 |
Previous Article | Next Article 
The Journal of Neuroscience, April 1, 2000, 20(7):2543-2550
Thrombomodulin as a New Marker of Lesion-Induced Astrogliosis:
Involvement of Thrombin through the G-Protein-Coupled
Protease-Activated Receptor-1
Armelle
Pindon1,
Martin
Berry2, and
Daniel
Hantaï1
1 Institut National de la Santé et de la
Recherche Médicale Unité 523 (formerly 153), Institut de
Myologie, Hôpital de la Salpêtrière, F-75013 Paris,
France, and 2 Guy's, King's, and St. Thomas' School of
Biomedical Sciences, Centre of Neuroscience, Unit of Brain Damage and
Repair, Guy's Campus, London SE1 1UL, United Kingdom
 |
ABSTRACT |
Because injury of the CNS causes an astrogliosis, characterized by
cell swelling and proliferation, similar to the effects of the serine
protease thrombin on astrocytes, we hypothesized that a high level of
thrombin at the site of injury might initially induce an astrocyte
reaction and later increase the expression of its specific inhibitor,
thrombomodulin. Thrombomodulin could then stabilize the astroglial scar
through its adhesive properties.
Here, we studied the in vivo injury response of
astrocytes in the anterior medullary velum of adult rat by
immunostaining and in situ hybridization of
thrombomodulin. Thrombomodulin was poorly expressed on astrocytes in
normal tissue, increased up to 2 d after injury, and was still
highly expressed at 6 d.
To check that thrombin had a direct effect on thrombomodulin expression
by astrocytes, we used brain cortical astrocyte primary cultures
treated with either thrombin or the agonist peptide thrombin receptor-activating peptide-6, known to activate directly the thrombin G-protein-coupled receptor (GPCR) protease-activated receptor-1 (PAR-1). Modification of thrombomodulin expression was
studied by Western blotting and quantitative reverse transcription-PCR. There was a dose-dependent increase in thrombomodulin after 48 hr of
treatment, with gene expression peaking at 24 hr but falling to control
levels by 48 hr.
Together, these results show the following: (1) injury increases
astrocyte thrombomodulin expression; (2) thrombin might mediate thrombomodulin expression via the specific receptor PAR-1; and (3)
serine proteases, their inhibitors, and the new family of GPCR, PARs,
are active on astrogliosis.
Key words:
astrocyte; glial scar; rat; serine protease; lesion; thrombomodulin
 |
INTRODUCTION |
Astrocytes are implicated in several
CNS processes throughout development and in aging. During adult
life, astrocytes play a role in the homeostasis of brain extracellular
ion balance achieved primarily through astrocytic potassium
ionic buffering (Walz, 1989 ). Trauma and other pathological events in
the CNS induce astrocytic scar reactions (Mathewson and Berry, 1985 ;
Eng, 1988 ), characterized by hypertrophy, hyperplasia, and the
accumulation of gliofilaments. Because we and others have shown
previously that thrombin induced the same effects on cultured
astrocytes (Beecher et al., 1994 ; Grabham and Cunningham, 1995 ; Pindon
et al., 1998 ), we have studied the effects of this serine protease, generated in great amount at the site of a lesion, on astrocyte behavior in vivo.
Thrombin is a multifunctional serine protease, first described as
cleaving fibrinogen into fibrin in the blood-clotting cascade (Stone
and Le Bonniec, 1998 ). Thrombin has three specific G-protein-coupled receptors (GPCRs), protease-activated receptor-1, -3, and -4 (PAR-1, PAR-3, and PAR-4) (Vu et al., 1991 ; Ishihara et al., 1997 ; Xu et al.,
1998 ) through which it activates a wide range of cells, including
macrophages, bone cells, and neurons (Gustafson and Lerner,
1983 ; Bar-Shavit et al., 1986 ; Gurwitz and Cunningham, 1988 ), inducing
cell differentiation or growth, so that some authors view thrombin as a
growth factor (Grand et al., 1996 ). What could be its influence on CNS lesions?
Thrombin is able to protect neurons and astrocytes from cell death
(Vaughan et al., 1995 ; Donovan and Cunningham, 1998 ). Its action on
astrocytes in vitro is concentration-dependent. In the nanomolar range, thrombin has a mitogenic effect (Perraud et al., 1987 ;
Cavanaugh et al., 1990 ) and induces synthesis and release of NGF and
endothelin (Ehrenreich et al., 1993 ; Neveu et al., 1993 ). In the
picomolar range, thrombin induces morphological changes, reversing
astrocyte stellation through the specific activation of PKC 1 by
PAR-1 (Pindon et al., 1998 ) but also through the activation of the
small GTP-binding protein Rho (Suidan et al., 1997 ). Thus, because
thrombin induces both astrocyte proliferation and shape changes similar
to those characteristic of astrogliosis, it is possible that thrombin
might be involved in the latter process.
Astrocyte and neuron behavior is governed by a delicate equilibrium
between thrombin and its inhibitors. Until now, most of the studies on
the thrombin inhibition in the CNS have been done on protease nexin 1 (PN1) (Monard, 1993 ). There is another thrombin inhibitor,
thrombomodulin, which we have shown previously to be present and
functionally active on primary astrocyte cultures (Pindon et al.,
1997 ). Thrombomodulin is a transmembrane glycoprotein able to form a
complex with the protease (Esmon, 1987 ). The lectin-like domain of
thrombomodulin might involve the molecule in a new type of cell-cell
adhesion (Imada et al., 1990 ).
We wanted to know whether thrombomodulin was involved in astrogliosis
in vivo and whether thrombin was able to modulate its expression. We are the first to demonstrate that thrombomodulin is a
new marker of astrogliosis in vivo after injury and that it
is upregulated in astrocyte primary cultures after thrombin administration.
 |
MATERIALS AND METHODS |
Materials
DMEM, fetal calf serum, and trypsin were from Life
Technologies (Grand Island, NY). Human -thrombin was obtained
from Enzyme Research Laboratories (Bloomington, IN), and thrombin
receptor-activating peptide-6 (TRAP-6) (SFLLRN) was obtained
from Bachem AG (Bubendorf, Switzerland). The anti-thrombomodulin 3E2
monoclonal antibody against human thrombomodulin was purchased from
Serbio (Gennevilliers, France). The rat monoclonal and rabbit
polyclonal antibodies against mouse thrombomodulin were a generous gift
from Prof. Imada (Meiji Institute of Health Science, Odawara,
Japan). The horseradish peroxidase-conjugated polyclonal
antibodies against rabbit or rat immunoglobulin were from Dako
(Glostrup, Denmark). The tetramethylrhodamine (TMR)-conjugated goat
anti-rabbit IgG and fluorescein isothiocyanate (FITC)-conjugated goat
anti-mouse IgG were from Jackson ImmunoResearch (West Grove, PA). The
following items were supplied by Boehringer Mannheim (Mannheim,
Germany): digoxigenin detection kit, sheep anti-digoxigenin-alkaline
phosphatase Fab fragments, blocking reagent, digoxigenin in
vitro transcription kit, EcoRI and HindIII enzymes, and proteinase K. The sodium lauryl sarcosinate (Sarkosyl) was
from Fluka Chemie AG (Buchs, Switzerland). The reverse transcription (RT)-PCR kit was purchased from Promega (Paris, France); Taq
polymerase from Eurobio (Les Ulis, France); RT-PCR MIMIC construction
kit from Clontech (Palo Alto, CA); and the enhanced chemiluminescence (ECL) kit from Amersham (Buckinghamshire, UK). The following were purchased from Sigma (St. Louis, MO): protease inhibitors (leupeptin, aprotinin, and pepstatin), nitro blue tetrazolium (NBT), and
5-bromo-4-chloro-3-indolyl phosphate (BCIP). All other chemicals were
of reagent grade.
