 |
Previous Article | Next Article 
The Journal of Neuroscience, April 15, 2000, 20(8):2988-2993
Molecular Separation of Two Behavioral Phenotypes by a Mutation
Affecting the Promoters of a Ca-Activated K Channel
Nigel S.
Atkinson,
Robert
Brenner,
Whei-meih
Chang,
Jennette
Wilbur,
James L.
Larimer, and
Joyce
Yu
Section of Neurobiology, School of Biological Sciences and the
Institute for Cellular and Molecular Biology, The University of Texas
at Austin, Austin, Texas 78712-1064
 |
ABSTRACT |
The Drosophila slowpoke gene encodes a BK-type
calcium-activated potassium channel. Null mutations in
slowpoke perturb the signaling properties of neurons and
muscles and cause behavioral defects. The animals fly very poorly
compared with wild-type strains and, after exposure to a bright but
cool light or a heat pulse, exhibit a "sticky-feet" phenotype.
Expression of slowpoke arises from five transcriptional
promoters that express the gene in neural, muscle, and epithelial
tissues. A chromosomal deletion
(ash218) has been identified that
removes the neuronal promoters but not the muscle-tracheal cell
promoter. This deletion complements the flight defect of
slowpoke null mutants but not the sticky-feet phenotype.
Electrophysiological assays confirm that the
ash218 chromosome restores normal
electrical properties to the flight muscle. This suggests that the
flight defect arises from a lack of slowpoke expression
in muscle, whereas the sticky-feet phenotype arises from a lack of
expression in nervous tissue.
Key words:
Drosophila; calcium-activated potassium
channel; potassium channel; behavior; flight; tissue-specific
transcription; regulation of transcription
 |
INTRODUCTION |
Ion channel proteins generate the
electrical impulses used by neurons and muscles to convey information
and trigger movement. The range of electrical properties that a cell
can manifest arises from the combined activity of the suite of channels
expressed. Ion channels also participate in processes distinct from the
transmission of electrical signals. In many epithelial cells, the same
family of channels participate in transport of ions, water, and
nutrients between the lumen of organs and their interior (Pacha et al., 1991 ; Stoner and Morley, 1995 ). The combination of channels expressed is expected to be substantially different in these functionally disparate cells.
The choice of which channels a cell is to express does not appear to be
a simple decision. The superfamily of ion channels are represented by a
large number of distinct genes, some of which can encode multiple
products via alternative promoter use and alternative splicing (Brenner
and Atkinson, 1996 ; Wei et al., 1996 ). In general, the number of
biophysically distinct channels expressed by a cell is small compared
with its potential.
The Drosophila slowpoke gene encodes a Ca-activated K channel
expressed in neurons, muscles, midgut, and trachea (Becker et al.,
1995 ). Elimination of the channel by mutation dramatically alters the
electrical properties of both neurons and muscles (Elkins and Ganetzky,
1988 ; Saito and Wu, 1991 ; Warbington et al., 1996 ). In tracheal and
midgut cells, the function of the channel has not been directly
demonstrated, but it is believed to participate in the process of
electrolyte transport and acid secretion, respectively (Becker et al.,
1995 ; Brenner and Atkinson, 1997 ). It is unlikely that a single channel
polypeptide satisfies the functional needs of such disparate tissue
types. The slowpoke gene, however, is well suited for this
role. Expression of slowpoke arises from an array of
tissue-specific transcriptional promoters, some of which give rise to
mRNAs that encode polypeptides differing in their N terminus. To
date, five tissue-specific promoters have been mapped (Bohm et al.,
2000 ). In addition, slowpoke transcripts are alternatively
spliced at five sites that affect the coding region of the gene
(Atkinson et al., 1991 ; Adelman et al., 1992 ). It is assumed that
multiple promoters and alternative splicing enable tissues to express
channels tailored to the needs of the cell.
In addition to their electrophysiological phenotypes,
slowpoke mutants display behavioral abnormalities. The
animals are semiflightless and, in response to a brief heat pulse,
remain stationary for many minutes (Elkins et al., 1986 ). This unusual
temperature-dependent phenotype is difficult to understand in terms of
thermolabile proteins. Here, we demonstrate that the animals are not
paralyzed but inappropriately adhere to the surface and that this
behavior is not wrought by temperature per se but appears to be a
consequence of overstimulation. Using a chromosomal deletion that
removes the neuronal but not the muscle promoter, we demonstrate the
origins of the "sticky-feet" and the flight phenotypes.
 |
MATERIALS AND METHODS |
Stocks. Drosophila stocks were maintained using
standard Drosophila husbandry techniques. Four stocks were
used: w1118; st
hhbar3 slo1,
slo4, y w; red e
ash218/y+ TM3 Sb e
Ser, and red, e,
ash218/TM6 Tb. The
ash218 allele stock was kindly
provided by Allen Shearn (Department of Biology, The Johns Hopkins
University, Baltimore, MD).
