 |
 Previous Article | Next Article 
The Journal of Neuroscience, April 1, 2000, 20(7):2575-2588
In Vivo Structure-Function Analyses of
Caenorhabditis elegans MEC-4, a Candidate Mechanosensory
Ion Channel Subunit
Kyonsoo
Hong,
Itzhak
Mano, and
Monica
Driscoll
Department of Molecular Biology and Biochemistry, Rutgers, The
State University of New Jersey, Piscataway, New Jersey 08854
 |
ABSTRACT |
Mechanosensory signaling mediated by mechanically gated ion
channels constitutes the basis for the senses of touch and hearing and
contributes fundamentally to the development and homeostasis of all
organisms. Despite this profound importance in biology, little is known
of the molecular identities or functional requirements of mechanically
gated ion channels. We report a genetically based structure-function
analysis of the candidate mechanotransducing channel subunit MEC-4, a
core component of a touch-sensing complex in Caenorhabditis
elegans and a member of the DEG/ENaC superfamily. We identify
molecular lesions in 40 EMS-induced mec-4 alleles and further probe residue and domain function using site-directed approaches. Our analysis highlights residues and subdomains critical for MEC-4 activity and suggests possible roles of these in channel assembly and/or function. We describe a class of substitutions that
disrupt normal channel activity in touch transduction but remain
permissive for neurotoxic channel hyperactivation, and we show that
expression of an N-terminal MEC-4 fragment interferes with in
vivo channel function. These data advance working models for
the MEC-4 mechanotransducing channel and identify residues, unique to
MEC-4 or the MEC-4 degenerin subfamily, that might be specifically
required for mechanotransducing function. Because many other
substitutions identified by our study affect residues conserved within
the DEG/ENaC channel superfamily, this work also provides a broad view
of structure-function relations in the superfamily as a whole. Because
the C. elegans genome encodes representatives of a large
number of eukaryotic channel classes, we suggest that similar
genetic-based structure-activity studies might be generally applied to
generate insight into the in vivo function of diverse channel types.
Key words:
MEC-4; touch sensation; mechanosensation; mechanotransduction; neurodegeneration; degenerin; Na+ channel; ENaC; mutagenesis
| |
INTRODUCTION |
The molecular mechanisms by which
mechanical signals direct biological responses remain a largely
uncharted area in the field of signal transduction.
Electrophysiological studies indicate that mechanotransduction can be
mediated by ion channels that open or close in response to force
(French, 1992 ; García-Añoveros and Corey, 1997; Sukharev
et al., 1997; Ghazi et al., 1998). Such channels play essential roles
in a diverse range of activities including cell volume control,
development, morphogenesis, and the neuronal signaling underlying touch
sensation, hearing, proprioception, and balance. Until recently,
eukaryotic mechanosensitive ion channels have eluded cloning efforts,
and thus little is understood of their structures and functions.
The nematode Caenorhabditis elegans has proved a facile
model system for the identification of molecules involved in touch transduction. Extensive genetic mutant screens have yielded hundreds of
mutations that specifically disrupt gentle body touch sensation mediated by six specialized mechanosensory neurons (Chalfie and Thomson, 1979; Chalfie and Sulston, 1981; Chalfie and Au, 1989). These
mutations define at least nine structural genes (designated mec genes for the mechanosensory abnormal phenotype of the
mutants) that encode proteins hypothesized to participate in a
touch-transducing molecular complex (for review, see Chalfie,
1993; Tavernarakis and Driscoll, 1997). The core molecules in the
complex, MEC-4 (Driscoll and Chalfie, 1991; Lai et al., 1996) and the
homologous MEC-10 (Huang and Chalfie, 1994), are postulated to be
subunits of a mechanically gated touch-transducing channel. Gating
tension is thought to be exerted on the channel via attachments to the touch neuron-specific extracellular matrix and a specialized
cytoskeleton. Several mec genes encode molecules that might
associate with extracellular or intracellular MEC-4 domains to deliver
the channel-gating force (for review, see Chalfie, 1993; Tavernarakis
and Driscoll, 1997).
mec-4 and mec-10 are members of the C. elegans degenerin family, composed of ~20 members (Mano and
Driscoll, 1999). Two additional degenerins, unc-8 and
unc-105, have been implicated in mechanical signaling (Liu
et al., 1996; Tavernarakis et al., 1997; García-Añoveros et al., 1998). Degenerins belong to the DEG/ENaC superfamily (named for
the C. elegans degenerins and the vertebrate
epithelial Na+ channel) that includes
subunits of the amiloride-sensitive epithelial Na+ channel (Rossier et al., 1994) [some
data suggest ENaC subunits may be mechanically sensitive (Awayda et
al., 1995; Drummond et al., 1998; but see Awayda and Subramanyam, 1998;
Rossier, 1998)], acid-sensitive ion channels that may contribute to
pain perception (ASICs) (Waldmann and Lazdunski, 1998), snail
FMRF-amide gated channel FaNaC (Lingueglia et al., 1995),
Drosophila ripped pocket and pickpocket (Adams et al.,
1998a; Darboux et al., 1998a,b) (the latter of which has been
implicated in mechanosensation), and C. elegans flr-1
(Take-Uchi et al., 1998). All DEG/ENaCs have two transmembrane domains
and a single large extracellular region (see Fig. 1A
for MEC-4 transmembrane topology). Highly conserved regions include
short amino acid stretches both before and after the first
membrane-spanning domain (MSDI), an extracellular Cys-rich domain (CRD)
corresponding to MEC-4 CRDIII, a short region before predicted
transmembrane domain II (MSDII) [which may be functionally analogous
to the H5 loop of Shaker-type K+ channels,
although no primary sequence homology is apparent (Jan and Jan, 1994;
Schild et al., 1997)], and the amphipathic MSDII. Conserved residues
before and within MSDII contribute to the channel pore (Hong and
Driscoll, 1994; Waldmann et al., 1995; Schild et al., 1997; Adams et
al., 1998a,b; Kellenberger et al., 1999a,b; Snyder et al.,
1999). Included in the MSDII region is a key residue that influences
channel activity; large-side chain amino acid substitutions for a
conserved small residue situated close to MSDII cause channel
hyperactivation (MEC-4 position 713) (Driscoll and Chalfie, 1991; Hong
and Driscoll, 1994; Huang and Chalfie, 1994;
García-Añoveros et al., 1995, 1998; Waldmann et al.,
1996; Adams et al., 1998a,b; Champigny et al., 1998). In C. elegans, this genetically induced channel hyperactivation can
induce necrotic-like cell death (Chalfie and Wolinsky, 1990; Driscoll
and Chalfie, 1991; Hall et al., 1997).
Deciphering structure-activity relationships in mechanically gated
channels is essential for elaborating molecular mechanisms of
mechanotransduction. However, functional analysis of specialized mechanosensitive channels is far from straightforward. Study in heterologous expression systems is complicated by the fact that tension-conferring contacts of accessory proteins and channel subunits
are expected to be required for gating. Another challenge is that
prediction of target residues for site-directed mutagenesis is
difficult because of the paucity of information on the structure and
function of mechanically gated channels. Here we report results of a
genetic approach to structure-function studies based on the large-scale analysis of mec-4 mutations shown to confer
behavioral consequences in vivo. We further probe domains
that exhibited particularly high or low distributions of
channel-disrupting substitutions among EMS-induced mec-4
mutants by testing for effects of site-directed mutations on normal
channel function, aberrant toxicity, and complex assembly. Our data
significantly extend the understanding of structure-activity relations
for the MEC-4 mechanotransducing channel. Because many substitutions we
analyzed affect residues conserved within the DEG/ENaC superfamily, our
findings hold important implications for DEG/ENaC superfamily
regulation and function.
| |
MATERIALS AND METHODS |
Strains and genetic analysis. C. elegans
strains were grown at 20°C and maintained as described by Brenner
(1974). mec-4 alleles used in this work were described by
Chalfie and Sulston (1981) and Chalfie and Au (1989). The dominant
death-inducing mec-4(d) allele encoding the A713V
substitution was u231.
