 |
Previous Article | Next Article 
The Journal of Neuroscience, April 1, 2000, 20(7):2504-2511
Regulation of Long-Term Potentiation by H-Ras through NMDA
Receptor Phosphorylation
Toshiya
Manabe3, 4,
Atsu
Aiba1,
Atsushi
Yamada1,
Taeko
Ichise1,
Hiroyuki
Sakagami5,
Hisatake
Kondo5, and
Motoya
Katsuki1, 2
1 Division of DNA Biology and Embryo Engineering,
Center for Experimental Medicine and 2 Core Research for
Evolutional Science and Technology (CREST), The Institute of Medical
Science, University of Tokyo, Tokyo 108-8639, Japan,
3 Department of Neurophysiology, Faculty of Medicine,
University of Tokyo, Tokyo 113-0033, Japan, 4 Department
of Physiology, Kobe University School of Medicine, Kobe 650-0017,
Japan, and 5 Division of Histology, Department of Cell
Biology, Graduate School of Medical Sciences, Tohoku University, Sendai
980-8575, Japan
 |
ABSTRACT |
The proto-oncogene ras plays a critical role in cell
proliferation and differentiation. However, ras genes
are abundantly expressed in the adult CNS, although neuronal
cells normally do not proliferate. Recently, several lines of evidence
implicated the involvement of Ras signaling pathway in synaptic
plasticity. To explore the role of the Ras proteins in the CNS, we
generated knock-out mice lacking the H-ras gene and then
used them to study the roles of Ras in synaptic transmission and
plasticity. An investigation of protein phosphorylation and synaptic
transmission in H-ras null mutant mice has shown that
the NMDA receptor is a final target molecule of the Ras protein pathway
in the CNS. In the H-ras null mutant hippocampus, the
tyrosine phosphorylation of NR2A ( 1) and NR2B ( 2) subunits of
NMDA receptors is increased, and, correspondingly, NMDA synaptic
responses are selectively enhanced. In addition, long-term
potentiation is markedly enhanced in mutant mice, most likely
because of a selective enhancement of NMDA synaptic responses. Therefore, although Ras proteins have been implicated in cell proliferation and differentiation, the regulation of activity-dependent synaptic plasticity in the adult animals by downregulation of the
phosphorylation of the NMDA receptor may be another major and pivotal
role for H-Ras protein.
Key words:
long-term potentiation; NMDA receptor; H-Ras; tyrosine
phosphorylation; hippocampus; mutant mice
 |
INTRODUCTION |
It is well established that
proto-oncogene ras plays a critical role in cell
proliferation and differentiation, as well as in oncogenesis (Lowy and
Willumsen, 1993 ). In mammals, three distinct ras genes
(H-ras, N-ras, and K-ras) have been
identified (Ellis et al., 1981 ; Shimizu et al., 1983 ; Ruta et
al., 1986 ), each encoding homologous but distinct 21 kDa proteins. The
Ras proteins function as molecular switches that are activated by
binding GTP catalyzed by Ras guanine nucleotide exchange factors (GEFs)
and inactivated by the conversion of bound GTP to GDP by an intrinsic
GTPase activity and GTPase activating proteins (GAPs) (Lowy and
Willumsen, 1993 ). ras genes are abundantly expressed in the
adult mouse CNS (Leon et al., 1987 ), and several lines of
evidence implicated the involvement of Ras signaling pathway in
synaptic plasticity and learning. The mice lacking neuron-specific GEF,
Ras-guanine-nucleotide-releasing factor (GRF), showed impairment of LTP
in the amygdala despite normal hippocampal long-term potentiation (LTP)
(Brambilla et al., 1997 ). In addition, an inhibitor of extracellular
response kinase cascades, which are activated by activated Ras,
inhibits hippocampal LTP induction (English and Sweatt, 1997 ).
Furthermore, a novel RasGAP, termed p135 SynGAP, that associates with
the postsynaptic density (PSD)-95 protein family has been found
recently (Chen et al., 1998 ; Kim et al., 1998 ). These results prompted
us to search for the novel functions of the Ras proteins in neural plasticity.
The NMDA receptor plays a central role in development, plasticity, and
neurotoxicity in the CNS. LTP of excitatory synaptic transmission in
the hippocampus is a candidate for the cellular mechanism underlying
neural plasticity, such as learning and memory (Bliss and Collingridge,
1993 ). The activation of NMDA receptors (Collingridge et al., 1983 ) and
the influx of Ca2+ to the postsynaptic
cell through the receptor (Lynch et al., 1983 ; Malenka et al., 1988 )
are essential for the induction of LTP in the CA1 region of the
hippocampus. The NMDA receptor is composed of two distinct types of
subunits, the NR1 ( 1) and NR2A-NR2D ( 1- 4) (Kutsuwada et al.,
1992 ; Monyer et al., 1992 ; Ishii et al., 1993 ). The NMDA receptor
channel activities are regulated by either a receptor subunit
composition or post-translational modifications. The NMDA receptors are
known to be phosphorylated and modulated by serine/threonine kinases,
such as protein kinase C (Chen and Huang, 1992 ) and protein tyrosine
kinases (PTKs) (Wang and Salter, 1994 ), such as Src family kinases (Yu
et al., 1997 ).
Here, we report that, in the H-ras deficient mice, tyrosine
phosphorylation of NMDA receptors is increased without a change in the
subunit composition of NMDA receptors. The magnitude of mutant LTP is
almost double that of wild-type mice. This effect is most likely
attributable to a selective enhancement of the NMDA synaptic responses
induced by an increase in the tyrosine phosphorylation of NMDA
receptors. Therefore, the protein encoded by the H-ras gene
is a key molecule that regulates LTP induction by the downregulation of
the NMDA receptor activity.
 |
MATERIALS AND METHODS |
Mice. When comparing wild-type and
H-ras( / ) mice, littermates from heterozygous parents
were used in most cases, although in some cases, age-matched animals
were also used. All experiments using mice were performed
in accordance with the animal use guidelines at each institute.
In situ hybridization. The nucleotide sequence of
the probe was complementary to the H-ras cDNA
(5'GCCAGGACCACTCTCATCGGGTGGGTTCAGTTTCCGCAATTTATG3'). Brains of
adult wild-type and mutant mice were quickly removed under ether
anesthesia and frozen in powdered dry ice. The sagittal sections were cut on a cryostat at a thickness of 25 µm and mounted onto silane-coated glass slides. The sections were immersed in 4% paraformaldehyde for 10 min and acetylated in 0.25% acetic anhydrate-0.1 M triethanolamine, pH 8.0, for 10 min at room temperature. After prehybridization, the sections
were incubated overnight at 42°C in the solution containing 50%
deionized formamide, 4× SSC (1× SSC: 0.15 M
NaCl and 0.015 M sodium citrate, pH7.4), 1× Denhardt's solution (0.02% each of polyvinylpyrolidone, bovine serum
albumin, and Ficoll), 1% sodium N-lauroyl sarcosinate
(Sarkosyl), 0.1 M phosphate buffer, pH
7.2, 250 µg/ml heat-denatured salmon sperm DNA, 10% dextran sulfate,
100 mM dithiothreitol, and
35S-labeled oligonucleotide probe
(5-10 × 105cpm/50 µl). The
sections were then washed in 0.1× SSC-0.1% Sarkosyl at 50°C four
times for 30 min. The sections were exposed to Hyperfilm -max
(Amersham Pharmacia Biotech, Uppsala, Sweden) for 2 weeks at room temperature.