Reverse transcription-PCR. For reverse-transcription
(RT)-PCR, RNA was purified from
w1118 flies, from
slo4 flies, and from red e
ash218/slo4
transheterozygotes. Approximately 0.5 gm of adult animals were added to
2.5 ml (5 vol) of 3 M LiCl, 6 M urea, and 0.2% SDS and ground in a glass
homogenizer. To precipitate the RNA, the sample was incubated overnight
on ice and centrifuged at 5000 rpm [Sorvall (Newtown, CT) RC5C
with a SA-600 rotor] for 20 min at 4°C in a 15 ml Corex centrifuge
tube. The liquid between the bottom pellet and the floating pellet was
removed with a pipette and discarded. The pellet was dissolved in 2-4
vol of 10 mM Tris-base, 1 mM Na2EDTA, and 1% SDS on
ice for 15 min. The solution was extracted twice with
phenol:CCl3 (24:1), pH 8.0 with 0.1%
hydroxyquinoline, and once with CCl3. The RNA was
precipitated by adjusting the aqueous layer to 0.3 M sodium acetate (stock is pH 5.2),
followed by the addition of 3 vol of 100% ethanol and incubation at
70°C. The RNA was stored in ethanol until needed. To recover the
RNA, the solution was centrifuged at 8500 rpm/30 min/4°C. The pellet
was air-dried and resuspended in 300-600 µl of water. All solutions were made using DEPC-treated water.
One microgram of RNA was reverse-transcribed in a 25 µl volume
with Moloney Murine Leukemia Virus Reverse transcriptase (New England
Biolabs, Beverly, MA) and 0.5 pM of the primer slo26 (5' TGCGATCCAGTATGCAGTCT 3') for 45 min at 40°C. The solution was adjusted to 100 µl with water and heated at 65°C for 5 min. Five microliters of the RT product was used to seed the PCR reaction.
A hot-start PCR amplification was performed in a PCR machine (MJ
Research Inc., Watertown, MA) with the enzyme mix provided in a 100 µl volume using the enzyme mix provided in the Expand High Fidelity
PCR System (Boehringer Mannheim, Indianapolis, IN) and 1.5 mM MgCl2, 0.125 mM dNTPs, and 2 µM of each PCR primer. Annealing temperatures were
determined using the OLIGO program (National Biosciences, Plymouth, MA).
To detect transcripts produced by slowpoke promoter
C0, PCR was performed using the GAMMA5 primer (5'
ATTGTATACGCTGCTGACGAGA3', anneals to exon C0) and slo45 primer (5'
CCGCCATTTTGATTCTGTGTG3', anneals at approximately nucleotide 2520). The
slo42 primer (5' CTCGGTGGTTTAGCCAGTACTA 3'), which anneals to exon C1,
and the slo45 PCR primer were used detect the presence of transcripts produced from both promoter C0 or promoter C1. Neither of these primers
amplify a product derived from transcripts produced from promoter C2.
Promoter C2 products were detected by using the PCR primer slo43b
(5'TGGCACTCGACTGCACTTGA3') and primer slo45. The slo43b primer
specifically anneals to exon C2, and therefore this primer set can be
used to detect transcripts produced by this promoter C2.
Action potential recording. The recording of action
potentials from the dorsal longitudinal flight muscles (DLM) was
performed essentially as described by Elkins et al. (1988) . Lightly
etherized adults were glued to a coverslip along their ventral midline
using Superglue. Flies were allowed to recover for a minimum of 1 hr before recording. The mounted fly was placed under a microscope, and
two uninsulated tungsten electrodes were inserted into the brain.
Current flow [generated with a Grass Instruments (Quincy, MA) S88
stimulator] through these electrodes causes activation of the giant
fiber pathway and the production of action potentials in the DLM. A
glass electrode was inserted into the flight muscle (2-5 M , filled
with 1 M NaCL) and used to record the evoked
action potential spikes using a World Precision Instruments (Sarasota, FL) Electrometer Intra 767. All recordings were made in DLM indirect flight muscles c through f (Engel and Wu, 1992 ). All potentials were
measured with reference to an uninsulated tungsten electrode inserted
into the abdomen. The stimulus threshold was determined by stimulating
the brain at 2 V (0.1 msec) and gradually increasing the potential
until DLM spikes were observed. After a threshold voltage was
determined, 0.2 V above threshold was used for the remainder of the
experiment. Data were collected using a MacADIOS 8ain
analog-to-digital converter (69.4 µsec/point), filtered at 14 kHz
with a single-pole low-pass filter, and recorded using the Macintosh
program Superscope (GW Instruments, Somerville, MA).
Sticky-feet behavioral assay. The sticky-feet behavior is
elicited by overstimulating the flies using a heat pulse or a bright light delivered by a fiber optic lamp. For heat treatment, 2- to
5-d-old adult flies are trapped at the bottom of an empty glass fly
vial using a foam or cotton plug and incubated at 37.7-40°C for 2-8
min. The time and temperature required to elicit the behavior seems to
vary with the season but not within a season. Exposure for a few
seconds to a very bright but cool light can be substituted for the heat
treatment (50 W fiber optic lamp, set on high). Positive (wild-type
animals) and negative (slo4 mutant
animals) internal controls are always performed. After the heat pulse,
the animals are gently transferred to the tabletop and not disturbed
for ~15 sec. A pencil with a pink-pearl eraser was used to push on
the sides of the animals. Flies homozygous for a slowpoke
mutant allele hang onto the surface and allow themselves to be pushed
over. Flies heterozygous for a slowpoke mutant allele will
walk or fly away from the stimulus. Wild-type flies will take flight
and leave the area.