Molecular methods. For direct PCR product sequencing,
mec-4 alleles of genomic DNA of 1  -ray-induced and 49 EMS-induced mec-4(r) mutants were isolated as described in
Emmons et al. (1979). Four sets of primers (sense and antisense) were
used to amplify genomic DNAs from nucleotide 420 to 4877 that cover all
the coding regions of MEC-4. The following sequencing primers were
used: for exon 1, antisense
5'GGGAACAAAATACAATTGCATAC3';
for exon 2, sense 5'AAGTCGCAGC
TGAGTAATCTAAC ATTT3'; for exon 3, sense
5'AATCATGTGCTCCTTACTGAGCTT3
and sense 5'CGAAGTTGTCACC
GAACCACCCACCA3'; for exon 4, sense
5'TAATATTAATGGTGAGTGTTGCAT3';
for exon 5, sense
5'CAGAAGTTCATATGAGACGTTT3';
for exon 6, sense
5'CTAGCTTCACTTGTTTGATTTTAC3';
for exon 7, sense
5'ATTTCAGGTAACAA-TCACAAATA3';
for exon 8, sense 5'CGTGTGATATCGAAGCGTTA
G3'; for exon 9, sense
5'TGAAGTCCGTTATGTATAAACC3';
for exon 10, sense 5'CATTTGGATTACGA
TTCGTATTA3'; for exon 11, sense
5'GTTAAAATAGCAATTAAATATAGAACTTA3';
for exon 12, sense
5'ATTGCGATGCAGCAGACCCTATTG3';
for exon 13, antisense
5'GTTCTCTCAAATAGGCCCA3';
for exon 14, antisense
5'CGCTAGTAGTAATTCGGCATTT3';
and for exon 15, antisense 5'TTATTTTAAGA
CACAACATTGCAAT3'. Oligonucleotides were
purchased from Keystone Laboratories and Genosys Biotechnologies.
DNA-sequencing reactions were performed according to the
manufacturers' specifications (United States Biochemicals, Cleveland,
OH, or Life Technologies, Gaithersburg, MD) (Hong and Driscoll, 1994).
All mutations were confirmed on both strands.
Site-directed mutagenesis (Kunkel, 1985) was performed on plasmid
pTU#12 [a rescuing 6.1 kb genomic mec-4(+) clone that
contains ~1.9 kb upstream of the predicted mec-4
initiation codon including the final coding exons of the gene 5' to
mec-4, all introns, and ~0.5 kb of 3'-flanking sequence]
or pTU#14, the equivalent mec-4 clone with the A713V
substitution (Driscoll and Chalfie, 1991; Lai et al., 1996), using the
Muta-Gene phagemid in vitro mutagenesis kit protocol
(Bio-Rad, Hercules, CA). All mutations were confirmed by sequence
analysis. mec-4 expression from these plasmids appears specific to the touch sensory neurons because (1)
lacZ and green fluorescent protein reporter fusions
to the intact mec-4 gene in pTU#12 consistently label only
the six touch sensory neurons (Mitani et al., 1993) (M. Driscoll,
unpublished observations), (2) anti-MEC-4 antibody staining of
transgenic lines harboring pTU#12 visualizes only the six touch sensory
neurons, and (3) pTU#14 induces the exclusive degeneration of the touch
receptor neurons.
Generation and scoring of transgenic animals. Germ line
transformation was performed as described (Driscoll, 1995; Mello and Fire, 1995). Plasmid DNAs (50 µg/ml) were coinjected with
cotransformation marker DNA (50 µg/ml) for all the samples tested.
mec-4 alleles encoding single amino acid substitutions or
deletions were introduced into wild-type N2 or recessive
mec-4(u253) animals. mec-4(u253) has a partial
deletion of mec-4-coding sequences (see Table 1) and is a
likely functional null allele. Plasmid pRF4, which carries the dominant
marker rol-6(su1006) (Kramer et al., 1990), was coinjected with mec-4 alleles to facilitate the identification of
roller transformants. rol-6 is expressed in the hypodermal
lineage, which does not segregate early from the neuronal lineages that
produce the touch cells, but a small number of transgenic Rol animals are expected to lack the transgene array in the touch neurons. To
ensure that transforming DNA (which exists as an extrachromosomal array
that can be lost during cell division) would be present in as many
cells as possible, we scored only rollers from lines in which
transforming DNA was passed on to a minimum of 30%, but on average
>50%, of the progeny for touch sensitivity as described (Chalfie and
Sulston, 1981). For each mec-4 allele tested, at least 100 rollers from three independent transgenic lines were assayed for touch
sensitivity; the percent scores listed are the average values for these
three lines. For cell death assays, transgenic lines were examined
during the first larval stage (L1) and the fourth larval stage (L4) for
swollen degenerating PLM neurons in the tail. Observations were
performed at 400× magnification using Nomarski differential
interference contrast optics. Animals that had at least one swollen PLM
cell were scored as positive. Death in the L1 stage was scored by
examining a population of ~200 L1 animals from each of the three
transgenic lines derived for each construct. In the L1 stage, Rol
animals harboring introduced DNA cannot be distinguished from those
that have lost transforming DNA, so only a fraction of the L1
population is expected to exhibit degenerations. Degeneration in the L4
stage was scored by examining 50 Rol animals from each of the three
lines. Scores listed are the average percent degeneration from three
independent lines. N2 animals do not exhibit degenerations in L1 or L4
animals (n > 200); in mec-4(u231), which
has two genomic copies of the allele encoding the A713V substitution,
99% of the animals exhibit degenerations in the L1 stage, but no
animals exhibit degenerations in the L4 stage because the dead cells
are eliminated (n > 200).
Whole-mount histochemistry. Transgenic animals were stained
using the biotin-avidin system (Molecular Probes, Eugene, OR) with
antibody AbM4(1-69), which recognizes the MEC-4 N terminal (N-terminal
mutations and CRD region deletions), or AbM4(746-760), which
recognizes the C terminal (all single amino acid substitutions), as
described (Driscoll, 1995; Lai et al., 1996). Secondary biotinylated FITC-conjugated anti-rabbit antibodies were added at a 1:200
dilution and incubated 4 hr at room temperature. After washing 2 hr at room temperature, fluorescein-avidin D antibodies (1:500 dilution) were added, and animals were mounted in fluorescein-avidin D buffer for observation. Note that low endogenous levels of MEC-4(+) protein are not detectable (Lai et al., 1996). A positive score for staining indicates readily detectable immunoreactivity of touch neurons over
background (see Fig. 2); minus indicates no apparent staining over background.
| |
RESULTS |
EMS-induced mutations highlight four regions that are critical for
mec-4 function in vivo
Fifty-three independently isolated recessive mec-4
alleles (r), most of which act genetically as
loss-of-function alleles, have been isolated in screens for
touch-insensitive C. elegans mutants (Chalfie and Sulston,
1981; Chalfie and Au, 1989). To identify amino acids essential for
MEC-4 function in vivo, we sequenced coding regions of 50 of
these mec-4 alleles, 49 generated by EMS mutagenesis and 1 generated by -ray mutagenesis.
We identified single nucleotide changes within the coding sequence of
32 mec-4(r) alleles (Table 1).