Western blot. The hippocampus was homogenized in
radioimmunoprecipitation assay (RIPA) buffer (20 mM Tris-HCl, 150 mM NaCl, 0.1% SDS, 1% sodium deoxycholate, 1% Triton X-100, 2 mM EDTA, 50 mM NaF, 1 mM sodium orthovanadate, 20 µg/ml aprotinin,
and 20 µg/ml leupeptin). Cellular fractions containing synaptosomes and PSDs were prepared as described by Carlin et al. (1980) . Proteins were separated by electrophoresis on SDS-PAGE. The proteins were then
transferred to the polyvinylidene difluoride (PVDF) membranes (Bio-Rad,
Hercules, CA), and immunoblots were probed with monoclonal anti-pan Ras
(Calbiochem, San Diego, CA), polyclonal anti-H-Ras (Santa Cruz
Biotechnology, Santa Cruz, CA), monoclonal anti-N-Ras (Santa Cruz
Biotechnology), and monoclonal anti-K-Ras (Santa Cruz Biotechnology)
antibodies and were visualized by enhanced chemiluminescence (ECL;
Amersham Pharmacia Biotech).
Immunoprecipitation and detection of tyrosine
phosphorylation. Hippocampus lysates were homogenized in RIPA
buffer containing 0.5% SDS. After boiling the lysates, they were
diluted by RIPA buffer lacking SDS to 0.1% SDS (Sheng et al., 1994 )
and centrifuged for 20 min at 18,000 × g. The
supernatants were incubated at 4°C with protein G-Sepharose (Amersham
Pharmacia Biotech) overnight. After centrifugation, 200 µg of
precleared lysates were incubated with a monoclonal anti-NR2A antibody
(a gift from Dr. S. Nakanishi, Kyoto University Faculty of Medicine,
Kyoto, Japan) or affinity-purified polyclonal anti-NR2B antibodies (a
gift from Drs. T. Yamamoto and H. Umemori, Institute of Medical
Science, University of Tokyo, Tokyo, Japan) raised to synthetic peptide
HGAVPGRFQKDI corresponding to amino acids 1407-1418 of NR2B at 4°C
for 1 hr. Immune complexes were isolated by the addition of protein
G-Sepharose followed by incubation for 1 hr at 4°C. The resulting
immune complexes were washed five times with RIPA buffer, resuspended
in Laemli sample buffer, and boiled for 5 min. Proteins were separated
by SDS-PAGE. The proteins were then transferred to PVDF membranes, and
immunoblots were probed with an anti-phosphotyrosine antibody (anti-PY)
linked to horse radish peroxidase (RC20:HRPO; Transduction Laboratories, Lexington, KY). The amount of anti-PY bound to the 180 kDa band was quantified by densitometry of the x-ray films. The ratio
of the amount of anti-PY bound in wild-type and mutant mice to the mean
of that in wild-type mice on the same blot was calculated, and then the
normalized values on different blots were averaged.
To examine the subunit composition and tyrosine phosphorylation of the
heteromeric complexes of native NMDA receptors, hippocampal lysates
solubilized in RIPA buffer were immunoprecipitated with polyclonal
anti-NR1 antibodies (Upstate Biotechnology, Lake Placid, NY), and
immunoblots were probed with polyclonal anti-NR1 (Chemicon, Temecula,
CA), polyclonal anti-NR2A (Santa Cruz Biotechnology), polyclonal
anti-NR2B (Santa Cruz Biotechnology), anti-PY, and polyclonal
anti-PSD-95 (Santa Cruz Biotechnology) antibodies.
The PTK activity was assayed using Universal Tyrosine Kinase Assay Kit
(Takara Shuzo, Otsu, Shiga, Japan). The procedure was a modification of
that described by Rijksen et al. (1991) . Protein lysates were incubated
with a substrate poly(Glu-Tyr) immorbilized to microplates and
unlabeled ATP in the presence of 1 mM sodium-orthovanadate and 50 mM NaF. After termination of the reaction, the
extent of tyrosine phosphorylation was measured by ELISA with
anti-phosphotyrosine (PY20:HRPO) and HRPO substrate,
3,3',5,5'-tetramethylbenzidine. One unit (U) is defined as the activity
of c-Src protein, which can transfer 1 pmol of -phosphate of ATP to
the substrate per minute.
The data are expressed as the means ± SEMs. Student's
t test was used to determine whether there was a significant
difference (p < 0.05) in the mean between the
two sets of data.
Electrophysiology. Hippocampal slices (400-µm-thick) were
prepared from 6- to 12-week old mice and placed in a holding chamber for at least 1 hr. A single slice was then transferred to the recording
chamber and submerged beneath a continuously perfusing medium that had
been saturated with 95% O2 and 5%
CO2. The composition of the medium was (in
mM): 119 NaCl, 2.5 KCl, 1.3 MgSO4, 2.5 CaCl2, 1.0 NaH2PO4, 26.2 NaHCO3, and 11 glucose. All the perfusing
solutions contained 100 µM picrotoxin to block
GABAA receptor-mediated inhibitory synaptic
responses. The field potential recordings were made with a glass
electrode (3 M NaCl) placed in the stratum
radiatum. The whole-cell pipette solution contained (in
mM): 122.5 cesium gluconate, 17.5 CsCl, 10 HEPES,
0.2 EGTA, 8 NaCl, 2 Mg-ATP, and 0.3 Na3-GTP, pH
7.2 (osmolarity 290-300 mOsm). In the whole-cell recordings, the
values of the membrane potential were corrected for the liquid junction
potential at the electrode tip. An Axopatch 1D amplifier (Axon
Instruments, Foster City, CA) was used, and the signal was filtered at 1 kHz, digitized at 5-10 kHz, and stored on an
IBM-compatible computer equipped with a Labmaster analog-to-digital
board (Axon Instruments). For evoking synaptic responses, a bipolar
tungsten stimulating electrode was placed in the stratum radiatum, and Schaffer collateral-commissural fibers were stimulated at 0.1 Hz. For
LTP experiments, the stimulus strength was adjusted so that it gave
rise to AMPA receptor-mediated EPSPs of the slope value between 0.10 and 0.15 mV/msec. For the analysis of EPSPs, we measured their early
rising phase to avoid contamination of voltage-dependent components as
much as possible. All experiments were done at room temperature. The
data are expressed as the means ± SEMs. Student's t
test was used to determine whether there was a significant difference
(p < 0.05) in the mean between the two sets of
data. The majority of electrophysiological experiments were performed
in a blind manner, and the results were essentially identical to those
of the nonblind experiments, and thus all the data were pooled.
 |
RESULTS |
Expression of H-ras gene
The distribution of H-ras mRNAs in the brain examined
by in situ hybridization showed that the H-ras
gene is abundantly expressed in the CNS, including the hippocampus,
cerebral cortex, cerebellum, and striatum, of normal mice (Fig.
1a). A Western blot analysis of the amount of the H-Ras protein in whole-cell extracts from the
cerebral cortex or in the fraction containing synaptosomes and
mitochondria, the synaptosome fraction, and the PSD fraction (Carlin et
al., 1980 ) showed that H-Ras protein exists in the synaptosome but not
in the PSD fraction (Fig. 1e). Because we confirmed the
existence of H-Ras protein in neurons, mice lacking the
H-ras gene [H-ras( / )] were generated to
examine the roles of Ras proteins in the CNS. H-ras( / )
mice appeared to be healthy and bred and developed normally. Their life
spans were the same as those of the wild-type littermates, and their
behavior also appeared to be normal. A histological examination of
various brain regions, including the striatum, hippocampus (Fig.
1d), cerebral cortex, and cerebellum in the mutant mice
showed no obvious morphological abnormalities at the microscopic level.
In situ hybridization analyses of brain slices with
oligonucleotide probes indicated that H-ras mRNAs are absent
in H-ras( / ) mice (Fig. 1b). We
examined the amount of Ras proteins in the
H-ras( / ) hippocampus lysate. Immunoreactivity with
an anti-pan Ras antibody that recognizes all three types of Ras protein
was drastically decreased in the mutant lysate (Fig.