Methods
Astrocyte cell culture
All animal studies were approved by animal use procedures
adopted by the Institut National de la Santé et de la Recherche Médicale. Neonatal (1- to 3-d-old) OF1 mice (IFFA CREDO,
L'Arbresle, France) were anesthetized on ice and decapitated, and
their brains were removed. After careful removal of the meninges, the
cortex were passed through a 100 µm mesh filter in DMEM containing
20% fetal calf serum. The cells were seeded from a half cortex/25 cm2 flask. Astrocytes were isolated from
cortex following a protocol designed for newborn rats (McCarthy and
Vellis, 1980 ), as modified previously for mice (Beecher et al., 1994 ).
After 24 hr, the medium was removed, and cells were washed by pipetting
PBS (in mM: 137 NaCl, 2.7 KCl, 6.7 Na2HPO4, 1.5 KH2PO4, 0.7 CaCl2, and 0.5 MgCl2, pH
7.4) to remove loosely adherent cells, and, at day 3, the medium was
replaced by DMEM containing 10% fetal calf serum. When confluent, cells were washed twice with PBS and subsequently washed with 0.2 gm/l
EDTA and 0.5 gm/l trypsin to remove oligodendrocytes. After
trypsinization at 37°C for 5 min, the cells were grown in DMEM
containing 10% fetal calf serum. This culture contains >90% astrocytes recognized by the presence of an astrocyte-specific protein,
glial fibrillary acidic protein (GFAP).
Cell treatment
Cells were incubated in serum-free (thus thrombin-free) medium
for at least 12 hr before treatment. Cells were undergoing a single
treatment with 2 nM -thrombin, TRAP-6 at different
concentrations from 1.5 nM to 150 µM, or, as
a control, the vehicle (PBS), all at 37°C (5%
CO2). Cells were left in the same medium and were collected 9, 24, 36, and 48 hr after treatment was initiated.
Anterior medullary velum lesion
Lesions were placed in the anterior medullary velum (AMV) (Berry
et al., 1995 ) of Avertin-anesthetized, adult Wistar rats using a
retractable, curved needle, guarded by a trochar, devised specifically
for this purpose. With the needle withdrawn into the trochar, the
instrument was introduced through the posterior atlanto-occipital
membrane into the IVth ventricle until the tip of the instrument lay in
the most rostral portion of the ventricle. Protrusion of the enclosed
needle, at this point, brought its superiorly curving tip into contact
with the AMV in the ventricular roof. Withdrawal of the instrument,
with the needle protruded, thus produced a midsagittal lesion of the
AMV, sometimes accompanied by a corresponding lesion of the overlying
cerebellar vermis. Groups of five lesioned animals, of either sex, were
killed 9 hr postlesioning (hpl) and 1, 2, and 6 d postlesioning
(dpl). Animals were perfused with 4% paraformaldehyde (PAF) in PBS.
The entire AMV, with trochlear nerves attached, was then dissected free
from the inferior colliculi and rostroinferior surface of the
cerebellum (Fig. 1) and transferred to
distilled water.

View larger version (22K):
[in this window]
[in a new window]
|
Figure 1.
Schematic representation of whole mounts of rat
AMV. A, Intact; B, transected by a
midsagittal penetrant lesion. In the intact specimen, trochlear fibers
from the ipsilateral IVth nucleus (IV) in the
midbrain invade the AMV at the entry point (*); the majority decussate
and exit in the contralateral IVth nerve rootlet
(A). Midsagittal transection of the crossing
axons precipitates degeneration of all severed distal segments coursing
contralaterally from the midline into each rootlet
(B). From the severed proximal stumps of IVth
nerve fibers, regenerating sprouts grow into the ipsilateral halves of
each velum, specifically directed into each ipsilateral IVth nerve
rootlet, represented as dashed lines. Modified from
Berry et al. (1998) .
|
|
Immunohistochemistry on AMV
Free-floating AMV were fixed again in 4% PAF for 15 min, washed
with PBS, permeabilized with 0.1% Triton X-100 overnight, and then
washed twice in PBS. Saturation was performed for 2 hr in PBS
containing 0.1% BSA (PBS-BSA) and 1% normal goat serum at 4°C.
Double-staining was performed by incubating monoclonal 3E2
anti-thrombomodulin and polyclonal anti-GFAP antibodies with a dilution
of 1:100 in PBS-BSA, overnight at 4°C. AMV were washed twice for 5 min and once for 10 min in PBS and then incubated for 1 hr at 4°C
with secondary antibodies, TMR-conjugated goat anti-rabbit IgG, and
FITC-conjugated goat anti-mouse IgG diluted in PBS-BSA at 1:250 and
1:200, respectively. AMV were washed twice for 5 min and once for 10 min in PBS, then fixated in 4% PAF for 10 min before mounting and
viewing with a Zeiss (Oberkochen, Germany) Axiophot fluorescence
microscope or a Leica (Nussloch, Germany) TCS 4D confocal microscope.
Synthesis of digoxigenin-labeled riboprobes
Sense and antisense riboprobes were synthesized. Five micrograms
of plasmid containing the thrombomodulin cDNA fragment of 418 bp
(described by Pindon et al., 1997 ) were opened by incubating either
EcoRI or HindIII for 1 hr at 37°C, precipitated
in 0.15 M sodium acetate, pH 5, and 50% of
phenol-chloroform, and centrifuged for 5 min at 12,000 × g. The pellet was washed with 70% ethanol and resuspended
in 4 µl of H2O. Riboprobes were synthesized
with 1 µl of this suspension using an in vitro
transcription SP6/T7 digoxigenin labeling kit. The reaction was
performed with T3 polymerase for the sense probe and T7 polymerase for
the antisense probe, using the digoxigenin-UTP nucleotides mix, in the
presence of RNase, for 2 hr at 37°C and then for 10 min with 2 µl
of DNase. RNA were precipitated by incubating overnight at 20°C in
the presence of 100 µl of TE buffer (10 mM
Tris-HCl and 0.1 mM EDTA, pH 7.5).
