majority of the
photoreceptors (Fig.
2A,C);
staining was equally intense in the central (Fig. 2A)
as well as in the peripheral (Fig. 2C) retina. This staining pattern shows that retinal cones express Type II NCKX. Also, a clear
staining of the cone-type NCKX was observed the retinal ganglion cell
layer (GCL) in central and peripheral retina, but not all GCL cells
were positive (Fig. 2A,C). The
sense probes used as controls gave no specific staining (Fig.
2B,F,H). The full-length chicken Type I NCKX antisense riboprobe labeled a minority
of the inner segments (Fig. 2D); staining was strong in cell bodies at the base of the outer nuclear layer (ONL) close to
the outer plexiform layer (OPL) but tapered off toward the outer
limiting membrane (OLM). Type I NCKX staining was much more pronounced
in the peripheral retina compared with the central retina (data not
shown), and the staining pattern was very similar to that observed for
the rhodopsin antisense probe (Fig. 2E). From this we
conclude that our Type I retinal chicken NCKX represents rod NCKX,
consistent with the observation that chicken Type I showed highest
homology to the mammalian rod NCKX (see above).

View larger version (88K):
[in this window]
[in a new window]
|
Figure 2.
In situ hybridization in chicken
retina. Photomicrographs of cross sections of the chicken central
(A, B) and peripheral
(C-H) retina, stained for cone NCKX
(A, C), rod NCKX (D), and
rhodopsin (E) mRNA using their respective
antisense riboprobe. Sense riboprobe for cone NCKX (B,
F), rod NCKX (G), and rhodopsin
(H) mRNA were used as controls.
RPE, Retinal pigment epithelium; IS,
inner segments of photoreceptors; OS, outer segments of
photoreceptors; ONL, outer nuclear layer;
OPL, outer plexiform layer; INL, inner
nuclear layer; IPL, inner plexiform layer;
GCL, ganglion cell layer. Arrowheads
indicate the position of the outer limiting membrane
(OLM). Scale bar, 50 µm.
|
|
In further agreement with the correct identification of rod and cone
NCKX within the chicken retina, we observed that the rod NCKX
transcripts were found internal to the plane of the OLM of the retina,
toward the OPL, which corresponds in shape and location to the rod
photoreceptor inner segments. Cone NCKX transcripts in the
photoreceptor region are located outside the OLM, more toward the outer
segments (Fig. 2A,C), and staining
for cone NCKX transcripts was more homogeneous than for rod NCKX
transcripts. The above noted differences in the subcellular
localization of rod and cone transcripts in the photoreceptor layer
correspond well with observations that the nuclei of rods of
gallinaceous birds lie in the lower half of the ONL, whereas most
nuclei of the cones lie directly below the OLM (Ramon y Cajal, 1972 ;
Mariani, 1987 ). The apical extensions of the cone nuclei, the inner
segments, are located just external to the OLM, which corresponds well
with the localization of the cone NCKX transcripts illustrated in
Figure 2A,C.
Northern blot analysis of rod and cone NCKX transcripts in chicken
retina and brain
We used Northern hybridization analysis to examine expression
levels of the two chicken NCKX types in retina and brain because these
are the two tissues in which NCKX transcripts have been demonstrated
before (Reiländer et al., 1992 ; Tsoi et al., 1998 ). The Northern
blot shows that the probe for chicken rod NCKX hybridized strongly to a
retinal mRNA transcript of ~6.5 kb (Fig.
3A), similar in size to those
reported before for bovine (Reiländer et al., 1992 ) and human
(Tucker et al., 1998b ) rod NCKX1
poly(A+)-mRNA. The Northern blot also
shows that the probe for chicken cone NCKX hybridized strongly to a
single predominant retinal transcript of ~10.5 kb and also to a
similarly sized transcript in brain, albeit at a much lower level when
compared with retina (Fig. 3B, bottom
panel). We use human cone NCKX cDNA to probe a commercially
available human normal brain blot containing mRNAs from the frontal
lobe, temporal lobe, parietal lobe, occipital lobe, cerebellum, and
lung and observed a hybridizing band at 10.5 kb of approximately equal
intensity in all samples except for that from lung tissue (data not
shown). In a separate Northern blot, we compared RNA isolated from
human retina with human hippocampus RNA and observed a much stronger
signal from human retina after hybridization with a human cone NCKX
specific probe (data not illustrated), comparable to the results shown
for chicken.

View larger version (47K):
[in this window]
[in a new window]
|
Figure 3.
mRNA expression of NCKX in chicken retina and
brain. Total RNA (5 µg/lane) was separated on a 1%
formaldehyde/agarose gel. Northern hybridization was performed using
(A) [ -32P]dCTP-labeled chicken
retinal rod NCKX cDNA and (B) chicken retinal
cone NCKX cDNA as probes. The bottom panels show a
longer exposure of A and B. Lane
1, Total brain RNA (10-d-old chick); lane 2,
total brain RNA (adult); lane 3, total retinal RNA
(adult). The positions of the 28S and 18S ribosomal RNAs are
indicated.
|
|
Potassium-dependent Na-Ca exchange of rod and cone NCKX expressed
in insect cells
We examined functional expression of the different NCKX proteins
cloned here by measuring Nain-dependent
45Ca2+ uptake
in High Five cells representing so-called reverse Na-Ca exchange.
These experiments take advantage of the well established property of
NCKX proteins to mediate both calcium influx and calcium efflux
dependent on the direction of the sodium gradient. Reverse Na-Ca
exchange has previously been described in outer segments isolated from
bovine rod photoreceptors (Schnetkamp et al., 1989 ) and in cells
transfected with cDNA from the full-length dolphin retinal rod NCKX
(Cooper et al., 1999 ). High Five cells were loaded with high sodium
concentration with the use of the ionophore monensin as described in
Materials and Methods; this method was used before to examine reverse
Na-Ca exchange in retinal rod outer segments (Schnetkamp et al.,
1995 ).