1f) compared with that in the wild-type
lysate, suggesting that most of Ras proteins are the H-Ras proteins in the mouse hippocampus. The amount of N-Ras or K-Ras proteins was not
significantly different between wild-type and
H-ras-deficient mice, whereas the H-Ras proteins were absent
in H-ras( / ) mice (Fig. 1f).

View larger version (107K):
[in this window]
[in a new window]
|
Figure 1.
Expression of H-ras gene in the
CNS. a, b, In situ
hybridization analyses of H-ras mRNA in the CNS of
wild-type (a) and H-ras( / )
mice (b). Scale bar, 5 mm. c,
d, A Nissl staining of the hippocampus sections of
wild-type (c) and H-ras( / )
mice (d). Scale bar, 250 µm. e,
A Western blot analysis of H-Ras and PSD-95 proteins in the fraction
from the mouse cerebral cortex. Whole-cell extract (lane
1, 10 µg) and the fractions containing synaptosome and
mitochondria (lane 2, 10 µg), synaptosome (lane
3, 10 µg; lane 4, 5 µg), and isolated PSD
(lane 5, 5 µg) were separated by SDS-PAGE and
subjected to immunoblotting. f, A Western blot analysis
of the Ras proteins with anti-pan Ras, anti-H-Ras, anti-N-Ras, and
anti-K-Ras antibodies in the wild-type (+/+) and
H-ras( / ) hippocampus.
|
|
Increase in tyrosine phosphorylation of NMDA receptors without an
alteration of the subunit composition in H-ras( / )
mice
We next examined the tyrosine phosphorylation and the subunit
composition of NMDA receptors in H-ras( / ) mice. We first
examined the tyrosine phosphorylation of NR2A and NR2B after a
dissociation of the NMDA receptor complexes (Sheng et al., 1994 ). The
proteins (200 µg) from the wild-type and
H-ras( / ) lysates were boiled in 0.5% SDS followed by
dilution into RIPA buffer and then were immunoprecipitated with
anti-NR2A or anti-NR2B antibodies. The resulting immune complexes were
blotted with anti-PY (Fig.
2a). The amounts of anti-PY
bound to both NR2A (155 ± 14% of wild type; n = 16) and NR2B (172 ± 23% of wild type; n = 16) in
the H-ras( / ) were significantly larger
(p < 0.01) than those in the wild type (NR2A,
100 ± 11%, n = 16; NR2B, 100 ± 5%,
n = 16). Next, the hippocampus proteins solubilized in
RIPA buffer were coimmunoprecipitated by an anti-NR1 antibody to
examine the subunit composition and tyrosine phosphorylation of the
heteromeric complexes of native NMDA receptors in wild-type and mutant
mice. The amount of NR1, NR2A, and NR2B coprecipitated with the
anti-NR1 antibody was not altered in the H-ras( / )
lysates (Fig. 2b). The same blot probed with anti-PY showed
a single 180 kDa band (Fig. 2b, bottom
right). Because no 180 kDa tyrosine-phosphorylated protein
other than NR2A or NR2B is known in the NMDA receptor complex, the
tyrosine phosphorylation of the 180 kDa protein coprecipitated with the anti-NR1 antibody is likely to correspond to that of NR2A and NR2B.
Anti-PY bound to the 180 kDa protein was significantly larger (p < 0.05) in the H-ras( / )
lysates (137 ± 3% of wild type; n = 3) than
that in the wild type (100 ± 18%; n = 3) (Fig.
2b), suggesting that the phosphorylation of NR2A and NR2B
was increased in the NMDA receptor complex in the
H-ras( / ) mice. Furthermore, we examined the amount of
PSD-95 proteins that may be required for the localization of NMDA
receptors to synapses and found that the amount of PSD-95
proteins in the NMDA receptor complex is not significantly
changed in H-ras( / ) mice (Fig. 2c).

View larger version (23K):
[in this window]
[in a new window]
|
Figure 2.
Tyrosine phosphorylation of NR2A and NR2B in
the wild-type (+/+) and H-ras( / ) hippocampus.
a, Hippocampal proteins (200 µg) solubilized in
boiling SDS followed by dilution into RIPA buffer were incubated with
anti-NR2A or anti-NR2B antibodies. Immunoprecipitation
(IP) with anti-NR2A or anti-NR2B antibodies was
separated by SDS-PAGE and immunoblotted with the anti-PY. The
amount of antibodies bound to each band was quantified by densitometry
of the x-ray films, and values were normalized to the mean of wild-type
values. The normalized amount of anti-PY bound to NR2A and NR2B in
H-ras( / ) mice was significantly larger
(p < 0.01) than that in wild-type mice. The
insets are representative immunoblots with the anti-PY.
b, Hippocampus proteins (200 µg) solubilized in RIPA
buffer were incubated with an anti-NR1 antibody.
Immunoprecipitation with the anti-NR1 antibody was separated by
SDS-PAGE and transferred to PVDF membrane. The membrane was then
analyzed by sequential blotting using anti-NR1, anti-NR2A, anti-NR2B, and anti-PY antibodies. The amount
of NR1, NR2A, and NR2B coprecipitated with the anti-NR1 antibody was
not altered in the H-ras( / ) lysates. Tyrosine
phosphorylation of 180 kDa proteins coprecipitated with the anti-NR1
antibody was significantly larger (p < 0.05) in the H-ras( / ) lysates than that in the wild
type. The insets are representative immunoblots with
each antibody. c, The membrane blotted with the same
immunoprecipitation as in b was analyzed by sequential
blotting using anti-NR1 and anti-PSD-95 antibodies. The amount of
PSD-95 coprecipitated with the anti-NR1 antibody was not significantly
changed in the H-ras( / ) lysates.
|
|
Because we found the increase of tyrosine phosphorylation of NR2A and
NR2B in the H-ras( / ) hippocampus, we measured PTK activity with the synthetic peptide poly(Glu-Tyr) as a general PTK
substrate in the hippocampal lysates in the presence of tyrosine phosphatase inhibitors (Rijksen et al., 1991 ). The
H-ras( / ) lysates had a significant 18% increase in the
activity of PTKs when compared with wild-type lysates (wild type,
3.03 ± 0.09 × 10 2 U/µg,
n = 8; H-ras( / ), 3.56 ± 0.13 × 10 2 U/µg, n = 8;
p < 0.01). These results suggest that H-Ras proteins regulate NMDA receptors by downregulation of tyrosine phosphorylation without changing the subunit composition and interaction between NMDA
receptors and PSD-95 proteins in normal animals.
Upregulation of NMDA receptor-mediated synaptic responses in
H-ras-deficient mice
We next investigated excitatory synaptic transmission in
hippocampal slices of H-ras( / ) and wild-type mice to
study the effects of these biochemical changes on the synaptic
functions in the CNS. EPSCs were evoked in CA1 pyramidal cells
using whole-cell patch-clamp techniques by stimulating Schaffer
collateral-commissural fibers in the stratum radiatum. We first
examined whether NMDA receptor-mediated EPSCs are modified by the
increase in phosphorylation of NMDA receptor subunits in
H-ras( / ) mice (Fig.
3a,b). AMPA receptor-mediated EPSCs were recorded at a membrane potential of 90
mV in a voltage-clamp mode. NMDA EPSCs were then measured at the same
stimulus strength in the presence of
6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) (10 µM), a non-NMDA receptor antagonist, at +40 mV
to relieve the voltage-dependent Mg2+
block of the NMDA receptor channel (Mayer et al., 1984 ; Nowak et al.,
1984 ). The ratio of NMDA to AMPA EPSC amplitudes (Sakimura et al.,
1995 ) was significantly larger (p < 0.02) (Fig.