In situ hybridization
Free-floating AMV were washed twice for 5 min in PBS-0.1%
Tween 20 (PBST), dipped successively in 50% methanol-PBST and 75% methanol-PBST for 2 min, quickly dipped in 50% methanol-PBST and 25% methanol-PBST, and given two 5 min washes in PBST. AMV were treated with 10 µg/ml proteinase K for 10 min, fixed with 4% PAF in
PBS containing 4 µl/ml 25% glutaraldehyde for 15 min, washed once
with PBST for 5 min, and put in a solution of 50% PBST and 50%
hybridization mix (50% formamide, 1.3× SSC, 5 mM EDTA,
100 µg/ml heparin, 50 µg/ml yeast RNA, 0.2% Tween 20, and 0.5%
CHAPS). After washing three times for 5 min with hybridization mix, AMV were incubated overnight at 65°C in the mix containing the probe at a
concentration of 10 µl/ml, washed twice for 30 min in hybridization mix at 65°C and then for 20 min at 65°C in 50% hybridization
mix-50% MABT solution (100 mM maleic acid, 1150 mM NaCl, and 0.1% Tween 20, pH 7.5), rinsed three times in
MABT at room temperature, and finally incubated for 30 min with 300 ml
of MABT, 100 ml of blocking reagent (from the kit), and 100 ml of
normal goat serum. The immunodetection of the probe was performed
overnight at 4°C in the same solution as above containing the
antibody anti-digoxigenin-alkaline phosphatase at 1:2000. AMV were
given three 5 min and three 1 hr washes with MABT, incubated twice for
10 min in the NTMT solution (0.1 M NaCl, 0.1 M
Tris-HCl, pH 9.5, 0.05 M MgCl2, and
1% Tween 20), and incubated at room temperature in the dark in NTMT
containing 4.5 µl/ml NBT and 3.5 µl/ml BCIP (X-phosphate). The
reaction was stopped by washing with PBST. AMV were then processed as
whole mounts as above for microscopy.
Cell fractionation
Cells were washed twice with PBS, placed into ice-cold 0.02 M Tris-HCl buffer, pH 7.5, containing a cocktail of
protease inhibitors (0.5 µg/ml leupeptin, 1.25 µg/ml aprotinin, and
0.5 µg/ml pepstatin), disrupted with a glass homogenizer at 4°C,
and ultracentrifuged at 105,000 × g for 30 min at
4°C in an ultracentrifuge (Beckman, Palo Alto, CA). The supernatant
consisted of the cytosolic fraction. The pellet was resuspended in
ice-cold 0.01 M Tris-HCl, pH 6.8, containing 1%
Triton X-100, for 20 min at 4°C, and again centrifuged at
105,000 × g for 30 min. The supernatant of this final
centrifugation consisted of the solubilized membrane protein fraction.
Western immunoblotting
After cell fractionation, membrane fraction protein extracts (10 µg/well) were resolved on 10% SDS-PAGE (Laemmli, 1970 ) and subsequently transferred to a nitrocellulose membrane (Towbin et al.,
1979 ) in 0.025 M Tris, 0.192 M glycine, and
10% isopropanol, pH 8.3, buffer. Membranes were incubated for 2 hr at
25°C with PBS containing 10% instant nonfat dry milk. They were
subsequently incubated overnight in PBS containing 5% instant nonfat
dry milk, along with either a polyclonal or monoclonal antibody against mouse thrombomodulin, washed once for 5 min and three times for 15 min
in PBS-0.05% Tween 20. They were then incubated for 1 hr at room
temperature with either a peroxidase-conjugated polyclonal goat
anti-rabbit IgG antibody or a mouse IgG antibody and washed again as
above. Finally, immunoreactive bands were revealed using ECL reagents
(Amersham) and visualized on Kodak (Eastman Kodak, Rochester, NY)
X-OMAT AR film. Western blots were quantified using the MCID-M4
software (Imaging Research Inc., St Catharines, Ontario, Canada).
RNA extraction
Total RNA was prepared according to Chomczynski and Sacchi
(1987) . Cells were washed with PBS at 4°C and lysed in 4 M guanidium thiocyanate, 25 mM sodium citrate,
pH 7.5, 0.5% Sarkosyl, and 0.1 M -2 mercaptoethanol.
The total amount of RNA was determined by measuring its absorbance at
260 nm in a Beckman DU-70 spectrophotometer.
Competitive RT-PCR mimic
This method uses a PCR mimic DNA that contains complementary
sequences of primers identical to the sequences found on the thrombomodulin cDNA used in conventional thrombomodulin PCR. Known amounts of mimic DNA were mixed with the thrombomodulin cDNA and competed together for the PCR. When the intensity of PCR products were
equal for mimic DNA and thrombomodulin cDNA, we estimated that titers
of both were equal.
PCR mimic construction. Construction of the PCR mimic was
performed using the RT-PCR MIMIC kit from Clontech. A primary PCR amplification of 2 ng of a 554 bp neutral DNA fragment
(BamHI/EcoRI of v-erbB) was performed
using the PCR kit from Promega. The composite primers were 5'
TGGTGTGGTCAATGTCCGCAAGTGAAATCTCCTCCG 3' and 5' AGTGTCGGTGGTAAGATTGAGTCCATGGGGAGCTTT 3'. The PCR was performed in a
total volume of 50 ml with 1.5 mM
MgCl2, 2.5 U Taq polymerase, and 0.4 µM composite primers. The reaction cycles were
1 cycle at 95°C for 5 min and 30 cycles of three segments: 45 sec at
94°C, 45 sec at 50°C, and 90 sec at 72°C. The PCR product was
diluted at 1:100 and ran for a second PCR amplification using 1 mM MgCl2, 2.5 U
Taq polymerase, and 0.4 µM primers
as described by Pindon et al. (1997) .
PCR mimic purification and estimation. PCR products were
loaded on chroma spin TE-100 columns and then centrifuged at 700 × g for 5 min. The product and different concentrations of
fX174 DNA were resolved on a 1% agarose gel electrophoresis.
Comparison of band intensities gave the mimic concentration in
nanograms per milliliter. We calculated the mimic DNA
concentration in attomoles per milliliter because the molecular weight
of the mimic was 604 × 600 = 398,640 gm/mol. We diluted the
mimic DNA to 100 amol/ml in TE buffer.