We inserted the cDNAs of the various chicken and human NCKX cDNAs into
a novel insect cell expression vector (Lu et al., 1997 ; Farrell et al.,
1998 ) and generated clonal cell lines after stable transfection. In a
first set of experiments we used sodium-loaded High Five transformed
with our different NCKX cDNAs to measure 45Ca2+ uptake
into cells suspended in a high potassium medium and compare it with
45Ca2+ uptake
into cells suspended in high sodium medium (Fig.
4). High potassium medium provides
optimal support for potassium-dependent reverse Na-Ca exchange,
whereas high sodium inhibits reverse Na-Ca exchange. No difference was
observed in untransfected control cells between
45Ca2+ uptake
in high potassium medium and
45Ca2+ uptake
in high sodium medium (Fig. 4C). In contrast,
45Ca2+ uptake
in high potassium medium (filled circles) greatly
exceeded 45Ca2+ uptake
in high sodium medium (inverted triangles) when cells transfected with either of the two splice variants of the chicken cone
NCKX were examined (Fig. 4A,B).
These results are consistent with
45Ca2+ uptake
via reverse Na-Ca +K exchange. To further support the notion that the
large increase in
45Ca2+ uptake
in high potassium medium observed in sodium-loaded cells transfected
with cone NCKX represents reverse Na-Ca+K exchange, two additional
controls were performed. First, reverse Na-Ca exchange via the retinal
rod NCKX in sodium-loaded cells is not supported when the external
medium contains lithium without any potassium present; in contrast,
reverse Na-Ca exchange via the heart NCX1 operates independent of the
presence of potassium in the external medium (Schnetkamp and Szerencsei
1991 ; Schnetkamp et al., 1991a ; Cooper et al., 1999 ). Second, addition
of alkali cation ionophores such as monensin or gramicidin to
sodium-loaded High Five cells suspended in the high potassium medium
should result in a complete release of internal sodium to the
suspension medium and abolish reverse Na-Ca exchange, similar to what
we have shown before in the case of sodium-loaded rod outer segments
(Schnetkamp et al., 1995 ). When the above two control conditions were
applied to High Five cells transfected with either of the splice
variants of the chicken cone exchanger,
45Ca2+ uptake
was reduced from the high value observed in potassium medium to the
control level observed in the sodium medium (Fig. 4, square
and diamond symbols). Neither the presence of different alkali cations in the suspension medium nor addition of monensin had
any effect on
45Ca2+ uptake
in untransfected control cells (Fig. 4C). Similar
experiments were performed with High Five cells transfected with the
two splice variants of the human cone NCKX or with the chicken rod
NCKX: significant
45Ca2+ uptake
above that in untransfected control cells was only observed in the
potassium medium as illustrated here for the two chicken cone NCKXs
(also see Fig. 5). We compared the net
potassium-dependent component of
45Ca2+ uptake
observed in High Five cells transfected with the different rod and cone
NCKX cDNAs described here (Fig. 5): the shorter splice variants of the
two cone NCKXs consistently showed the highest potassium-dependent
Na-Ca exchange activity, whereas the lowest activity was observed for
the chicken rod NCKX. A very similar ranking was obtained when
potassium-dependent Na-Ca exchange activity was measured in other
clonal cell lines or in transiently transfected cells (data not
illustrated). Insect cells expressing chicken rod NCKX and cells
expressing either of the two splice variants of chicken cone NCKX
showed very similar levels of transcripts as detected on Northern blots
of RNA isolated from several clonal lines (data not shown).

View larger version (13K):
[in this window]
[in a new window]
|
Figure 4.
Potassium dependent
45Ca2+ uptake in High Five cells
transformed with the two chicken cone NCKX isoforms.
45Ca2+ uptake was measured in
sodium-loaded High Five cells expressing (A)
chicken cone NCKX splice variant, (B) chicken
full-length cone NCKX, and (C) untransfected
control cells (C). Incubation media contained 80 mM sucrose, 20 mM HEPES (adjusted to pH 7.4 with arginine), 5 µM EDTA, 35 µM
CaCl2, 1 µCi
45Ca2+, and 150 mM
KCl (filled circles), or 150 mM NaCl
(open inverted triangles), or 150 mM LiCl
(filled squares), or 150 mM KCl in
the presence of 1 µM monensin (open
diamonds). The temperature was 25°C.
|
|

View larger version (18K):
[in this window]
[in a new window]
|
Figure 5.
Net potassium-dependent
45Ca2+ uptake in High Five cells
transformed with the various chicken and human NCKX types.
45Ca2+ uptake was measured in
sodium-loaded High Five cells expressing chicken cone NCKX splice
variant (open diamonds), human cone NCKX splice variant
(open inverted triangles), human full-length cone NCKX
(filled squares), chicken full-length cone NCKX
(filled circles), and chicken rod NCKX
(filled triangles). Incubation media contained 80 mM sucrose, 20 mM HEPES (adjusted to pH 7.4 with arginine), 5 µM EDTA, 35 µM
CaCl2, 1 µCi
45Ca2+, and 150 mM
KCl. The temperature was 25°C.