Of these, 22 are missense mutations that specify single amino acid
substitutions, 7 are nonsense mutations, and 3 disrupt splice junction
consensus sites. Three mec-4(r) alleles (u45,
u51, and u56) encode two independent nucleotide
substitutions that affect amino acids encoded by different exons. Two
EMS-induced alleles harbor identical 4 bp insertions 11 nucleotides in
front of the predicted mec-4 initiation codon, which
introduce a potential initiation codon out of frame with the
mec-4-coding sequences (u229 and
u308), and four alleles harbor rearrangements that affect
coding regions (e1497, u85, u253, and u423). We
did not detect nucleotide changes within the mec-4-coding sequence in nine alleles. These alleles are likely to harbor mutations outside of the sequenced coding region, e.g., upstream of position  30, within large introns or within the 3'-untranslated region.
The distribution of EMS-induced mutations relative to the
mec-4-coding sequence is depicted in Figure
1B. Nonsense mutations are generally dispersed along the length of the coding sequence. By
contrast, there are four regions where single amino acid substitutions that disrupt MEC-4 function (specified by missense mutations) are
clustered: (1) a short stretch of conserved intracellular amino acids
that precede the first membrane-spanning domain (designated In91-95
for intracellular residues 91-95), (2) a small region that precedes
the third Cys-rich domain in the extracellular domain (Ex533-542), (3)
a nearby short stretch within the third Cys-rich domain
(ExCRDIII595-601), and (4) a region including the second membrane-spanning domain (MSDII713-739). EMS, which causes C to T and G to A transitions (Coulondre and Miller, 1977), has the potential to alter 548 of the 768 MEC-4 amino acids (see the more detailed description of susceptible codons at
http://touchworms.rutgers.edu/posted). Because mutations are
selected in our screen only when they exert a functional consequence on
behavior, the clustering of channel-disrupting substitutions suggests
that these regions are particularly critical for MEC-4 function.
View larger version (15K):
[in this window]
[in a new window]
|
Figure 1.
Channel-inactivating substitutions cluster to four
regions within MEC-4. A, Transmembrane topology and
relative positioning of MEC-4 domains. N and C terminals are
intracellular; CRDs are extracellular. Domains are not drawn to scale.
B, Distribution of identified mec-4(r)
mutations relative to the mec-4-coding sequence. Exons
1-15 are represented by boxes filled to indicate domain
identity and transmembrane position. Amino acids (top
left and right of the row
of exon boxes) and nucleotides (bottom
left and right of the row
of exon boxes; red) are numbered as in
Lai et al. (1996). Symbols indicate the following: *,
position of individual missense mutation; ×, nonsense; ^, splice
site; I, insertion; and  , deletion mutation. Four
"hot spots" where substitutions of MEC-4-inactivating substitutions
cluster are indicated: In91-95, intracellular amino acids 91-95;
Ex533-542, extracellular amino acids 533-542; ExCRDIII595-601,
extracellular residues 595-601 within the Cys-rich domain III;
and MSDII713-739, membrane-spanning domain II residues 713-739.
ERD, extracellular regulatory domain;
NTD, neurotoxin-related domain.
|
|
Interestingly, many affected amino acids are highly conserved among
members of the DEG/ENaC superfamily, consistent with important roles in
the function of this channel class. We therefore performed further
tests to deduce more about the activity of the highlighted residues and domains.
Extended study of domains in which channel-inactivating
substitutions cluster or are absent: strategies for in vivo
analysis of site-directed mutations
Routine electrophysiological analysis from small C. elegans neurons is not yet technically feasible. Moreover,
isolation of mechanically gated channels from their normal
physiological contexts that occurs in heterologous expression systems
is unlikely to reconstitute channels with normal gating [see
Tavernarakis and Driscoll (1997), their discussion]. An alternative
approach toward elaborating MEC-4 structure-function relationships in
C. elegans that confers the benefit of examining mutational
effects in a whole-animal model is to generate transgenic nematodes
harboring site-directed mutations and to assay cellular and behavioral
consequences in vivo. Such an in vivo approach
enabled us previously to collect data suggesting that residues within
MEC-4 MSDII contribute to a channel pore-lining domain (Hong and
Driscoll, 1994), a hypothesis later supported by electrophysiological
analysis of related mutant channels (Waldmann et al., 1995, 1996; Adams
et al., 1998a; Champigny et al., 1998; García-Añoveros et
al., 1998).
We have experimental tools to address four basic questions concerning
engineered MEC-4 variants. (1) Is the mutant protein produced, (2) does
the mutant protein function, (3) does a given substitution affect MEC-4
A713V neurotoxicity, and (4) can the mutant protein participate in
channel complex assembly? We test protein production by antibody
staining, which indicates whether the protein is made, although this
does not offer the resolution to establish that the protein reaches its
appropriate subcellular localization. We test mutant protein function
by the transgene rescue of a mec-4 mutation.
mec-4 alleles encoding an engineered substitution are
introduced into a mec-4 deletion mutant background, and
alleles that fail to restore touch sensitivity in transgenic animals
are scored as nonfunctional. To ask whether specific amino acid
residues are essential in cis for the activity of the
constitutively open A713V channel, we construct mec-4
alleles that encode both the toxic A713V substitution and a
substitution for the residue in question. The doubly mutant
mec-4 allele is assayed for the ability to induce touch cell
degeneration in vivo. A substitution that disrupts normal
channel function but does not affect the toxic phenotype suggests that
the amino acid identified may be needed for normal channel opening and
closing but is dispensable after the channel is hyperactivated; we
consider such residues candidate protein contacts by which mechanical
gating force might be administered. Finally, we address the ability of
a mutant protein to assemble with some components of the channel
complex on the basis of previous observations regarding the wild-type
subunit expression in transgenic animals. Introduction of wild-type
mec-4 transgenes into a wild-type background [i.e.,
mec-4(+)] can partially disrupt touch sensitivity, a
phenomenon likely to result because excess introduced subunits (which
are produced at a few-fold higher level than the endogenous protein
because of transgene dosage) sequester other components required for
synthesis, assembly, or function of the mature channel (Hong and
Driscoll, 1994). This interference phenomenon does not result from
competition for transcriptional regulatory factors between endogenous
and plasmid mec-4 genes because plasmids that contain
promoter sequences but do not produce any protein (because they encode
a termination codon immediately after the mec-4 initiation
codon) do not interfere with wild-type gene function (Hong and
Driscoll, 1994) (Fig.
2B, middle
plot). To extend our understanding of mutant engineered
mec-4 alleles that are nonfunctional in complementation
assays, we introduce them into a mec-4(+) background. If the
nonfunctional channel protein partially disrupts touch sensitivity when
introduced into a wild-type background, we infer that channel activity
is disrupted in one or both of two ways: (1) mutant subunits may form
mature but defective channel complexes, or (2) as is true for wild-type subunits, mutant subunits may associate with and sequester other essential proteins of the channel complex, disrupting the overall assembly of functional channels. In either case, we can infer that the
mutant MEC-4 protein is produced and participates in some aspect of the
multistep process of channel complex assembly.
View larger version (42K):
[in this window]
[in a new window]
|
Figure 2.
The MEC-4 N terminal: channel-inactivating
substitutions cluster to a conserved region implicated in human ENaC
disease. A, N-terminal substitutions that inactivate
MEC-4 affect conserved residues. MEC-4-inactivating amino acid
substitutions in the N terminal cluster to a region conserved in all
DEG/ENaC superfamily members. Gray boxes
highlight corresponding residues in the family members listed;
numbering indicates the MEC-4 amino acid position. MEC-4
G95 corresponds to human  ENaC G37, which when substituted causes
human pseudohypoaldosteronism type I, a loss-of function disorder
(Chang et al., 1996). B, In vivo
assays of mutant mec-4 transgenes are shown. Top
Plot, Transgenes were introduced into the
mec-4() mutant (deletion allele u253)
to indicate rescue as shown by the percent of touch-sensitive animals.