Preliminary competitive PCR amplification. Thrombomodulin
cDNA was obtained by performing retrotranscription with 3 µg of astrocyte total RNA using the Promega kit; RNA was heated for 3 min at
65°C, added to the reaction medium from the Promega kit, and
incubated for 40 min at 42°C. Serial dilution of mimic DNA was
performed in TE buffer to obtain nine concentrations from 100 amol/ml
to 10 6 amol/ml. Competitive PCR were run
in 96-well plates with serial dilutions of PCR mimic competing with a
constant amount of thrombomodulin cDNA. PCR were performed with 2 µl
of a mimic DNA concentration, 2 µl of the retrotranscription product,
and 46 µl of PCR reaction buffer (1 mM
MgCl2, 2.5 U Taq polymerase, and 0.4 µM of thrombomodulin primers). PCR was run as
described by Pindon et al. (1997) . PCR products were resolved on a 1%
agarose gel, size markers used were Boehringer markers IV, mimic DNA is
604 bp, and thrombomodulin cDNA fragment is 418 bp. Comparison of the
intensity of the two bands, mimic DNA and thrombomodulin cDNA, in each
independent well gave an estimation of the cDNA amount and determined
the dilution range to be used in the fine-tuned competitive PCR amplification.
Fine-tuned competitive PCR amplification. A twofold dilution
series was made with mimic DNA (i.e., from
10 2 to 0.312 10 3 amol), and PCR was run in 96-well
plates with 2 µl of a mimic DNA, 2 µl of the astrocyte total RNA
retrotranscription product, and 46 µl of PCR reaction buffer, as
described above. PCR products were resolved on a 1% agarose gel, and
the amount of thrombomodulin fragment cDNA was determined by comparing
the intensity of the two bands in each independent PCR. The
concentration of cDNA was equal to the one of mimic DNA when the two
bands had the same intensity.
 |
RESULTS |
Thrombomodulin expression in the lesioned AMV
Protein expression: immunohistochemistry
The protein expression of thrombomodulin was studied by
immunohistochemistry on permeabilized AMV at different times after lesion: 0 and 9 hpl and 1, 2, and 6 dpl. To visualize astrocytes and
thrombomodulin, double-staining was performed. Cells were labeled with
anti-GFAP antibody specific for astrocytes and a marker of astrogliosis
(Bignami et al., 1972 ) and anti-human thrombomodulin monoclonal
antibody. Immunohistochemistry was visualized in the z plan of
the tissue that contained astrocytes using a confocal microscope.
Immediately after lesion, thrombomodulin was weakly expressed in the
AMV up to 9 hpl but increased after 1 dpl (Fig.
2A,D,G). Thrombomodulin protein expression was maximal at 2 dpl but decreased at
6 dpl (Fig. 2J,M). However,
thrombomodulin expression was more intense at 6 dpl than in controls.
GFAP was present at all times after lesion, compatible with the
astrogliosis (Fig.
2B,E,H,K). Thrombomodulin and GFAP were colocalized (Fig.
2I,L,O), showing that
thrombomodulin coated reactive astrocytes after lesioning.

View larger version (97K):
[in this window]
[in a new window]
|
Figure 2.
Thrombomodulin protein increases on astrocytes
after lesion of the AMV. Double-immunolabeling by thrombomodulin
(left) and GFAP (middle) of astrocytes of
whole mounts of AMV at different times after lesioning as observed by
confocal microscopy. Times after lesion are as follows: 0 hpl
(A-C); 9 hpl (D-F); 1 dpl
(G-I); 2 dpl (J-L); and 6 dpl (M-O). Immunohistochemistry was performed
with monoclonal 3E2 anti-thrombomodulin and polyclonal anti-GFAP
antibodies, which were revealed by fluorescein
isothiocyanate-conjugated (green) and
tetra-methylrhodamine-conjugated (red) secondary
antibodies, respectively. Colocalization of thrombomodulin and GFAP on
astrocytes is shown by yellow (right),
maximal at 2 dpl. Pictures represent a representative sample of five
experiments. Scale bar, 50 µm.
|
|
mRNA expression: in situ hybridization
Thrombomodulin mRNA was revealed by in situ
hybridization with a riboprobe in which uracil bases were coupled with
digoxigenin. Phosphatase alkaline-coupled antibodies against
digoxigenin were used and revealed by precipitation of diformazan.
Thrombomodulin mRNA was not detected in AMV at 0 hpl (Fig.
3A) but first appeared at 9 hpl, and the level of expression increased to become maximal by 1-2
dpl (Fig. 3B-D). At 2 dpl, the expression of thrombomodulin
mRNA was localized within a limited area around the site of the lesion
delineating a clear boundary outside of which no staining was detected
(Fig. 3F). Thrombomodulin mRNA was still expressed
around the lesion at 6 dpl but with a weaker intensity (Fig.
3E). Controls, performed with sense probe, did not show any
specific staining in the AMV. The staining seen on the border of the
tissue (Fig. 3A-E) is a nonspecific edge effect also
observed in negative control sense riboprobe.

View larger version (158K):
[in this window]
[in a new window]
|
Figure 3.
Thrombomodulin mRNA is upregulated after lesion of
AMV. In situ hybridization of thrombomodulin mRNA after
lesion of the AMV. AMV were taken at different times after lesioning
and hybridized with a digoxigenin-labeled riboprobe, followed by
immunodetection with an anti-digoxigenin-alkaline phosphatase antibody
revealed by a diformazan precipitate. Times after lesion:
A, 0 hpl; B, 9 hpl; C, 1 dpl; D, F, 2 dpl; E, 6 dpl. The lesion is marked by asterisks in
A-E, except in F in which it is out of
the field on the right. Note that, at 2 dpl in
F, there is a clear limit between thrombomodulin
mRNA-positive (right) and mRNA-negative
(left) cells, which might mark the limit of a front of
astrocytosis (see Discussion). Scale bars, 100 µm.
|
|
To show that thrombomodulin mRNA expression was localized on
astrocytes, we performed immunohistochemistry revealing GFAP on AMV
already processed for thrombomodulin mRNA in situ
hybridization. We visualized the staining with confocal microscopy to
be in the precise z plan of the astrocytes. Because of technical
limitation of confocal microscopy, it is not possible to visualize the
diformazan precipitate under visible light. Nevertheless, it was
possible to see the mRNA in an indirect way; the presence of the
diformazan precipitate quenches the fluorescent immunostaining and
shows instead a negative dark surface. The GFAP immunohistochemistry performed alone on AMV shows staining of astrocyte cell bodies (Fig.
4A). However, when
performed after in situ hybridization, only astrocyte
processes were stained, whereas astrocyte cell bodies were dark (Fig.
4B). We concluded that thrombomodulin mRNA was
colocalized within astrocytes.

View larger version (112K):
[in this window]
[in a new window]
|
Figure 4.