|
|
Properties of the potassium binding site of different
NCKX proteins
The external potassium dependence of reverse Na-Ca+K exchange in
isolated retinal rod outer segments varies markedly with the presence
of other alkali cations in the medium (Schnetkamp and Szerencsei, 1991 ;
Schnetkamp et al., 1995 ). Here, we examined the external potassium
dependence of reverse Na-Ca exchange in cells transfected with the
different NCKX cDNAs in a medium in which either lithium chloride or
choline chloride was the major constituent. We compared the results
obtained with the different NCKX cDNAs with results obtained in
isolated bovine retinal rod outer segments under identical sodium
loading and medium conditions. Figure 6
illustrates the potassium dependence of
45Ca2+ uptake
in choline versus lithium medium for High Five cells expressing the
short splice variant of human cone NCKX. The right-hand
panel of Figure 6 shows that
45Ca2+ uptake
in sodium medium or in lithium medium without potassium was very
similar and represents background
45Ca2+ uptake
observed in untransfected control cells. When the external potassium
concentration was increased by iso-osmotic substitution of lithium
chloride by potassium chloride, a gradual increase in both the rate and
final level of
45Ca2+ uptake
was observed (half-maximal at ~15 mM
potassium). As shown in Figure 4, this potassium-dependent increase was
only observed in cells transfected with NCKX cDNAs and not in
untransfected control cells. When the experiment was repeated with
choline chloride replacing lithium chloride in the suspension medium
(Fig. 6, left panel), a small but significant
increase in
45Ca2+ uptake
was observed in potassium-free choline medium when compared with
45Ca2+ uptake
in sodium medium (compare filled diamonds with open
diamonds). Furthermore, when the external potassium concentration
was increased by iso-osmotic substitution of choline chloride by
potassium chloride, both the rate and final level of
45Ca2+ uptake
increased at much lower potassium concentrations (half-maximal at ~2
mM potassium) when compared with those observed
in lithium medium. A very similar pattern of potassium-dependent uptake
in choline versus lithium medium was observed in isolated bovine rod
outer segments and in High Five cells transfected with the other NCKX
clones. The results are summarized in Figure
7. The initial rate of
45Ca2+ uptake
was represented by the average of the first three time points at 5, 30, and 60 sec, respectively, and the rate was normalized with respect to
the maximal rate observed in full 150 mM
potassium medium. Each of the six NCKX proteins tested showed a large
(5- to 10-fold) shift in potassium dependence when uptake in choline medium was compared with that in lithium medium. Half-maximal activation of bovine rod outer segment NCKX and the two splice variants
of chicken cone NCKX was observed at approximately twofold lower
potassium concentrations (both in choline and in lithium medium) when
compared with values observed for chicken rod or for the two splice
variants of human NCKX. All six NCKX proteins showed a significant
potassium-independent component when assayed in choline medium but not
in lithium medium (data not shown).

View larger version (24K):
[in this window]
[in a new window]
|
Figure 6.
Potassium dependence of
45Ca2+ uptake in High Five cells
transformed with the human cone NCKX splice variant.
45Ca2+ uptake was measured in
sodium-loaded High Five cells expressing human cone NCKX splice variant
as a function of external potassium concentration as described in the
legend of Figure 4. Media contained either 150 mM choline
chloride (left panel) or 150 mM LiCl
(right panel), or 150 mM NaCl
(open diamonds in both panels). In the
left-hand panel, KCl concentration was increased by iso-osmotic
substitution of choline chloride to final concentrations of 150 mM (filled circles), 20 mM (open circles), 5 mM
(filled inverted triangles), 1 mM
(open inverted triangles), 0.5 mM
(filled squares), 0.1 mM (open
squares), or no KCl (filled diamonds). In
the right-hand panel, KCl concentration was increased by iso-osmotic
substitution of LiCl to final concentrations of 150 mM
(filled circles), 20 mM (open
circles), 10 mM (filled inverted
triangles), 5 mM (open inverted
triangles), 2 mM (filled
squares), 1 mM (open squares), or no
KCl (filled diamonds). The temperature was
25°C.
|
|

View larger version (15K):
[in this window]
[in a new window]
|
Figure 7.
Comparison of the potassium dependence of
45Ca2+ uptake in High Five cells
transformed with different NCKX cDNAs used in this study. Initial rates
of potassium-dependent 45Ca2+ uptake
(average of the first three time points) were obtained for cells
transformed with the different NCKX cDNAs in either LiCl or choline
chloride medium as illustrated in Figure 6. Left panel,
Potassium dependence in LiCl medium. Right panel,
Potassium-dependence in choline chloride medium. Potassium dependence
was measured in both media for cells transformed with human full-length
cone NCKX (open diamonds), chicken full-length cone NCKX
(filled squares), chicken cone NCKX splice
variant (open inverted triangles), human cone NCKX
splice variant (filled circles), chicken rod NCKX
(filled triangles), or bovine rod outer segment
NCKX (open hexagonals).
|
|
 |
DISCUSSION |
A dynamic equilibrium between calcium influx via the cGMP-gated
channels and extrusion via the Na-Ca+K exchanger is thought to control
the intracellular free calcium concentration in the outer segments of
both retinal rods and cones. The presence of Na-Ca exchange was
previously demonstrated in salamander cone outer segments, and the
time-constant of the light-induced decline of the exchanger current and
changes in the intracellular free calcium concentration were shown to
be much faster in cones when compared with rods (Nakatani and Yau,
1988 , Nakatani and Yau, 1989 ; Hestrin and Korenbrot, 1990 ; Sampath et
al., 1999 ). By analogy with rod photoreceptors, it was thought that a
Na-Ca+K exchanger operates in cone outer segments, but the identity of
the cone exchanger had not yet been established, nor was it clear
whether the cone exchanger belongs to the NCX or the NCKX family. In
this report we used molecular cloning to isolate two splice variants of
the gene products of both a chicken and human cone Na-Ca+K exchanger.
In addition, we have cloned the cDNA of the chicken rod Na-Ca+K
exchanger. We used in situ hybridization to identify the
distinct rod and cone exchangers after localizing their transcripts to
the inner segment of rods and cone photoreceptors, respectively.