Flight test. The relative ability of the 3- to 6-d-old
animals to fly was measured as described previously (Benzer, 1973 ; Elkins et al., 1986 ; Green et al., 1986 ) with minor modifications. The
walls of a pipette jar (15 cm diameter, 62 cm tall) were coated with
mineral oil. A funnel was fixed on a platform at the top of the jar,
and flies were dropped through the opening. The falling animals fly
toward the walls of the jar and are trapped in the mineral oil. The
position of each animal on the jar is marked, and then the distance of
each mark from the bottom of the jar is determined. Rulers taped to the
side of the jar simplify this process. Although the mineral oil seeps
to the bottom of the jar, the embedded flies do not move and are stable
for hours. Animals that fly well tend to cluster near the top of the
jar, whereas animals that fly poorly are most often found near the
bottom. Dead flies and flies that do not fly fall into the bottom of
the jar and are not counted. This test can be used to distinguish wild-type animals from animals carrying a mutant slowpoke
allele (Elkins et al., 1986 ). For each genotype, 350-1000 flies were tested. For flight testing, animals were not heat-treated.
 |
RESULTS |
Fine mapping of ash218 deletion
endpoint on the slowpoke promoter map
The slowpoke transcriptional control region has been
well characterized using transgenes that drive the expression of a
reporter gene. It has been shown that promoter C0 and C1 (Fig.
1) generate slowpoke
expression in the nervous system in adult, larval, and embryonic
stages, whereas promoter C2 alone is responsible for expression in
muscle and tracheal cells (Bohm et al., 2000 ).

View larger version (8K):
[in this window]
[in a new window]
|
Figure 1.
Map of the slowpoke transcriptional
control region. The rightward-pointing arrows identify
the position of five slowpoke transcriptional promoters.
The labels immediately below the
line identify the tissue specificity of the each
promoter as determined by deletion mapping. A,
ApaI; B, BamHI;
Bg, BglII; C,
ClaI; E, EcoRI;
H, HindIII; K,
KpnI; M, MunI;
N, NcoI; P,
PstI; S, SmaI;
Sp, SpeI; X,
XbaI; Xh, XhoI;
Y, XmnI; Z,
SphI.
|
|
The slowpoke gene is found on chromosome 3 at cytological
position 96A17 (Atkinson et al., 1991 ). Adjacent to slowpoke
is the ash2 gene in which mutations cause homeotic
transformations of body parts during development. The function of the
ash2 gene and the phenotype of its mutant alleles are
unrelated to that of the slowpoke gene. However, during the
study of ash2 function, Adamson and Shearn (1996)
characterized a chromosomal deletion that removed the entire
ash2 gene. This mutation is called
ash218. Fortuitously, one
endpoint of this encroached upon the slowpoke gene. Their
data indicated that this deletion removed some of the
slowpoke transcriptional promoters.
Our mapping data indicates that the endpoint of the deletion falls
between promoter C1 and promoter C2 (data not shown) and as a
consequence removes promoter C0 and promoter C1 (Fig. 1). Deletion
analysis performed on a slowpoke transgene has shown that
removal of these two promoters causes a loss of slowpoke expression in the adult CNS. Muscle and tracheal cell
expression, however, persists if promoter C2 and the following
downstream intron are present (Brenner and Atkinson, 1996 ; Brenner et
al., 1996 ). Thus, the ash218
deletion has removed sequences absolutely required for adult neuronal
expression but left the promoter driving muscle and tracheal expression intact.
An RT-PCR assay was used to confirm that the
ash218 chromosome does not
express the promoter C0 and C1 neuronal transcripts but does express
transcripts originating from promoter C2. Each of these promoters
produces a transcript that begins with a unique exon. RNA was isolated
from
ash218/slo4
transheterozygotes. The use of the transheterozygote was necessary because the ash218 deletion is
a recessive lethal mutation. The
slo4 mutant allele is a chromosome
inversion with one breakpoint in the slowpoke gene. It has
been shown to be a null mutation by genetic, electrophysiological,
immunohistochemical, and RT-PCR criteria (Atkinson et al., 1991 ; Becker
et al., 1995 ). RT-PCR was performed on wild-type,
ash218/slo4,
and slo4 RNA using primer sets
specific for transcripts containing exon C0, C1, and C2 (Fig.
2). Exon C0- and C1-containing
transcripts were not detected in either the
ash218/slo4
or the slo4 RNA. A primer set
specific for exon C2-containing transcripts amplified a product from
ash218/slo4
RNA but not from slo4 RNA. All of
the primer sets amplified a product from the wild-type RNA.

View larger version (81K):
[in this window]
[in a new window]
|
Figure 2.
The ash218
deletion eliminates expression from neuronal promoters C0 and C1 but
not from the muscle-tracheal cell-specific promoter C2. The products
of each promoter begins with a unique exon and can be identified by
RT-PCR using exon-specific primers. Total RNA from
ash218/slo4
transheterozygous, wild-type, and
slo4 homozygous flies was reverse
transcribed, and the resultant cDNA was subjected to the PCR using the
exon-specific primers. PCR products were separated in a 2% agarose gel
and stained with ethidium bromide. C0,
C1, and C2 identify groups of three
lanes displaying products amplified using primers
specific for exon C0, C1, or C2, respectively. Amplifications performed
on
ash218/slo4,
wild-type, and slo4 RNA are
identified by a, w, and s,
respectively. From left to right, the
arrows identify PCR products diagnostic for the presence
of mRNAs that include exon C0, exon C1, and exon C2, respectively.