Astrocytes express thrombomodulin in AMV after
lesioning. Immunohistochemistry of GFAP was performed after the
in situ hybridization of thrombomodulin mRNA. Confocal
immunolocalization of GFAP (A) and of GFAP
followed by thrombomodulin in situ hybridization
(B) in astrocytes in the AMV at 2 dpl. Note that
the astrocyte somata (arrows), clearly visible in
A, appear as black negative circles in
B after in situ hybridization because of
the diformazan precipitate. This shows that astrocytes are the cells
expressing thrombomodulin in the AMV. Scale bar, 50 µm.
|
|
Thrombomodulin expression was modulated by thrombin treatment
Thrombomodulin protein expression after thrombin treatment
Astrocyte primary cultures were grown in serum-free conditions for
at least 12 hr and treated with a single dose of -thrombin at 2 nM. Cells were harvested 9, 24, 36, and 48 hr after the
treatment. The membrane fraction was resolved by Western blot analysis.
We have shown previously that mouse thrombomodulin is present in astrocytes (Pindon et al., 1997 ) and appears in Western blots with a
molecular mass of 70 and 140 kDa as described previously (Imada et al.,
1987 ). Because this was the expected molecular mass of thrombomodulin,
we focused the quantification on the 70 kDa band. We show here that, 9 hr after thrombin treatment, thrombomodulin localized in the membrane
fraction disappeared (Fig.
5A). The protein appeared 24 hr after treatment, at the same level of expression as in controls
(Fig. 5A,C). Then, thrombomodulin
levels increased and more than doubled 48 hr after thrombin treatment
(Fig. 5A,C). No significant
modification of thrombomodulin levels were observed (Fig.
5B) after repeating the above experiments with 2 nM -thrombin previously incubated for 5 min at
37°C with 10 U/ml hirudin, a thrombin inhibitor.

View larger version (30K):
[in this window]
[in a new window]
|
Figure 5.
Time course of thrombin-induced modulation of
thrombomodulin protein expression by astrocytes in culture; Western
blot of thrombomodulin expression after thrombin treatment on rat
primary astrocyte cultures. A, Cells were treated with 2 nM -thrombin for 9, 24, 36, and 48 hr. Control
(Ctl) were vehicle-treated astrocytes. Bands have
been quantified using MCID program. B, As a control, we
used the same time treatments with 2 nM -thrombin plus
10 U/ml hirudin. Bands have been quantified using MCID software.
Membrane fractions were obtained by cell fractionation, and 10 µg of
proteins were loaded on 10% SDS-PAGE and then transferred on a
nitrocellulose membrane. Monoclonal antibody against mouse
thrombomodulin was used, and horseradish-peroxidase-conjugated
secondary antibody was revealed by enhanced chemiluminescence.
C, Quantification of thrombomodulin in membrane
fraction. Data are expressed as the percentage of the control sample
scan area. Results are mean of three independent experiments performed
on three different astrocyte primary cultures. Error bars are
SD.
|
|
Protein expression after PAR-1-specific activation
To determine whether a thrombomodulin increase induced by thrombin
was dependent on PAR-1 activation, we performed a dose-response curve
with TRAP-6, a specific activator of PAR-1 (Fig.
6). Astrocytes were incubated for 48 hr
because thrombomodulin expression was found to be doubled at this time
(see above). We found that the thrombomodulin 70 kDa band, which is the
predicted molecular mass of the protein, was upregulated by PAR-1
activation. The effect of PAR-1 activation on thrombomodulin levels
started from 1.5 µM TRAP-6.

View larger version (26K):
[in this window]
[in a new window]
|
Figure 6.
Upregulation of thrombomodulin protein expression
by astrocytes in culture is attributable to the activation of PAR-1.
Western blot of thrombomodulin after a dose-response treatment of
TRAP-6. Primary astrocyte cultures were treated for 48 hr with TRAP-6
(SFLLRN): untreated, C; 150 µM,
1; 1.5 µM, 2; 150 nM, 3; and 1.5 nM,
4. Membrane fractions were obtained by cell
fractionation, and 10 µg of proteins were loaded on 10% SDS-PAGE and
then transferred on a nitrocellulose membrane. Polyclonal antibody
against mouse thrombomodulin was used, and
horseradish-peroxidase-conjugated secondary antibody was revealed by
enhanced chemiluminescence.
|
|
Thrombomodulin mRNA expression after thrombin treatment
The amount of thrombomodulin mRNA in astrocyte primary cultures
treated once with 2 nM -thrombin was studied at
different times using a quantitative RT-PCR mimic technique.
Retrotranscription was performed with 3 µg of total RNA extract. The
competitive PCR was performed with the whole amount of cDNA and an
increasing amount of mimic DNA. Fine-tuning of the competitive PCR
amplification was performed with a twofold dilution series from
10 2 to
3.10 4 amol of mimic DNA (Fig.
7). Thrombomodulin cDNA, reflecting the amount of thrombomodulin mRNA in astrocytes, was upregulated by thrombin. The increase in thrombomodulin mRNA levels was transient because it was doubled 9 hr after treatment and increased by fivefold after 24 hr (Fig. 7). The amount dropped to control levels by 48 hr after treatment.

View larger version (44K):
[in this window]
[in a new window]
|
Figure 7.
Thrombin upregulates thrombomodulin mRNA
expression in cultured astrocytes; quantitative thrombomodulin mRNA
expression at different times after thrombin treatment as measured by
RT-PCR mimic. Astrocytes were treated with either 2 nM
-thrombin for 9, 24, or 48 hr or vehicle
(Control). A, Reverse transcription
was made with 3 µg of astrocyte total RNA. PCR was performed with the
whole product of the reverse transcription to which various
concentrations of mimic were added: 10 2 amol
(1); 5 × 10 3 amol
(2); 2.5 × 10 3 amol
(3); 1.25 × 10 3 amol
(4); 0.625 × 10 3 amol
(5); and 0.312 × 10 3 amol
(6). The PCR amplimers were separated by
electrophoresis on 1% agarose gels. The gel represents a typical
experiment of three independent experiments from three independent
astrocyte primary cultures. B, Thrombomodulin mRNA
quantification performed by competitive RT-PCR mimic. Results are mean
of three independent experiments from three different astrocyte primary
cultures. Errors bars are SD.
|
|
 |
DISCUSSION |
The transition of astrocytes from resting to reactive cells
correlated with the expression of a wide range of new molecules (for
review, see Ridet et al., 1997 ). Nevertheless, little is known about
the mechanisms triggering astrogliosis. To the list of cytokines and
growth factors implicated in the reaction of the CNS to injury, we can
now add a new family of compounds, the serine proteases, signaling via
one of the novel GPCR family, the PARs (for review, see Dery et al.,
1998 ) and their inhibitors. Recently, gene expression of PAR-1 and the
thrombin inhibitor PN1 was shown to be modulated in neurons after
axotomy (Niclou et al., 1998 ).
Injury of the AMV induces a reactive astrogliosis (Berry et al., 1998 )
for which thrombomodulin is a transient marker. Thrombomodulin expression in vivo was very weak but increased after trauma,
with a maximal expression at 2 dpl corresponding to the approximate time needed to initiate astrogliosis (O'Brien et al., 1994 ; Hou et
al., 1995 ). Thrombomodulin expression decreased later but always stayed
elevated compared with controls. As we have shown previously (Pindon et
al., 1997 ), thrombomodulin was expressed over the surface of the
astrocyte plasma membrane, whereas GFAP stained only intermediate filaments; thus, thrombomodulin staining revealed the entire surface of astrocytes.