Rod and cone Na-Ca+K exchangers: sequence comparison
The chicken rod or cone NCKX cDNAs code for surprisingly small
proteins of 634-663 residues compared with the much larger NCKX
proteins (1013-1216 residues) described previously from different mammalian rods (Reiländer et al., 1992 ; Tucker et al., 1998a ; Cooper et al., 1999 ). The size difference makes a comparison of overall
identity percentages difficult to interpret because the two large
hydrophilic loops are of considerably different length and are quite
variable, even when comparing the different mammalian rod NCKX
sequences. When we limit the comparison to the two sets of proposed
transmembrane spanning segments, chicken rod NCKX shows greatest
similarity to mammalian rod NCKX, whereas chicken and human cone NCKX
show greater identity to the similarly sized rat brain NCKX2 (Tsoi et
al., 1998 ). When compared with the entire rat brain NCKX2 sequence,
chicken rod NCKX shows 55.1% identity, chicken cone NCKX shows 76.5%
identity, and human cone NCKX shows 89.6% identity. Northern analysis
showed that cone-type NCKX transcripts are considerably more abundant
in human or chicken retina when compared with human or chicken brain,
respectively (Fig. 3). When sequence comparison is limited to the
proposed transmembrane spanning segments for all the vertebrate NCKX
clones described to date, NCKX proteins fall clearly into two groups:
the rod NCKX on the one hand and the cone and brain NCKX on the other
hand (Fig. 8). The alignment identifies
several residues that could be used to distinguish between the two
groups and may provide useful targets for mutagenesis if functional
analysis would reveal significant differences in cation transport
properties between the two groups (see below).

View larger version (69K):
[in this window]
[in a new window]
|
Figure 8.
Comparison of four types of rod NCKX and three
types of cone NCKX/NCKX2 in the first (A) and
second (B) transmembrane spanning segment.
Bo-Rod, Bovine rod NCKX1 (Reiländer et al., 1992 );
Do-Rod, dolphin rod NCKX1 (Cooper et al., 1999 );
Hu-Rod, human rod NCKX1 (Tucker et al., 1998a );
Ch-Rod, chicken rod NCKX; Hu-Cone, human
cone NCKX; Ra-Brain, rat brain NCKX2 (Tsoi et al.,
1998 ); Ch-Cone, chicken cone NCKX amino acid sequences.
Alignments were made using ClustalW 1.7 and Boxshade 3.21. The putative
transmembrane segments are overlined, and
the -repeat motifs as originally identified by Schwarz and Benzer
(1997) are double underlined. Black boxed
amino acid indicates identity in at least four proteins; gray
boxed indicates a conserved amino acid substitution with at
least three identical residues in the other sequences at the same
position.
|
|
Localization of NCKX transcripts in retina
Our in situ hybridization results clearly show a
colocalization of chicken rod NCKX and rhodopsin to the inner segment
of rod photoreceptors, whereas cone NCKX transcripts were found in the
cone inner segment layer and in a subpopulation of ganglion cells (Fig.
2). The extent of hybridization also shows that the majority of cones
express the same gene product, but we cannot completely exclude the
possibility that one of the five different types of chicken cones would
express a different NCKX gene product. Rod NCKX1 and the rod cGMP-gated
channels are found to be associated in bovine rod outer segments (Bauer
and Drechsler, 1992 ). Nonsensory cGMP-gated channels have been
identified in retinal ganglion cells by whole-cell patch-clamp studies
(Ahmad et al., 1994 ; Thompson, 1997 ; Kawai and Sterling, 1999 ). This
may suggest that NCKX proteins can be found in cells expressing
cGMP-gated channels and play a crucial role in extruding calcium that
enters cells via the nonspecific cGMP-gated channels.
Cone NCKX cDNAs code for potassium-dependent Na-Ca exchangers
Functional analysis of rod NCKX proteins after heterologous
expression has previously yielded some apparently conflicting results.
In our hands, neither the full-length bovine nor human rod NCKX1
yielded Na-Ca exchange activity in a number of different heterologous
systems, whereas the full-length dolphin rod NCKX1 yielded
potassium-dependent Na-Ca exchange after transfection into HEK293
(Cooper et al., 1999 ). In contrast, Navangione et al. (1997) used
transient transfection of HEK293 cells with full-length bovine NCKX1
and observed Na-Ca exchange currents that did not depend on potassium;
these authors suggest that potassium dependence may be conferred on the
NCKX1 protein by a yet to be identified accessory component/protein. In
this study we used stable transfection into insect High Five cells, and
we observed with all five NCKX cDNAs described here that
Nain-dependent calcium uptake (reverse Na-Ca
exchange) was completely dependent on external potassium and internal
sodium (Figs. 4, 5). Moreover, we observed a large shift in potassium
affinity in isolated bovine rod outer segments when reverse Na-Ca
exchange in choline medium was compared with that in lithium medium.
When we tested High Five cells transfected with our different NCKX
clones for this distinct feature of the potassium binding site, we
observed in all cases a 5- to 10-fold decrease in potassium dependence
when calcium uptake in choline medium was compared with that in lithium
medium; in choline medium, the Km for
potassium ranged between 0.5 and 3 mM, whereas in
lithium this value ranged between 7 and 15 mM
(Figs. 6, 7). Similar observations were made with the full-length
dolphin NCKX1, with a deletion mutant of bovine NCKX1 in which most of
the two large hydrophilic loops was removed, and with an NCKX
paralog cloned from Caenorhabditis elegans (Szerencsei et
al., 2000 ). From these results we conclude that the potassium binding
site conferring potassium dependence on the Na-Ca+K exchanger is an
integral part of the NCKX protein and does not require any additional
factors or proteins.