Middle Plot, Transgenes were introduced into a wild-type
mec-4(+) background to test for the degree of
interference (scored as the percent of touch-insensitive animals).
Bottom Plot, Effects of double substitutions of the
amino acid (AA) change indicated situated in cis to the
A713V channel-activating substitution as assayed in the
mec-4() background are shown. The score is the percent
of animals that harbor at least one degenerating tail touch neuron as
assayed at the L1 stage; results were identical in examination at the
L4 larval stage. Genotypes of transformation host strains are
indicated in the top right
corner of each plot.
Control constructs and specific amino acid substitutions tested are
indicated below the bottom
plot. rol-6(su1006) is a
cotransformation marker that causes animals to roll; this marker was
included in all transgenic lines to facilitate identification of
transformed animals. p:: XX harbors the
mec-4 promoter and the coding region with two stop
codons inserted after the mec-4 initiation codon. For
all panels, scores for transgenic lines were the average
of at least 100 animals scored for three independently derived lines.
Error bars indicate SD. Bottom Images,
The immunoreactivity in transgenic animals that harbor the introduced
gene in the mec-4() background is shown. Antibody
staining of PLM tail cells is shown for mec-4()
mutants that harbor transgenes encoding the indicated MEC-4
substitutions. The antibody used was polyclonal AbM4(746-760), which
recognizes the C terminal. Touch cell positions appear different
because they are photographed from different angles; scales also differ
slightly. C, Effects of overexpression of wild-type and
mutant MEC-4 N-terminal fragments (AA1-109) are shown.
Top, The ability of N-terminal fragments to inhibit
endogenous MEC-4 channel function was scored as the percent of
touch-insensitive animals; transgenic lines were constructed in the
mec-4(+) background. Bottom, The ability
of N-terminal fragments to disrupt the toxicity of endogenous MEC-4
A713V channels was scored as the percent of animals lacking
degeneration; transgenic lines were constructed in the dominant
mec-4(u231) background in which PLM touch cells
degenerate in >90% of animals.
|
|
Probing structure and activity of the intracellular N-terminal
MEC-4 domain
Transgenic mutant strains exhibit behavioral defects identical to
those in EMS-induced genomic mutants
The In91-95 genetic "hot spot" for N-terminal MEC-4
channel-inactivating substitutions falls within a short region near
MSDI that is highly conserved among DEG/ENaC superfamily members
(corresponding to MEC-4 amino acids 87-95; Fig. 2A).
To investigate further the functional importance of residues within
In91-95, we constructed mec-4 point mutations and deletions
and assayed mutant alleles for function in vivo.
We first tested the validity of in vivo transgenic channel
assays by reconstructing mutant mec-4 alleles encoding the
T91I, S92F, and G95E substitutions known to disrupt MEC-4 function when encoded by genomic mutations (refer to Table 1). The analogous engineered substitution constructs were tested for function in transgenic animals by assaying for complementation of the
mec-4(u253) deletion allele, hereafter referred
to as mec-4(). Mutant T91I, S92F, and G95E
mec-4 constructs fail to rescue the touch insensitivity defect in the mec-4() background (Fig.
2B, top plot). We confirmed that mutant proteins are expressed in vivo by demonstrating
that constructs encoding mec-4(T91I),
mec-4(S92F), and mec-4(G95E) produce proteins
detectable by antibody staining that interfere with mechanosensation
when introduced into a wild-type background (Fig. 2B,
middle plot). The observed transgene interference
also indicates that at least some aspects of channel assembly can occur when the In91-95 region is disrupted. Note that not all substitutions in the conserved region disrupt MEC-4 function; for example, the Y89R
mutant behaves as does the wild type in all assays.
Substitutions T91I, S92F, and G95E block channel hyperactivation
caused by the A713V substitution
In the well studied Shaker-type K+
channel, a cytoplasmic inhibitory domain associates with the channel
pore to inhibit ion transport (Hoshi et al., 1990; Zagotta et al.,
1990). Because a common ancestor has been suggested for DEG/ENaCs and
Shaker-type K+ channels, we considered the
possibility that the highly conserved domain in DEG/ENaCs, which
includes the In91-95 region, has a similar role in channel regulation.
We reasoned that if the In91-95 region were required for negative
regulation of channel activity, substitutions that disrupt this region
of MEC-4 might confer the channel-hyperactivated phenotype of
degeneration. However, examination of the T91I, S92F, and G95E mutants
throughout their life span and into senescence failed to reveal any
signs of neurodegeneration (data not shown). In a second test for
channel-activating effects of these substitutions, we asked how
alterations within the In91-95 domain affect channel activity when
situated in cis to the channel-hyperactivating substitution
A713V. We reasoned that if the In91-95 region were solely required for
negative regulation of the channel as in the ball-and-chain model of
the K+ channel, disruption of this
inhibitory domain should increase channel activity (or leave it
unaffected) and thus would not block the toxicity of the hyperactivated
A713V substitution. We generated double-mutant alleles that harbor the
disrupting substitutions T91I, S92F, or G95E or the deletion 89-92
in cis to the toxic A713V substitution, introduced the
double-mutant alleles into the mec-4() background, and
tested transgenic lines for cell death (Fig. 2B,
bottom plot). We find that the N-terminal
substitutions T91I, S92F, and G95E and 89-92 fully block channel
toxicity when situated in cis to the A713V substitution.
Taken together, our data argue against an exclusive negative regulatory
role for the conserved In91-95 domain.
Overexpression of the N-terminal domain interferes with endogenous
channel function via a mechanism that requires residues S91, T92, and
G95
To learn more about the function of the conserved In91-95 region,
we sought to distinguish between (1) a potential role in protein
interactions required for channel assembly or function and (2) an
exclusive role for the In91-95 domain in channel activation. We
reasoned that if the conserved In91-95 region mediates a critical association with other channel subunits or other components of the
mechanotransducing complex, overexpression of this domain might disrupt
endogenous channel activity by competing with wild-type subunits for
functional contacts. Alternatively, if the In91-95 domain is needed
for opening but does not require any specific protein interaction to do
so, overexpression of this domain is not expected to interfere with
endogenous channel function. We overexpressed wild type and mutant
variants of the MEC-4 N-terminal 1-109 amino acid fragment to begin to
distinguish between these two possibilities. Unlike overexpression of
the complete MEC-4 subunit, these experiments focus on the ability of
the N terminal to form a functional domain that can interact with the
expression machinery or components of the functional complex.
We first created transgenic lines expressing MEC-4(1-109) and assayed
for interference with endogenous MEC-4 channel activity. We find that
expression of the wild-type N-terminal fragment causes strong
interference with normal MEC-4 channel function in the wild-type
background; transgenic lines expressing this fragment exhibit defective
touch sensitivity (Fig. 2C, top). Moreover, expression of the MEC-4(1-109) N-terminal fragment in the
mec-4(d) background (encoding the hyperactivating A713V
substitution) causes a significant reduction in the number of
degenerating touch neurons (Fig. 2C, bottom).
Taken together, our data indicate that expression of the N-terminal
domain interferes in trans with the assembly or function of
the MEC-4 channel.