Variations in immunostaining of thrombomodulin reflect changes in
thrombomodulin gene expression. However, we could not reject the
hypothesis that the regulation of thrombomodulin expression over the
astrocyte cell surface was by proteins released from vesicles in the
vicinity of the plasma membrane (Maruyama and Majerus, 1985 ). There was
no detectable thrombomodulin expression in normal conditions (Fig.
2A), but mRNA transcription occurred after lesioning
(Fig. 3B-E). The kinetics of the gene expression were
delayed compared with protein expression of thrombomodulin, because
mRNA was detectable from 9 hpl with a maximum at 1 dpl.
We observed here that astrocytes expressing thrombomodulin mRNA spread
from the lesion site into a restricted area of the surrounding tissue
(Fig. 3F). This phenomenon might be linked to the
observation that the response to a CNS lesion is characterized by a
wave of reactive gliosis propagating outward from the lesion site
(Mathewson and Berry, 1985 ; Logan and Berry, 1993 ). Here, we found
that, because thrombomodulin is a transient marker of astrogliosis, it
may mark the wave front of astrocyte reactivity. Thrombomodulin is not
only a thrombin inhibitor but could also increase the cell-to-cell
adhesion via its lectin homolog domain (Patthy, 1988 ; Petersen, 1988 )
and might stabilize the astrocyte processes forming the scar. The N
terminus of thrombomodulin, like that of E selectin (another adhesion
molecule that is also induced by thrombin on endothelial cells
(Kaplanski et al., 1997 ), has been shown to belong to the C-type lectin
family (Graves et al., 1994 ). Moreover, structure-function analysis of
the C-type lectin indicates a defined region containing specific amino
acid side chains that may be involved in ligand binding (Graves et al.,
1994 ; Villoutreix and Dalbäck, 1998 ). It has been suggested that
an unknown ligand binds to the thrombomodulin lectin domain and
triggers signal transduction pathways (Zhang et al., 1998 ).
Thrombin regulates thrombomodulin expression in vitro in
hemangioma cells and smooth muscle cells (Dittman et al., 1989 ;
Bartha et al., 1993 ; Ma et al., 1997 ). We wanted to know whether
thrombin could induce similar regulation in astrocytes based on a model used to define the biochemical activity of thrombomodulin on newborn mouse cortical astrocyte primary cultures mediated by the formation of
a thrombin-thrombomodulin complex (Pindon et al., 1997 ). The observation of Maruyama and Majerus (1985) , that the
thrombin-thrombomodulin complex is internalized and degraded, could
explain our finding of thrombomodulin levels falling 9 hr after a
single thrombin treatment of astrocytes. Subsequently, thrombin induced
a time-dependent increase of thrombomodulin expression in astrocytes
doubling the amount 2 d after a single thrombin treatment. Two
days was the time we chose to study the effect of TRAP-6, a specific
activator of the GPCR PAR-1, on PAR-1 activation. This study
demonstrated that responses induced in the brain are not
attributable to a general proteolytic effect but involve an
intracellular signaling mechanism in response to thrombin.
The increase of thrombomodulin expression induced by thrombin was
mediated by the specific receptor PAR-1 (Fig. 5). TRAP-6-induced thrombomodulin increased in a dose-dependent way. The efficient concentrations of TRAP-6-inducing thrombomodulin were similar to those
found by Grabham and Cunningham (1995) to induce tyrosine phosphorylation in astrocytes. For lower concentrations, which did not
induce tyrosine phosphorylation, we did not find thrombomodulin modulation. The PAR-1 activation on neurons induces neurite retraction, dependent on tyrosine kinase and phosphatase activities (Jalink and
Moolenaar, 1992 ; Suidan et al., 1992 ). It will be interesting to know
whether thrombomodulin variations are also dependent on tyrosine
phosphorylations. These modulations are regulated at the
transcriptional level because our quantitative RT-PCR showed that mRNA
levels were increased fivefold 1 d after a single treatment (Figs.
6, 7); their subsequent decrease could be explained by the half-life of
thrombomodulin (8.9 hr) (Dittman et al., 1988 ), underlying the weak
stability of this mRNA. The kinetics of the modulation of
thrombomodulin mRNA levels are different from the protein; the
bell-shaped increase in expression of mRNA occurred earlier after the
treatments compared with that of the protein. At earlier stages after
trauma, the appearance of new thrombomodulin could have been hidden by
the internalization of the thrombin-thrombomodulin complex bound to
free thrombin (Maruyama and Majerus, 1985 ).
The upregulation of thrombomodulin induced by PAR-1 activation supports
the idea that thrombin acts in the first hour after trauma. Niclou and
colleagues (1998) could not find any PAR-1 mRNA in astrocytes of the
facial nerve by in situ hybridization 4 d after
transection, but because 4 dpl is already late for triggering astrogliosis, PAR-1 gene expression could have already been activated. In fact, the astroglial response takes place quite soon because GFAP
gene expression can be detected 1 hr after a mechanical lesion in
transgenic mice bearing a GFAP-lacZ gene construct (Mucke et al.,
1991 ). Moreover, thrombin infusion in the brain induces an infiltration
of inflammatory cells, proliferation of mesenchymatous cells,
angiogenesis, and increased astrocyte reactivity (Nishino et al.,
1993 ). The availability of a specific PAR-1 antagonist would be useful
to block thrombomodulin upregulation in vivo.
Together, these results support a strong correlation between the
thrombin-thrombomodulin system and the initial induction of cellular
and molecular astrogliosis events in reaction to CNS lesions.
 |
FOOTNOTES |
Received Nov. 5, 1999; revised Jan. 3, 2000; accepted Jan. 14, 2000.
This work was supported by Institut National de la Santé et de la
Recherche Médicale, the Association Française contre les
Myopathies, and the French Institute on Spinal Cord Research.
Correspondence should be addressed to Dr. Armelle Pindon, Institut
National de la Santé et de la Recherche Médicale
Unité 523, Institut de Myologie, Groupe Hospitalier
Pitié-Salpêtrière, 47, Boulevard de l'Hôpital,
75651 Paris Cedex 13, France. E-mail: inserm523{at}myologie.chups.jussieu.fr.
 |
REFERENCES |
-
Bar-Shavit R,
Kahn AJ,
Mann KG,
Wilner GD
(1986)
Growth-promoting effects of esterolytically inactive thrombin on macrophages.
J Cell Biochem
32:261-272[Web of Science][Medline].
-
Bartha K,
Brisson C,
Archipoff G,
de la Salle C,
Lanza F,
Cazenave JP,
Beretz A
(1993)
Thrombin regulates tissue factor and thrombomodulin mRNA levels and activities in human saphenous vein endothelial cells by distinct mechanisms.