3b) in H-ras( / ) mice (59.9 ± 5.2%,
n = 12 cells and 6 mice) than in wild-type mice
(44.3 ± 4.9%, n = 13 cells and 7 mice),
suggesting that the modulation of NMDA receptors may enhance the NMDA
synaptic responses in H-ras( / ) mice. However, it is also
possible that the larger NMDA/AMPA ratio is attributable to a selective
reduction of AMPA synaptic responses. To differentiate these
possibilities, we examined the input-output relationships of the AMPA
and NMDA EPSPs in wild-type and H-ras( / ) mice using
extracellular field potential recording techniques. The input-output
relationship of the AMPA synaptic responses was similar in both groups
(Fig. 3d), but NMDA synaptic responses were larger in mutant
mice (Fig. 3e), indicating that the larger NMDA/AMPA ratio
observed in the whole-cell recordings is attributable to an absolute
increase in the NMDA synaptic responses in H-ras( / )
mice.

View larger version (25K):
[in this window]
[in a new window]
|
Figure 3.
NMDA synaptic responses are larger in
H-ras( / ) mice. a, AMPA receptor-mediated
EPSCs (downward traces) and NMDA receptor-mediated EPSCs
(upward traces) were recorded at membrane potentials of
90 and +40 mV, respectively. When NMDA EPSCs were recorded, 10 µM CNQX was present to block AMPA EPSCs.
b, The ratio of amplitudes of the NMDA EPSC to those of
the AMPA EPSC was calculated for each cell, and the values were then
averaged for all cells. The ratio was significantly larger in
H-ras( / ) mice than in wild-type mice
(p < 0.02). c, The
current-voltage relationships of NMDA synaptic currents in wild-type
(open circles; n = 9 cells, 5 mice)
and H-ras( / ) (filled circles;
n = 7 cells, 4 mice) mice. Current amplitudes,
which were larger in H-ras( / ) mice, were normalized
to the value obtained at +40 mV for easier comparison.
d, The input-output relationships of AMPA EPSPs of
wild-type (open circles; n = 10 slices, 5 mice) and H-ras( / ) (filled
circles; n = 10 slices, 5 mice) mice.
Sample traces in the inset represent the
responses evoked with five different stimulus intensities varying from
1.35 to 1.71 V. e, The input-output relationships of
NMDA EPSPs of wild-type (open circles;
n = 14 slices, 7 mice) and
H-ras( / ) (filled circles;
n = 14 slices, 7 mice) mice. CNQX (10 µM) was present to block AMPA receptor-mediated synaptic
responses. Sample traces in the inset
represent the responses evoked with five different stimulus intensities
varying from 2.16 to 2.88 V. Stimulation with higher intensities was
used to overcome the Mg2+ block of the NMDA
receptor. As shown in the inset, in
H-ras( / ) mice, NMDA EPSPs were often accompanied by
bursting activity, presumably because of their large size. In some
experiments, 40 µM D-APV was applied at the
end of the experiments, and the synaptic responses were completely
abolished.
|
|
The enhanced NMDA synaptic responses could be introduced by changes in
the biophysical properties of the receptor. However, the rise
time (wild type, 13.5 ± 0.3 msec, n = 13 cells
and 7 mice; H-ras( / ), 13.1 ± 0.4 msec,
n = 12 cells and 6 mice; p > 0.2) and
the decay time constant (wild type, 57.5 ± 4.2 msec; H-ras( / ), 55.2 ± 4.2 msec; p > 0.3) of the NMDA synaptic currents measured at +40 mV with
whole-cell recordings were similar between the wild-type and
H-ras( / ) mice, indicating that the kinetics of the NMDA
receptors is not modified in the H-ras( / ) mice. Furthermore, the I-V curves of wild-type and mutant mice
were almost superimposable (Fig. 3c), which suggests that
the larger NMDA synaptic responses are not caused by a modulation of
the voltage-dependent Mg2+ block of the
NMDA receptor. It is thus possible that the enhanced synaptic NMDA
responses in H-ras( / ) mice are associated with an
increase in the single channel conductance of the existing receptor
channel and/or an increase in the number of active NMDA receptor channels.
Enhanced LTP in H-ras-deficient mice
It is well established that the induction of LTP at the Schaffer
collateral-commissural-CA1 synapse is mediated by the activation of
postsynaptic NMDA receptors (Collingridge et al., 1983 ; Nicoll and
Malenka, 1995 ). EPSPs were recorded in the CA1 region using extracellular field potential recording techniques. The stimulation of
afferent fibers evoked AMPA receptor-mediated EPSPs in the stratum
radiatum. The tetanic stimulation of the afferent fibers (100 Hz for 1 sec, repeated twice at a 10 sec interval) gave rise to LTP of
excitatory synaptic transmission in wild-type mice (Fig. 4a,b). The
magnitude of LTP in the H-ras( / ) mice induced by the
same conditioning was remarkably larger than that in the wild-type mice
(Fig. 4a,b). The induction of LTP in the
H-ras( / ) mice was completely blocked by the NMDA
receptor antagonist D-2-amino-5-phosphonovaleric acid (D-APV) (50 µM;
n = 2 slices and 1 mouse), indicating that the
increased magnitude of LTP was not caused by the addition of NMDA receptor-independent potentiation. In some separate
experiments, to examine whether the synaptic NMDA responses during the
conditioning for inducing LTP are also larger in mutant mice,
depolarization caused by tetanic stimulation was measured (Fig.
4c,d). As expected, the component of
depolarization that was sensitive to D-APV was significantly larger in the H-ras( / ) mice [the ratio of
NMDA receptor-dependent depolarization to AMPA receptor-dependent
depolarization (see the figure legend): wild-type, 61.5 ± 11.0%,
n = 4 slices and 4 mice; H-ras( / ),
94.8 ± 11.3%, n = 5 slices and 5 mice; p < 0.04], indicating that the NMDA receptor is more
active in H-ras( / ) mice during tetanic stimulation.

View larger version (36K):
[in this window]
[in a new window]
|
Figure 4.
LTP is enhanced in H-ras( / )
mice. a, Sample traces of field EPSPs
(average of 10 consecutive responses) of wild-type and
H-ras( / ) mice recorded at the times indicated in
b. The stimulus artifacts are truncated.
b, The averaged time course of LTP in wild-type
(n = 13 slices, 10 mice) and
H-ras( / ) (n = 16 slices, 12 mice) mice. Initial EPSP slopes were measured, and the values were
normalized in each experiment using the averaged slope value measured
during the control period (time, 30 to 0 min). Tetanic stimulation
was applied at time 0. c, Depolarization caused by
high-frequency stimulation (100 Hz for 1 sec) in the presence of 50 µM D-APV and after washout of the antagonist.
The stimulus strength was adjusted to evoke an EPSP that had an initial
slope value of 0.16 to 0.18 mV/msec, thus the depolarization in the
presence of APV was similar between the wild-type and
H-ras( / ) mice. The stimulus artifacts are truncated.
d, Depolarization at 150 msec from the beginning of
tetanic stimulation was measured in the presence of 50 µM
D-APV and then 20 min after washout of the antagonist. NMDA
receptor-dependent depolarization was calculated by subtracting the
value in APV from that after washout, which included both NMDA and AMPA
receptor-mediated depolarization. In the presence of APV,
depolarization solely mediated by AMPA receptors was recorded. NMDA
receptor-dependent depolarization was calculated by subtracting AMPA
receptor-dependent depolarization from the total depolarization in the
absence of APV. The ratio of NMDA to AMPA receptor-dependent
depolarization was significantly larger (p < 0.04) in the H-ras( / ) than in wild-type
mice.
|
|
Although the larger magnitude LTP in H-ras( / ) mice is
most likely attributable to the enhanced NMDA receptor activity, it is
also possible that a change in the presynaptic transmitter release
probability may be involved in the modulation of LTP. We thus examined
the paired-pulse facilitation (PPF) (Zucker, 1989 ; Manabe et al., 1993 )
of AMPA receptor-mediated EPSCs to assess whether H-ras
knock-out may affect the presynaptic release mechanisms. PPF induced at
an interstimulus interval of 50 msec was not significantly different
(p > 0.3) between wild-type (1.85 ± 0.06, n = 18 cells and 9 mice) and H-ras( / )
(1.89 ± 0.08, n = 12 cells and 6 mice) mice (Fig.