We then tested whether the amino acid residues identified as essential
for in vivo MEC-4 function are important for N-terminal 1-109 fragment-mediated channel interference by expressing N-terminal fragments containing either the T91I, the S92F, or the G95E
substitutions (Fig. 2C). We find that both interference with
normal channel function and interference with
mec-4(d)-induced degeneration are eliminated by the T91I and
the S92F substitutions. The G95E substitution also significantly
disrupts interference in trans, although to a slightly
lesser degree. We conclude that residues T91, S92, and G95 are
essential both for normal channel function and for the inhibitory
interaction mediated by the transgenically expressed N-terminal 1-109 domain.
Additional N-terminal residues, not highlighted by EMS-induced
substitutions, are required for MEC-4 function
The identified clustering of MEC-4-inactivating amino acid
substitutions to In91-95 suggested that the rest of the N terminal, which is not conserved among DEG/ENaC family members, might be dispensable for MEC-4 function. To determine whether this might be the
case, we assayed a deletion mutation that affected most of the
nonconserved portion of the N-terminal region (22-86; Fig.
2B). Although in vivo interference assays
and immunocytochemistry indicate that mutant MEC-4 protein is produced
and is able to initiate channel assembly, mec-4(22-86)
fails to complement the mec-4() mutation. Thus, sequences
outside the highly conserved N-terminal domain are required for MEC-4
function. Nonconserved regions of ENaCs have also been shown to be
important for channel function (Chalfant et al., 1999).
Extending models for the function of the conserved In91-95 region
in DEG/ENaC channels
Our data hold implications for models of MEC-4 function that are
of particular interest in the context of recent work on mammalian DEG/ENaC family members. Corresponding residues in ENaC subunits modulate channel-gating kinetics (Gründer et al., 1997, 1999). Residues in the conserved region of the ASIC2 (also named BNC1 and MDEG) N-terminal domain have been shown to influence ion
selectivity, indicating that the conserved domain may loop back into
the membrane to contribute to the channel pore (Coscoy et al., 1999).
The finding that MEC-4 substitutions T91I, S92F, and G95E disrupt both
normal channel function and channel hyperactivation is consistent with contributions of residues within the In91-95 region to pore function and/or formation; we showed previously that residues in the MSDII pore
are essential for toxicity of the hyperactivating A713V substitution (Hong and Driscoll, 1994). However, inhibitory effects of the expressed
N-terminal domain suggest that if this is the case, either (1) the
domain can insinuate itself into the pore without being physically
tethered to the rest of the channel, or (2) the conserved In91-95
subdomain serves additional functions.
The fact that overexpression of the MEC-4 N-terminal 109 amino acids
interferes with channel activity is also consistent with a model in
which the fragment associates with endogenous intact channel subunits
or with other proteins in the channel complex; introduction of a domain
that competes for required interacting proteins should disrupt overall
channel activity, possibly by sequestering essential proteins or by
initiating the assembly of aberrant complexes that are targeted for
degradation. In this regard, it is interesting that the N-terminal
fragment of ENaC interacts with  ENaC and interferes with ENaC
activity in the oocyte expression system by reducing ENaC protein
levels (Adams et al., 1997). Our studies expand observations on
N-terminal inhibition by DEG/ENaC family members by demonstrating that
inhibition can occur in vivo and by defining three conserved
amino acid residues critical for N-terminal fragment-mediated
interference. MEC-4 residues T91, S92, and G95 may normally promote
intersubunit association during channel assembly. Alternatively, these
residues might be critical for fragment stability or the folding of an
interaction domain elsewhere on the N-terminal fragment.
Although EMS-induced mutations do not cluster to membrane-spanning
domain I (MSDI), the domain is critical for channel function and
assembly
The first transmembrane domain of DEG/ENaC superfamily members
includes a few highly conserved amino acids (Fig.
3A). Substitution of MEC-4
MSDI for ASIC2 MSDI has a modest effect on channel conductance [by
contrast, a similar swap of MSDII causes dramatic changes in channel
properties (Waldmann et al., 1995)], but little is understood of MSDI
contributions to channel function. Interestingly, among 50 sequenced
mec-4 alleles, we did not identify any single mutation that
disrupted channel activity and mapped to MSDI, despite the fact that 17 of the 21 codons in this domain have the potential to change amino acid
specification consequent to EMS mutagenesis (see
http://touchworms.rutgers.edu/posted). Allele u45 encodes MSDI substitution G117E as well as a second substitution, E397K (see
Table 1), but the weak ts phenotype of this allele is not conferred by
the G117E substitution alone because an engineered mec-4
allele, encoding only the G117E change, behaves similar to the wild
type in all assays (Fig. 3B). Although we cannot exclude that the lack of mec-4 mutations affecting MSDI is caused by
chance, the paucity of MSDI mutations suggests that individual residues in this domain may not be critically important to MEC-4 activity. MSDI
may serve as a hydrophobic structural domain that directs required
transmembrane topology and might stabilize the channel complex by
surrounding the pore-lining MSDII in the membrane.
View larger version (34K):
[in this window]
[in a new window]
|
Figure 3.
MEC-4 MSDI: single amino acid substitutions that
disrupt channel function are conspicuously absent, although the domain
is required for channel assembly. A, Sequence alignment
of predicted MSDI regions from representative DEG/ENaC family members
is shown. Note that apart from an invariant Trp residue highlighted by
a gray box, the domain is not highly
conserved in primary sequences. The position of the G117E substitution
is indicated. Numbers indicate positions of MEC-4 amino
acids. B, In vivo assays of mutant
mec-4 transgenes are shown. Left,
Transgenes were introduced into the mec-4() mutant
(deletion allele u253) to indicate rescue as scored by
the percent of touch-sensitive animals. Middle,
Transgenes were introduced into a wild-type mec-4(+)
background to test for the degree of interference (scored as the
percent of touch-insensitive animals). Right, The
effects of double substitutions of the AA change indicated situated
in cis to the A713V channel-activating substitution as
assayed in the mec-4() background are shown. The score
is the percent of animals that harbor at least one degenerating tail
touch neuron. Control constructs and specific amino acid substitutions
tested are indicated below each
panel. ND, Not determined.
|
|
Analysis of a mutant allele in which MSDI is deleted,
mec-4(109-130), suggests that MSDI functions in
directing appropriate transmembrane topology are essential for channel
assembly. Transgenic animals bearing the mec-4(109-130)
allele are touch insensitive, and animals harboring the double
substitution 109-130,A713V do not exhibit neurodegeneration (Fig.
3B, left, right). However, it is
remarkable that MEC-4(109-130) is the only defective channel subunit tested in our large survey that completely fails to interfere with endogenous channel function when introduced into the wild-type mec-4(+) background (Fig. 3B, middle).
Because antibody staining confirms that the MEC-4(109-130) protein
is produced, the inability of the mutant protein to interfere with
endogenous channel activity suggests that MEC-4(109-130), which
could adopt an inverted transmembrane topology, never encounters other
channel subunits and is defective in an early process essential for
channel assembly. Note that the N-terminal domain, which itself can
interfere with assembly, is intact in the MEC-4(109-130) protein,
suggesting that the N terminal participates in an aspect of assembly
that is not encountered by the MSDI mutant.
Channel-inactivating substitutions in the MEC-4 extracellular
domain cluster around CRDIII; some substitutions uncouple channel
function and neurotoxicity
The MEC-4 extracellular region includes a domain close to MSDI
that is strikingly conserved among all superfamily members (FPAITLCNLNPYK, MEC-4 AA151-163), three Cys-rich domains (with CRDI unique to degenerins), and a small degenerin-specific domain that
influences channel gating [extracellular regulatory domain (ERD)
(García-Añoveros et al., 1995)]. Interestingly, CRDIII includes a region of low but significant sequence similarity to scorpion venom neurotoxins (NTD AA572-646) that is conserved in DEG/ENaC family members (Tavernarakis and Driscoll, 2000). Venom neurotoxins are known to associate with voltage-gated
Na+ channel domains at high affinity
(Catterall, 1980; Rogers et al., 1996; Cestèle et al., 1998), and
thus related structures are candidate interaction domains.