J Biol Chem
268:421-429[Abstract/Free Full Text].
-
Beecher KL,
Andersen TT,
Fenton JW,
Festoff BW
(1994)
Thrombin receptor peptides induce shape change in neonatal murine astrocytes in culture.
J Neurosci Res
37:108-115[Web of Science][Medline].
-
Berry M,
Ibrahim M,
Carlile J,
Ruge F,
Duncan A,
Butt AM
(1995)
Axon-glial relationships in the anterior medullary velum of the adult rat.
J Neurocytol
24:965-983[Web of Science][Medline].
-
Berry M,
Hunter AS,
Duncan A,
Lordan J,
Kirvell S,
Tsang W-L,
Butt A
(1998)
Axon-glial relations during regeneration of axons in the adult rat anterior medullary velum.
J Neurocytol
27:915-937[Web of Science][Medline].
-
Bignami A,
Eng LF,
Dahl D,
Uyeda CT
(1972)
Localization of the glial fibrillary acidic protein in astrocytes by immunofluorescence.
Brain Res
43:429-435[Web of Science][Medline].
-
Cavanaugh KP,
Gurwitz D,
Cunningham DD,
Bradshaw RA
(1990)
Reciprocal modulation of astrocyte stellation by thrombin and protease nexin-1.
J Neurochem
54:1735-1743[Web of Science][Medline].
-
Chomczynski P,
Sacchi N
(1987)
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:156-159[Web of Science][Medline].
-
Dery O,
Corvera CU,
Steinhoff M,
Bunnett NW
(1998)
Proteinase-activated receptors: novel mechanisms of signaling by serine proteases.
Am J Physiol
43:1429-1452.
-
Dittman WA,
Kumada T,
Sadler JE,
Majerus PW
(1988)
The structure and function of mouse thrombomodulin. Phorbol myristate acetate stimulates degradation and synthesis of thrombomodulin without affecting mRNA levels in hemangioma cells.
J Biol Chem
263:15815-15822[Abstract/Free Full Text].
-
Dittman WA,
Kumada T,
Majerus PW
(1989)
Sequence of cDNA for mouse thrombomodulin and comparison of the predicted mouse and human amino acid sequences.
Nucleic Acids Res
17:802[Free Full Text].
-
Donovan FM,
Cunningham DD
(1998)
Signaling pathways involved in thrombin-induced cell protection.
J Biol Chem
273:12746-12752[Abstract/Free Full Text].
-
Ehrenreich H,
Cosat T,
Clouse KA,
Pluta RM,
Ogino Y,
Coligan JE,
Burd PR
(1993)
Thrombin is a regulator of endothelin-1.
Brain Res
600:201-207[Web of Science][Medline].
-
Eng LF
(1988)
Astrocytic response to injury.
In: Current issues in neuronal regeneration research (Reier P,
Bunge R,
Seil F,
eds), pp 247-255. New York: Liss.
-
Esmon CT
(1987)
The regulations of natural anticoagulant pathways.
Science
235:1348-1352[Abstract/Free Full Text].
-
Grabham P,
Cunningham DD
(1995)
Thrombin receptor activation stimulates astrocyte proliferation and reversal of stellation by distinct pathways: involvement of tyrosine phosphorylation.
J Neurochem
64:583-591[Web of Science][Medline].
-
Grand RJA,
Turnell AS,
Grabham PW
(1996)
Cellular consequences of thrombin-receptor activation.
Biochem J
313:353-368.
-
Graves BJ,
Crowther RL,
Chandran C,
Rumberger JM,
Li S,
Huang KS,
Presky DH,
Familetti PC,
Wolitzky BA,
Burns DK
(1994)
Insight into E-selectin/ligand interaction from the crystal structure and mutagenesis of the lec/EGF domains.
Nature
367:532-538[Medline].
-
Gurwitz D,
Cunningham DD
(1988)
Thrombin modulates and reverses neuroblastoma neurite outgrowth.
Proc Natl Acad Sci USA
85:3440-3444[Abstract/Free Full Text].
-
Gustafson GT,
Lerner U
(1983)
Thrombin, a stimulator of bone resorption.
Biosci Rep
3:255-261[Web of Science][Medline].
-
Hou YJ,
Yu AC,
Garcia JM,
Aotaki-Keen A,
Lee YL,
Eng LF,
Hjelmeland LJ,
Menon VK
(1995)
Astrogliosis in culture. IV. Effects of basic fibroblast growth factor.
J Neurosci Res
15:359-370.
-
Imada M,
Imada S,
Iwasaki H,
Kime A,
Yamguchi H,
Moore EE
(1987)
Fetomodulin: marker surface protein of fetal development which is modulatable by cyclic AMP.
Dev Biol
122:483-491[Web of Science][Medline].
-
Imada S,
Yamaguchi H,
Nagumo M,
Katayanagi S,
Iwasaki H,
Imada M
(1990)
Identification of fetomodulin, a surface marker protein of fetal development, as thrombomodulin by gene cloning and functional assays.
Dev Biol
140:113-122[Web of Science][Medline].
-
Ishihara H,
Connolly AJ,
Zeng D,
Khan ML,
Zheng YW,
Timmons C,
Tram T,
Coughlin SR
(1997)
Protease-activated receptor 3 is a second thrombin receptor in humans.
Nature
386:502-506[Medline].
-
Jalink K,
Moolenaar WH
(1992)
Thrombin receptor activation causes rapid neural cell rounding and neurite retraction independent of classic second messengers.
J Cell Biol
118:411-419[Abstract/Free Full Text].
-
Kaplanski G,
Fabrigoule M,
Boulay V,
Dinarello CA,
Bongrand P,
Kaplanski S,
Farnarier C
(1997)
Thrombin induces endothelial type II activation in vitro: IL1 and TNF-alpha-independent IL-8 secretion and E-selectin expression.
J Immunol
158:5435-5441[Abstract].
-
Laemmli UK
(1970)
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:680-685[Medline].
-
Logan A,
Berry M
(1993)
Transforming growth factor-beta 1 and basic fibroblast growth factor in the injured CNS.
Trends Pharmacol Sci
14:337-342[Medline].
-
Ma SF,
Garcia JG,
Reuning U,
Little SP,
Bang NU,
Dixon EP
(1997)
Thrombin induces thrombomodulin mRNA expression via the proteolytically activated thrombin receptor in cultured bovine smooth muscle cells.
J Lab Clin Med
129:611-619[Web of Science][Medline].
-
Maruyama I,
Majerus PW
(1985)
The turnover of thrombin-thrombomodulin complex in cultured human umbilical vein endothelial cells and A549 lung cancer cells. Endocytosis and degradation of thrombin.
J Biol Chem
15:15432-15438.