5a,b), suggesting
that presynaptic release probability is not affected by H-Ras proteins.

View larger version (24K):
[in this window]
[in a new window]
|
Figure 5.
The LTP modulation is not mediated by a change in
presynaptic release mechanisms but by a change in the postsynaptic
induction mechanism. a, PPF of synaptic responses was
induced by delivering afferent fiber stimulation twice at an
interstimulus interval of 50 msec. Cells were voltage-clamped at 90
mV. b, Averaged values of PPF. The facilitation ratios
were calculated by dividing the amplitude of the second EPSCs by that
of the first EPSCs. Ten consecutive traces were averaged, and the
amplitude of the averaged trace was measured. There was no significant
difference in PPF between the wild-type and H-ras( / )
mice. c, The saturation level of LTP in the
H-ras( / ) mice is similar to that in the wild-type
mice. Examples of LTP saturation in the wild-type and the
H-ras( / ) mouse. Tetanic stimulation was repeatedly
applied at the times indicated by the arrows. Each data
point represents an averaged slope value of six consecutive EPSPs,
normalized to the value during the control period. d,
Summary of LTP saturation measurements. There was no significant
difference between the two groups.
|
|
The data presented above strongly suggest that the enhanced LTP in
H-ras( / ) mice results from the larger synaptic NMDA
responses. If the enhanced LTP is solely a result of an increased
Ca2+ influx through the NMDA receptors and
not a result of a modification of LTP expression mechanisms, then the
LTP saturation level of the H-ras( / ) mice should be
similar to that of the wild-type mice. To saturate LTP, high-frequency
stimulation was repeatedly applied until there was no more potentiation
(Fig. 5c). The saturation level of
H-ras( / ) slices (229.8 ± 15.6% of control,
n = 4 slices and 4 mice) was not significantly
different (p > 0.3) (Fig. 5d) from
that of wild-type slices (222.3 ± 21.1%, n = 4 slices and 4 mice), suggesting that the expression mechanisms are
unchanged. Because many reports suggest that LTP is expressed, at least
in part, by an increase in AMPA receptor sensitivity (Davies et al., 1989 ; Manabe et al., 1992 ; Manabe and Nicoll, 1994 ; Isaac et al., 1995 ;
Liao et al., 1995 ), the larger magnitude of LTP could be explained by a
downregulation of the AMPA receptor in naive slices from the
H-ras( / ) mice, which could also account for the higher ratio of NMDA/AMPA synaptic responses (Fig.
3a,b). However, the results of the LTP saturation
experiments, together with those of the experiments examining the
input-output relationships of AMPA responses (Fig. 3d),
rule out this possibility, because the saturation level of LTP in the
H-ras( / ) mice should be higher than that in the
wild-type mice if the basal level of AMPA sensitivity in
H-ras( / ) mice is lower. It is thus unlikely that the
enhanced LTP in H-ras( / ) mice is attributable to a
downregulation of the AMPA receptor sensitivity, thus further
supporting the selective enhancement of the NMDA synaptic responses in
H-ras( / ) mice.
 |
DISCUSSION |
The NMDA receptor channel plays a central role in the development
(McDonald and Johnston, 1990 ), plasticity (Malenka and Nicoll, 1993 ),
and neurotoxicity (Choi, 1988 ) in the CNS. The essential role of NMDA
receptors in synaptic plasticity, in particular in the CA1 region of
the hippocampus, has been described by many researchers (Malenka and
Nicoll, 1993 ). When NMDA receptor activation is blocked by an
antagonist, LTP induced by standard procedures is inhibited
(Collingridge et al., 1983 ). The knockout of one of the NMDA receptor
subunits, NR2A, causes a reduction in the NMDA synaptic responses in
the CA1 region, resulting in a decrease in the magnitude of LTP
(Sakimura et al., 1995 ). Furthermore, a partial blockade of NMDA
receptor activity results in no change or, in some cases, in long-term
depression of synaptic transmission, depending on the degree of the
blockade (Cummings et al., 1996 ). However, it is unknown as to whether
LTP is enhanced when the NMDA responses are increased. In our present
study, NMDA synaptic responses were selectively enhanced without
apparent changes in the presynaptic release probability in
H-ras( / ) mice, thus enabling us to examine the effect of
a selective enhancement of NMDA receptor activity on LTP
induction. Recently, two kinds of knock-out mice, the nociceptin
receptor-deficient mice (Manabe et al., 1998 ) and the PSD-95-deficient
mice (Migaud et al., 1998 ), have been reported to show an enhancement
of LTP. Because both knock-out mice showed normal NMDA synaptic
responses, the mechanism of the enhancement of LTP in our
H-ras( / ) mice is different from those in the nociception receptor- and PSD-95-deficient mice. Furthermore, we confirm that the
amount of PSD-95 in the NMDA receptor complex coimmunoprecipitated with
an anti-NR1 antibody is not significantly changed in
H-ras( / ) mice, suggesting that the increase in LTP
produced by loss of H-Ras does not involve a decrease in PSD-95 expression.
We found that the tyrosine phosphorylation of NR2A and NR2B subunits of
NMDA receptors was increased in the H-ras( / )
hippocampus. The NMDA synaptic responses were increased in baseline
synaptic transmission, as well as during tetanic stimulation. The
potentiated NMDA synaptic response is probably attributable to the
increase in tyrosine phosphorylation of the postsynaptic receptors in
the mutant mice, because the tyrosine phosphorylation of NMDA receptors is reported to enhance the activity of NMDA receptor (Wang and Salter,
1994 ; Yu et al., 1997 ). Thus, the regulation of synaptic plasticity via
its regulation of the NMDA receptor phosphorylation in the adult CNS
may be a novel H-Ras function. The signal transduction pathway from
H-Ras proteins to NMDA receptors remains to be elucidated. It has been
shown that PTKs, such as Src family kinases, exist upstream of Ras in
signal transduction and positively regulate Ras activities (Sadoshima
and Izumo, 1996 ). Our results suggest that the Ras protein inhibits the
PTK activities on NMDA receptors by an unknown pathway.
We, however, could not exclude the possibility that upregulation of
NMDA synaptic responses and enhancement of LTP in
H-ras( / ) mice might be caused indirectly by an
impairment in neuronal development but not directly by the
lack of H-Ras in adult hippocampal neurons, because H-Ras proteins have
been shown to play a critical role in the proliferation and development
in a variety of cell types and at different developmental stages. In
that case, upregulation of tyrosine phosphorylation of NMDA receptors
might be caused by the absence of H-Ras during development but not by
the deficiency of H-Ras-mediated pathways acutely activated by the
extracellular signals in the adult hippocampus. In addition,
H-ras( / ) hippocampus might have morphological changes on
the subcellular level, such as increase of dendritic spines expressing
NMDA receptors but not AMPA receptors, although we could not find a
significant morphological abnormality in H-ras( / ) brain,
including the hippocampus. Furthermore, the larger depolarization and
enhancement of LTP could be explained by the modification of
voltage-dependent channels in the H-ras( / ) mice.
However, we did not observe any difference between the wild-type and
H-ras( / ) mice in the depolarization during the tetanus
in the presence of APV (Fig. 4c), suggesting that the
voltage-dependent component may not be modulated by the mutation. Even
in the presence of APV, the depolarization during tetanus is very
large, which should activate voltage-dependent channels considerably.
Thus, it is rather unlikely that the modulation of voltage-dependent channels is the primary cause of the enhancement of LTP.