All NCKX proteins tested in our lab in the High Five cell system shared
a very similar potassium dependence with that observed in isolated
bovine rod outer segments. In contrast, the maximal calcium transport
activity observed for reverse Na-Ca exchange varied significantly
among the different NCKX proteins. Net potassium-dependent calcium
uptake was lowest for chicken rod NCKX (0.3 nmol calcium/mg protein),
comparable to values between 0.4 and 0.6 nmol calcium/mg protein
observed in another study for full-length dolphin rod NCKX1 and a
deletion mutant of bovine NCKX1 (Szerencsei et al., 2000 ). In contrast,
the short splice variant of the human and chicken cone NCKX showed
severalfold higher calcium uptake activities of ~3 nmol calcium/mg
protein (Fig. 5). The high activity of these cone NCKX clones was
consistently observed in different clonal cell lines and in transiently
transfected cells (data not illustrated). This could merely reflect
different protein levels (although transcript levels appeared
comparable) or different amounts of properly processed protein.
However, it is tempting to speculate that the difference in transport
capacity may represent differences in turnover number for rod and cone
NCKX, respectively, and may reflect the differences observed for
calcium fluxes in cones versus rods. Profound differences in calcium
permeation have been observed for the cGMP-gated cation channels in rod
and cone photoreceptors, respectively; the fraction of the dark current
that is carried by calcium ions is much greater in cone cGMP-gated
channels compared with rod cGMP-gated channels (Perry and McNaughton,
1991 ; Frings et al., 1995 ; Picones and Korenbrot, 1995 ; Dzeja et al.,
1999 ). Furthermore, direct measurements of light-induced changes in
outer segment calcium concentration revealed that the calcium
concentration in the cone outer segment varies over a 75-fold dynamic
range in red-sensitive cones, a value more than three times greater
than in rods of the same species, with time constants three to six
times faster than in rods (Sampath et al., 1998 , 1999 ). The faster time
constant of light-induced changes in calcium could also be interpreted
to indicate that the calcium buffer capacity of rod outer segments
significantly exceeds that in cone outer segments. The
calcium-sensitive sites within the phototransduction cascade are likely
to be influenced more profoundly in cones during exposure to steady
light than in rods and therefore may reflect a more powerful modulation
of calcium-sensitive processes in cones than in rods (Yau, 1994 ), as
has been established for the ligand sensitivity of cGMP-gated ion
channels (Miller et al., 1994 ; Rebrik and Korenbrot, 1998 ). Further
studies on the rod and cone NCKX may elucidate whether functional
differences between the two exchangers contribute significantly to the
observed differences in rod and cone physiology.
 |
FOOTNOTES |
Received Sept. 7, 1999; revised Nov. 22, 1999; accepted Nov. 24, 1999.
This work was supported by operating grants from the Medical Research
Council of Canada (MRC) to P.P.M.S. and to the MRC Group on Ion
Channels and Transporters, and the Canadian RP Foundation (P.P.M.S.)
and by the Alberta Heritage Foundation for Medical Research (AHFMR).
C.F.M.P. is a recipient of an AHFMR fellowship; P.P.M.S. is an AHFMR
Medical Scientist. We thank Dr. U. B. Kaupp (Forschungszentrum
Jülich, Institut für Biologische Informationsverarbeitung, Jülich, Germany) for his kind gift of the chicken retinal cDNA libraries, Drs. P. J. Farrell and K. Iatrou (Department of
Biochemistry and Molecular Biology, University of Calgary) for
providing the insect transfection vector pIE1/153A, Dr. D. Rancourt for
use of the paraffin mounting equipment and microtome, and Dr. W. K. Stell for discussion of the in situ hybridization results.
Sequence data from this study have been deposited with the
GenBank/European Molecular Biology Laboratory Data Libraries under accession numbers AF097366 and AF177984-AF177987.
Correspondence should be addressed to Dr. Paul P. M. Schnetkamp,
University of Calgary, Faculty of Medicine, 3330 Hospital Drive N.W.,
Calgary, Alberta, Canada T2N 4N1. E-mail:
pschnetk{at}ucalgary.ca.
 |
REFERENCES |
-
Ahmad I,
Leinders-Zufall T,
Kocsis JD,
Shepherd GM,
Zufall F,
Barnstable CJ
(1994)
Retinal ganglion cells express a cGMP-gated cation conductance activatable by nitric oxide donors.
Neuron
12:155-165[Web of Science][Medline].
-
Bauer PJ,
Drechsler M
(1992)
Association of cyclic GMP-gated channels and Na+-Ca2+-K+ exchangers in bovine retinal rod outer segment plasma membranes.
J Physiol (Lond)
451:109-131[Abstract/Free Full Text].
-
Blaustein MP,
Lederer WJ
(1999)
Sodium/calcium exchange: its physiological implications.
Physiol Rev
79:763-854[Abstract/Free Full Text].
-
Bönigk W,
Altenhofen W,
Müller F,
Dose A,
Illing M,
Molday RS,
Kaupp UB
(1993)
Rod and cone photoreceptor cells express distinct genes for cGMP-gated channels.
Neuron
10:865-877[Web of Science][Medline].
-
Breitschopf H,
Suchanek G
(1996)
In: Nonradioactive in situ hybridization application manual, Ed 2, pp 136-140. Mannheim, Germany: Boehringer Mannheim.
-
Bruhn SL,
Cepko CL
(1996)
Development of the pattern of photoreceptors in the chick retina.
J Neurosci
16:1430-1439[Abstract/Free Full Text].
-
Cervetto L,
Lagnado L,
Perry RJ,
Robinson DW,
McNaughton PA
(1989)
Extrusion of calcium from rod outer segments is driven by both sodium and potassium gradients.