-
Mathewson AJ,
Berry M
(1985)
Observation on the astrocyte response to a cerebral stab wound in adult rats.
Brain Res
327:61-69[Web of Science][Medline].
-
McCarthy K,
Vellis JD
(1980)
Preparation of astroglial and oligodendroglial cell cultures from rat cerebral tissue.
J Cell Biol
85:890-902[Abstract/Free Full Text].
-
Monard D
(1993)
Tinkering with certain blood components can engender distinct functions in the nervous system.
Perspect Dev Neurobiol
1:165-168[Medline].
-
Mucke L,
Oldstone MBA,
Morris JC,
Nerenberg MI
(1991)
Rapid activation of astrocyte specific expression of GFAP-lacZ transgene by focal injury.
New Biol
3:465-474[Web of Science][Medline].
-
Neveu I,
Jehan F,
Jandrot-Perrus M,
Wion D,
Brachet P
(1993)
Enhancement of the synthesis and secretion of nerve growth factor in primary cultures of glial cells by proteases: a possible involvement of thrombin.
J Neurochem
60:858-867[Web of Science][Medline].
-
Niclou SP,
Suidan HS,
Pavlik A,
Vjsada R,
Monard D
(1998)
Changes in the expression of protease-activated receptor 1 and protease nexin-1 mRNA during rat nervous system development and after nerve lesion.
Eur J Neurosci
10:1590-1607[Web of Science][Medline].
-
Nishino A,
Suzuki M,
Ohtani H,
Motohashi O,
Umezawa K,
Nagura H,
Yoshimoto T
(1993)
Thrombin may contribute to the pathophysiology of central nervous system injury.
J Neurotrauma
10:167-179[Web of Science][Medline].
-
O'Brien MF,
Lenke LG,
Lou J,
Bridwell KH,
Joyce ME
(1994)
Astrocyte response and transforming growth factor-beta localization in acute spinal cord injury.
Spine
15:2321-2329.
-
Patthy L
(1988)
Detecting distant homologies of mosaic proteins. Analysis of the sequences of thrombomodulin, thrombospondin complement components C9, C8 alpha and C8 beta, vitronectin and plasma cell membrane glycoprotein PC-1.
J Mol Biol
202:689-696[Web of Science][Medline].
-
Perraud F,
Besnard F,
Sensenbrenner M,
Labourdette G
(1987)
Thrombin is a potent mitogen for rat astroblasts but not for oligodendrocytes and neuroblasts in primary culture.
Int J Dev Neurosci
5:181-188[Web of Science][Medline].
-
Petersen TE
(1988)
The amino-terminal domain of thrombomodulin and pancreatic stone protein are homologous with lectins.
FEBS Lett
231:51-53[Web of Science][Medline].
-
Pindon A,
Hantaï D,
Jandrot-Perrus M,
Festoff BW
(1997)
Novel expression and localization of active thrombomodulin on the surface of mouse brain astrocytes.
Glia
19:259-268[Web of Science][Medline].
-
Pindon A,
Festoff BW,
Hantaï D
(1998)
Thrombin-induced reversal of astrocyte stellation is mediated by activation of protein kinase C
-1.
Eur J Biochem
255:766-774[Web of Science][Medline]. -
Ridet JL,
Malhotra SK,
Privat A,
Gage FH
(1997)
Reactive astrocytes: cellular and molecular cues to biological function.
Trends Neurosci
21:80] 20:570-577 [Erratum (1998) .
-
Stone SR,
Le Bonniec BF
(1998)
Thrombin.
In: Handbook of proteolytic enzymes (Barret AJ,
Rawlings ND,
Woessner JF,
eds), pp 168-174. London: Academic.
-
Suidan HS,
Stone SR,
Hennings BA,
Monard D
(1992)
Thrombin causes neurite retraction in neuronal cells through activation of cell surface receptors.
Neuron
8:363-375[Web of Science][Medline].
-
Suidan HS,
Nobes CD,
Hall A,
Monard D
(1997)
Astrocyte spreading in response to thrombin and lysophosphatidic acid is dependent on the Rho GTPase.
Glia
21:244-252[Web of Science][Medline].
-
Towbin H,
Staehelin T,
Gordon J
(1979)
Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.
Proc Natl Acad Sci USA
76:4350-4354[Abstract/Free Full Text].
-
Vaughan PJ,
Pike CJ,
Cotman CW,
Cunningham DD
(1995)
Thrombin receptor activation protects neurons and astrocytes from cell death induced by environmental insults.
J Neurosci
15:5389-5401[Abstract].
-
Villoutreix BO,
Dalbäck B
(1998)
Molecular model for the C-type lectin domain of human thrombomodulin.
J Mol Modeling
4:310-312.
-
Vu TK,
Hung DT,
Wheaton VI,
Coughlin SR
(1991)
Molecular cloning of a functional thrombin receptor reveals a novel proteolytic mechanism of receptor activation.
Cell
64:1057-1068[Web of Science][Medline].
-
Walz W
(1989)
Role of glial cells in the regulation of the brain ion neuroenvironment.
Prog Neurobiol
33:309-333[Web of Science][Medline].
-
Xu WF,
Andersen H,
Whitmore TE,
Presnell SR,
Yee DP,
Ching A,
Gilbert T,
Davie EW,
Foster DC
(1998)
Cloning and characterization of human protease-activated receptor 4.
Proc Natl Acad Sci USA
95:6642-6646[Abstract/Free Full Text].
-
Zhang Y,
Weiler-Guettler H,
Chen J,
Wilhelm O,
Deng Y,
Qiu F,
Nakagawa K,
Klevesath M,
Wilhelm S,
Bohrer H,
Nakagawa M,
Graeff H,
Martin E,
Stern DM,
Rosenberg RD,
Ziegler R,
Nawroth PP
(1998)
Thrombomodulin modulates growth of tumor cells independent of its anticoagulant activity.
J Clin Invest
1017:1301-1309.
Copyright © 2000 Society for Neuroscience 0270-6474/00/2072543-08$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
M. Steinhoff, J. Buddenkotte, V. Shpacovitch, A. Rattenholl, C. Moormann, N. Vergnolle, T. A. Luger, and M. D. Hollenberg
Proteinase-Activated Receptors: Transducers of Proteinase-Mediated Signaling in Inflammation and Immune Response
Endocr. Rev.,
February 1, 2005;
26(1):
1 - 43.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. S. OSSOVSKAYA and N. W. BUNNETT
Protease-Activated Receptors: Contribution to Physiology and Disease
Physiol Rev,
April 1, 2004;
84(2):
579 - 621.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Zhang, Q. Zhai, Y. Luo, and M. E. Dorf
RANTES-mediated Chemokine Transcription in Astrocytes Involves Activation and Translocation of p90 Ribosomal S6 Protein Kinase (RSK)
J. Biol. Chem.,
May 17, 2002;
277(21):
19042 - 19048.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|