EMS-induced single amino acid substitutions in the extracellular domain
that disrupt MEC-4 function affect several residues, many of which
cluster before and within CRDIII (AA533-542 and AA595-601,
respectively) and thus distinguish this region as critical for channel
function (Fig. 4A,B).
Within this region, channel-inactivating substitutions alter residues
that are highly conserved either among the DEG/ENaC superfamily or
among the degenerin subfamily. By constructing transgenic lines, we
confirmed that the mutant alleles identified (encoding G533S, G539E,
S542F, C595Y, G598E, D599N, and R601C) produce protein but fail to
complement the mec-4() mutant (Fig. 4C,
top, middle). Although all these substitutions fully abolish touch sensitivity on their own, they have three distinct
effects on channel toxicity when situated in cis to A713V (Fig. 4C, bottom). Substitutions G533S and R601C
block channel activity, even in the context of the hyperactivating
A713V substitution, suggesting these residues are critical to a channel
that can assemble and open. In contrast, other substitutions in this
region uncouple channel function in touch transduction from the ability
to induce neurodegeneration when the channel is hyperactivated by
A713V. The D599N,A713V double mutant has a moderate effect such that the average size of a degenerating touch receptor cell body is approximately one-half the size of that in the MEC-4 A713V transgenic animals. Substitutions G539E, S542F, C595Y, and G598E allow
degeneration when situated in cis to A713V, but the size of
detectable degenerating cell bodies is markedly reduced compared with
those in animals harboring the A713V substitution alone. Because we
noted previously an approximate correlation of the level of toxic
channel expression with the degree of swelling (Hall et al., 1997), the
smaller cells might reflect an overall decrease in the ion influx into
touch neurons (compared with the A713V mutant). If so, conductance in the D599N,A713V channel may be more than that of G539E,A713V; S542F,A713V; C595Y,A713V; and G598E,A713V channels, which may be more
than that of G533S,A713V and R601C,A713V channels.
View larger version (35K):
[in this window]
[in a new window]
|
Figure 4.
The MEC-4 extracellular region: substitutions
identify residues that may be critical for mechanotransduction; some
substitutions disrupt mechanosensation without preventing
neurotoxicity. A, Schematic drawing of MEC-4
extracellular domains and relative positions of amino acid
substitutions disrupting channel activity is shown.
Black boxes indicate membrane-spanning
domains, gray boxes indicate Cys-rich
domains, the hatched box is an extracellular regulatory
domain, and the NRD-labeled box is an neurotoxin-related
domain. Domains are not drawn exactly to scale. Vertical
lines indicate sites of nonconserved amino acid changes
that disrupt MEC-4 function outside the CRDIII region; the
horizontal line indicates the region
where changes are clustered. B, Sequence alignment of
amino acids near and within CRDIII from representative DEG/ENaC family
members is shown. Unfilled boxes
highlight residues highly conserved throughout the superfamily;
gray boxes highlight degenerin family
members that are especially well conserved in these regions.
Numbers indicate positions of MEC-4 amino acids.
C, In vivo assays of mutant
mec-4 transgenes are shown. Top,
Transgenes were introduced into the mec-4() mutant
(deletion allele u253) to indicate rescue as scored by
the percent of touch-sensitive animals. Middle,
Transgenes were introduced into a wild-type mec-4(+)
background to test for the degree of interference (scored as the
percent of touch-insensitive animals). Bottom, The
effects of double substitutions of the AA change indicated situated
in cis to the A713V channel-activating substitution as
assayed in the mec-4() background are shown. The score
is the percent of animals that harbor at least one degenerating tail
touch neuron. Control constructs and specific amino acid substitutions
tested are indi- cated below the bottom
panel. Also indicated below this
panel are scores for the size of degenerating neurons:
L, large, neurons similar to those occurring in the
mec-4(u231) A713V substitution background;
M, medium, degenerating neurons that swell to
approximately one-half the size noted for mec-4(u231)
and vacuolar degenerations that are visible at 100× magnification;
S, small vacuoles only apparent at 400× magnification;
and , no detectable degeneration.
|
|
CRDIII substitutions G539E, S542F, C595Y, G598E, and D599N fully
disrupt touch sensitivity yet confer intermediate effects on
A713V-mediated toxicity. Two explanations, not necessarily mutually
exclusive, could be suggested. One possibility is that the channel
activity required for touch sensation must be precisely controlled for
neuronal signaling, but the ion transport activity required for
neurotoxicity is less constrained; accumulated influx over time can
kill the neuron, and the rate of influx may vary within limits. Another
possibility is that the G539E, S542F, C595Y, G598E, and D599N
substitutions alter residues that are partially dispensable when the
channel is chronically open. Thus, this region may be involved in
appropriate gating, a process that is less important in the
constitutively open channel than in the wild-type channel.
It is striking that four independently isolated mec-4
alleles alter MEC-4 C595, a residue conserved in DEG/ENaC channels and venom neurotoxins. Also of interest is that the corresponding Cys in
rENaC is not critical for ENaC channel function under the
conditions of assay (Firsov et al., 1999). In the ENaC channel, this
Cys might be needed only in and ENaC subunits, or a small-side chain amino acid at this position may suffice for ENaC function. An
alternative possibility is that MEC-4 C595 might have been co-opted to
serve a role in mechanical gating that is not relevant to the ENaC
channels. In this regard, it is noteworthy that nearby MEC-4 residues
highlighted by EMS-induced channel-inactivating mutations (G598, D599,
and R601) are highly conserved only in the degenerin subfamily. This
hot spot falls within the venom neurotoxin-related domain,
which, by analogy, is predicted to mediate high-affinity interactions
with specific targets. Also interesting is that channel modulation by
endogenous venom toxin-related proteins has been demonstrated recently
in mammals (Miwa et al., 1999). The subdomain highlighted by CRDIII
mutations might interact with the specialized extracellular matrix
proteins needed for appropriate gating [for example, matrix protein
MEC-9, which itself includes many venom toxin-related Kunitz domains
(Du et al., 1996)].
Additional residues implicated in mechanotransduction are
positioned throughout the extracellular domain
Additional substitutions in the extracellular domain highlight
certain amino acids as candidate participants in a critical function of
mechanically gated channels or the degenerin subfamily (Fig.
4A). For example, A321T affects a residue common only
to MEC-4 and MEC-10 and could identify a residue essential to the action of the touch-transducing channel. Somewhat unexpectedly, the
single amino acid substitutions affecting nonconserved or degenerin-specific residues (G230, A321, A420, E445, P395, and E397;
the latter two are each present in combination with a second substitution and thus may not inactivate the channel on their own) do
not cluster to the degenerin-specific CRDI or ERD or to any other
domain, suggesting that sites distant in the primary sequence might
play most important roles in MEC-4/degenerin channel function. This
observation underscores the value of genetic approaches for
identification of residues critical for in vivo function
that are not apparent from sequence alignment.
MSDII and surrounding regions: constraints in and near the
channel pore
Genetic and electrophysiological evidence indicates that certain
residues within MSDII participate in the conduction pore of DEG/ENaC
channels (Hong and Driscoll, 1994; Waldmann et al., 1995; Schild et
al., 1997; Adams et al., 1998a,b; Kellenberger et al., 1999a,b; Snyder
et al., 1999). The conserved region preceding MSDII is thought to loop
back into the membrane to contribute also to the pore, similar to the
H5 loop of K+ channels (Jan and Jan, 1994;
Renard et al., 1994) (see Figs. 1A, 5A),
although recent experimental data suggest that the ENaC pore structure
may differ in several ways from the K+
channel (Snyder et al., 1999).