Amplification with exon C0 primers produces the 2844 nucleotide band
only from wild-type RNA (lanes 1-3). The exon
C1-specific primers produce the diagnostic 2406 nucleotide PCR product
only from the wild-type RNA (lanes 4-6).
Finally, the exon C2-specific primers amplified the diagnostic 2373 nucleotide product derived from exon C2 from both
ash218/slo4
and wild-type RNA but not from the
slo4 RNA. Other bands are nonspecific
PCR artifacts. Conditions favoring maximal sensitivity often lead to
the concomitant production of spurious bands.
|
|
Action potential recordings
In Drosophila muscle, the rising phase of the
regenerative action potential is generated by the influx of Ca ions
through voltage-gated Ca channels (Salkoff and Wyman, 1983 ). The
repolarization phase of the action potential is driven by the activity
of at least four different outward potassium currents. These are called IA,
ICF,
IK, and
ICS. The Shaker,
slowpoke, and shab genes encode the channels that
conduct IA,
ICF, and
IK, respectively (Baumann et al.,
1987 ; Kamb et al., 1987 ; Papazian et al., 1987 ; Tsunoda and Salkoff,
1995 ; Singh and Singh, 1999 ). The channel that conducts ICS has not yet been identified.
The electrophysiological consequences of a mutant slowpoke
gene have been extensively studied. Mutant slowpoke alleles
eliminate the Ca-activated K current called
ICF in neurons and muscle fibers (Salkoff, 1983 ; Elkins et al., 1986 ; Gho and Mallart, 1986 ; Singh and
Wu, 1989 ; Komatsu et al., 1990 ; Saito and Wu, 1991 ; Broadie and Bate,
1993 ). In the indirect flight muscles of the adult, the loss of this
potassium current has a striking electrophysiological consequence: the
production of extremely broad and Bactrian camel-shaped action
potentials (Elkins and Ganetzky, 1988 ). All of the mutant slowpoke alleles, slo1,
slo2,
slo3,
slo4,
slo5, and
slo8, have been shown to eliminate
ICF in indirect flight muscles and to
cause the same action potential phenotype (Atkinson et al., 1991 ).
To demonstrate that the ash218
chromosome produced functional slowpoke channels in
Drosophila flight muscle, we examined the shape of action
potentials produced by the indirect flight muscles of
ash218/slo4
transheterozygotes. It was not possible to assay
ash218 in the homozygous state
because it is a recessive lethal mutation. The
slo4 mutation is a chromosomal
inversion and has been shown to be a homozygous viable
slowpoke null allele (Atkinson et al., 1991 ; Becker et al.,
1995 ). Figure 3 shows action potentials
produced from wild-type muscle, slo4
homozygous muscle, and
ash218/slo4
muscle stimulated at 20 and 33 Hz. In addition, we also examined action
potentials evoked at 10 and 50 Hz (Fig.
4). In all cases, wild-type and
ash218/slo4
animals produced action potentials of normal shape and duration, whereas homozygous slo4 muscle
produced broad and abnormally shaped action potentials. Therefore, in
indirect flight muscle, the
ash218 chromosome produces
functional slowpoke channels.

View larger version (17K):
[in this window]
[in a new window]
|
Figure 3.
Action potentials produced by dorsal longitudinal
flight muscles of wild-type, slo4
homozygous, and
ash218/slo4
transheterozygous animals at a stimulation frequency of 20 and 33 Hz.
Wild-type muscle produces sharp action potentials at all simulation
frequencies tested. Muscle homozygous for the
slo4 mutation initially produces
sharp action potentials, but later spikes are of abnormal shape and
breadth. The ash218 deletion
completely complements the slo4
action potential phenotype. This indicates that the
ash218 deletion produces functional
slowpoke channels in Drosophila
muscle.
|
|

View larger version (71K):
[in this window]
[in a new window]
|
Figure 4.
Broadening of dorsal longitudinal flight muscle
action potentials stimulated at 10, 20, 33, and 50 Hz. The half-height
width of six consecutive action potentials were measured. Width is
expressed in milliseconds. Black,
stippled, gray, and white
bars represent an average from wild-type animals (n = 3), slo4/+ heterozygote animals
(n = 9),
ash218/slo4
transheterozygous animals (n = 6), and
slo4 homozygous animals
(n = 10), respectively. The thin line
above the bar represents the SEM for each
measurement. Ap1, Ap2,
Ap3, Ap4, Ap5, and
Ap6 represents the width of the first, second, third,
fourth, fifth, and sixth action potentials, respectively.
|
|
Flight assay
A second phenotype caused by a defect in the slowpoke
gene is a reduced ability of the mutant animals to fly (Elkins et al., 1986 ). Upon visual inspection, it is obvious that flies that carry a
null mutation in the gene are very poor fliers. The slowpoke mutant animals walk much of the time and fly for only very short distances. We tested the capacity of the animals for flight using a
modified cylinder drop test assay (Benzer, 1973 ; Elkins et al., 1986 ;
Green et al., 1986 ). In this assay, flies are dropped into the center
of a cylinder whose walls have been coated with mineral oil. As they
fall, the animals fly out from the center of the cylinder, strike the
cylinder walls, and are trapped in the oil. In practice, the animals
remain at the position where they first collide with the wall. Animals
that fly well tend to accumulate near the top of the column, whereas
animals that fly poorly are predominately found near the bottom of the column.