Ras proteins are activated by GEFs, which promote the exchange of bound
GDP for GTP, and inactivated by GAPs, which stimulate the intrinsic Ras
GTPase activity. Ras GEFs include Ras-GRF
(CDC25Mm) (Martegani et al., 1992 ;
Shou et al., 1992 ) and Ras-GRF2 (Fam et al., 1997 ), mSOS1 and mSOS
(Bowtell et al., 1992 ; Chardin et al., 1993 ), Ras-GRP (calcium- and
diacylglycerol-regulated GEFII) (Ebinu et al., 1998 ; Kawasaki et al.,
1998 ), and SmgGDS (Mizuno et al., 1991 ). Of these, mice lacking Ras-GRF
showed normal LTP, although the analysis on properties of basal
synaptic transmission revealed that Ras-GRF( / ) mice showed larger
EPSPs in the CA1 region of the hippocampus (Brambilla et al., 1997 ). On
the other hand, in our H-ras( / ) mice, LTP is enhanced,
but basal synaptic transmission mediated by AMPA receptors is not
changed. Ras-GRF specifically activates H-Ras proteins among three
mammalian Ras proteins in vivo (Jones and Jackson, 1998 ).
Although the Ras activity was not measured in the Ras-GRF( / ) mice,
it is possible that, in the Ras-GRF( / ) mice, the H-Ras activity was
not reduced because of the compensation of other Ras GEFs existing in
the hippocampus. In that case, the electrophysiological phenotype in
the Ras-GRF( / ) mice could be attributable to downregulation of
other target molecules of Ras-GRF. In the RasGAP family, recently
cloned SynGAP exists in the PSD fraction and is included in the NMDA
receptor complex (Chen et al., 1998 ; Kim et al., 1998 ), suggesting the
involvement of Ras proteins in the NMDA receptor regulation.
Although Ras proteins have been implicated in cell proliferation and
differentiation, and thus in the cellular functions that are critical
for the development of the organism, our present study revealed a novel
link between the H-Ras protein and the NMDA receptor via the Ras
pathway. Because the NMDA receptor plays a central role in the
modulation of synaptic transmission in the CNS and learning and memory,
the regulation of activity-dependent synaptic plasticity and learning
and memory in adult animals may be another major and pivotal role for
Ras proteins.
 |
FOOTNOTES |
Received Nov. 19, 1999; revised Jan. 7, 2000; accepted Jan. 25, 2000.
This work was supported in part by Grants-in-Aid for Scientific
Research on Priority Areas, for Cancer Research and for Scientific Research from the Ministry of Education, Science, Sports, and Culture,
Japan, Grants-in-Aid from the Ministry of Health and Welfare, Japan,
the Uehara Memorial Foundation, and the Mitsubishi Foundation. We are
grateful to R. Nicoll, S. Tonegawa, T. Takahashi, D. Saffen, M. Kano,
N. Suzuki, and K. Kobayashi for their comments on this manuscript, H. Umemori and T. Yamamoto for the assay of tyrosine phosphorylation of
NMDA receptors and an anti-NR2B antibody, S. Nakanishi for an anti-NR2A
antibody, and K. Nakamura, K. Nakao, and K. Ise for generation of the
H-ras mutant mice. We also thank K. Katsuki and Y. Ikeda
for their excellent technical assistance and K. Tsurui, T. Kohyama, and
M. Tanaka for their help in maintaining the animals.
Drs. Manabe and Aiba contributed equally to this work.
Correspondence should be addressed to Dr. Motoya Katsuki, Division of
DNA Biology and Embryo Engineering, Center for Experimental Medicine,
The Institute of Medical Science, University of Tokyo, 4-6-1
Shirokanedai, Minato-ku, Tokyo 108-8639, Japan. E-mail: katsuki{at}ims.u-tokyo.ac.jp.
 |
REFERENCES |
-
Bliss TVP,
Collingridge GL
(1993)
A synaptic model of memory: long-term potentiation in the hippocampus.
Nature
361:31-39[Medline].
-
Bowtell D,
Fu P,
Simon M,
Senior P
(1992)
Identification of murine homologues of the Drosophila son of sevenless gene: potential activators of ras.
Proc Natl Acad Sci USA
89:6511-6515[Abstract/Free Full Text].
-
Brambilla R,
Gnesutta N,
Minichiello L,
White G,
Roylance AJ,
Herron CE,
Ramsey M,
Wolfer DP,
Cestari V,
Rossi-Arnaud C,
Grant SG,
Chapman PF,
Lipp HP,
Sturani E,
Klein R
(1997)
A role for the Ras signalling pathway in synaptic transmission and long-term memory.
Nature
390:281-286[Medline].
-
Carlin RK,
Grab DJ,
Cohen RS,
Siekevitz P
(1980)
Isolation and characterization of postsynaptic densities from various brain regions: enrichment of different types of postsynaptic densities.
J Cell Biol
86:831-845[Abstract/Free Full Text].
-
Chardin P,
Camonis JH,
Gale NW,
van Aelst L,
Schlessinger J,
Wigler MH,
Bar-Sagi D
(1993)
Human Sos1
a guanine nucleotide exchange factor for Ras that binds to GRB2.
Science
260:1338-1343[Abstract/Free Full Text]. -
Chen H-J,
Rojas-Soto M,
Oguni A,
Kennedy MB
(1998)
A synaptic Ras-GTPase activating protein (p135 SynGAP) inhibited by CaM kinaseII.
Neuron
20:895-904[Web of Science][Medline].
-
Chen L,
Huang L-YM
(1992)
Protein kinase C reduces Mg2+ block of NMDA-receptor channels as a mechanism of modulation.
Nature
356:521-523[Medline].
-
Choi DW
(1988)
Calcium-mediated neurotoxicity: relationship to specific channel types and role in ischemic damage.
Trends Neurosci
11:465-469[Web of Science][Medline].
-
Collingridge GL,
Kehl SJ,
McLennan H
(1983)
Excitatory amino acids in synaptic transmission in the Schaffer collateral-commissural pathway of the rat hippocampus.
J Physiol (Lond)
334:33-46[Abstract/Free Full Text].
-
Cummings JA,
Mulkey RM,
Nicoll RA,
Malenka RC
(1996)
Ca2+ signaling requirements for long-term depression in the hippocampus.
Neuron
16:825-833[Web of Science][Medline].
-
Davies SN,
Lester RAJ,
Reymann KG,
Collingridge GL
(1989)
Temporally distinct pre- and post-synaptic mechanisms maintain long-term potentiation.
Nature
338:500-503[Medline].
-
Ebinu JO,
Bottorf DA,
Chan EYW,
Stang SL,
Dunn RJ,
Stone JC
(1998)
Ras GRP, a Ras guanyl nucleotide-releasing protein with calcium- and diacylglycerol-binding motifs.
Science
280:1082-1088[Abstract/Free Full Text].
-
Ellis RW,
Defeo D,
Shih TY,
Gonda MA,
Young HA,
Tsuchida N,
Lowy DR,
Scolnick EM
(1981)
The p21 src genes of Harvey and Kirsten sarcoma viruses originate from divergent members of a family of normal vertebrate genes.
Nature
292:506-511[Medline].
-
English JD,
Sweatt JD
(1997)
A requirement for the mitogen-activated protein kinase cascade in hippocampal long term potentiation.
J Biol Chem
272:19103-19106[Abstract/Free Full Text].
-
Fam NP,
Fan WT,
Wang Z,
Zhang LJ,
Chen H,
Moran MF
(1997)
Cloning and characterization of Ras-GRF2, a novel guanine nucleotide exchange factor for Ras.
Mol Cell Biol
17:1396-1406[Abstract].
-
Isaac JTR,
Nicoll RA,
Malenka RC
(1995)
Evidence for silent synapses: implications for the expression of LTP.