Nature
337:740-743[Medline].
-
Cooper CB,
Winkfein RJ,
Szerencsei RT,
Schnetkamp PPM
(1999)
cDNA cloning and functional expression of the dolphin retinal rod Na-Ca+K exchanger NCKX1: comparison with the functionally silent bovine NCKX1.
Biochemistry
38:6276-6283[Medline].
-
Dzeja C,
Hagen V,
Kaupp UB,
Frings S
(1999)
Ca2+ permeation in cyclic nucleotide-gated channels.
EMBO J
18:131-144[Web of Science][Medline].
-
Farrell PJ,
Lu ML,
Prevost J,
Brown C,
Behie L,
Iatrou K
(1998)
High-level expression of secreted glycoproteins in transformed lepidopteran insect cells using a novel expression vector.
Biotechnol Bioeng
60:656-663[Web of Science][Medline].
-
Frings S,
Seifert R,
Godde M,
Kaupp UB
(1995)
Profoundly different calcium permeation and blockage determine the specific function of distinct cyclic nucleotide-gated channels.
Neuron
15:169-179[Web of Science][Medline].
-
Gray-Keller MP,
Detwiler PB
(1994)
The calcium feedback signal in the phototransduction cascade of vertebrate rods.
Neuron
13:849-861[Web of Science][Medline].
-
Haase W,
Friese W,
Gordon RD,
Muller H,
Cook NJ
(1990)
Immunological characterization and localization of the Na+/Ca2+-exchanger in bovine retina.
J Neurosci
10:1486-1494[Abstract].
-
Hestrin S,
Korenbrot JI
(1990)
Activation kinetics of retinal cones and rods: response to intense flashes of light.
J Neurosci
10:1967-1973[Abstract].
-
Kawai F,
Sterling P
(1999)
AMPA receptor activates a G-protein that suppresses a cGMP-gated current.
J Neurosci
19:2954-2959[Abstract/Free Full Text].
-
Kim TS,
Reid DM,
Molday RS
(1998)
Structure-function relationships and localization of the Na/Ca-K exchanger in rod photoreceptors.
J Biol Chem
273:16561-16577[Abstract/Free Full Text].
-
Korenbrot JI
(1995)
Ca2+ flux in retinal rod and cone outer segments: differences in Ca2+ selectivity of the cGMP-gated ion channels and Ca2+ clearance rates.
Cell Calcium
18:285-300[Web of Science][Medline].
-
Lagnado L,
Cervetto L,
McNaughton PA
(1988)
Ion transport by the Na-Ca exchange in isolated rod outer segments.
Proc Natl Acad Sci USA
85:4548-4552[Abstract/Free Full Text].
-
Lu M,
Farrell PJ,
Johnson R,
Iatrou K
(1997)
A baculovirus (Bombyx mori nuclear polyhedrosis virus) repeat element functions as a powerful constitutive enhancer in transfected insect cells.
J Biol Chem
272:30724-30728[Abstract/Free Full Text].
-
Mariani AP
(1987)
Neuronal and synaptic organization of the outer plexiform layer of the pigeon retina.
Am J Anat
179:25-39[Web of Science][Medline].
-
McNaughton PA,
Cervetto L,
Nunn BJ
(1986)
Measurement of the intracellular free calcium concentration in salamander rods.
Nature
322:261-263.
-
Miller JL,
Picones A,
Korenbrot JI
(1994)
Differences in transduction between rod and cone photoreceptors: an exploration of the role of calcium homeostasis.
Curr Opin Neurobiol
4:488-495[Medline].
-
Morris VB
(1970)
Symmetry in a receptor mosaic demonstrated in the chick from the frequencies, spacing and arrangement of the types of retinal receptor.
J Comp Neurol
140:359-398[Web of Science][Medline].
-
Nakatani K,
Yau KW
(1988)
Calcium and light adaptation in retinal rods and cones.
Nature
334:69-71[Medline].
-
Nakatani K,
Yau KW
(1989)
Sodium-dependent calcium extrusion and sensitivity regulation in retinal cones of the salamander.
J Physiol (Lond)
409:525-548[Abstract/Free Full Text].
-
Navangione A,
Rispoli G,
Gabellini N,
Carafoli E
(1997)
Electrophysiological characterization of ionic transport by the retinal exchanger expressed in human embryonic kidney cells.
Biophys J
73:45-51[Web of Science][Medline].
-
Perry RJ,
McNaughton PA
(1991)
Response properties of cones from the retina of the tiger salamander.
J Physiol (Lond)
443:561-587.
-
Picones A,
Korenbrot JI
(1995)
Permeability and interaction of Ca2+ with cGMP-gated ion channels differ in retinal rod and cone photoreceptors.
Biophys J
69:120-127[Web of Science][Medline].
-
Ramon y Cajal S
(1972)
The retina of birds.
In: The structure of the retina (Thorpe SA,
Glickstein M,
eds), pp 76-92. Springfield, IL: Charles C. Thomas.
-
Rebrik TI,
Korenbrot JI
(1998)
In intact cone photoreceptors, a Ca2+-dependent, diffusible factor modulates the cGMP-gated ion channels differently than in rods.
J Gen Physiol
112:537-548[Abstract/Free Full Text].
-
Reid DM,
Friedel U,
Molday RS,
Cook NJ
(1990)
Identification of the sodium-calcium exchanger as the major ricin-binding glycoprotein of bovine rod outer segments and its localization to the plasma membrane.
Biochemistry
29:1601-1607[Medline].
-
Reiländer H,
Achilles A,
Friedel U,
Maul G,
Lottspeich F,
Cook NJ
(1992)
Primary structure and functional expression of the Na/Ca, K-exchanger from bovine rod photoreceptors.