To determine whether the defective flight phenotype of
slowpoke mutants was associated with a muscle defect, we
assayed the flight ability of
ash218/slo4
transheterozygotes. In this assay, these animals accumulated near the
top of the column and at the same position as wild-type flies. As shown
in Figure 5, the
slo4 homozygotes were obviously
impaired in their flying ability and accumulated in the bottom half of
the column.

View larger version (24K):
[in this window]
[in a new window]
|
Figure 5.
Column-based flight assay used to measure the
relative capacity of flies for flight. Flies are dropped from a vial
into the center of an oil-coated cylinder. The falling flies fly from
the center and are trapped in the oil. The distance that they fall is
correlated with their capacity for flight (Benzer, 1973 ; Elkins et al.,
1986 ; Green et al., 1986 ). The column was fractionated, top to bottom,
into bins 5 cm in length. The abscissa represents the distance from the
top of the column that the flies fell. The ordinate is the percentage
of animals assayed. A, The
ash218 chromosome was tested for its
capacity to complement the flight defect associated with the
slo4 mutant allele. Results from an
assay performed using 952 w1118, 828 slo4, and 733 ash218/slo4
transheterozygotes. B, Ability of the
ash218 chromosome to complement the
flight defect associated with the
slo1 mutant allele. Results from an
assay performed using 1002 w1118, 903 w1118; st bar3
slo1,and 369 ash218/st bar3
slo1 flies. The
w1118 stock carries a wild-type copy
of the slowpoke gene and served at the positive control.
Wild-type flies (squares) and the
ash218/slo4
or
ash218/slo1
transheterozygotes (triangles) accumulate near the top
of the column. The slo4 or
slo1 homozygotes
(circles) accumulate deeper in the column. Flies that
did not initiate flight are not counted and are trapped in a pool of
oil at the bottom of the column.
|
|
Sticky-feet phenotype
After a brief heat pulse from 22 to 37°C, flies that are
homozygous for null mutations in the slowpoke gene have been
described as standing motionless for several minutes (Elkins et al.,
1986 ). This behavior is better described as a sticky-feet phenotype. Approximately 15 sec after a 2-8 min, 37-40°C heat pulse, the flies
stand in place and can be pushed with a pencil. During this time, they
behave as if their feet are stuck to the surface on which they stand
(Fig. 6). Continuing to push the fly
causes it to gradually lean over and eventually to fall onto its side
or back. The flies are not paralyzed per se, because once knocked over
they right themselves, after which, their feet frequently stick to the
surface. If the fly is left undisturbed, this behavior can persist for
many minutes. Recovery seems to be speeded by repeated touching of the
fly. All of the known slowpoke null alleles (slo1,
slo2,
slo3,
slo4,
slo5, and
slo8) exhibit this behavior as
homozygotes and in all allelic combinations. Heterozygous and wild-type
animals do not manifest this response.

View larger version (29K):
[in this window]
[in a new window]
|
Figure 6.
An example of the sticky-feet phenotype exhibited
by animals homozygous for null mutations in the slowpoke
gene. This particular homozygous slo4
male has been exposed to a bright light (see Materials and Methods) for
15 sec and is being pushed with a number 2 pencil. Such animals do not
attempt to escape or avoid the pencil and hang onto the surface on
which they stand. The animal is shown leaning over in response to the
pressure. With continued pressure, the animal will topple over and then
in a very uncoordinated manner attempt to right himself. If successful,
such an animal will usually once again exhibit the sticky-feet
phenotype. Recovery from the behavior can take many minutes and seems
to be speeded by repetitive stimulation.
|
|
We have also been able to elicit this behavior using a cool but very
bright light. Stimulation with light evokes the behavior much more
rapidly than exposure to an elevated temperature. Homozygous slo1 flies exposed to the maximal
output from a 60 W fiber optic lamp elicit this behavior in 15 sec.
During this time, no change in temperature of the platform was
observed. Based on this result, we postulate that the sticky-feet
behavior is induced not by temperature but by overstimulation of the animals.
The ash218 deletion removes
promoters C0 and C1 (neural-specific) but leaves promoter C2 intact
(muscle and tracheal cell-specific). This provides us with the
opportunity to determine whether the sticky-feet behavior arises from a
lack of expression in muscle or neural tissue. Flies carrying a single
copy of the ash218 and
slo4 mutant chromosomes were
behaviorally tested. Animals that walked or flew away when pushed on
with a pencil were scored as exhibiting wild-type behavior.
Flies carrying a single copy of the
ash218 and
slo4 mutant chromosomes were
produced by crossing yw;
ash218, red,
e/y + TM3 Sb
Ser virgin females to slo4
males. The genotypes of these animals were (1) yw;
ash218/slo4
male, (2) yw;
slo4/y+,TM3
Sb Ser male, (3) yw/+;
ash218/slo4
female, and (4) yw/+;
slo4/y+TM3
Sb Ser female. Although all of the progeny were behaviorally scored, the data reported here was collected only from females. The
males were excluded because behavioral testing of the males could not
be performed as a blind assay because the
ash218/slo4
transheterozygote and slo4
heterozygote males can be distinguished with the naked eye based on
their body color. However, detection of the physical markers that
distinguish the transheterozygote and heterozygote females require
substantial magnification and therefore permit an unbiased behavioral
assay to be performed.