A substitution in the predicted pore loop can interfere with
hyperactive channel function in trans
In addition to previously reported EMS-induced amino acid
substitutions implicated in the formation of the channel pore [S726, T729, and E739 (Hong and Driscoll, 1994)], we identified one
substitution in the pre-MSDII region, G716D, that affects a site highly
conserved among superfamily members. This site is of particular
interest because substitutions at the corresponding site in degenerins MEC-10 (Huang and Chalfie, 1994) and UNC-8 (Shreffler et al., 1995) can
suppress the effects of toxic hyperactivated channels in
trans-heterozygotes although these substitutions do not exert dominant
effects on wild-type subunits. This property extends to MEC-4; when
MEC-4 G716D and MEC-4 A713V are cosynthesized in mec-4
trans-heterozygotes, touch cell death is diminished (27% cells viable)
compared with that when MEC-4(+) and MEC-4 A713V are cosynthesized
(10% cells viable). One possible explanation for the apparent
restriction to interference with hyperactivated channels is that the
structural constraints introduced by the G716D subunit may be relevant
only to the aberrant open conformation induced by the A713V residue.
Local substitutions that hyperactivate the channel appear
restricted to AA position 713
A well characterized substitution in the MEC-4 pre-MSDII region is
the toxic A713V change (Driscoll and Chalfie, 1991; Lai et al., 1996).
Initial studies in C. elegans indicated that steric hindrance plays a role in the degeneration mechanism because large-side chain amino acid substitutions at this position are toxic, whereas small-side chain amino acids are not (Driscoll and Chalfie, 1991). Elegant studies on the corresponding position in the ASIC2 (also named
BNaC1 and BNC1) subunit suggest a model in which the transmembrane helices rotate when the channel is activated, exposing the Ala residue
to reagents in the extracellular environment (Adams et al., 1998b).
According to the working model, steric constraints provided by
large-side chain amino acids at position 713 prevent the rotation back
to the inactive conformation, effectively locking the channel open.
A713 is the only residue in the pore region known to induce cell death
when substituted. To test whether steric disruption elsewhere in the
local region might also lock the channel open and to learn more about
structure-function relationships in this area, we systematically
introduced the large positively charged residue Arg and, for
comparison, the small residue Ala, into positions flanking 713. (Arg
substitutions were selected in part because in the genetic screen for
mec mutations Arg substitutions would not have been
generated because of the specificity of the EMS mutagen.) In addition
to our standard test for rescue of mec-4() and
interference with mec-4(+) (Fig.
5B, top,
middle), we assayed engineered substitutions in
vivo for the ability to initiate neurodegeneration on their own
(Fig. 5B, bottom). We conclude that most
substitutions in this region disrupt normal channel function,
underscoring that resides in this region play a critical role in
channel biology. It is noteworthy, however, that substitution D714A,
affecting a highly conserved amino acid, does not disrupt channel
activity. Introduction of the large-side chain amino acid Arg into
positions immediately flanking A713 does not induce degeneration.
View larger version (44K):
[in this window]
[in a new window]
|
Figure 5.
The MEC-4 pore region: primary sequence
constraints within the vicinity of the channel pore. A,
Sequence alignment of amino acids near and within MSDII from
representative DEG/ENaC family members is shown. Gray
boxes highlight strictly conserved residues.
Numbers indicate positions of MEC-4 amino acids;
boundaries of the pre-MSDII loop and the transmembrane -helix are
not known. The skull and crossbones
indicates MEC-4 A713; substitutions of large-side chain amino acids at
this position induce neurodegeneration (Driscoll and Chalfie, 1991).
Substitutions within predicted MSDII were reported in Hong and Driscoll
(1994). B, In vivo assays of mutant
mec-4 transgenes are shown. Top,
Transgenes were introduced into the mec-4() mutant
(deletion allele u253) to indicate rescue in terms of
the percent of touch-sensitive animals. Middle,
Transgenes were introduced into a wild-type mec-4(+)
background to test for the degree of interference (scored as the
percent of touch-insensitive animals). The A713V value in this panel is
from Driscoll and Chalfie (1991). Bottom, The effects of
double substitutions of the AA change indicated situated in
cis to the A713V channel-activating substitution as assayed in
the mec-4() background are shown. The score is the
percent of animals that harbor at least one degenerating tail touch
neuron. Control constructs and specific amino acid substitutions tested
are indicated below the bottom
panel.
|
|
The restriction of apparent steric constraints for closing to a single
position could reflect the action of A713 as a critical but small
flexible swivel joint that allows the conformational change between
active and inactive channel states. Alternatively, residues in the
conserved pore region flanking position 713 could be essential for
channel opening such that substitutions for most residues in this
region fully disrupt channel function and thus eliminate the option of
defective closing. Our in vivo findings are different from a
recent study using MTSEA modification of residues in the region
of ENaC, which reports channel activation by modification of
residues near, and corresponding to, MEC-4 A713 (Snyder et al., 1999).
It is not clear whether such differences indicate a fundamental
distinction between degenerin and ENaC subunits or reflect differences
in the assay in the experimental system, i.e., comparison of engineered
amino acid substitutions in a native environment with chemically
induced modifications of a functional channel expressed in a
heterologous system.
Basic residues in the C-terminal domain are critical for MEC-4
channel function
The intracellular C terminals of mammalian ENaC family members
include Pro-rich sequences that mediate channel localization and
subunit recycling (Shimkets et al., 1994; Hansson et al., 1995a,b; Schild et al., 1995, 1996; Snyder et al., 1995; Firsov et al., 1996; Goulet et al., 1998; Prince and Welsh, 1999). The intracellular C terminals of C. elegans superfamily members
do not have Pro-rich regions or other striking sequence similarities to
their mammalian counterparts. Moreover, C terminals of C. elegans family members are highly divergent. Our sequence analysis
of EMS-induced mec-4 alleles failed to identify any
mutations affecting the MEC-4 C-terminal domain, prompting us to
question whether this domain is dispensable for MEC-4 function. To test
this possibility, we constructed a truncated subunit that lacked MEC-4
amino acids 740-768 and tested for in vivo function.
mec-4(740-768) does not rescue the touch-insensitive
phenotype in the mec-4() background although the truncated
protein is immunologically detectable and interferes with
mec-4(+) function in transgenic animals (Fig. 6B, left,
middle). Thus, the MEC-4 C-terminal domain is not dispensable for
channel function. Because in the mammalian ENaC channel C-terminal deletions in some subunits cause a net increase in
Na+ uptake, we tested the truncated MEC-4
subunit for the capacity to induce the channel-hyperactivated
neurodegeneration phenotype. We find mec-4(740-768)
alone does not induce touch cell death (data not shown). Moreover, the
double substitution mutant protein MEC-4(740-768,A713V) does not
induce degeneration, indicating that the MEC-4 C-terminal domain must
be intact to make a hyperactive channel (Fig. 6B,
right).
View larger version (23K):
[in this window]
[in a new window]
|
Figure 6.
The MEC-4 C terminal: a basic region
in the MEC-4 C terminal is essential for channel function.