EMBO J
11:1689-1695[Web of Science][Medline].
-
Sampath AP,
Matthews HR,
Cornwall MC,
Fain GL
(1998)
Bleached pigment produces a maintained decrease in outer segment Ca2+ in salamander rods.
J Gen Physiol
111:53-64[Abstract/Free Full Text].
-
Sampath AP,
Matthews HR,
Cornwall MC,
Bandarchi J,
Fain GL
(1999)
Light-dependent changes in outer segment free-Ca2+ concentration in salamander cone photoreceptors.
J Gen Physiol
113:267-277[Abstract/Free Full Text].
-
Schaeren-Wiemers N,
Gerfin-Moser A
(1993)
A single protocol to detect transcripts of various types and expression levels in neural tissue and cultured cells: in situ hybridization using digoxigenin-labelled cRNA probes.
Histochemistry
100:431-440[Web of Science][Medline].
-
Schnetkamp PPM,
Szerencsei RT
(1991)
Effect of potassium ions and membrane potential on the Na-Ca-K exchanger in isolated intact bovine rod outer segments.
J Biol Chem
266:189-197[Abstract/Free Full Text].
-
Schnetkamp PPM,
Basu DK,
Szerencsei RT
(1989)
Na+-Ca2+ exchange in bovine rod outer segments requires and transports K+.
Am J Physiol
257:C153-C157[Abstract/Free Full Text].
-
Schnetkamp PPM,
Li XB,
Basu DK,
Szerencsei RT
(1991a)
Regulation of free cytosolic Ca2+ concentration in the outer segments of bovine retinal rods by Na-Ca-K exchange measured with fluo-3. I. Efficiency of transport and interactions between cations.
J Biol Chem
266:22975-22982[Abstract/Free Full Text].
-
Schnetkamp PPM,
Szerencsei RT,
Basu DK
(1991b)
Unidirectional Na+, Ca2+, and K+ fluxes through the bovine rod outer segment Na-Ca-K exchanger.
J Biol Chem
266:198-206[Abstract/Free Full Text].
-
Schnetkamp PPM,
Tucker JE,
Szerencsei RT
(1995)
Ca2+ influx into bovine retinal rod outer segments mediated by Na+/Ca2+/K+ exchange.
Am J Physiol
269:C1153-1159[Abstract/Free Full Text].
-
Schwarz EM,
Benzer S
(1997)
Calx, a Na-Ca exchanger gene of Drosophila melanogaster.
Proc Natl Acad Sci USA
94:10249-10254[Abstract/Free Full Text].
-
Szerencsei RT,
Tucker JE,
Cooper CB,
Winkfein RJ,
Farrell PJ,
Iatrou K,
Schnetkamp PPM
(2000)
Minimal domain requirement for cation transport by the potassium-dependent Na/Ca-K exchanger: comparison with a NCKX paralog from Caenorhabditis elegans.
J Biol Chem
275:669-676[Abstract/Free Full Text]
-
Thompson SH
(1997)
Cyclic GMP-gated channels in a sympathetic neuron cell line.
J Gen Physiol
110:155-164[Abstract/Free Full Text].
-
Tsoi M,
Rhee KH,
Bungard D,
Li XF,
Lee SL,
Auer RN,
Lytton J
(1998)
Molecular cloning of a novel potassium-dependent sodium-calcium exchanger from rat brain.
J Biol Chem
273:4155-4162[Abstract/Free Full Text].
-
Tucker JE,
Winkfein RJ,
Cooper CB,
Schnetkamp PPM
(1998a)
cDNA cloning of the human retinal rod Na-Ca+K exchanger: comparison with a revised bovine sequence.
Invest Ophthalmol Vis Sci
39:435-440[Abstract].
-
Tucker JE,
Winkfein RJ,
Murthy SK,
Friedman JS,
Walter MA,
Demetrick DJ,
Schnetkamp PPM
(1998b)
Chromosomal localization and genomic organization of the human retinal rod Na-Ca+K exchanger.
Hum Genet
103:411-414[Web of Science][Medline].
-
Yau KW
(1994)
Phototransduction mechanism in retinal rods and cones. The Friedenwald Lecture.
Invest Ophthalmol Vis Sci
35:9-32[Free Full Text].
-
Yau KW,
Nakatani K
(1984)
Electrogenic Na-Ca exchange in retinal rod outer segment.
Nature
311:661-663[Medline].
Copyright © 2000 Society for Neuroscience 0270-6474/00/2041424-11$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
D.-G. Luo, T. Xue, and K.-W. Yau
How vision begins: An odyssey
PNAS,
July 22, 2008;
105(29):
9855 - 9862.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. S. Ginger, S. E. Askew, R. M. Ogborne, S. Wilson, D. Ferdinando, T. Dadd, A. M. Smith, S. Kazi, R. T. Szerencsei, R. J. Winkfein, et al.
SLC24A5 Encodes a trans-Golgi Network Protein with Potassium-dependent Sodium-Calcium Exchange Activity That Regulates Human Epidermal Melanogenesis
J. Biol. Chem.,
February 29, 2008;
283(9):
5486 - 5495.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Cuomo, R. Gala, G. Pignataro, F. Boscia, A. Secondo, A. Scorziello, A. Pannaccione, D. Viggiano, A. Adornetto, P. Molinaro, et al.