A total of 516 females were examined. None of the 238 yw/+;
slo4/y+
TM3 Sb Ser animals showed the sticky-feet phenotype and were behaviorally scored as wild type. Of the remaining yw/+;
ash218/slo4
animals, 254 were scored as exhibiting the sticky-feet phenotype, and
24 were scored as exhibiting wild-type behavior. As a control, we
performed the behavioral assay on 258 slo4 animals. Of these, 230 were
scored as having the sticky-feet phenotype and 28 were scored as wild
type. It is common for us to have a 10% mis-scoring rate for the
slo4 homozygous parental stock.
Therefore, we conclude that the
ash218 mutation fails to
complement this slowpoke behavioral phenotype.
 |
DISCUSSION |
Mutations in the slowpoke gene have pleiotropic effects
on animal physiology and behavior. In both muscles and neurons,
slowpoke mutations have been shown to eliminate the BK-type
Ca-activated K current called ICF
(Salkoff, 1983 ; Elkins et al., 1986 ; Gho and Mallart, 1986 ; Singh and
Wu, 1989 ; Komatsu et al., 1990 ; Saito and Wu, 1991 ; Broadie and Bate,
1993 ). In muscles, a slowpoke null allele alters the shape
and duration of the flight muscle action potentials (Elkins et al.,
1986 ; Elkins and Ganetzky, 1988 ). In neurons, the same mutation affects
not only the action potentials shape (Saito and Wu, 1991 ) but also the
release of neurotransmitter from motoneurons (Gho and Ganetzky, 1992 ;
Warbington et al., 1996 ) and the habituation of a neuronal circuit in
the adult CNS (Engel and Wu, 1998 ). This indicates that
slowpoke channels are of central importance for the normal
function of both neurons and muscle fibers.
During repetitive stimulation of the flight muscle, wild-type animals
produce trains of well formed action potentials. Animals homozygous for
a slowpoke null mutation produce extremely broad action
potential spikes. In a train of action potentials, the first spike is
typically of normal breadth. Subsequent spikes, however, are typically
extremely broad and often have two peaks. In slowpoke
mutants, it is believed that a current called
IA, conducted by the
Shaker-encoded voltage-gated K channel, is responsible for
repolarization of the first spike (Elkins and Ganetzky, 1988 ). The
voltage-dependent inactivation of this current reduces its contribution
to the repolarization of subsequent spikes. In wild-type muscle, the
slowpoke-encoded channels ensure the rapid repolarization of
subsequent spikes. However, in muscle lacking a functional slowpoke gene, the subsequent spikes cannot be properly repolarized.
Animals carrying null mutations in the slowpoke gene also
present behavioral phenotypes. Although the animals are very healthy and fecund, they are relatively lethargic and have a limited capacity for flight. They also manifest a temperature- or light-induced sticky-feet phenotype. A priori, one cannot predict whether
these behavioral traits have a neuronal or muscular origin. Previous studies of the slowpoke transcriptional control region
indicates that neuronal and muscle expression arise from different
promoters, which are separated by >3.7 kb of genomic DNA (Brenner and
Atkinson, 1996 ; Brenner et al., 1996 ). An ideal tool for identifying
the origin of the sticky-feet and flight phenotypes would be a mutant lesion that affected either the neuronal or muscle promoters but not
both. The ash218 deletion provides
just such a tool. This deletion removes the neighboring ash2
gene and the neuronal promoters of the slowpoke gene. The
portion that remains intact includes promoter C2 and other sequences
required for muscle expression (Brenner and Atkinson, 1996 ; Brenner et
al., 1996 ). Therefore, the
ash218 deletion should also be
viewed as a slowpoke mutation that eliminates neuronal
slowpoke expression. In addition, because the
ash218 deletion does not
involve the slowpoke coding region, the BK channels
expressed by the chromosome should be fully functional.
As an aside, the ash218
deletion also allows us to determine the orientation of the
slowpoke gene on Drosophila chromosome 3. Genetic
mapping indicates that slowpoke (genetic position 3-86) is
distal to ash2 (genetic map position 3-78.6). That is, the slowpoke locus is farther from the centromere that the
ash2 locus. The
ash218 deletion removes both
ash2 and a portion of the slowpoke transcription control region but not the slowpoke coding region.
Therefore, the 5' end of slowpoke transcription unit must be
closer to ash2 than the 3' end of the transcription unit,
which means that slowpoke is positioned on chromosome 3 such
that transcription proceeds away from the centromere.
As predicted, the ash218
chromosome complements the slo4
mutant muscle phenotype with regard to its electrophysiological
abnormality. Furthermore, the restoration of electrical properties is
correlated with a restoration of normal flight. This strongly suggests
that the flight defect in animals carrying slowpoke null
mutations is caused solely by an absence of BK-type channels in muscle
and the resultant abnormalities in the electrical character of the muscle fiber. Satisfyingly, a phenotype suspected to be neuronal in
origin is not complemented by the
ash218 chromosome; that is, the
ash218/slo4
transheterozygotes exhibit a robust sticky-feet phenotype.
The sticky-feet phenotype is an extremely unusual behavior. It is
triggered by both heat and bright light, suggesting that it is a direct
response to overstimulation of the animal. The persistence of the
behavior for many minutes after the stimulus ends suggests that the
affected cells enter a prolonged state of inappropriate activity. Such
a response might be caused by seizure-like activity within a circuit
involved in evoking a reflex behavior.
 |
FOOTNOTES |
Received Dec. 22, 1999; revised Dec. 22, 1999; accepted Feb. 2, 2000.