Neuron
15:427-434[Web of Science][Medline].
-
Ishii T,
Moriyoshi K,
Sugihara H,
Sakurada K,
Kadotani H,
Yokoi M,
Akazawa C,
Shigemoto R,
Mizuno N,
Masu M,
Nakanishi S
(1993)
Molecular characterization of the family of the N-methyl-D-aspartate receptor subunits.
J Biol Chem
268:2836-2843[Abstract/Free Full Text].
-
Jones MK,
Jackson JH
(1998)
Ras-GRF activates Ha-Ras, but not N-Ras or K-Ras 4B, protein in vivo.
J Biol Chem
273:1782-1787[Abstract/Free Full Text].
-
Kawasaki H,
Springett GM,
Toki S,
Canales JJ,
Harlan P,
Blumenstiel JP,
Chen EJ,
Bany IA,
Mochizuki N,
Ashbacher A,
Matsuda M,
Housman DE,
Graybiel AM
(1998)
A Rap guanine nucleotide exchange factor enriched highly in the basal ganglia.
Proc Natl Acad Sci USA
95:13278-13283[Abstract/Free Full Text].
-
Kim JH,
Liao D,
Lau L-F,
Huganir RL
(1998)
SynGAP: a Synaptic RasGAP that associates with the PSD-95/SAP90 protein family.
Neuron
20:683-691[Web of Science][Medline].
-
Kutsuwada T,
Kashiwabuchi N,
Mori H,
Sakimura K,
Kushiya E,
Araki K,
Meguro H,
Masaki H,
Kumanishi T,
Arakawa M,
Mishina M
(1992)
Molecular diversity of the NMDA receptor channel.
Nature
358:36-41[Medline].
-
Leon J,
Guerrero I,
Pellicer A
(1987)
Differential expression of the ras gene family in mice.
Mol Cell Biol
7:1535-1540[Abstract/Free Full Text].
-
Liao D,
Hessler NA,
Malinow R
(1995)
Activation of postsynaptically silent synapses during pairing-induced LTP in CA1 region of hippocampal slice.
Nature
375:400-404[Medline].
-
Lowy DR,
Willumsen BM
(1993)
Function and regulation of ras.
Annu Rev Biochem
62:851-891[Web of Science][Medline].
-
Lynch G,
Larson J,
Kelso S,
Barrionuevo G,
Schottler F
(1983)
Intracellular injections of EGTA block induction of hippocampal long-term potentiation.
Nature
305:719-721[Medline].
-
Malenka RC,
Nicoll RA
(1993)
NMDA-receptor-dependent synaptic plasticity: multiple forms and mechanisms.
Trends Neurosci
16:521-527[Web of Science][Medline].
-
Malenka RC,
Kauer JA,
Zucker RS,
Nicoll RA
(1988)
Postsynaptic calcium is sufficient for potentiation of hippocampal synaptic transmission.
Science
242:81-84[Abstract/Free Full Text].
-
Manabe T,
Nicoll RA
(1994)
Long-term potentiation: evidence against an increase in transmitter release probability in the CA1 region of the hippocampus.
Science
265:1888-1892[Abstract/Free Full Text].
-
Manabe T,
Renner P,
Nicoll RA
(1992)
Postsynaptic contribution to long-term potentiation revealed by the analysis of miniature synaptic currents.
Nature
355:50-55[Medline].
-
Manabe T,
Wyllie DJA,
Perkel DJ,
Nicoll RA
(1993)
Modulation of synaptic transmission and long-term potentiation: effects on paired pulse facilitation and EPSC variance in the CA1 region of the hippocampus.
J Neurophysiol
70:1451-1459[Abstract/Free Full Text].
-
Manabe T,
Noda Y,
Mamiya T,
Katagiri H,
Houtani T,
Nishi M,
Noda T,
Takahashi T,
Sugimoto T,
Nabeshima T,
Takeshima H
(1998)
Facilitation of long-term potentiation and memory in mice lacking nociceptin receptors.
Nature
394:577-581[Medline].
-
Martegani E,
Vanoni M,
Zippel R,
Coccetti P,
Brambilla R,
Ferrari C,
Sturani E,
Alberghina L
(1992)
Cloning by functional complementation of a mouse cDNA encoding a homologue of CDC25, a Saccharomyces cerevisiae RAS activator.
EMBO J
11:2151-2157[Web of Science][Medline].
-
Mayer ML,
Westbrook GL,
Guthrie PB
(1984)
Voltage-dependent block by Mg2+ of NMDA responses in spinal cord neurones.
Nature
309:261-263[Medline].
-
McDonald JW,
Johnston MV
(1990)
Physiological and pathophysiological roles of excitatory amino acids during central nervous system development.
Brain Res Rev
15:41-70[Medline].
-
Migaud M,
Charlesworth P,
Dempster M,
Webster LC,
Watabe AM,
Makhinson M,
He Y,
Ramsay MF,
Morris RG,
Morrison JH,
O'Dell TJ,
Grant SG
(1998)
Enhanced long-term potentiation and impaired learning in mice with mutant postsynaptic density-95 protein.
Nature
396:433-439[Medline].
-
Mizuno T,
Kaibuchi K,
Yamamoto T,
Kawamura M,
Sakoda T,
Fujioka H,
Matsuura Y,
Takai Y
(1991)
A stimulatory GDP/GTP exchange protein for smg p21 is active on the post-translationally processed form of c-Ki-ras and rhoA p21.
Proc Natl Acad Sci USA
88:6442-6446[Abstract/Free Full Text].
-
Monyer H,
Sprengel R,
Schoepfer R,
Herb A,
Higuchi M,
Lomeli H,
Burnashev N,
Sakmann B,
Seeberg PH
(1992)
Heteromeric NMDA receptors: molecular and functional distinction of subtypes.
Science
256:1217-1221[Abstract/Free Full Text].
-
Nicoll RA,
Malenka RC
(1995)
Contrasting properties of two forms of long-term potentiation in the hippocampus.
Nature
377:115-118[Medline].
-
Nowak L,
Bregestovski P,
Ascher P,
Herbet A,
Prochiantz A
(1984)
Magnesium gates glutamate-activated channels in mouse central neurones.
Nature
307:462-465[Medline].
-
Rijksen G,
van Oirschot BA,
Staal GEJ
(1991)
Nonradioactive assays of protein-tyrosine kinase activity using anti-phosphotyrosine antibodies.
Methods Enzymol
200:98-107[Web of Science][Medline].
-
Ruta M,
Wolford R,
Dhar R,
DeFeo-Jones D,
Ellis R,
Scolnick EM
(1986)
Nucleotide sequence of the two rat cellular rasH genes.
Mol Cell Biol
6:1706-1710[Abstract/Free Full Text].
-
Sadoshima J,
Izumo S
(1996)
The heterotrimeric Gq protein-coupled angiotensin II receptor activates p21ras via the tyrosine kinase-Shc-Grb2-Sos pathway in cardiac myocytes.
EMBO J
15:775-787[Web of Science][Medline].
-
Sakimura K,
Kutsuwada T,
Ito I,
Manabe T,
Takayama C,
Kushiya E,
Yagi T,
Aizawa S,
Inoue Y,
Sugiyama H,
Mishina M
(1995)
Reduced hippocampal LTP and spatial learning in mice lacking NMDA receptor
1 subunit.
Nature
373:151-155[Medline]. -
Sheng M,
Cummings J,
Roldan LA,
Jan YN,
Jan LY
(1994)
Changing subunit composition of heteromeric NMDA receptors during development of rat cortex.
Nature
368:144-147[Medline].
-
Shimizu K,
Goldfarb M,
Suard Y,
Perucho M,
Li Y,
Kamata T,
Feramisco J,
Stavnezer E,
Fogh J,
Wigler MH
(1983)
Three human transforming genes are related to the viral ras oncogenes.