A, C-terminal-coding sequence of MEC-4 and deletions and
substitutions assayed are shown. Numbers indicate MEC-4
amino acid positions. Black horizontal lines indicate
regions deleted in mutant constructs; in K(753-756)A, Ala residues
replace all Lys residues, and the remainder of the C-terminal
sequence is intact. B, In vivo assays of
mutant mec-4 transgenes are shown. Left,
Transgenes were introduced into the mec-4() mutant
(deletion allele u253) to indicate rescue in terms of
the percent of touch-sensitive animals. Middle,
Transgenes were introduced into a wild-type mec-4(+)
background to test for the degree of interference (scored as the
percent of touch-insensitive animals). Right, The
effects of double substitutions of the AA change indicated situated
in cis to the A713V channel-activating substitution as
assayed in the mec-4() background are reported. The
score is the percent of animals that harbor at least one degenerating
tail touch neuron. Control constructs and specific amino acid
substitutions tested are indicated below each
panel.
|
|
To define C-terminal residues required for channel function better, we
constructed a partial deletion of the MEC-4 C terminal by introducing a
termination codon after K756 (Fig. 6A).
mec-4(756-768) can complement the mec-4()
mutant and, in conjunction with the A713V substitution, can induce
neurodegeneration (Fig. 6B, right). Thus,
amino acids residues after amino acid 756 are dispensable for both
normal and aberrant MEC-4 function. One sequence feature that stands
out in the remaining C-terminal region required for function is a
highly Lys-rich region (K753-K762). To test the importance of this
basic region in function, we substituted Ala for Lys residues (MEC-4
K(753-756)A). This substitution disrupts channel function (Fig.
6B) but does not by itself generate a hyperactive channel that is toxic to touch neurons (data not shown). The basic residues essential for MEC-4 function could mediate an interaction with
other channel subunits or a cytoplasmic component of the mechanotransducing complex, participate in assembly, or influence folding and/or channel stability. If the basic residues do affect subunit stability, this process is likely mechanistically distinct from
that operative for the Pro-rich regions of ENaC channels. In the case
of MEC-4, disruption of this region lessens channel activity, whereas
in mammalian ENaC channels deletion of the Pro-rich SH3-binding domains
causes channels to become more stable. Although our results appear to
underscore differences in channel functions mediated via C-terminal
sequences in MEC-4 and ENaCs, it should be noted that C terminals of
ENaC family members do include clusters of basic residues that, like
those in MEC-4, might mediate essential channel functions.
| |
DISCUSSION |
In vivo genetic approaches in the dissection of
molecular mechanisms of mechanotransducing channel function
The elaboration of structure-function relationships in
mechanotransducing channels presents a unique challenge in channel biology because gating is thought to require tethering of the channels
in their normal physiological context. We have exploited powerful
C. elegans genetic approaches to define critical domains or
amino acids in the C. elegans MEC-4 touch-transducing
channel. A key advantage of the genetic approach to channel structure
and function is that no assumptions need be made a priori regarding the
potential functional significance of any residues. Moreover, only
substitutions that alter channel function in the normal cellular context are identified. Our analysis has both suggested new roles for
specific conserved domains and has highlighted unsuspected residues as
candidate participants in mechanotransduction-specific processes.
Interpreting data from EMS-induced mutagenesis: a survey of
mec-4-inactivating mutations
We deduced the molecular identities of a large number of
EMS-induced MEC-4 mutations to initiate a broad-based
structure-function survey of a candidate mechanotransducing channel. A
few points regarding our data set should be noted. First, the
specificity of the EMS mutagen restricts the number of codons that can
be altered to specify amino acid changes [EMS induces primarily
AT-to-CG transitions (Coulondre and Miller, 1977; Anderson, 1995); see http://touchworms.rutgers.edu/posted. for detailed information on
EMS-susceptible MEC-4 codons], and thus a complete spectrum of
channel-inactivating substitutions cannot be generated using EMS.
Second, even among susceptible codons, a Poisson analysis of existing
mutations indicates that it is unlikely that all substitutions capable
of channel disruption have been identified among the collection of
EMS-induced mec-4 alleles; the screen is not saturated for all possible mec-4-inactivating mutations. Third, although
generally indicative of relative importance, hot-spot regions of
locally concentrated substitutions or "cold-spot" regions lacking
channel-inactivating substitutions do not necessarily always reflect
the regions of greatest or least (respectively) functional importance.
Mutational hot and cold spots might sometimes reflect a bias of the
mutagen for specific sequences or chromatin configurations. Finally, it should be emphasized that the mec-4 mutant collection is
biased toward single residue changes that disrupt channel function. In some instances, single amino acid substitutions may not disrupt activity, but more substantial alterations would reveal functional requirements, for example, as might be the case for MSDI or the MEC-4
C-terminal domain. Moreover, some MEC-4 substitutions might not disrupt
function because MEC-4 is assembled in vivo in the context
of other subunits in the channel complex. For example, we can envisage
a scenario in which both MEC-4 and MEC-10 provide a functionally vital
interaction with the extracellular protein MEC-9. If a substitution
renders MEC-4 no longer able to bind MEC-9, the remaining MEC-10
interaction with MEC-9 may still be sufficient for channel function,
and thus the MEC-4 substitution will have no behavioral consequence. In
summary, the absence of a channel-inactivating substitution at a given
site cannot be interpreted to mean that that amino acid does not play
an important role in channel function.
Genetic modeling of channel structure and activity: extending
models for mechanotransduction and DEG/ENaC function
Our analysis of mutagen-induced and site-directed mec-4
mutations provides novel insight into touch channel function and holds several implications for members of the DEG/ENaC channel class. Our key
findings include (1) identification of residues in the conserved
intracellular N-terminal region required for channel activation and
demonstration of sequence-dependent inhibitory effects for N-terminal
fragment expression, (2) demonstration that MSDI must be present for
early steps of channel assembly to occur, (3) highlighting of
extracellular residues that might function specifically in
mechanotransduction and demonstration of the functional significance of
residues in the neurotoxin-related domain, (4) identification of
substitutions that uncouple normal channel activity in mechanosensation
and abnormal activity in neurodegeneration, (5) demonstration that
features in the microenvironment of amino acid residue 713, which cause
channel hyperactivation, do not extend to flanking residues, and (6)
definition of a basic region in the short MEC-4 C terminal needed for
channel activity. Because many substitutions affect conserved sites,
our findings are generally relevant to deciphering DEG/ENaC function
and set the stage for biochemical and electrophysiological analysis of analogous substitutions in mammalian counterparts.
The finding that in vivo expression of the MEC-4 N-terminal
cytoplasmic domain can interfere with endogenous channel function is
consistent with a model in which this region interacts with other
components of the channel complex. The observations that N-terminal
fragments of both nematode and human DEG/ENaCs negatively influence
channel function suggest that N-terminal fragment transinhibition is a
common property of the channel class and thus suggest a possible strategy for dominant-negative interference with channel activity. Tissue- or temporal-specific expression of N-terminal domains could be
used for comparison of the knock-down of channel activity in flies or
mice, enabling tests of working hypotheses of ENaC function in
restricted tissues [for example, as the proposed role of ENaC channels
in baroreceptor mechanotransduction (Drummond et al., 1998) or the role
of ASIC channels in pain sensation], or small peptides including the
N-terminal domain might be used for therapeutic in vivo
modulation of blood pressure.
Although many eukaryotic channel types have been identified, few have
been exhaustively dissected by genetic approaches. With the exciting
accomplishment of the complete C. elegans genome sequence
and the relative ease of generation of deletion mutations in defined
genes, it becomes feasible to apply broad-scale genetic-based approaches, similar to that described here, to channel structure and
function in the nematode. Such in vivo studies are highly likely to reveal new insights into the mechanisms of channel function in their native contexts.
| |
FOOTNOTES | |
TOP
ABSTRACT
INTRODUCTION