This work was supported by National Science Foundation Grant
IBN-9724088 to N.S.A.
Correspondence should be addressed to Nigel S. Atkinson, Section of
Neurobiology, Patterson Building, The University of Texas at Austin,
Austin, TX 78712-1064. E-mail: nigela{at}mail.utexas.edu.
 |
REFERENCES |
-
Adamson AL,
Shearn A
(1996)
Molecular genetic analysis of Drosophila ash2, a member of the trithorax group required for imaginal disc pattern formation.
Genetics
144:621-633[Abstract].
-
Adelman JP,
Shen KZ,
Kavanaugh MP,
Warren RA,
Wu YN,
Lagrutta A,
Bond CT,
North RA
(1992)
Calcium-activated potassium channels expressed from cloned complementary DNAs.
Neuron
9:209-216[Web of Science][Medline].
-
Atkinson NS,
Robertson GA,
Ganetzky B
(1991)
A component of calcium-activated potassium channels encoded by the Drosophila slo locus.
Science
253:551-555[Abstract/Free Full Text].
-
Baumann A,
Krah-Jentgens I,
Müller R,
Müller-Holtkamp F,
Seidel R,
Kecskemethy N,
Casal J,
Ferrus A,
Pongs O
(1987)
Molecular organization of the maternal effect region of the Shaker complex of Drosophila: characterization of an IA channel transcript with homology to vertebrate Na+ channel.
EMBO J
6:3419-3429[Web of Science][Medline].
-
Becker MN,
Brenner R,
Atkinson NS
(1995)
Tissue-specific expression of a Drosophila calcium-activated potassium channel.
J Neurosci
15:6250-6259[Abstract].
-
Benzer S
(1973)
Genetic dissection of behavior.
Sci Am
229:24-37[Web of Science][Medline].
-
Bohm RA,
Brenner R,
Wang B,
Atkinson N
(2000)
Transcriptional control of Ca-activated K channel expression: identification of a second, evolutionarily-conserved, neuronal promoter.
J Exp Biol
203:693-704[Abstract].
-
Brenner R,
Atkinson N
(1996)
Developmental and eye-specific transcriptional control elements in an intronic region of a Ca2+-activated K+ channel gene.
Dev Biol
177:536-543[Web of Science][Medline].
-
Brenner R,
Atkinson NS
(1997)
Calcium-activated potassium channel gene expression in the midgut of Drosophila.
Comp Biochem Physiol B Biochem Mol Biol
118:411-420[Medline].
-
Brenner R,
Thomas TO,
Becker MN,
Atkinson NS
(1996)
Tissue-specific expression of a Ca2+-activated K+ channel is controlled by multiple upstream regulatory elements.
J Neurosci
16:1827-1835[Abstract/Free Full Text].
-
Broadie KS,
Bate M
(1993)
Development of larval muscle properties in the embryonic myotubes of Drosophila melanogaster.
J Neurosci
13:167-180[Abstract].
-
Elkins T,
Ganetzky B
(1988)
The roles of potassium currents in Drosophila flight muscles.
J Neurosci
8:428-434[Abstract].
-
Elkins T,
Ganetzky B,
Wu C-F
(1986)
A Drosophila mutation that eliminates a calcium-dependent potassium current.
Proc Natl Acad Sci USA
83:8415-8419[Abstract/Free Full Text].
-
Engel JE,
Wu C-F
(1992)
Interactions of membrane excitability mutations affecting potassium and sodium currents in the flight and giant fiber escape systems of Drosophila.
J Comp Physiol [A]
171:93-104[Medline].
-
Engel JE,
Wu C-F
(1998)
Genetic dissection of functional contributions of specific potassium channel subunits in habituation of an escape circuit in Drosophila.
J Neurosci
18:2254-2267[Abstract/Free Full Text].
-
Gho M,
Ganetzky B
(1992)
Analysis of repolarization of presynaptic motor terminals in Drosophila larvae using potassium-channel-blocking drugs and mutations.
J Exp Biol
170:93-111[Abstract/Free Full Text].
-
Gho M,
Mallart A
(1986)
Two distinct calcium-activated potassium currents in larval muscle fibres of Drosophila melanogaster.
Pflügers Arch
407:526-533[Web of Science][Medline].
-
Green CC,
Sparrow JC,
Ball E
(1986)
Flight testing columns.
Drosophila Information Service
63:141.
-
Kamb A,
Iverson LE,
Tanouye MA
(1987)
Molecular characterization of Shaker, a Drosophila gene that encodes a potassium channel.
Cell
50:405-413[Web of Science][Medline].
-
Komatsu A,
Singh S,
Rathe P,
Wu C-F
(1990)
Mutational and gene dosage analysis of calcium-activated potassium channels in Drosophila: correlation of micro- and macroscopic currents.
Neuron
4:313-321[Web of Science][Medline].
-
Pacha J,
Frindt G,
Sackin H,
Palmer LG
(1991)
Apical maxi K channels in intercalated cells of CCT.
Am J Physiol
261:F696-F705[Abstract/Free Full Text].
-
Papazian DM,
Schwarz TL,
Tempel BL,
Jan YN,
Jan LY
(1987)
Cloning of genomic and complementary DNA from Shaker a putative potassium channel gene from Drosophila.
Science
238:749-753[Free Full Text].