A Critical Role for the Potassium-Dependent Sodium-Calcium Exchanger NCKX2 in Protection against Focal Ischemic Brain Damage
J. Neurosci.,
February 27, 2008;
28(9):
2053 - 2063.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. C. Corbo, C. A. Myers, K. A. Lawrence, A. P. Jadhav, and C. L. Cepko
A typology of photoreceptor gene expression patterns in the mouse
PNAS,
July 17, 2007;
104(29):
12069 - 12074.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Visser and J. Lytton
K+-Dependent Na+/Ca2+ Exchangers: Key Contributors to Ca2+ Signaling
Physiology,
June 1, 2007;
22(3):
185 - 192.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Visser, V. Valsecchi, L. Annunziato, and J. Lytton
Analysis of Ion Interactions with the K+ -dependent Na+/Ca+ Exchangers NCKX2, NCKX3, and NCKX4: IDENTIFICATION OF THR-551 AS A KEY RESIDUE IN DEFINING THE APPARENT K+ AFFINITY OF NCKX2
J. Biol. Chem.,
February 16, 2007;
282(7):
4453 - 4462.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. F. Altimimi and P. P. M. Schnetkamp
Na+-dependent Inactivation of the Retinal Cone/Brain Na+/Ca2+-K+ Exchanger NCKX2
J. Biol. Chem.,
February 9, 2007;
282(6):
3720 - 3729.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Paillart, R. J. Winkfein, P. P.M. Schnetkamp, and J. I. Korenbrot
Functional Characterization and Molecular Cloning of the K+-dependent Na+/Ca2+ Exchanger in Intact Retinal Cone Photoreceptors
J. Gen. Physiol.,
January 1, 2007;
129(1):
1 - 16.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X.-F. Li, L. Kiedrowski, F. Tremblay, F. R. Fernandez, M. Perizzolo, R. J. Winkfein, R. W. Turner, J. S. Bains, D. E. Rancourt, and J. Lytton
Importance of K+-dependent Na+/Ca2+-exchanger 2, NCKX2, in Motor Learning and Memory
J. Biol. Chem.,
March 10, 2006;
281(10):
6273 - 6282.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Rizzuto and T. Pozzan
Microdomains of Intracellular Ca2+: Molecular Determinants and Functional Consequences
Physiol Rev,
January 1, 2006;
86(1):
369 - 408.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K.-J. Kang, T. G. Kinjo, R. T. Szerencsei, and P. P. M. Schnetkamp
Residues Contributing to the Ca2+ and K+ Binding Pocket of the NCKX2 Na+/Ca2+-K+ Exchanger
J. Biol. Chem.,
February 25, 2005;
280(8):
6823 - 6833.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K.-J. Kang, Y. Shibukawa, R. T. Szerencsei, and P. P. M. Schnetkamp
Substitution of a Single Residue, Asp575, Renders the NCKX2 K+-dependent Na+/Ca2+ Exchanger Independent of K+
J. Biol. Chem.,
February 25, 2005;
280(8):
6834 - 6839.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Cai and J. Lytton
The Cation/Ca2+ Exchanger Superfamily: Phylogenetic Analysis and Structural Implications
Mol. Biol. Evol.,
September 1, 2004;
21(9):
1692 - 1703.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Cai and J. Lytton
Molecular Cloning of a Sixth Member of the K+-dependent Na+/Ca2+ Exchanger Gene Family, NCKX6
J. Biol. Chem.,
February 13, 2004;
279(7):
5867 - 5876.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M.-H. Kim, S.-h. Lee, K. H. Park, W.-K. Ho, and S.-H. Lee
Distribution of K+-Dependent Na+/Ca2+ Exchangers in the Rat Supraoptic Magnocellular Neuron Is Polarized to Axon Terminals
J. Neurosci.,
December 17, 2003;
23(37):
11673 - 11680.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X.-F. Li, A. S. Kraev, and J. Lytton
Molecular Cloning of a Fourth Member of the Potassium-dependent Sodium-Calcium Exchanger Gene Family, NCKX4
J. Biol. Chem.,
December 6, 2002;
277(50):
48410 - 48417.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Cai, K. Zhang, and J. Lytton
A Novel Topology and Redox Regulation of the Rat Brain K+-dependent Na+/Ca2+ Exchanger, NCKX2
J. Biol. Chem.,
December 6, 2002;
277(50):
48923 - 48930.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-H. Lee, M.-H. Kim, K. H. Park, Y. E. Earm, and W.-K. Ho
K+-Dependent Na+/Ca2+ Exchange Is a Major Ca2+ Clearance Mechanism in Axon Terminals of Rat Neurohypophysis
J. Neurosci.,
August 15, 2002;
22(16):
6891 - 6899.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Sharon, H. Yamamoto, T. L. McGee, V. Rabe, R. T. Szerencsei, R. J. Winkfein, C. F. M. Prinsen, C. S. Barnes, S. Andreasson, G. A. Fishman, et al.
Mutated Alleles of the Rod and Cone Na-Ca+K-Exchanger Genes in Patients with Retinal Diseases
Invest. Ophthalmol. Vis. Sci.,
June 1, 2002;
43(6):
1971 - 1979.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-H. Su and V. D. Vacquier
A flagellar K+-dependent Na+/Ca2+ exchanger keeps Ca2+ low in sea urchin spermatozoa
PNAS,
May 14, 2002;
99(10):
6743 - 6748.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Kraev, B. D. Quednau, S. Leach, X.-F. Li, H. Dong, R. Winkfein, M. Perizzolo, X. Cai, R. Yang, K. D. Philipson, et al.
Molecular Cloning of a Third Member of the Potassium-dependent Sodium-Calcium Exchanger Gene Family, NCKX3
J. Biol. Chem.,
June 15, 2001;
276(25):
23161 - 23172.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Dong, P. E. Light, R. J. French, and J. Lytton
Electrophysiological Characterization and Ionic Stoichiometry of the Rat Brain K+-dependent Na+/Ca2+ Exchanger, NCKX2
J. Biol. Chem.,
July 6, 2001;
276(28):
25919 - 25928.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|