Proc Natl Acad Sci USA
80:2112-2116[Abstract/Free Full Text].
-
Shou C,
Farnsworth CL,
Neel BG,
Feig LA
(1992)
Molecular cloning of cDNAs encoding a guanine-nucleotide-releasing factor for Ras p21.
Nature
358:351-354[Medline].
-
Wang YT,
Salter MW
(1994)
Regulation of NMDA receptors by tyrosine kinases and phosphatases.
Nature
369:233-235[Medline].
-
Yu X-M,
Askalan R,
Keil IIGJ,
Salter MW
(1997)
NMDA channel regulation by channel-associated protein tyrosine kinase Src.
Science
275:674-678[Abstract/Free Full Text].
-
Zucker RS
(1989)
Short-term synaptic plasticity.
Annu Rev Neurosci
121:13-31.
Copyright © 2000 Society for Neuroscience 0270-6474/00/2072504-08$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
H. Yang and R. R. Mattingly
The Ras-GRF1 Exchange Factor Coordinates Activation of H-Ras and Rac1 to Control Neuronal Morphology
Mol. Biol. Cell,
May 1, 2006;
17(5):
2177 - 2189.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. A. Kushner, Y. Elgersma, G. G. Murphy, D. Jaarsma, G. M. van Woerden, M. R. Hojjati, Y. Cui, J. C. LeBoutillier, D. F. Marrone, E. S. Choi, et al.
Modulation of Presynaptic Plasticity and Learning by the H-ras/Extracellular Signal-Regulated Kinase/Synapsin I Signaling Pathway
J. Neurosci.,
October 19, 2005;
25(42):
9721 - 9734.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Suvarna, S. L. Borgland, J. Wang, K. Phamluong, Y. P. Auberson, A. Bonci, and D. Ron
Ethanol Alters Trafficking and Functional N-Methyl-D-aspartate Receptor NR2 Subunit Ratio via H-Ras
J. Biol. Chem.,
September 9, 2005;
280(36):
31450 - 31459.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Miyamoto, L. Chen, M. Sato, M. Sokabe, T. Nabeshima, T. Pawson, R. Sakai, and N. Mori
Hippocampal Synaptic Modulation by the Phosphotyrosine Adapter Protein ShcC/N-Shc via Interaction with the NMDA Receptor
J. Neurosci.,
February 16, 2005;
25(7):
1826 - 1835.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Niisato, A. Fujikawa, S. Komai, T. Shintani, E. Watanabe, G. Sakaguchi, G. Katsuura, T. Manabe, and M. Noda
Age-Dependent Enhancement of Hippocampal Long-Term Potentiation and Impairment of Spatial Learning through the Rho-Associated Kinase Pathway in Protein Tyrosine Phosphatase Receptor Type Z-Deficient Mice
J. Neurosci.,
February 2, 2005;
25(5):
1081 - 1088.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. A. Hoeffer, S. Sanyal, and M. Ramaswami
Acute Induction of Conserved Synaptic Signaling Pathways in Drosophila Melanogaster
J. Neurosci.,
July 16, 2003;
23(15):
6362 - 6372.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Thornton, R. Yaka, S. Dinh, and D. Ron
H-Ras Modulates N-Methyl-D-aspartate Receptor Function via Inhibition of Src Tyrosine Kinase Activity
J. Biol. Chem.,
June 20, 2003;
278(26):
23823 - 23829.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Opazo, A. M. Watabe, S. G. N. Grant, and T. J. O'Dell
Phosphatidylinositol 3-Kinase Regulates the Induction of Long-Term Potentiation through Extracellular Signal-Related Kinase-Independent Mechanisms
J. Neurosci.,
May 1, 2003;
23(9):
3679 - 3688.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Harvey-Girard and R. J. Dunn
Excitatory Amino Acid Receptors of the Electrosensory System: The NR1/NR2B N-Methyl-D-Aspartate Receptor
J Neurophysiol,
February 1, 2003;
89(2):
822 - 832.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. H. Komiyama, A. M. Watabe, H. J. Carlisle, K. Porter, P. Charlesworth, J. Monti, D. J. C. Strathdee, C. M. O'Carroll, S. J. Martin, R. G. M. Morris, et al.
SynGAP Regulates ERK/MAPK Signaling, Synaptic Plasticity, and Learning in the Complex with Postsynaptic Density 95 and NMDA Receptor
J. Neurosci.,
November 15, 2002;
22(22):
9721 - 9732.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Sheng and M. J. Kim
Postsynaptic Signaling and Plasticity Mechanisms
Science,
October 25, 2002;
298(5594):
776 - 780.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. M. Costa and A. J. Silva
Review Article : Molecular and Cellular Mechanisms Underlying the Cognitive Deficits Associated With Neurofibromatosis 1
J Child Neurol,
August 1, 2002;
17(8):
622 - 626.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-H. Koh, C. Ruiz-Canada, M. Gorczyca, and V. Budnik
The Ras1-Mitogen-Activated Protein Kinase Signal Transduction Pathway Regulates Synaptic Plasticity through Fasciclin II-Mediated Cell Adhesion
J. Neurosci.,
April 1, 2002;
22(7):
2496 - 2504.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Nishiyama, T. Knopfel, S. Endo, and S. Itohara
Glial protein S100B modulates long-term neuronal synaptic plasticity
PNAS,
March 19, 2002;
99(6):
4037 - 4042.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Woodhall, D. I. Evans, M. O. Cunningham, and R. S. G. Jones
NR2B-Containing NMDA Autoreceptors at Synapses on Entorhinal Cortical Neurons
J Neurophysiol,
October 1, 2001;
86(4):
1644 - 1651.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Iida, K. Namikawa, H. Kiyama, H. Ueno, S. Nakamura, and S. Hattori
Requirement of Ras for the Activation of Mitogen-Activated Protein Kinase by Calcium Influx, cAMP, and Neurotrophin in Hippocampal Neurons
J. Neurosci.,
September 1, 2001;
21(17):
6459 - 6466.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. A. Gusev and D. L. Alkon
Intracellular Correlates of Spatial Memory Acquisition in Hippocampal Slices: Long-Term Disinhibition of CA1 Pyramidal Cells
J Neurophysiol,
August 1, 2001;
86(2):
881 - 899.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. M. Esteban, C. Vicario-Abejón, P. Fernández-Salguero, A. Fernández-Medarde, N. Swaminathan, K. Yienger, E. Lopez, M. Malumbres, R. McKay, J. M. Ward, et al.
Targeted Genomic Disruption of H-ras and N-ras, Individually or in Combination, Reveals the Dispensability of Both Loci for Mouse Growth and Development
Mol. Cell. Biol.,
March 1, 2001;
21(5):
1444 - 1452.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
R. Heumann, C. Goemans, D. Bartsch, K. Lingenhohl, P. C. Waldmeier, B. Hengerer, P. R. Allegrini, K. Schellander, E. F. Wagner, T. Arendt, et al.
Transgenic Activation of Ras in Neurons Promotes Hypertrophy and Protects from Lesion-induced Degeneration
J. Cell Biol.,
December 27, 2000;
151(7):
1537 - 1548.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Nakazawa, S. Komai, T. Tezuka, C. Hisatsune, H. Umemori, K. Semba, M. Mishina, T. Manabe, and T. Yamamoto
Characterization of Fyn-mediated Tyrosine Phosphorylation Sites on GluRepsilon 2 (NR2B) Subunit of the N-Methyl-D-aspartate Receptor
J. Biol. Chem.,
January 5, 2001;
276(1):
693 - 699.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Li, A. Okano, Q. B. Tian, K. Nakayama, T. Furihata, H. Nawa, and T. Suzuki
Characterization of a Novel synGAP Isoform, synGAP-beta
J. Biol. Chem.,
June 8, 2001;
276(24):
21417 - 21424.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|