-
Saito M,
Wu C-F
(1991)
Expression of ion channels and mutational effects in giant Drosophila neurons differentiated from cell division-arrested embryonic neuroblasts.
J Neurosci
11:2135-2150[Abstract].
-
Salkoff L
(1983)
Drosophila mutants reveal two components of fast outward current.
Nature
302:249-251[Medline].
-
Salkoff LB,
Wyman RJ
(1983)
Ion currents in Drosophila flight muscles.
J Physiol (Lond)
337:687-709[Abstract/Free Full Text].
-
Singh A,
Singh S
(1999)
Unmasking of a novel potassium current in Drosophila by a mutation and drugs.
J Neurosci
19:6838-6843[Abstract/Free Full Text].
-
Singh S,
Wu C-F
(1989)
Complete separation of four potassium currents in Drosophila.
Neuron
2:1325-1329[Web of Science][Medline].
-
Stoner LC,
Morley GE
(1995)
Effect of basolateral or apical hyposmolarity on apical maxi K channels of everted rat collecting tubule.
Am J Physiol
268:F569-F580[Abstract/Free Full Text].
-
Tsunoda S,
Salkoff L
(1995)
The major delayed rectifier in both Drosophila neurons and muscle is encoded by Shab.
J Neurosci
15:5209-5221[Abstract].
-
Warbington L,
Hillman T,
Adams C,
Stern M
(1996)
Reduced transmitter release conferred by mutations in the slowpoke-encoded Ca2(+)-activated K+ channel gene of Drosophila.
Invert Neurosci
2:51-60[Web of Science][Medline].
-
Wei A,
Jegla T,
Salkoff L
(1996)
Eight potassium channel families revealed by the C. elegans genome project.
Neuropharmacology
35:805-829[Web of Science][Medline].
Copyright © 2000 Society for Neuroscience 0270-6474/00/2082988-06$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
W. L. Imlach, S. C. Finch, J. Dunlop, A. L. Meredith, R. W. Aldrich, and J. E. Dalziel
The Molecular Mechanism of "Ryegrass Staggers," a Neurological Disorder of K+ Channels
J. Pharmacol. Exp. Ther.,
December 1, 2008;
327(3):
657 - 664.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. d. l. P. Fernandez, J. Chu, A. Villella, N. Atkinson, S. A. Kay, and M. F. Ceriani
Impaired clock output by altered connectivity in the circadian network
PNAS,
March 27, 2007;
104(13):
5650 - 5655.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Zeng, T. M. Weiger, H. Fei, and I. B. Levitan
Mechanisms of Two Modulatory Actions of the Channel-binding Protein Slob on the Drosophila Slowpoke Calcium-dependent Potassium Channel
J. Gen. Physiol.,
November 1, 2006;
128(5):
583 - 591.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Laumonnier, S. Roger, P. Guerin, F. Molinari, R. M'Rad, D. Cahard, A. Belhadj, M. Halayem, A. M. Persico, M. Elia, et al.
Association of a Functional Deficit of the BKCa Channel, a Synaptic Regulator of Neuronal Excitability, With Autism and Mental Retardation
Am J Psychiatry,
September 1, 2006;
163(9):
1622 - 1629.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-T. A. Chiang, M. Steciuk, B. Shtonda, and L. Avery
Evolution of pharyngeal behaviors and neuronal functions in free-living soil nematodes
J. Exp. Biol.,
May 15, 2006;
209(10):
1859 - 1873.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. R. Keyser and J. L. Witten
Calcium-activated potassium channel of the tobacco hornworm, Manduca sexta: molecular characterization and expression analysis
J. Exp. Biol.,
November 1, 2005;
208(21):
4167 - 4179.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Zeng, T. M. Weiger, H. Fei, A. M. Jaramillo, and I. B. Levitan
The Amino Terminus of Slob, Slowpoke Channel Binding Protein, Critically Influences Its Modulation of the Channel
J. Gen. Physiol.,
May 31, 2005;
125(6):
631 - 640.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Sanyal, C. Consoulas, H. Kuromi, A. Basole, L. Mukai, Y. Kidokoro, K. S. Krishnan, and M. Ramaswami
Analysis of Conditional Paralytic Mutants in Drosophila Sarco-Endoplasmic Reticulum Calcium ATPase Reveals Novel Mechanisms for Regulating Membrane Excitability
Genetics,
February 1, 2005;
169(2):
737 - 750.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Ghezzi, Y. M. Al-Hasan, L. E. Larios, R. A. Bohm, and N. S. Atkinson
slo K+ channel gene regulation mediates rapid drug tolerance
PNAS,
December 7, 2004;
101(49):
17276 - 17281.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. F. Ceriani, J. B. Hogenesch, M. Yanovsky, S. Panda, M. Straume, and S. A. Kay
Genome-Wide Expression Analysis in Drosophila Reveals Genes Controlling Circadian Behavior
J. Neurosci.,
November 1, 2002;
22(21):
9305 - 9319.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Muller, J. G. J. Hoenderop, R. Vennekens, P. Eggert, F. Harangi, K. Mehes, V. Garcia-Nieto, F. Claverie-Martin, C. H. v. Os, B. Nilius, et al.
Epithelial Ca2+ channel (ECAC1) in autosomal dominant idiopathic hypercalciuria
Nephrol. Dial. Transplant.,
September 1, 2002;
17(9):
1614 - 1620.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|